DOCSLIB.ORG

Investigating the Regulation and Function of the NR4A Nuclear Receptors in Cancer Jordan A

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Investigating the Regulation and Function of the NR4A Nuclear Receptors in Cancer Jordan A University of Tennessee Health Science Center UTHSC Digital Commons Theses and Dissertations (ETD) College of Graduate Health Sciences 5-2016 Investigating the Regulation and Function of the NR4A Nuclear Receptors in Cancer Jordan A. Beard University of Tennessee Health Science Center Follow this and additional works at: https://dc.uthsc.edu/dissertations Part of the Medical Cell Biology Commons, and the Medical Molecular Biology Commons Recommended Citation Beard, Jordan A. (http://orcid.org/0000-0003-0281-1432), "Investigating the Regulation and Function of the NR4A Nuclear Receptors in Cancer" (2016). Theses and Dissertations (ETD). Paper 378. http://dx.doi.org/10.21007/etd.cghs.2016.0391. This Dissertation is brought to you for free and open access by the College of Graduate Health Sciences at UTHSC Digital Commons. It has been accepted for inclusion in Theses and Dissertations (ETD) by an authorized administrator of UTHSC Digital Commons. For more information, please contact [email protected]. Investigating the Regulation and Function of the NR4A Nuclear Receptors in Cancer Document Type Dissertation Degree Name Doctor of Philosophy (PhD) Program Biomedical Sciences Track Molecular Therapeutics and Cell Signaling Research Advisor Taosheng Chen, Ph.D. Committee Leonard Lothstein, Ph.D. Leta Nutt, Ph.D. Edwards A. Park, Ph.D. Gerard P. Zambetti, Ph.D. ORCID http://orcid.org/0000-0003-0281-1432 DOI 10.21007/etd.cghs.2016.0391 This dissertation is available at UTHSC Digital Commons: https://dc.uthsc.edu/dissertations/378 Investigating the Regulation and Function of the NR4A Nuclear Receptors in Cancer A Dissertation Presented for The Graduate Studies Council The University of Tennessee Health Science Center In Partial Fulfillment Of the Requirements for the Degree Doctor of Philosophy From The University of Tennessee By Jordan A. Beard May 2016 Chapter 2 © 2015 by Elsevier Inc. All other material © 2016 by Jordan A. Beard. All rights reserved. ii DEDICATION This dissertation is dedicated to my loving wife, Carrie Beard, and my family for their love and support during my time in graduate school. I fully appreciate your continued encouragement throughout this journey. iii ACKNOWLEDGEMENTS First and foremost, I want to thank my mentor, Dr. Taosheng Chen. Over the past six years, he has provided me with his overwhelming support and an outstanding laboratory environment in which I could learn and grow into the scientist that I am today. My success in the lab and in my scientific career can be attributed to his mentorship and his guidance in becoming an independent scientist. I would like to thank my dissertation committee members, Drs. Leonard Lothstein, Leta Nutt, Edwards Park, and Gerard Zambetti for their guidance and constructive review of my research project. I am also grateful for your time spent on writing recommendations for travel awards and during my search for a postdoctoral fellowship. I have had the privilege of working with a great group of scientists in the department of Chemical Biology and Therapeutics at St. Jude Children’s Research Hospital (SJCRH). I have enjoyed the opportunity to gain feedback on my research while making great friends in the process. From the first day of my rotation, the members of the Chen research group have been the most welcoming group of people, and have taught me much and supported me greatly throughout my time in lab. I would like to give a special thank you to those members who went above and beyond to assist me, which includes Drs. Jing Wu, Ayesha Elias, Su Sien Ong, Yue-Ming Wang, Milu Cherian, and Jesse Bakke, Mrs. Alexa Farmer, Mrs. Jessica Hoyer, and Ms. Asli Goktug. A very special thank you goes to my former Pediatric Oncology Education summer student, Justin Hills. Mr. Hills was of tremendous help during the summers of 2013 and 2014. Your adeptness at the bench and in your organizational skills made my first experience as a mentor incredibly great, and I learned much about how to teach novel ideas and unfamiliar techniques to someone with an eager mind. I am grateful for your time here, and your willingness to help with the project is of great value. Other SJCRH faculty and staff have aided in my education and research. I would like to thank Dr. Mark Hatley and his lab for valuable discussions and for providing reagents that have aided in my research. SJCRH is a wonderful place to work, largely because of the great core facilities offered. I would like to thank Dr. Michael Wang and Mr. Granger Ridout of the Hartwell Center for their assistance with providing microarray processing and dataset analysis. Last but not least, I want to thank