www.nature.com/scientificreports

OPEN Phaeocystis globosa Virus DNA X: a “Swiss Army knife”, Multifunctional DNA Received: 4 May 2017 Accepted: 27 June 2017 polymerase-lyase-ligase for Base Published: xx xx xxxx Excision Repair José L. Fernández-García1, Ana de Ory1, Corina P. D. Brussaard2 & Miguel de Vega 1

Phaeocystis globosa virus 16T is a giant virus that belongs to the so-called nucleo-cytoplasmic large DNA virus (NCLDV) group. Its linear dsDNA genome contains an almost full complement of required to participate in viral base excision repair (BER). Among them is a coding for a bimodular protein consisting of an N-terminal Polβ-like core fused to a C-terminal domain (PgVPolX), which shows homology with NAD+-dependent DNA ligases. Analysis of the biochemical features of the purifed revealed that PgVPolX is a multifunctional protein that could act as a “Swiss army knife” enzyme during BER since it is endowed with: 1) a template-directed DNA polymerization activity, preferentially acting on DNA structures containing gaps; 2) 5′-deoxyribose-5-phosphate (dRP) and abasic (AP) site lyase activities; and 3) an NAD+-dependent DNA ligase activity. We show how the three activities act in concert to efciently repair BER intermediates, leading us to suggest that PgVPolX may constitute, together with the viral AP-endonuclease, a BER pathway. This is the frst time that this type of protein fusion has been demonstrated to be functional.

DNA base lesions are the most common type of genomic damage and pose a challenge to genome stability. Lesions can arise afer exposure of DNA to genotoxicants [e.g., radiation, alkylating mutagens, by-products of cellular metabolism such as reactive oxygen species (ROS)], or can arise spontaneously under physiological conditions, such as the hydrolysis of the glycosidic bonds that leaves uninformative apurinic/apyrimidinic (AP) sites, and deaminations that lead to miscoding bases1, 2. Te base excision repair (BER) pathway is a multi-step enzymatic pathway that is primarily responsible for repairing a broad spectrum of non-bulky and non-helix-distorting DNA lesions produced by the oxidation, alkylation, deamination or hydroxylation of DNA bases3. Te general pathway consists of fve steps: 1) recognition and hydrolytic cleavage of altered base-sugar bonds by DNA N-glycosylases4; 2) recognition of the resulting AP sites by an AP-endonuclease, which cleaves at the 5′-side of the AP site to ren- der a 1-nt gap fanked by 3′-OH and 5′-dRP termini; 3) removal of the 5′-dRP moiety by a 5′-dRP lyase, leaving a ligatable 5′-P end; 4) short gap flling by a specifc DNA polymerase to restore the original (nondamaged) nucle- otide; and 5) fnal nick sealing by a DNA ligase (reviewed in ref. 3). Family X DNA (PolXs), including mammalian Pol β5 and Pol λ6, 7, bacterial PolXs8–10 as well as the African Swine Fever Virus (ASFV) PolX11, 12, are involved in the flling-in step of BER. Tese polymerases are relatively small, monomeric proteins that catalyze the insertion of a few nucleotides and lack an intrinsic proofreading activity13. Teir optimized architecture allows them to efciently accomplish the flling-in of short gaps that arise in BER. In general, PolX members present a common Polβ-like core14 with an N-terminal 8-kDa domain that specifcally recognizes the 5′-phosphate group of the gap, which allows the correct positioning of the enzyme on the gapped or nicked structure15–17. Te 8-kDa domain of several eukaryotic PolXs including Pol β and Pol λ18, 19 and yeast Pol420 and Trf421, is also endowed with a 5′-dRP lyase activity that removes the 5′-dRP

1Centro de Biología Molecular Severo Ochoa (CSIC-UAM), C/Nicolás Cabrera 1, Campus Cantoblanco, 28049, Madrid, Spain. 2Department of Marine Microbiology and Biogeochemistry, NIOZ Royal Netherlands Institute for Sea Research, Utrecht University, NL-1790 AB, Den Burg (Texel), The Netherlands. Correspondence and requests for materials should be addressed to M.d.V. (email: [email protected])

Scientific REPOrtS | 7: 6907 | DOI:10.1038/s41598-017-07378-3 1 www.nature.com/scientificreports/

group during short-patch BER6, 22. Te C-terminal polymerization domain of the Polβ-like core possesses the three universally conserved subdomains, fngers, palm and thumb, which are responsible for the binding and further elongation of the 3′ terminus of the upstream primer strand14. Te only known exception to this structural generality is the ASFV PolX, which lacks the 8-kDa domain and the fngers subdomain11. In several PolXs, the domain responsible for the polymerization reaction is fused to catalytic and/or protein-protein interaction domains. Tus, the Polβ-like core of the eukaryotic DNA polymerases λ, μ, termi- nal deoxynucleotidyl (TdT) and yeast Pol IV, is fused to an N-terminal BRAC1 carboxy terminus (BRCT) domain that interacts with nonhomologous end joining-DNA bound factors to recruit these polymerases to double-strand breaks23–28. In Bacterial and Archaeal PolXs, the C-terminus of the Polβ-like core is fused to a polymerase and histidinol phosphatase (PHP) domain29, which contains 3′-5′ exonuclease, 3′-phosphatase and 3′-phosphodiesterase activities, and endows the polymerase with the capacity to process damaged 3′ termini10, 30–32. It also has an AP-endonuclease activity, which enables the enzyme to process an AP site and restore the original nucleotide9, 10. Aside from bacteria, archaea and , some viruses contain PolXs. Te nucleo-cytoplasmic large DNA virus (NCLDV) group constitutes a monophyletic group of viruses that infect a wide range of eukaryotes, such as unicellular marine protists, insects, fsh and mammals. Tey possess dsDNA genomes ranging from 100 kb to 2.5 Mb that, unlike smaller viruses, usually have many genes that encode for putative DNA repair proteins33, 34. Te genome of the viral strain 16T that infects Phaeocystis globosa (strain PgV-16T), a high-biomass-forming phytoplankton species with a central role in oceanic carbon and sulfur cycles35, has been recently sequenced36. PgV-16T is a giant virus from the Megaviridae family36 that belongs to the NCLDV group and has a linear dsDNA genome 459,984 bp in length. Its genome contains an almost full complement of genes (Xth/APE1-like AP-endonuclease, a hypothetical PolX and a NAD+-dependent DNA ligase) required to execute a potential viral BER pathway33, 34, 36. NAD+-dependent ligases are present in a minority of NCLDVs and most likely were acquired from a bacteriophage at the early stages of evolution of eukaryotes33, 37, whereas PolX could be acquired from diferent cellular organisms including eukaryotes33, 38. Interestingly, whereas PolX and ligase are encoded by two independent genes in the Marseilleviridae, Mimiviridae and Poxviridae families, which also belong to the NCLDV group, PgV-16T and its close relative CeV, a virus infecting the unicellular marine phytoplankton Haptolina (formerly Chrysochromulina) ericina, represent the frst examples where the DNA ligase gene is fused to the C-terminus of the PolX coding region36, 39. To expand the current knowledge on the role of PolXs in BER, we have characterized the putative PolX from PgV-16T (PgVPolX). Our results indicate that, in addition to the general polymerization properties shared by most PolXs, PgVPolX has an intrinsic 5′-dRP lyase and NAD+-dependent DNA ligase activity. Te coordina- tion of these activities enables the enzyme to perform the last three steps of BER: removal of the 5′-dRP moiety, flling-in of the resulting gap, and fnal sealing of the nick to restore the original genomic information. To the best of our knowledge, this is the frst characterization of this type of fused protein. Results P. globosa virus 401 gene codes for a family X DNA polymerase. Te complete genome sequence of the P. globosa virus revealed an ORF corresponding to gene 401, which would encode for a 1093 amino acid protein whose N-terminal 379 amino acids have homology with family X DNA polymerases (30% identity with human Pol β) (Fig. 1a); and whose C-terminal domain (475–1050) has homology with the NAD+-dependent DNA ligases36 (Fig. 1b). To determine whether this type of fused viral gene is functional, we cloned the entire ORF into the pET16(a)+ expression vector which carries an N-terminal (His)10-tag. Te recombinant protein was expressed in Escherichia coli BL21(DE3) cells and purifed as described in Materials and Methods. To examine the presence of a polymerization activity in PgVPolX, the purifed protein was incubated with a 5′-Cy5-labeled primer/template DNA (depicted in Fig. 2, top), 100 µM dNTPs and Mg2+ as a metal activator. As shown in Fig. 2a (lef panel), PgVPolX catalyzed the 5′-3′ extension of the primer molecule, demonstrating a distributive polymerization activity as it yielded polymerization products whose length was strongly dependent on the enzyme:DNA ratio. Tis result suggests that PgVPolX is well suited to accomplish short-stretch DNA synthesis in vivo. To determine whether the polymerization activity was inherent to PgVPolX, the purifed pro- tein was sedimented through a glycerol gradient, and the collected fractions were individually assayed for DNA polymerase activity on the same substrate. A single activity peak cosedimented with the mass peak of the purifed PgVPolX (Fig. 2b). Additionally, substitution of the two predicted metal ligands Asp245 and Asp247 with alanine (Fig. 1a) rendered a virtually inactive protein (Fig. 2a, right panel), and the residual polymerization activity was intrinsic to the mutant enzyme (Supplementary Fig. S1A). Overall, the results allow us to unambiguously assign a DNA polymerization activity to PgVPolX and rule out the presence of a contaminant DNA polymerase from E. coli. As expected for a PolX family DNA polymerase, the presence of a downstream oligonucleotide in 5-nt gapped structures promoted the rapid appearance of a band corresponding to the fully repaired gap (Fig. 3, middle and right panels). Te slightly faster repair of the Gap-5′/P substrate (Fig. 3, right panel) suggested that recognition of the 5′-P increases the processivity of PgVPolX. In this sense, the fact that most of the T/P substrate was elongated at the highest PolX concentration used (Fig. 3, lef panel) in comparison with the gapped molecules (Fig. 3, middle and lef panels) would indicate more frequent dissociation/reassociation events, possibly as a consequence of a less tight binding to the T/P structure. Similar to Pol β, PgVPolX displayed a partial strand displacement capacity and efciently inserted several additional nucleotides afer flling-in the gap. Having shown that PgVPolX is a DNA-dependent DNA polymerase, we next analyzed its ability to select among the four deoxynucleotides (base discrimination) to catalyze faithful DNA synthesis. Tus, the incorpo- ration of each of the four dNTPs was assayed individually on the four 1-nt gapped DNA structures depicted in Fig. 4a, covering the 16 possible template-substrate nucleotide pairs. As shown in Fig. 4a, PgVPolX initiated

