Cbln3, a Novel Member of the Precerebellin Family That Binds Specifically to Cbln1

The Journal of Neuroscience, September 1, 2000, 20(17):6333–6339 Cbln3, a Novel Member of the Precerebellin Family that Binds Specifically to Cbln1 Zhen Pang, Jian Zuo, and James I. Morgan Department of Developmental Neurobiology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105 Precerebellin (Cbln1) is the precursor of the brain-specific hexade- cal to Cbln1 and also contained a C1q signature domain and signal capeptide cerebellin. Although cerebellin has properties of a con- sequence for secretion. In addition to binding avidly to Cbln3, Cbln1 ventional neuropeptide, its function is controversial because Cbln1 also formed homomeric complexes. In contrast, Cbln3 homomeric has structural features characteristic of circulating atypical collag- association was weak. These interactions exhibited specificity be- ens. Cbln1 is related to the three subunits of the complement C1q cause C1qB bound to neither Cbln1 nor Cbln3. Like cbln1, cbln3 complex. Therefore, we hypothesized that Cbln1 participated in was expressed in the cerebellum and dorsal cochlear nucleus in analogous heteromeric complexes with precerebellin-related pro- which it was detected in granule neurons. Because Cbln1 and teins. Using LexA-Cbln1 as bait in a yeast two-hybrid screen, we Cbln3 are coexpressed in the brain and interact avidly, they may isolated a cDNA encoding a novel Cbln1-related protein, desig- function as a secreted heteromeric complex in vivo. nated Cbln3. The gene encoding cbln3 had the same intron–exon structure as cbln1 but mapped to a different mouse chromosome Key words: cerebellum; dorsal cochlear nucleus; granule cells; (14). The deduced amino acid sequence of Cbln3 was 55% identi- yeast two-hybrid; C1q signature domain; gene mapping Cerebellin is a brain-specific hexadecapeptide (Slemmon et al., complexes, we hypothesized that Cbln1 may be part of a protein 1984) that is structurally conserved from chicken to man (Slemmon complex that consisted of related polypeptides. Indeed, a protein et al., 1984; Morgan et al., 1988; Yiangou et al., 1989). This (Cbln2) similar to Cbln1 has been identified (Wada and Ohtani, neuropeptide is most abundant in the cerebellum and dorsal co- 1991; Kavety et al., 1994), indicating the existence of a precerebel- chlear nucleus (DCoN), although it can be detected in other brain lin gene family. However, the expression pattern of cbln2 is differ- regions at relatively low levels (Mugnaini and Morgan, 1987; Bur- ent from that of cbln1, implying that they could not participate in net et al., 1988; Morgan et al., 1988). Antibodies against cerebellin heteromeric complexes. For example, whereas cbln1 is expressed at specifically stain Purkinje cells in the cerebellum and cartwheel high levels in the adult cerebellum, cbln2 is nearly undetectable neurons in the DCoN (Slemmon et al., 1985; Mugnaini and Mor- (Wada and Ohtani, 1991). In contrast, cbln2 is expressed at rela- gan, 1987). Because neurons within the DCoN and cerebellum tively high levels in extracerebellar brain areas and in the fetal have similar lineages and the two brain regions have analogous nervous system, whereas cbln1 is either absent or only expressed at organization, we suggested that cerebellin functioned as a conven- very low levels (Urade et al., 1991; Wada and Ohtani, 1991). tional neuropeptide in these structures (Mugnaini and Morgan, Therefore, we hypothesized that additional Cbln1-related proteins 1987). Indeed, cerebellin is enriched in the synaptosomal fraction existed that bound to Cbln1. (Slemmon et al., 1984) and is released in a calcium-dependent Here we report the cloning of Cbln3, a third member of the manner after depolarization (Burnet et al., 1988). Furthermore, precerebellin family. This protein was isolated through its binding cerebellin can elicit norepinephrine secretion from the adrenal to LexA-Cbln1 in a yeast two-hybrid screen. Not only did Cbln3 gland (Mazzocchi et al., 1999; Albertin et al., 2000). However, the bind to Cbln1 but the two were also coexpressed at high levels in precise function of cerebellin is controversial. the cerebellum and DCoN. This casts doubt on the role of cerebel- Like many neuropeptides, cerebellin is derived from a precursor, lin as a classical neuropeptide modulator. Rather, these findings named precerebellin or Cbln1 (Urade et al., 1991). Although suggest that the precerebellins are secreted proteins that function precerebellin has no collagen motif, the C-terminal two-thirds of as heteromeric complexes. the protein shows significant structural similarity to the globular (noncollagen) domains of several atypical collagens, including the MATERIALS AND METHODS complement C1q subunits (Urade et al., 1991). Such proteins are Yeast two-hybrid cDNA