Dr. Susan Nozell at the University of Alabama at Birmingham. Dr. Nozell was the first person to introduce me to hands-on biomedical research and I am grateful to have taken her Cell and Molecular Biology class. From discussions about cell signaling pathways in class, learning how to run PCR and Western blots in the lab, to demonstrating how to structure a grant application, I thank Dr. Nozell for instilling within me a passion for research. iv ABSTRACT The nuclear receptor (NR) superfamily represents a structurally-conserved group of ligand-regulated transcription factors. These proteins have critical roles in various physiological and pathological processes, including cancer, and have been targets of drug therapy. The orphan NR subfamily 4A (NR4A), which includes the NR4A1 (Nur77), NR4A2 (Nurr1), and NR4A3 (Nor-1) genes has been implicated in adult solid tumors and have been characterized as pro-tumorigenic mediator of cell proliferation, transformation, migration, and drug resistance. Alternatively, in leukemia, NR4A1 and NR4A3 have been described as tumor suppressors in hematologic malignancies. Members of the NR4A family are commonly overexpressed in cancer and this has been attributed to their regulation by other oncogenic signaling pathways. Despite the understanding of signaling cascades that lead to overexpression of the NR4A members, little is known about their regulation by microRNAs (miRNAs). miRNAs are small, non-coding, endogenous RNAs that are transcribed, processed, and used to direct cellular proteins that destabilize or block translation of target mRNA. In this study, we first sought to determine the miRNAs that are responsible for regulating NR4A2. Using a 3ʹ UTR reporter assay, we identified miR-34 as a regulator of the NR4A2 through its 3ʹ UTR, which was confirmed using mutagenesis of the predicted binding region of the miR-34 seed region to its target site. We demonstrated that overexpression of exogenous or induction of endogenous miR-34 expression downstream of p53 activation by Nutlin-3a was associated with decreased endogenous NR4A2. Additionally, overexpression of NR4A2 was capable of suppressing the activation of p53 target genes, and was also able to attenuate the sensitivity of cells to the anti-proliferative effect of Nutlin-3a. We further explored the roles of the NR4A family in pediatric cancer, an area that has not been fully investigated. We first determined that the members of the NR4A family are overexpressed in rhabdomyosarcoma (RMS) cell lines compared to normal muscle cells. Knockdown of NR4A1 or NR4A2 led to a reduction in cell proliferation and transformation, while knockdown of NR4A2 could also affect cell migration. Using a microarray approach, we sought to investigate the transcriptome-level changes in response to NR4A knockdown, and determined that knockdown of NR4A2 led to a unique gene signature, while NR4A1 and NR4A3 knockdown had large overlaps in expression changes. These unique gene expression changes in response to NR4A2 knockdown could explain the unique effects that NR4A2 has on migration. Overall, this study has discovered miR-34 as a novel regulator of NR4A2, and places NR4A2 in a potential feedback mechanism involving p53, miR-34, and NR4A2. This could indicate that NR4A2 mediates at least some of its pro-oncogenic effects through the inhibition of p53, which is relieved by p53 itself upon activation. Alternatively, NR4A2, is shown to have other roles in cancer, potentially through novel downstream target genes. These data may be used in understanding the effects of miR-34 v replacement therapy, as this method of treatment is progressing through clinical trials, allowing us to understand the diverse regulator cascades being modulated. vi TABLE OF CONTENTS CHAPTER 1. INTRODUCTION .....................................................................................1 Nuclear Receptors ............................................................................................................1 Discovery of the nuclear receptor superfamily ............................................................1 Domain structure and function .....................................................................................1 N-terminal domain and AF-1 .................................................................................. 1 DNA-binding domain ............................................................................................. 3 Ligand-binding domain and AF-2 .......................................................................... 3 Nuclear receptors and cancer .......................................................................................3 Glucocorticoid receptor .......................................................................................... 3 Estrogen receptor ...................................................................................................