Scientific REPOrtS | 7: 6907 | DOI:10.1038/s41598-017-07378-3 2 www.nature.com/scientificreports/

Figure 1. (a) Multiple sequence alignment of the Pol β-like core of PgVPolX with human family X DNA polymerases. Numbers indicate the amino acid position relative to the N-terminus of each DNA polymerase. Names of organisms are abbreviated as follows (numbers in parentheses indicate the corresponding accession number): PgV-16T PolX, DNA polymerase X from strain 16 T of P. globosa virus (NC_021312.1); Polβ, human DNA polymerase β (NP_002681); Pol λ, human DNA polymerase λ (NP_037406); Polμ, human DNA polymerase μ (NP_001271260.1); TdT, terminal deoxynucleotidyl transferase (NP_001017520.1). White letters boxed in black indicate the three conserved Asp responsible for the polymerization reaction. Black bold letters boxed in gray indicate the nucleophile residue responsible for the 5′-dRP lyase activity in Pol β and Pol λ. Black bold letters boxed in white indicate the other two lysine residues described to play a role in 5′-dRP lyase catalysis in Pol β. Asterisks indicate invariant residues among PolX members11. According to Pol β structural data17, 60, the alignment is divided into the 8-kDa subdomain (white area), and the polymerization domain (grey area). (b) Alignment of the C-terminal NAD+-dependent DNA ligase domain of PgVPolX with the Ligase A from E. coli and Mimivirus DNA Ligase (MimLig). Te conserved Motifs I-VI present in NAD+-dependent DNA ligases are indicated61. An asterisk indicates the lysine residue that is specifcally adenylated during the ligation reaction. Te accession numbers of E. coli LigA and MimLig are WP_001413640.1 and Q5UPZ0.1, respectively.

DNA synthesis following the Watson-Crick base pairing rules as it extended the primer strand exclusively in the presence of the complementary (correct) nucleotide despite a 10-fold higher concentration of each of the three non-complementary (incorrect) deoxynucleotides. To evaluate 3′- and 2′-OH discrimination by PgVPolX, we used a defned 1-nt gapped DNA molecule to compare dGMP, ddGMP and GMP incorporation. As shown in Fig. 4b, the enzyme inserted dGMP and ddGMP nucleotides with a similar efciency, suggesting that PgVPolX does not show a strong selection for the 3′-OH group of the nucleotide. Similar to that observed for Pol β and Pol λ, PgVPolX was severely impaired in its ability to incorporate ribonucleotides, most likely due to the presence of the aromatic residue Tyr315 (see Fig. 1a), which is a homolog of residues Tyr271 and Tyr505 of Pol β and Pol λ, respectively, and has been described to discriminate against the ribose 2′-OH group40, 41.

Scientific REPOrtS | 7: 6907 | DOI:10.1038/s41598-017-07378-3 3 www.nature.com/scientificreports/

Figure 2. (a) Polymerization activity of PgVPolX on a template/primer substrate. Te assay was performed as described in Materials and Methods, with 25 nM of the primer/template substrate (schematized on top of the fgure) and 100 µM dNTPs. Afer incubation for 5 min at 30 °C, the reactions were stopped by adding EDTA up to 10 mM. Samples were analyzed by 7 M urea-20% PAGE and visualized using a Typhoon 9410 scanner. Te position of the primer is indicated. (b) Sedimentation analysis of the polymerization activity of PgVPolX. Te upper panel shows the SDS-PAGE analysis followed by Coomasie Blue staining of the even gradient fractions 2–34. Te bottom panel shows the polymerization activity of the individual fractions using the primer/template substrate depicted on top of the fgure, in the presence of 100 µM dNTPs. Samples were processed as in (a).

Figure 3. DNA substrate preference for PgVPolX. Te following diferent molecules used in the analysis: T/P, template-primer; Gap-5′/OH, 5 nucleotides gap; and Gap-5′/P, 5 nucleotides gap bearing a 5′-phosphate group are schematized on top of the fgure. Te assay was carried out as described in Materials and Methods with 25 nM DNA substrate and 100 µM dNTPs. Asterisks indicate the 5′ Cy5-labeled end of the primer strand.