library screening and analysis of protein–protein not typically thought to undergo selective processing to yield neu- interactions. A mouse cerebellar cDNA library (Kurschner and Morgan, roactive peptides. Rather, the globular domains of the atypical 1995) was constructed in the yeast Escherichia coli shuttle vector pSD10a collagens are important for the appropriate alignment of three that carries the yeast URA3 gene as selectable marker (Dalton and Treisman, 1992). This permits the production of cDNA-encoded proteins polypeptide subunits that permits the subsequent formation of the as fusions to the transactivation domain of the VP16 protein of the Herpes collagen triple helix (Brass et al., 1991). Because most of the C1q simplex virus. A LexA-Cbln1 fusion protein was used as bait to screen the signature domain proteins exist as homomeric or heteromeric cerebellar VP16 fusion library in yeast. Because the signal peptide is likely processed from Cbln1 to yield the mature protein, the first 10 amino acids of precerebellin were deleted. This truncated cDNA was cloned into the Received April 14, 2000; revised June 6, 2000; accepted June 9, 2000. Y.LexA vector that carries the yeast TRP1 gene as a selectable marker (a This work was supported in part by National Institutes of Health Cancer Center gift from Dr. Steven Dalton, University of Adelaide, Adelaide, Australia). CORE Grant P30 CA21765 and the American Lebanese Syrian Associated Charities. The expression of LexA-Cbln1 and the VP16 fusions was under the We thank Dr. Connie Kurschner for the cerebellar cDNA library, Dr. Balaji Kavety control of a GAL10-CYC1 hybrid promoter, which rendered expression for the LexA-cbln1 construct, Nichola Wigle, Karen Forbes, and Jason Treadaway for galactose-inducible and glucose-repressible. technical support, and Carol Jacks for assistance in manuscript preparation. Ϫ TheϪ budding yeast Saccharomyces cerevisiae strain S260 (URA3 Correspondence should be addressed to Dr. James I. Morgan, Department of TRP1 ), which contains a genomic lexA-operator-lacZ reporter gene Developmental Neurobiology, St. Jude Children’s Research Hospital, 332 North integrated into the URA3 locus (Kurschner and Morgan, 1996), was first Lauderdale Street, Memphis, TN 38105. E-mail: [email protected]. transformed with the lexA-cbln1 construct. Transformants that survived on Dr. Pang’s present address: Merck & Co., Inc., Metabolic Disorders, MRL, P.O. Box tryptophan-deficient medium were then transformed with the plasmid 2000, R80T-150, Rahway, NJ 07065. library DNA, plated onto Hybond-N filters (AmershamϪ Ϫ Pharmacia Bio- Copyright © 2000 Society for Neuroscience 0270-6474/00/206333-07$15.00/0 tech, Arlington Heights, IL), and selected on Trp Ura plates. Filters 6334 J. Neurosci., September 1, 2000, 20(17):6333–6339 Pang et al.•A Novel Gene in the Precerebellin Family with cotransformed colonies were transferred to galactose medium to intron 1 of cbln3. The 3Ј probe, amplified with GSP4 (CTTCCCACTCT- induce the expression of the fusion proteins. LacZ-positive colonies were GAGGACCCAAG) and GSP5 (CCAAATAGCGCTGAGCAGGAAG), identified in a ␤-galactosidase assay in which 5-bromo-4-chloro-3-indolyl- is in the 3Ј untranslated region of cbln3. Hybridization was performed in ␤-D-galactopyranosidase was used as substrate (Breeden and Nasmyth, QuikHyb (Stratagene). After a high-stringency wash at 60°C in a solution 1985; Dalton and Treisman, 1992). Positive colonies were streaked out, and containing 0.2ϫ SSC and 0.1% SDS, the membrane was exposed to Kodak the activation of the reporter gene was confirmed. Plasmids were rescued X-OMAT AR film. A 5.5 kb EcoRI fragment encompassing the cbln3 by transforming ElectroMax E. coli competent cells (Life Technologies, coding sequence was identified on the Southern blots and cloned into Gaithersburg, MD) with total yeast DNA extracts. Protein interaction was pBluescript KS. Sequence analysis was conducted after subcloning and, further confirmed by cotransformation of the yeast with purified plasmid sometimes, using gene-specific oligonucleotide as primers. Sequence data DNA. The cDNA inserts were sequenced using automated DNA was deposited in GenBank (accession number AF218380). sequencing. Gene mapping. The Jackson Laboratory (Bar Harbor, ME) interspecific DNA sequencing. Sequencing reactions were performed by the Center backcross panel (C57BL/6JEi ϫ SPRET/Ei)F1 ϫ SPRET/Ei called Jack- for Biotechnology at St. Jude Children’s Research Hospital on template son BSS (Rowe et al., 1994) was used to determine the chromosomal DNA using dye-terminator cycle sequencing-ready reaction kits with Am- localization of cbln3 in the mouse. Two PCR primers were chosen to pliTag DNA polymerase FS (Perkin-Elmer/Applied Biosystems, Inc., Fos- amplify a 200 bp genomic DNA that showed

Load more