Load more

Recommended publications
  • Understanding the Impact of 1Q21.1 Copy Number Variant
    Understanding the impact of 1q21.1 copy number variant Article (Published Version) Havard, Chansonette, Strong, Emma, Mercier, Eloi, Colnaghi, Rita, Alcantara, Diana Rita Ralha, Chow, Eva, Martell, Sally, Tyson, Christine, Hrynchak, Monica, McGillivray, Barbara, Hamilton, Sara, Marles, Sandra, Mhanni, Aziz, Dawson, Angelika J, Pavlidis, Paul et al. (2011) Understanding the impact of 1q21.1 copy number variant. Orphanet Journal of Rare Diseases, 6 (54). pp. 1-12. ISSN 1750-1172 This version is available from Sussex Research Online: http://sro.sussex.ac.uk/id/eprint/41577/ This document is made available in accordance with publisher policies and may differ from the published version or from the version of record. If you wish to cite this item you are advised to consult the publisher’s version. Please see the URL above for details on accessing the published version. Copyright and reuse: Sussex Research Online is a digital repository of the research output of the University. Copyright and all moral rights to the version of the paper presented here belong to the individual author(s) and/or other copyright owners. To the extent reasonable and practicable, the material made available in SRO has been checked for eligibility before being made available. Copies of full text items generally can be reproduced, displayed or performed and given to third parties in any format or medium for personal research or study, educational, or not-for-profit purposes without prior permission or charge, provided that the authors, title and full bibliographic details are credited, a hyperlink and/or URL is given for the original metadata page and the content is not changed in any way.
    [Show full text]
  • The Rise and Fall of the Bovine Corpus Luteum
    University of Nebraska Medical Center DigitalCommons@UNMC Theses & Dissertations Graduate Studies Spring 5-6-2017 The Rise and Fall of the Bovine Corpus Luteum Heather Talbott University of Nebraska Medical Center Follow this and additional works at: https://digitalcommons.unmc.edu/etd Part of the Biochemistry Commons, Molecular Biology Commons, and the Obstetrics and Gynecology Commons Recommended Citation Talbott, Heather, "The Rise and Fall of the Bovine Corpus Luteum" (2017). Theses & Dissertations. 207. https://digitalcommons.unmc.edu/etd/207 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. THE RISE AND FALL OF THE BOVINE CORPUS LUTEUM by Heather Talbott A DISSERTATION Presented to the Faculty of the University of Nebraska Graduate College in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Biochemistry and Molecular Biology Graduate Program Under the Supervision of Professor John S. Davis University of Nebraska Medical Center Omaha, Nebraska May, 2017 Supervisory Committee: Carol A. Casey, Ph.D. Andrea S. Cupp, Ph.D. Parmender P. Mehta, Ph.D. Justin L. Mott, Ph.D. i ACKNOWLEDGEMENTS This dissertation was supported by the Agriculture and Food Research Initiative from the USDA National Institute of Food and Agriculture (NIFA) Pre-doctoral award; University of Nebraska Medical Center Graduate Student Assistantship; University of Nebraska Medical Center Exceptional Incoming Graduate Student Award; the VA Nebraska-Western Iowa Health Care System Department of Veterans Affairs; and The Olson Center for Women’s Health, Department of Obstetrics and Gynecology, Nebraska Medical Center.