PgVPolX has an inherent NAD+-dependent DNA ligase activity. As mentioned above, the PgVPolX C-terminal residues 475–1050 show homology with NAD+-dependent DNA ligases. We therefore assayed the ability of the recombinant PgVPolX to seal a duplex DNA substrate harboring a single nick. As shown in Fig. 5, the enzyme successfully converted the 5′32P-labeled 15mer substrate to a 28mer product, confrming the pres- ence of a DNA ligase activity. In addition, the inclusion of 50 µM NAD+ in the reaction mixture stimulated nick ligation about 7-fold, in agreement with an NAD+-dependent DNA ligase activity. Te activity observed in the absence of NAD+ is attributed to preadenylated PgVPolX in the enzyme preparation, as described for other DNA ligases42–44. As shown in Fig. 1b, the amino acid sequence of PgVPolX contains the KxDG motif I, a signature feature of the ligase superfamily wherein the lysine residue forms a covalent intermediate with AMP, which is

Scientific REPOrtS | 7: 6907 | DOI:10.1038/s41598-017-07378-3 4 www.nature.com/scientificreports/

Figure 4. (a) PgVPolX is a template-directed DNA polymerase. Te four diferent template-primer structures used, difering in the templating base of the 1-nt gaps, are shown on the lef. Te assay was performed as described in Materials and Methods with 25 nM of the indicated substrate, 3 nM of PgVPolX and either 20 µM of the correct dNTP or 200 µM of each of the three incorrect dNTPs. (b) Insertion of diferent types of nucleotides by PgVPolX. Te assay was performed as described in Materials and Methods in the presence of 25 nM of the substrate depicted on the top of the panel, 3 nM of PgVPolX and the indicated concentrations of nucleotides. Asterisks indicate the 5′ Cy5-labeled end of the primer strand.

Figure 5. Ligation of nicked DNA by PgVPolX. Te assay was performed as described in Materials and Methods with 1 nM of the 32P-5′-labeled substrate depicted on top of the fgure and the indicated concentrations of either the wild-type or mutant PgVPolX and of NAD+.

further transferred to the 5′-P of the nick before the fnal sealing step45. Tus, to further confrm that the ligase activity observed with PgVPolX was inherent to the purifed enzyme, the corresponding Lys547 residue was changed to an alanine (mutant K547A). As expected, the mutation abolished the ligation activity of the protein

Scientific REPOrtS | 7: 6907 | DOI:10.1038/s41598-017-07378-3 5 www.nature.com/scientificreports/

Figure 6. 5′-dRP lyase activity of PgVPolX. (a) Time course analysis of the 5′-dRP release by PgVPolX. Te assay was performed as described in Materials and Methods with 1 nM of the depicted substrate (top), and 3 nM of the ligase defcient-mutant K547A. Afer incubation for the indicated times, samples were analyzed by 7 M urea-20% PAGE and further autoradiography. Position of products is indicated. Alk. Alkalyne hydrolysis of the 5′-dRP moiety. (b) Quantifcation of the 5′-dRP released by PgVPolX. Te assay was performed as in (a) with 1 nM of the depicted substrate (top), 3 nM of the ligase-defcient mutant K547A in the absence or presence of 1.25 mM MgCl2. Te values plotted represent the ratio 19mer/(19mer +19mer +dRP) ×100 at each reaction time and are the mean of three independent experiments. (c) Formation of PgVPolX-DNA adducts. Reactions were performed as described in Materials and Methods, incubating 12 nM of the indicated protein, 6 nM of the 32 depicted [ P]3′-labeled DNA substrate (top) and 100 mM NaBH4. Samples were analyzed by 10% SDS-PAGE and further autoradiography. (d) 5′-dRP lyase activity of PgVPolX relies on residue Lys101. Te assay was performed as described in Materials and Methods by incubating 4 nM of the depicted substrate (top of panel c) and 3 nM of the indicated protein. Afer incubation for 2.5 min, samples were analyzed by 7 M urea-20% PAGE and further autoradiography. Alk. Alkalyne hydrolysis of the 5′-dRP moiety.

without afecting its polymerization activity (Supplementary Fig. S1B). Tis result is consistent with Lys547 as the adenylation site of the protein and eliminates the possibility that a contaminant from the bacterial expression system is responsible for the ligase activity of the wild-type enzyme.

5′-dRP Lyase activity associated with PgVPolX. In addition to single-stranded DNA binding and 5′-phosphate recognition, the 8-kDa domain of Pol β exhibits a 5′-dRP lyase activity responsible for the release of the 5′-dRP moiety during short patch BER46. As shown in Fig. 1a, there is signifcant amino acid similarity between residues 1–116 of PgVPolX and those forming the 8-kDa domain in Pol β (30% identity). More specif- ically, the residues that play a role in 5′-dRP lyase catalysis in Pol β (Lys35, Lys60, and Lys7247, 48) are conserved in PgVPolX (Lys64, Lys89 and Lys101). Te Pol β residue Lys72 was identifed as the nucleophile responsible for the release of the 5′-dRP group49. A homologous lysine residue is present in those PolXs with a 5′-dRP lyase, as in Pol λ (Lys31018), but it is absent in those PolXs that lack such an activity, such as Pol μ and TdT (see Fig. 1a). Tus, to evaluate the 5′-dRP release profciency of PgVPolX, a DNA hybrid mimicking a gap-flled BER interme- diate with the upstream 3′-OH end adjacent to the downstream dangling 5′-dRP group was used as a substrate (see Materials and Methods and scheme in top of Fig. 6a), and was incubated with the PgVPolX ligase-defcient mutant K547A to prevent potential further ligations. As shown in Fig. 6a, the PgVPolX K547A mutant removed the 5′-dRP moiety, as detected by the size reduction of the labeled substrate. Under these conditions, the absence of divalent cations did not impede the release of the 5′-dRP group by the protein, pointing to a metal-independent 5′-dRP lyase activity. Although unnecessary, the addition of Mg2+ to the reaction improved slightly the release of the 5′-dRP group by PgVPolX (Fig. 6b). We hypothesize that the presence of this metal ion likely assists the stable/proper binding of the protein to the DNA substrate, as described for the 5′-dRP lyase activity of Pol β19, 48. Te release of 5′-dRP by DNA polymerases β, λ, γ, ι and θ proceeds through β-elimination, which involves the formation of a Schif-base intermediate and has allowed categorizing the activity as a 5′-dRP lyase18, 19, 49–51. To

Scientific REPOrtS | 7: 6907 | DOI:10.1038/s41598-017-07378-3 6 www.nature.com/scientificreports/

Figure 7. AP-lyase activity of PgVPolX. Te depicted [32P]3′-labeled uracil-containing oligonucleotide (top) was treated with E. coli UDG, leaving an intact AP site. Te resulting AP-containing DNA (1 nM) was incubated in the presence of either E. coli EndoIII that incises 3′ to the AP site, or the indicated PgV-PolX for 10 min at 30 °C, as described in Materials and Methods. Position of products is indicated.