    [Show full text]
  • Genetic Screens in Isogenic Mammalian Cell Lines Without Single Cell Cloning
    ARTICLE https://doi.org/10.1038/s41467-020-14620-6 OPEN Genetic screens in isogenic mammalian cell lines without single cell cloning Peter C. DeWeirdt1,2, Annabel K. Sangree1,2, Ruth E. Hanna1,2, Kendall R. Sanson1,2, Mudra Hegde 1, Christine Strand 1, Nicole S. Persky1 & John G. Doench 1* Isogenic pairs of cell lines, which differ by a single genetic modification, are powerful tools for understanding gene function. Generating such pairs of mammalian cells, however, is labor- 1234567890():,; intensive, time-consuming, and, in some cell types, essentially impossible. Here, we present an approach to create isogenic pairs of cells that avoids single cell cloning, and screen these pairs with genome-wide CRISPR-Cas9 libraries to generate genetic interaction maps. We query the anti-apoptotic genes BCL2L1 and MCL1, and the DNA damage repair gene PARP1, identifying both expected and uncharacterized buffering and synthetic lethal interactions. Additionally, we compare acute CRISPR-based knockout, single cell clones, and small- molecule inhibition. We observe that, while the approaches provide largely overlapping information, differences emerge, highlighting an important consideration when employing genetic screens to identify and characterize potential drug targets. We anticipate that this methodology will be broadly useful to comprehensively study gene function across many contexts. 1 Genetic Perturbation Platform, Broad Institute of MIT and Harvard, 75 Ames Street, Cambridge, MA 02142, USA. 2These authors contributed equally: Peter C. DeWeirdt,
    [Show full text]
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
    [Show full text]
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Assessment of NR4A Ligands That Directly Bind and Modulate the Orphan Nuclear Receptor Nurr1
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.109017; this version posted May 25, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Assessment of NR4A Ligands that Directly Bind and Modulate the Orphan Nuclear Receptor Nurr1 Paola Munoz-Tello 1, Hua Lin 2,3, Pasha Khan 2, Ian Mitchelle S. de Vera 1,4, Theodore M. Kamenecka 2, and Douglas J. Kojetin 1,2,* 1 Department of Integrative Structural and Computational Biology, The Scripps Research Institute, Jupiter, FL, 33458, USA 2 Department of Molecular Medicine, The Scripps Research Institute, Jupiter, Florida 33458, USA 3 Current address: Biomedical Research Center of South China, College of Life Sciences, Fujian Normal University, Fuzhou 350117, China 4 Current address: Department of Pharmacology and Physiology, Saint Louis University School of Medicine, St. Louis, MO 63104, USA * Correspondence: [email protected] as ligands that increase Nurr1 transcription in human neuroblastoma SK- ABSTRACT N-BE(2)-C cells (11). Amodiaquine improves behavioral alterations in a Nurr1/NR4A2 is an orphan nuclear receptor transcription factor im- Parkinson’s disease animal model (11) and improves neuropathology and plicated as a potential drug target for neurological disorders including memory impairment in an Alzheimer’s disease animal model (12). Alzheimer’s and Parkinson’s diseases. Previous studies identified small molecule modulators of NR4A nuclear receptors including Nurr1 and Amodiaquine is the most potent and efficacious Nurr1 agonist of the Nur77/NR4A1; it remains unclear whether these ligands affect Nurr1 4-amino-7-chloroquinoline compounds, but these compounds are not through direct binding or indirect non-binding mechanisms.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials: Supplemental Table 1 Abbreviations FMDV Foot and Mouth Disease Virus FMD Foot and Mouth Disease NC Non-treated Control DEGs Differentially Expressed Genes RNA-seq High-throughput Sequencing of Mrna RT-qPCR Quantitative Real-time Reverse Transcriptase PCR TCID50 50% Tissue Culture Infective Doses CPE Cytopathic Effect MOI Multiplicity of Infection DMEM Dulbecco's Modified Eagle Medium FBS Fetal Bovine Serum PBS Phosphate Buffer Saline QC Quality Control FPKM Fragments per Kilo bases per Million fragments method GO Gene Ontology KEGG Kyoto Encyclopedia of Genes and Genomes R Pearson Correlation Coefficient NFKBIA NF-kappa-B Inhibitor alpha IL6 Interleukin 6 CCL4 C-C motif Chemokine 4 CXCL2 C-X-C motif Chemokine 2 TNF Tumor Necrosis Factor VEGFA Vascular Endothelial