determine whether this was also the case for PgVPolX, we exploited the ability of NaBH4 to reduce a Schif-base intermediate to form a covalent protein-DNA complex. Accordingly, if the catalytic mechanism of PgVPolX involved a Schif-base intermediate, addition of NaBH4 to a 5′-dRP-containing substrate would permit trapping of a DNA-protein complex that could be detected by autoradiography afer separation by SDS-PAGE. As shown in Fig. 6c, PgVPolX formed a stable adduct with a 5′-dRP-containing 19mer strand, indicating that the 5′-dRP removal activity of PgVPolX proceeds through β-elimination. Te fact that the purifed polymerization domain (residues 1–381) gave rise to an adduct with an electrophoretic mobility faster than that of the complex formed with the complete enzyme indicates that the 5′-dRP lyase activity is intrinsic to PgVPolX and resides in the Polβ-like core of the enzyme. As mentioned above, Lys72 and Lys310 residues from Pol β and Pol λ, respectively, have been identifed as the nucleophiles responsible for the Schif-base formation during the β-elimination of the 5′-dRP moiety18, 49. Te amino acid sequence comparison shown in Fig. 1a strongly suggests that PgVPolX residue Lys101 may be the homolog nucleophile in this polymerase. To test this possibility, PgVPolX Lys101 residue was changed into Ala (K101A) and the mutant protein was assayed for its ability to release a 5′-dRP moiety. Te K101A substitution almost completely abolished the 5′-dRP lyase activity (Fig. 6d), and the mutant was unable to form a covalent complex with the 5′-dRP-containing DNA in the presence of NaBH4 (see Fig. 6c). Tese results point to PgVPolX residue Lys101 as the main nucleophile responsible for the Schif-base formation during the release of the 5′-dRP group. Te 5′-dRP lyases that follow a β-elimination mechanism have been defned as a subset of AP-lyases, and they could potentially be capable of cleaving unincised AP sites52. Tus, to study whether PgVPolX exhibits lyase activ- ity on unincised AP substrates, we used a substrate consisting of a 34-mer dsDNA containing a 2′-deoxyuridine at position 16 of the 3′-labeled strand and treated this with UDG to form a natural AP site (see scheme in Fig. 7). Te incubation of the AP site-containing DNA with increasing concentrations of either the wild-type or the ligase-defcient mutant K547A, in the absence of divalent cations, rendered a nicked product with an electropho- retical mobility identical to that produced by the AP-lyase activity of E. coli endonuclease III (EndoIII) that incises at the 3′-side of the AP site3. By contrast, the 5′-dRP lyase-defcient K101A mutant was severely impaired in its ability to incise on the internal AP site (Fig. 7). Tese results are consistent with cleavage of the phosphodiester bond at the 3′ side of the AP site in a metal-independent manner, leading us to infer the presence of an intrinsic AP-lyase activity in PgVPolX that relies on the same active site as does the 5′-dRP lyase.

Repair of a single nucleotide gap. Te efcient DNA polymerization activity exhibited by PgVPolX on gapped molecules, together with its intrinsic 5′-dRP lyase and ligase activities, strongly suggests that PgVPolX

Scientific REPOrtS | 7: 6907 | DOI:10.1038/s41598-017-07378-3 7 www.nature.com/scientificreports/

Figure 8. In vitro repair of a single nucleotide BER intermediate. Top, schematic representation of the formation of the BER intermediate used as substrate. Te [32P]3′-labeled 2′-deoxyuridine-containing substrate (lane a) was treated with 27 nM E. coli UDG (lane c), leaving a 5′-dRP terminus. Te resulting BER intermediate (1 nM) was incubated with 3 nM of the indicated PgVPolX in the absence (−) or presence (+) of 10 µM dCTP for 10 min at 30 °C, as described in Materials and Methods. Position of products is indicated. Asterisk indicates an electrophoretic artifact that appears specifcally with the 34mer product with an AP site at position 15.

would be able to conduct the three last steps of the single nucleotide BER pathway. Te above results led us to gauge the competence of the enzyme to complete the repair of a gapped BER intermediate, where the gap is fanked by a 3′-OH and a 5′-dRP group. A hybrid DNA containing a nick fanked by an upstream 3′-OH-ended 14mer strand (see scheme in Fig. 8) and a 20mer downstream strand with a 5′-phospho 2′-deoxyuridine (lane a) was treated with UDG to generate, opposite to dGMP in the template strand, a natural 5′-dRP-end that remained stable throughout the assay (lane b). Te 5′-dRP lyase activity of both the wild-type and the ligase-defcient mutant K547A (Lig− in Fig. 8) rendered a 19mer product afer the release of the 5′-dRP moiety (lanes c and e). Importantly, the 5′-dRP lyase-defcient K101A mutant (Lya− in Fig. 8) produced a ligation product (lane d), indicating that the ligase activity of PgVPolX can accomplish direct sealing of the 3′-OH and 5′-dRP groups. Te absence of ligation products with the wild-type enzyme (lane c) would suggest that elimination of the 5′-dRP moiety by its lyase activity is faster than the ligation of both ends. Tus, PgVPolX converts the nicked molecule into a 1-nt gapped intermediate, preventing the regeneration of an internal AP site. As expected, in the presence of 10 µM dCTP, the wild-type enzyme produced a repaired 34mer product arising from the flling of the 1-nt gap and further sealing of the resulting nick (lane f). Under these conditions, the K101A mutant failed to produce any ligation product (lane g), which implies that the elongated upstream strand cannot be ligated to the dangling 5′-dRP group. Terefore, the three activities, polymerization, 5′-dRP lyase and DNA ligase act in concert to allow PgVPolX to efciently accomplish the gap-flling, 5′-dRP excision and sealing steps during the repair reaction. Discussion Due to the enormous diversity of genetic lesions, no single repair process can efciently repair all types of DNA damage. Five known systems, BER, nucleotide excision repair, double-strand break repair, mismatch repair and direct damage reversal, which all arose early in evolution and are highly conserved across prokaryotes and eukar- yotes2, are specialized pathways dedicated to repairing specifc types of lesions. As their cellular homologs, viral genomes are also continuously exposed to exogenous genotoxicants and to by-products of host metabolism such as the ROS. Tese molecules can cause a plethora of lesions and lead to irreversible mutations, altered , and chromosomal aberrations, as well as to blockage of replication and transcription2. Interestingly, whereas the aforementioned repair functions are infrequent or absent in small viral genomes, belonging to the specialized pathways are present in the NCLDVs33, 34. PgV-16T is a giant virus belonging to the NCLDV group35, 53 and its genome contains the sequences for an almost complete BER pathway. Among the proteins encoded by the PgV-16T genome, one that merits attention is a bimodular protein, PgVPolX, with an N-terminal Polβ-like core and a C-terminal NAD+-dependent DNA ligase. Te biochemical properties displayed by PgVPolX enable it to play an active role in BER as it shows a distributive polymerization pattern on template/primer molecules. Moreover, it is particularly active on gapped structures harboring a downstream 5′-P group whose

Scientific REPOrtS | 7: 6907 | DOI:10.1038/s41598-017-07378-3 8 www.nature.com/scientificreports/

recognition by the protein enables it to fll-in the gap processively and accurately. As shown for Pol β and λ, PgVPolX has an inherent 5′-dRP lyase activity dependent on residue Lys101 of the N-terminal 8-kDa domain, which is homologous to the nucleophiles Lys72 and Lys310 of Pol β and λ, respectively, and is responsible for the Schif-base formation during elimination of the 5′-dRP group. Te presence of both polymerization and 5′-dRP lyase activities in DNA polymerases, as in family X Pol β and λ, family A Pol γ and θ, and family Y Pol ι, is a compelling argument for a role for these enzymes in BER18, 19, 49–51. In addition, we have established the pres- ence of an NAD+-dependent DNA ligase activity in PgVPolX that acts in concert with the polymerization and 5′-dRP lyase activities to accomplish the last three steps during “short” BER, most likely afer the action of the viral AP-endonuclease. Alternatively, the presence of an intrinsic AP-lyase activity in PgVPolX suggests that this enzyme could act on unincised AP sites in the viral DNA, cleaving at the 3′-side of the AP site and consequently leaving a non-extendable 3′-phospho-α,β-unsaturated aldehyde (PUA) end. If this is the case, further flling of the gap would rely on previous processing of the 3′-blocked end by a phosphodiesterase activity. In this regard, the P. globosa virus genome contains an ORF coding for a hypothetical Nth-like AP-endonuclease, whose cellular counterparts are endowed with an additional phosphodiesterase activity that processes PUA-containing 3′-ends. Tus, the concerted action of the viral AP-endonuclease and PgVPolX would be sufcient to efciently repair AP lesions by those alternative BER pathways. Aside from the above-mentioned ORFs, the P. globosa virus genome has ORFs coding for putative sliding clamps and Flap endonucleases34, 36 whose cellular homologs play critical roles in the eukaryotic long-patch BER pathway3. Tis fact, together with the ability of PgVPolX to perform limited strand displacement suggests that AP sites could be repaired by a PgVPolX-mediated long-patch BER when the 5′-dRP group in the gap cannot be processed, as is proposed to occur with Pol β54. Although an increasing number of giant viruses have a gene coding for a putative PolX34, the amino acid sequence alignment of these viral PolXs show that the nucleophilic lysine responsible for the 5′-dRP lyase is not conserved (Supplementary Fig. S2). Interestingly, in many of these cases, the viral genome contains ORFs coding for both bifunctional N-glycosylases, which could cleave at the 3′-side of the AP site, and AP-endonucleases34. Te sequential action of these proteins would render a 1-nt gapped intermediate further flled-in by the polymer- ase and the resulting nick sealed by the ligase. Sequencing of the pangenome of giant DNA viruses has revealed the presence of genes encoding for most of the critical enzymes involved in DNA repair processes33, 34. Recent evolutionary studies have revealed that those genomes show a nonsynonymous/synonymous substitution rate below one, suggesting that most of the genes in these types of viruses are functional and contribute to virus adaptation33, 55. Tese observations could emphasize the importance of the preservation of those viral DNA repair functions to slow down viral evolution by safeguard- ing their genomes from random alterations55. In summary, we have demonstrated the functionality of the frst PolX-NAD+-dependent DNA ligase fusion reported, and how its activities are compatible with DNA repair path- ways. Our fndings support the notion that other viral protein fusions, such as the fused histones in Lausannevirus and Marseillevirus56 or the AP-endonuclease-PolX fusion in Entomopoxviruses57, will also be active. Materials and Methods Proteins, reagents and oligonucleotides. Unlabeled nucleotides were purchased from GE Healthcare. [α32P]cordycepin (3′-dATP) and [γ32P]ATP were obtained from Perkin Elmer Life Sciences. Where indicated, substrates were radiolabeled at the 3′ end with [α32P]cordycepin using TdT or, at the 5′ end, with [γ32P]ATP using T4 polynucleotide (T4PNK). TdT, T4PNK, E. coli uracil DNA glycosylase (UDG) and E. coli EndoIII were from New England Biolabs. Recombinant PgVPolX: Te ORF corresponding to gene 401 of P. globosa virus was synthesized by Genscript Corporation and cloned between the NdeI and BamHI restriction sites in the pET16b vector to express a recom- +2 binant protein fused to an N-terminal (His)10-tag for purifcation on Ni -afnity resins. E. coli BL21 (DE3) cells, which contain the T7 RNA polymerase gene under the control of the isopropyl β-D-thiogalactopyranoside (IPTG)-inducible lacUV5 promoter58, 59, were transformed with the resulting recombinant expression plasmid, named pET16-PgVPolX. Transformed cells were grown overnight at 37 °C in LB medium with ampicillin (100 µg/ ml). Cells were diluted into the same medium and incubated at 37 °C until the OD600 reached 0.6. Ten, IPTG (Sigma) was added to a concentration of 0.5 mM and incubation was continued for 16 h at 15 °C. Cells were col- lected by centrifugation for 10 min at 6143 × g. Cells were thawed and ground with alumina at 4 °C; the slurry was resuspended in Bufer A (50 mM Tris-HCl, pH7.5, 1 M NaCl, 7 mM β-mercaptoethanol, 5% glycerol) and centrifuged for 5 min at 650 × g at 4 °C to remove alumina and intact cells. Recombinant PgVPolX protein was soluble under these conditions since it remained in the supernatant afer a further centrifugation step for 20 min at 23,430 × g to separate insoluble proteins from the soluble extract. Te DNA present was removed by stir- ring the soluble extract containing 0.3% polyethyleneimine for 10 min followed by centrifugation for 10 min at 23,430 × g. Te resulting supernatant was precipitated with ammonium sulphate to 70% saturation, to obtain a polyethyleneimine-free protein pellet. Afer centrifugation for 25 min at 23,430 × g, the pellet was resuspended in Bufer A without NaCl to give a fnal ammonium sulphate concentration of 300 mM. Tis fraction was loaded onto a phosphocellulose column pre-equilibrated with Bufer A (300 mM NaCl) and the PgVPolX protein was step-eluted with 300, 400, 425, 450, 475, 500 and 600 mM NaCl. Te His-tagged PgVPolX was recovered in the 475 and 500 mM NaCl eluate fractions, which were then loaded onto a Ni-NTA column (Qiagen) pre-equilibrated with Bufer A (500 mM NaCl and 5 mM imidazole). Te afnity column was step-eluted with 20, 50, 75, 100, 125, 150, 175 and 200 mM imidazole in Bufer A (300 mM NaCl). Te polypeptide composition of the column fractions was monitored by SDS-PAGE. Te His-tagged PgVPolX was recovered in the 100 and 125 mM imida- zole eluate fractions. Finally, PgVPolX was dialyzed against a bufer containing 50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 7 mM β-mercaptoethanol and 50% glycerol and stored at −20 °C. Te fnal purity of the protein was esti- mated to be >90% by Coomassie blue-stained SDS-PAGE. Te purifed protein was further loaded onto a 4-ml

Scientific REPOrtS | 7: 6907 | DOI:10.1038/s41598-017-07378-3 9 www.nature.com/scientificreports/

Name Sequence (5′-3′) P GATCACAGTGAGTAC Cy5P (Cy5)GATCACAGTGAGTAC DOH AACGACGGCCAGT DowP (p)AACGACGGCCAGT T33 ACTGGCCGTGCTTCTATTGTACTCACGTGATCT T29 ACTGGCCGTGCTTXGTACTCACTGTGATC T28 ACTGGCCGTGCTTGTACTCACTGTGATC pU CTGCAGCTGATGCGCUGTACGGATCCCCGGGTAC pUc-G GTACCCGGGGATCCGTACGGCGCATCAGCTGCAG PC GTACTCACTGTGATC PddC GTACTCACTGTGAT(ddC) PC-1 GTACTCACTGTGAT Ph (p)UAGCTGATGCGCAGTACGG DU CCGTACTGCGCATCAGCTGATCACAGTGAGTAC

Table 1. Oligonucleotides used in this study. U denotes 2′-deoxyuridine. Cy5 stands for 1,1′-bis(3- hydroxypropyl)-3,3,3′,3′-tetramethylindodicarbocyanine dye. X = A, C, G or T. (p) = 5′-phosphate group.