Growth Gactor A CCL20 C-C motif Chemokine 20 CSF2 Macrophage Colony-Stimulating Factor 2 GADD45B Growth Arrest and DNA Damage Inducible 45 beta MYC Myc proto-oncogene protein FOS Proto-oncogene c-Fos MCL1 Induced myeloid leukemia cell differentiation protein Mcl-1 MAP3K14 Mitogen-activated protein kinase kinase kinase 14 IRF1 Interferon regulatory factor 1 CCL5 C-C motif chemokine 5 ZBTB3 Zinc finger and BTB domain containing 3 OTX1 Orthodenticle homeobox 1 TXNIP Thioredoxin-interacting protein ZNF180 Znc Finger Protein 180 ZNF36 Znc Finger Protein 36 ZNF182 Zinc finger protein 182 GINS3 GINS complex subunit 3 KLF15 Kruppel-like factor 15 Supplemental Table 2 Primers for Verification of RNA-seq-detected DEGs with RT-qPCR TNF F: CGACTCAGTGCCGAGATCAA R:
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • A Population-Based Study of Effects of Genetic Loci on Orofacial Clefts
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author J Dent Res Manuscript Author . Author manuscript; Manuscript Author available in PMC 2017 October 01. Published in final edited form as: J Dent Res. 2017 October ; 96(11): 1322–1329. doi:10.1177/0022034517716914. A Population-Based Study of Effects of Genetic Loci on Orofacial Clefts L.M. Moreno Uribe1, T. Fomina2, R.G. Munger3, P.A. Romitti4, M.M. Jenkins5, H.K. Gjessing2,6, M. Gjerdevik2,6, K. Christensen7, A.J. Wilcox8, J.C. Murray9, R.T. Lie2,6,*, and G.L. Wehby10,* 1Department of Orthodontics and Dows Institute, College of Dentistry, University of Iowa, Iowa City, IA, USA 2Department of Global Public Health and Primary Care, University of Bergen, Bergen, Norway 3Department of Nutrition and Food Sciences, Utah State University, Logan, UT, USA 4Department of Epidemiology, College of Public Health, University of Iowa, Iowa City, IA, USA 5National Center on Birth Defects and Developmental Disabilities, Centers for Disease Control and Prevention, Atlanta, GA, USA 6Norwegian Institute of Public Health, Bergen and Oslo, Norway 7Department of Public Health, University of Southern Denmark; Department of Clinical Genetics and Department of Biochemistry and Pharmacology, Odense University Hospital, Odense, Denmark 8Epidemiology Branch, National Institute of Environmental Health Sciences, National Institutes of Health, Durham, NC, USA 9Department of Pediatrics, Carver College of Medicine, University of Iowa, Iowa City, IA, USA 10Departments of Health Management and Policy, Economics, and Preventive and Community Dentistry, and Public Policy Center, University of Iowa, Iowa City, IA, USA Abstract Prior genome-wide association studies for oral clefts have focused on clinic-based samples with unclear generalizability.
    [Show full text]
  • Chromatin Regulator CHD1 Remodels the Immunosuppressive Tumor Microenvironment in PTEN-Defi Cient Prostate Cancer
    Published OnlineFirst May 8, 2020; DOI: 10.1158/2159-8290.CD-19-1352 RESEARCH ARTICLE Chromatin Regulator CHD1 Remodels the Immunosuppressive Tumor Microenvironment in PTEN-Defi cient Prostate Cancer Di Zhao 1 , 2 , Li Cai 1 , Xin Lu 1 , 3 , Xin Liang 1 , 4 , Jiexi Li 1 , Peiwen Chen 1 , Michael Ittmann 5 , Xiaoying Shang 1 , Shan Jiang6 , Haoyan Li 2 , Chenling Meng 2 , Ivonne Flores 6 , Jian H. Song 4 , James W. Horner 6 , Zhengdao Lan 1 , Chang-Jiun Wu6 , Jun Li 6 , Qing Chang 7 , Ko-Chien Chen 1 , Guocan Wang 1 , 4 , Pingna Deng 1 , Denise J. Spring 1 , Y. Alan Wang1 , and Ronald A. DePinho 1 Downloaded from cancerdiscovery.aacrjournals.org on September 28, 2021. © 2020 American Association for Cancer Research. Published OnlineFirst May 8, 2020; DOI: 10.1158/2159-8290.CD-19-1352 ABSTRACT Genetic inactivation of PTEN is common in prostate cancer and correlates with poorer prognosis. We previously identifi edCHD1 as an essential gene in PTEN- defi cient cancer cells. Here, we sought defi nitivein vivo genetic evidence for, and mechanistic under- standing of, the essential role of CHD1 in PTEN-defi cient prostate cancer. In Pten and Pten /Smad4 genetically engineered mouse models, prostate-specifi c deletion ofChd1 resulted in markedly delayed tumor progression and prolonged survival. Chd1 deletion was associated with profound tumor microenvironment (TME) remodeling characterized by reduced myeloid-derived suppressor cells (MDSC) and increased CD8+ T cells. Further analysis identifi ed IL6 as a key transcriptional target of CHD1, which plays a major role in recruitment of immunosuppressive MDSCs.