glycerol gradient (15–30%) containing 50 mM Tris-HCl, pH 7.5, 20 mM ammonium sulphate, 180 mM NaCl, 1 mM EDTA, and 7 mM β-mercaptoethanol, and centrifuged at 4 °C for 24 h at 58,000 rpm in a Beckman TST 60.4 rotor. Afer centrifugation, 34 fractions were collected from the bottom of the tube for further analysis. Recombinant PgVPolX polymerization domain: Plasmid pET16-PgVPolX (see above) was used as a template to generate the N-terminal polymerization domain (residues 1–381) by changing codon 382 (GAA) into the stop codon TAA using the QuikChange site-directed mutagenesis kit (Stratagene). Confrmation of the DNA sequence and the absence of additional ®mutations was carried out by sequencing the entire gene. BL21 (DE3) cells were transformed with the resulting plasmid and induction of protein expression and preparation of soluble bacterial lysates were performed as described for full-length PgVPolX. Te supernatant containing the PgVPolX polymerization domain was loaded onto a Ni-NTA column pre-equilibrated with Bufer A (300 mM NaCl and 5 mM imidazole). Te afnity column was step-eluted with 50, 100, 150, 175 and 200 mM imidazole. Te polypep- tide composition of the column fractions was monitored by SDS-PAGE. Te His-tagged PgVPolX-polymerization domain was recovered in the 100 mM imidazole-eluate fraction and was loaded onto a phosphocellulose column pre-equilibrated with Bufer A (300 mM NaCl). Te His-tagged PgVPolX-polymerization domain was step-eluted with Bufer A (50, 500 and 600 mM NaCl). Te protein was recovered in the 600 mM NaCl eluate fraction and further dialyzed against a bufer containing 50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 7 mM β-mercaptoethanol, 0,025% Tween -20 and 50% glycerol and stored at −20 °C. PgVPolX catalytic-defcient® mutants: PgVPolX mutants D245A/D247A, K101A and K547A were obtained using the QuikChange system. Plasmid pET16-PgVPolX was used as a template for mutagenesis. PgVPolX mutants were purifed from® soluble extracts of IPTG-induced BL21(DE3) cells by phosphocellulose and Ni-NTA chromatography as described for the wild-type enzyme. Oligonucleotides were purchased from Sigma-Aldrich (sequences are listed in Table 1). When indicated, oli- gonucleotides were radiolabeled either at the 5′ end using [γ32P]ATP (3000 Ci/mmol) and T4PNK or at the 3′-end using [α32P]cordycepin and TdT. Substrates were annealed in the presence of 60 mM Tris-HCl (pH 7.5) and 0.2 M NaCl at 80 °C for 5 min before slowly cooling to room temperature overnight.

DNA polymerization assays on defined DNA molecules. DNA-dependent polymerization was assayed on a template/primer substrate (obtained by hybridization of oligonucleotides Cy5P and T33, see Table 1), on 5-nt gapped molecules (obtained by hybridization of oligonucleotides Cy5P, T33 and either DOH or DowP, which contains a 5′-phosphate) and on 1-nt gapped molecules (obtained by hybridization of oligonu- cleotides Cy5P, T29X and DowP). Te incubation mixture (12.5 μl) contained 50 mM Tris-HCl pH 7.5, 1.25 mM MgCl2, 1 mM DTT, 4% (v/v) glycerol, 0.1 mg/ml BSA, 25 nM of the hybrid shown in each case, and the indicated concentrations of PgVPolX (or 2 µl of each of the PgVPolX containing fractions from the glycerol gradient) and nucleotides. Afer incubation for 5 min at 30 °C the reactions were stopped by adding EDTA to 10 mM. Samples were analyzed by 7 M urea-20% PAGE and visualized using a Typhoon 9410 scanner (GE Healthcare).

Ligation of nicked DNA. To obtain a nicked DNA substrate, [32P]5′-labeled oligonucleotide P and DowP were hybridized to oligonucleotide T28 (see Table 1). Te incubation mixture (12.5 μl) contained 50 mM Tris-HCl pH 7.5, 1.25 mM MgCl2, 1 mM DTT, 4% (v/v) glycerol, 0.1 mg/ml BSA, 1 nM of the nicked DNA substrate, and the indicated concentrations of both PgVPolX and NADH. Afer incubation for 5 min at 30 °C the reactions were stopped by adding EDTA to 10 mM. Samples were analyzed by 7 M urea-20% PAGE and autoradiography.

5′-dRP lyase activity on gap-flled BER intermediates. To obtain a gap-flled BER intermediate, the downstream [32P]3′-labeled oligonucleotide Ph, which contains a 5-phospho 2′-deoxyuridine, and either PC (upstream primer with a 3′-dCMP) or PddC (upstream primer with a 3′-ddCMP) were hybridized to oligonu- cleotide DU (see Table 1). A concentration of 1 nM of the hybrid molecules was further treated with 27 nM UDG

Scientific REPOrtS | 7: 6907 | DOI:10.1038/s41598-017-07378-3 10 www.nature.com/scientificreports/

for 15 min at 37 °C in the presence of 30 mM Hepes pH 7.5, 4% (v/v) glycerol, to render a 5′-dRP end. Afer incu- bation, the mixture was supplemented with the indicated concentration of PgVPolX, in the absence or presence of 1.25 mM MgCl2. Samples were incubated at 30 °C for the indicated times. Afer incubation, freshly prepared NaBH4 was added to a fnal concentration of 100 mM and the reactions were incubated for an additional 20 min on ice. Stabilized (reduced) DNA products were ethanol-precipitated with 0.2 µg/ml tRNA, resuspended in water and analyzed by 7 M urea-20% PAGE and autoradiography.

NaBH4 trapping assay. A 6 nM concentration of the gap-flled BER intermediate with the upstream strand harboring a 3′-ddCMP end (see above) was treated with 27 nM UDG for 15 min at 37 °C in a mixture containing 30 mM Hepes pH 7.5, 4% (v/v) glycerol and 1.25 mM MgCl2. Afer incubation, the mixture was supplemented with 12 nM of the indicated PgVPolX protein and incubation continued for 15 minutes at 30 °C. Te Schif base intermediate was trapped by the addition of 100 mM NaCl or freshly prepared NaBH4. Afer incubation on ice for 20 min, samples were analyzed by 10% SDS-PAGE followed by autoradiography.

AP lyase activity assay on 2′-deoxyuridine-containing substrates. To prepare dsDNA substrates with an internal AP site, [32P]3′-labeled oligonucleotide pU, which contains a 2′-deoxyuridine at position 16, was hybridized to the complementary oligonucleotide pUc-G (see Table 1). A 1 nM concentration of the hybrid was treated with 27 nM UDG for 15 min at 37 °C in the presence of 30 mM Hepes pH 7.5, 4% (v/v) glycerol. Afer incubation, the mixture was supplemented with either 4 nM of E. coli EndoIII, or the indicated concentrations of PgVPolX. Samples were incubated at 30 °C for 10 minutes and reactions were processed as described for the 5′-dRP lyase activity assay.