    [Show full text]
  • 1Q21.1 Duplication Syndrome and Epilepsy Case Report and Review
    CLINICAL/SCIENTIFIC NOTES OPEN ACCESS 1q21.1 Duplication syndrome and epilepsy Case report and review Ioulia Gourari, MD, Romaine Schubert, MD, and Aparna Prasad, PhD Correspondence Dr. Gourari Neurol Genet 2018;4:e219. doi:10.1212/NXG.0000000000000219 [email protected] Copy number variants (CNVs) of 1q21.1 are increasingly being recognized due to the wide- spread use of genetic screening tests for the investigation of developmental disorders and epilepsy. These include microdeletion and microduplication syndromes, associated with a wide variety of pathology including autism spectrum disorders, attention-deficit disorder, learning disabilities, hypotonia, facial dysmorphisms, and schizophrenia. The 1q21.1 region is consid- ered to be genetically unstable because it contains one of the largest areas of identical dupli- cation sequences in the human genome. Epilepsy has been reported in the literature, particularly in microdeletion syndromes, but rarely in association with microduplication syn- dromes. We report a patient with epilepsy and autism spectrum disorder due to a distal 1q21.1 microduplication and review the available literature and genetic information. Case report We present a 10-year-old girl with a low-functioning autism spectrum disorder and focal motor epilepsy. On examination, she has hypertelorism, minimal communicative language skills, and severe macrocephaly (HC = 57 cm, 3.6 SD > 99%). Seizures started at 7 years of age and consisted of head deviation to the left, generalized stiffening, clonic activity of the mouth, and fluttering of the eyelids, lasting for 1–2 minutes. Multiple video EEG recordings showed a right temporal focus with a less active, independent left temporal focus. 3T MRI scan of the brain was normal.
    [Show full text]
  • Differentiation of the Human PAX7
    © 2020. Published by The Company of Biologists Ltd | Development (2020) 147, dev187344. doi:10.1242/dev.187344 HUMAN DEVELOPMENT TECHNIQUES AND RESOURCES ARTICLE Differentiation of the human PAX7-positive myogenic precursors/satellite cell lineage in vitro Ziad Al Tanoury1,2,3, Jyoti Rao2,3, Olivier Tassy1,Bénédicte Gobert1,4, Svetlana Gapon2, Jean-Marie Garnier1, Erica Wagner2, Aurore Hick4, Arielle Hall5, Emanuela Gussoni5 and Olivier Pourquié1,2,3,6,* ABSTRACT SC derive from the paraxial mesoderm, the embryonic tissue that Satellite cells (SC) are muscle stem cells that can regenerate adult forms the vertebral column and skeletal muscles (Chal and Pourquié, muscles upon injury. Most SC originate from PAX7+ myogenic 2017; Gros et al., 2005; Hutcheson et al., 2009; Kassar-Duchossoy precursors set aside during development. Although myogenesis has et al., 2005; Lepper and Fan, 2010; Relaix et al., 2005; Schienda et al., + been studied in mouse and chicken embryos, little is known about 2006). Pax3 myogenic precursors arise from the dorsal epithelial + human muscle development. Here, we report the generation of human compartment of the somite called the dermomyotome. Pax3 cells of induced pluripotent stem cell (iPSC) reporter lines in which fluorescent the dermomyotome lips activate Myf5, then downregulate Pax3 and proteins have been introduced into the PAX7 and MYOG loci. We use delaminate and differentiate into elongated post-mitotic myocytes single cell RNA sequencing to analyze the developmental trajectory of expressing myogenin (Myog) to form the first embryonic muscles + the iPSC-derived PAX7+ myogenic precursors. We show that the called myotomes (Chal and Pourquié, 2017). At the same time, Pax3 PAX7+ cells generated in culture can produce myofibers and self- myogenic precursors delaminate from the lateral edge of the renew in vitro and in vivo.
    [Show full text]