In vitro reconstitution of single-nucleotide BER. To obtain the BER intermediate, the upstream oli- gonucleotide PC-1 and the [32P]3′-labeled downstream oligonucleotide Ph were hybridized to oligonucleotide DU (see Table 1). A 1 nM concentration of the hybrid molecule was incubated with 27 nM UDG in the pres- ence of 30 mM Hepes pH 7.5, 4% (v/v) glycerol, 1.25 mM MnCl2, 50 mM NADH and, when indicated, 10 µM dCTP. Afer incubation for 15 min at 37 °C, 3 nM of the indicated PgVPolX was added. Samples were incubated at 30 °C for an additional 10 min; afer which, freshly prepared NaBH4 was added to a fnal concentration of 100 mM, and the reactions were incubated for an additional 20 min on ice. Stabilized (reduced) DNA products were ethanol-precipitated with 0.2 µg/ml tRNA, resuspended in water and analyzed by 7 M urea-20% PAGE and visualized in a Typhoon 9410 scanner in phosphorimager mode. References 1. Bauer, N. C., Corbett, A. H. & Doetsch, P. W. Te current state of eukaryotic DNA base damage and repair. Nucleic Acids Res. 43, 10083–10101 (2015). 2. Hoeijmakers, J. H. Genome maintenance mechanisms for preventing cancer. Nature 411, 366–374 (2001). 3. Krwawicz, J., Arczewska, K. D., Speina, E., Maciejewska, A. & Grzesiuk, E. Bacterial DNA repair genes and their eukaryotic homologues: 1. Mutations in genes involved in base excision repair (BER) and DNA-end processors and their implication in mutagenesis and human disease. Acta Biochim. Pol. 54, 413–434 (2007). 4. Fromme, J. C., Banerjee, A. & Verdine, G. L. DNA glycosylase recognition and catalysis. Curr. Opin. Struct. Biol. 14, 43–49 (2004). 5. Sobol, R. W. & Wilson, S. H. Mammalian DNA beta-polymerase in base excision repair of alkylation damage. Prog. Nucleic Acid Res. Mol. Biol. 68, 57–74 (2001). 6. Braithwaite, E. K. et al. DNA polymerase lambda mediates a back-up base excision repair activity in extracts of mouse embryonic fbroblasts. J. Biol. Chem. 280, 18469–18475 (2005). 7. García-Díaz, M. et al. DNA polymerase lambda, a novel DNA repair enzyme in human cells. J. Biol. Chem. 277, 13184–13191 (2002). 8. Baños, B., Lázaro, J. M., Villar, L., Salas, M. & de Vega, M. Characterization of a Bacillus subtilis 64-kDa DNA polymerase X potentially involved in DNA repair. J. Mol. Biol. 384, 1019–1028 (2008). 9. Baños, B., Villar, L., Salas, M. & de Vega, M. Intrinsic apurinic/apyrimidinic (AP) endonuclease activity enables Bacillus subtilis DNA polymerase X to recognize, incise, and further repair abasic sites. Proc. Natl. Acad. Sci. U. S. A. 107, 19219–19224 (2010). 10. Nakane, S., Nakagawa, N., Kuramitsu, S. & Masui, R. Te role of the PHP domain associated with DNA polymerase X from Termus thermophilus HB8 in base excision repair. DNA Repair (Amst) 11, 906–914 (2012). 11. Oliveros, M. et al. Characterization of an African swine fever virus 20-kDa DNA polymerase involved in DNA repair. J. Biol. Chem. 272, 30899–30910 (1997). 12. Redrejo-Rodríguez, M., Rodríguez, J. M., Suárez, C., Salas, J. & Salas, M. L. Involvement of the reparative DNA polymerase Pol X of African swine fever virus in the maintenance of viral genome stability in vivo. J. Virol. 87, 9780–9787 (2013). 13. Moon, A. F. et al. Te X family portrait: Structural insights into biological functions of X family polymerases. DNA Repair (Amst) 6, 1709–1725 (2007). 14. Ramadan, K., Shevelev, I. & Hubscher, U. Te DNA-polymerase-X family: controllers of DNA quality? Nat. Rev. Mol. Cell Biol. 5, 1038–1043 (2004). 15. Pelletier, H., Sawaya, M. R., Kumar, A., Wilson, S. H. & Kraut, J. Structures of ternary complexes of rat DNA polymerase beta, a DNA template-primer, and ddCTP. Science 264, 1891–1903 (1994). 16. Prasad, R., Beard, W. A. & Wilson, S. H. Studies of gapped DNA substrate binding by mammalian DNA polymerase beta. Dependence on 5′-phosphate group. J. Biol. Chem. 269, 18096–18101 (1994). 17. Sawaya, M. R., Prasad, R., Wilson, S. H., Kraut, J. & Pelletier, H. Crystal structures of human DNA polymerase beta complexed with gapped and nicked DNA: evidence for an induced ft mechanism. Biochemistry 36, 11205–11215 (1997). 18. García-Díaz, M., Bebenek, K., Kunkel, T. A. & Blanco, L. Identifcation of an intrinsic 5′-deoxyribose-5-phosphate lyase activity in human DNA polymerase lambda: a possible role in base excision repair. J. Biol. Chem. 276, 34659–34663 (2001). 19. Matsumoto, Y. & Kim, K. Excision of deoxyribose phosphate residues by DNA polymerase beta during DNA repair. Science 269, 699–702 (1995). 20. González-Barrera, S. et al. Characterization of SpPol4, a unique X-family DNA polymerase in Schizosaccharomyces pombe. Nucleic Acids Res. 33, 4762–4774 (2005). 21. Gellon, L., Carson, D. R., Carson, J. P. & Demple, B. Intrinsic 5′-deoxyribose-5-phosphate lyase activity in Saccharomyces cerevisiae Trf4 protein with a possible role in base excision DNA repair. DNA Repair (Amst) 7, 187–198 (2008). 22. Srivastava, D. K. et al. Mammalian abasic site base excision repair. Identifcation of the reaction sequence and rate-determining steps. J. Biol. Chem. 273, 21203–21209 (1998).

Scientific REPOrtS | 7: 6907 | DOI:10.1038/s41598-017-07378-3 11 www.nature.com/scientificreports/

23. Mahajan, K. N. et al. Association of terminal deoxynucleotidyl transferase with . Proc. Natl. Acad. Sci. U. S. A. 96, 13926–13931 (1999). 24. Mahajan, K. N., Nick McElhinny, S. A., Mitchell, B. S. & Ramsden, D. A. Association of DNA polymerase mu (pol mu) with Ku and ligase IV: role for pol mu in end-joining double-strand break repair. Mol. Cell Biol. 22, 5194–5202 (2002). 25. Nick McElhinny, S. A. et al. A gradient of template dependence defines distinct biological roles for family X polymerases in nonhomologous end joining. Mol. Cell 19, 357–366 (2005). 26. Pryor, J. M. et al. Essential role for polymerase specialization in cellular nonhomologous end joining. Proc. Natl. Acad. Sci. U.S.A. 112, E4537–4545 (2015). 27. Tseng, H. M. & Tomkinson, A. E. A physical and functional interaction between yeast Pol4 and Dnl4-Lif1 links DNA synthesis and ligation in nonhomologous end joining. J. Biol. Chem. 277, 45630–45637 (2002). 28. Tseng, H. M. & Tomkinson, A. E. Processing and joining of DNA ends coordinated by interactions among Dnl4/Lif1, Pol4, and FEN-1. J. Biol. Chem. 279, 47580–47588 (2004). 29. Lecointe, F., Shevelev, I. V., Bailone, A., Sommer, S. & Hübscher, U. Involvement of an X family DNA polymerase in double-stranded break repair in the radioresistant organism Deinococcus radiodurans. Mol. Microbiol. 53, 1721–1730 (2004). 30. Baños, B., Lázaro, J. M., Villar, L., Salas, M. & de Vega, M. Editing of misaligned 3′-termini by an intrinsic 3′-5′ exonuclease activity residing in the PHP domain of a family X DNA polymerase. Nucleic Acids Res. 36, 5736–5749 (2008). 31. Nakane, S., Nakagawa, N., Kuramitsu, S. & Masui, R. Characterization of DNA polymerase X from Termus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3′-5′ exonuclease activity. Nucleic Acids Res. 37, 2037–2052 (2009). 32. Zafra, O., Pérez de Ayala, L. & de Vega, M. Te anti/syn conformation of 8-oxo-7,8-dihydro-2′-deoxyguanosine is modulated by Bacillus subtilis PolX active site residues His255 and Asn263. Efcient processing of damaged 3′-ends. DNA Repair (Amst) 52, 59–69 (2017). 33. Blanc-Mathieu, R. & Ogata, H. DNA repair genes in the Megavirales pangenome. Curr. Opin. Microbiol. 31, 94–100 (2016). 34. Redrejo-Rodríguez, M. & Salas, M. L. Repair of base damage and genome maintenance in the nucleo-cytoplasmic large DNA viruses. Virus Res. 179, 12–25 (2014). 35. Verity, P. G. et al. Current understanding of Phaeocystis ecology and biogeochemistry, and perspectives for future research. Biogeochemistry 83, 311–330 (2007). 36. Santini, S. et al. Genome of Phaeocystis globosa virus PgV-16T highlights the common ancestry of the largest known DNA viruses infecting eukaryotes. Proc. Natl. Acad. Sci. U.S.A. 110, 10800–10805 (2013). 37. Yutin, N. & Koonin, E. V. Evolution of DNA ligases of nucleo-cytoplasmic large DNA viruses of eukaryotes: a case of hidden complexity. Biol. Direct 4, 51 (2009). 38. Yutin, N. & Koonin, E. V. Hidden evolutionary complexity of Nucleo-Cytoplasmic Large DNA viruses of eukaryotes. Virol J. 9, 161 (2012). 39. Gallot-Lavallee, L. et al. The 474-Kilobase-Pair Complete Genome Sequence of CeV-01B, a Virus Infecting Haptolina (Chrysochromulina) ericina (Prymnesiophyceae). Genome Announc 3 (2015). 40. Cavanaugh, N. A. et al. Molecular insights into DNA polymerase deterrents for ribonucleotide insertion. J. Biol. Chem. 286, 31650–31660 (2011). 41. Ruiz, J. F. et al. Lack of sugar discrimination by human Pol mu requires a single glycine residue. Nucleic Acids Res. 31, 4441–4449 (2003). 42. de Ory, A., Zafra, O. & de Vega, M. Efcient processing of abasic sites by bacterial nonhomologous end-joining Ku proteins. Nucleic acids Res. 42, 13082–13095 (2014). 43. Zhu, H. & Shuman, S. Characterization of Agrobacterium tumefaciens DNA ligases C and D. Nucleic acids Res. 35, 3631–3645 (2007). 44. Zhu, H. & Shuman, S. Bacterial nonhomologous end joining ligases preferentially seal breaks with a 3′-OH monoribonucleotide. J. Biol. Chem. 283, 8331–8339 (2008). 45. Martin, I. V. & MacNeill, S. A. ATP-dependent DNA ligases. Genome biology 3, REVIEWS3005 (2002). 46. Beard, W. A. & Wilson, S. H. Structural design of a eukaryotic DNA repair polymerase: DNA polymerase beta. Mutat. Res. 460, 231–244 (2000). 47. Matsumoto, Y., Kim, K., Katz, D. S. & Feng, J. A. Catalytic center of DNA polymerase beta for excision of deoxyribose phosphate groups. Biochemistry 37, 6456–6464 (1998). 48. Prasad, R., Beard, W. A., Strauss, P. R. & Wilson, S. H. Human DNA polymerase beta deoxyribose phosphate lyase. Substrate specifcity and catalytic mechanism. J. Biol. Chem. 273, 15263–15270 (1998). 49. Deterding, L. J., Prasad, R., Mullen, G. P., Wilson, S. H. & Tomer, K. B. Mapping of the 5′-2-deoxyribose-5-phosphate lyase active site in DNA polymerase beta by mass spectrometry. J. Biol. Chem. 275, 10463–10471 (2000). 50. Longley, M. J., Prasad, R., Srivastava, D. K., Wilson, S. H. & Copeland, W. C. Identifcation of 5′-deoxyribose phosphate lyase activity in human DNA polymerase gamma and its role in mitochondrial base excision repair in vitro. Proc. Natl. Acad. Sci. U.S.A. 95, 12244–12248 (1998). 51. Prasad, R. et al. Human DNA polymerase theta possesses 5′-dRP lyase activity and functions in single-nucleotide base excision repair in vitro. Nucleic Acids Res. 37, 1868–1877 (2009). 52. Piersen, C. E., McCullough, A. K. & Lloyd, R. S. AP lyases and dRPases: commonality of mechanism. Mutat. Res. 459, 43–53 (2000). 53. Baudoux, A. C. & Brussaard, C. P. Characterization of diferent viruses infecting the marine harmful algal bloom species Phaeocystis globosa. Virology 341, 80–90 (2005). 54. Prasad, R. et al. DNA polymerase beta -mediated long patch base excision repair. Poly(ADP-ribose)polymerase-1 stimulates strand displacement DNA synthesis. J. Biol. Chem. 276, 32411–32414 (2001). 55. Doutre, G., Philippe, N., Abergel, C. & Claverie, J. M. Genome analysis of the frst Marseilleviridae representative from Australia indicates that most of its genes contribute to virus ftness. J. Virol. 88, 14340–14349 (2014). 56. Tomas, V. et al. Lausannevirus, a giant amoebal virus encoding histone doublets. Environ. Microbiol. 13, 1454–1466 (2011). 57. Afonso, C. L. et al. Te genome of Melanoplus sanguinipes entomopoxvirus. J. Virol. 73, 533–552 (1999). 58. Studier, F. W. Use of bacteriophage T7 lysozyme to improve an inducible T7 expression system. J. Mol. Biol. 219, 37–44 (1991). 59. Studier, F. W. & Mofatt, B. A. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189, 113–130 (1986). 60. Pelletier, H., Sawaya, M. R., Wolfe, W., Wilson, S. H. & Kraut, J. Crystal structures of human DNA polymerase beta complexed with DNA: implications for catalytic mechanism, processivity, and fdelity. Biochemistry 35, 12742–12761 (1996). 61. Wilkinson, A., Day, J. & Bowater, R. Bacterial DNA ligases. Mol. Microbiol. 40, 1241–1248 (2001).

Acknowledgements We are grateful to Drs. Modesto Redrejo-Rodríguez and Margarita Salas for critical reading of the manuscript, and to Robin van de Ven and Anna Noordeloos for technical support. Tis work was supported by the Spanish Ministry of Economy and Competitiveness grant BFU2014-53791-P to M.V., and by an institutional grant from Fundación Ramón Areces to the Centro de Biología Molecular “Severo Ochoa”.

Scientific REPOrtS | 7: 6907 | DOI:10.1038/s41598-017-07378-3 12 www.nature.com/scientificreports/

Author Contributions M.V. conceived and designed the project and wrote the manuscript. J.F.G., A.O., C.P.D.B. and M.V. performed the experiments. All authors analyzed the results and approved the fnal version of the manuscript. Additional Information Supplementary information accompanies this paper at doi:10.1038/s41598-017-07378-3 Competing Interests: Te authors declare that they have no competing interests. Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional afliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Cre- ative Commons license, and indicate if changes were made. Te images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not per- mitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

© Te Author(s) 2017

Scientific REPOrtS | 7: 6907 | DOI:10.1038/s41598-017-07378-3 13