DOCSLIB.ORG

Mouse Nprl2 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Nprl2 Conditional Knockout Project (CRISPR/Cas9) http://beta.alphaknockout.cyagen.net Mouse Nprl2 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Nprl2 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Nprl2 gene (NCBI Reference Sequence: NM_018879 ; Ensembl: ENSMUSG00000010057 ) is located on Mouse chromosome 9. 11 exons are identified , with the ATG start codon in exon 1 and the TGA stop codon in exon 11 (Transcript: ENSMUST00000010201). Exon 5~11 will be selected as conditional knockout region (cKO region). The second loxP will be inserted downstream of the TGA stop codon. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-95A11 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knock-out allele exhibit reduced embryo size, microphthalmia, occaional anophthalmia, pale liver, reduced fetal liver hematopoiesis, impaired erythropoiesis and reduced methionine synthesis. Exon 5~11 is not frameshift exon, and covers 60.7% of the coding region. The size of intron 4 for 5'-loxP site insertion: 535 bp. The size of effective cKO region: ~1690 bp. The function of mouse Cyb561d2 and Zmynd10 may be affected by deleting this cKO region Page 1 of 8 http://beta.alphaknockout.cyagen.net Overview of the Targeting Strategy gRNA region Wildtype allele T gRNA region G 5' A 3' 1 1 2 3 4 5 6 7 8 9 10 11 1 2 Targeting vector T G A Targeted allele T G A Constitutive KO allele (After Cre recombination) Legends Exon of mouse Cyb561d2 Homology arm Exon of mouse Nprl2 cKO region Exon of mouse Zmynd10 loxP site Page 2 of 8 http://beta.alphaknockout.cyagen.net Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(8056bp) | A(24.57% 1979) | C(25.26% 2035) | G(28.45% 2292) | T(21.72% 1750) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 http://beta.alphaknockout.cyagen.net BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr9 + 107540902 107543901 3000 browser details YourSeq 35 2957 3000 3000 80.0% chr15 + 78862736 78862775 40 browser details YourSeq 32 2968 3000 3000 100.0% chr7 - 79670356 79670389 34 browser details YourSeq 32 76 305 3000 97.1% chr1 - 21241044 21241476 433 browser details YourSeq 30 2969 3000 3000 96.9% chr17 - 6891256 6891287 32 browser details YourSeq 29 2972 3000 3000 100.0% chr7 + 44388945 44388973 29 browser details YourSeq 28 2973 3000 3000 100.0% chr8 + 122563433 122563460 28 browser details YourSeq 28 2947 3000 3000 96.7% chr2 + 112452186 112452240 55 browser details YourSeq 27 2583 2622 3000 88.6% chr5 - 53364061 53364104 44 browser details YourSeq 27 2974 3000 3000 100.0% chr10 + 60248056 60248082 27 browser details YourSeq 26 2216 2246 3000 82.8% chr4 - 22479363 22479391 29 browser details YourSeq 23 957 979 3000 100.0% chr2 - 145935031 145935053 23 browser details YourSeq 23 2978 3000 3000 100.0% chr1 - 16154214 16154236 23 browser details YourSeq 23 2168 2190 3000 100.0% chr3 + 110311385 110311407 23 browser details YourSeq 22 2058 2079 3000 100.0% chr7 + 82585146 82585167 22 browser details YourSeq 21 2216 2236 3000 100.0% chr11 - 87490071 87490091 21 browser details YourSeq 21 2216 2236 3000 100.0% chr11 - 77755891 77755911 21 Note: The 3000 bp section upstream of Exon 5 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr9 + 107545708 107548707 3000 browser details YourSeq 95 116 290 3000 82.3% chr10 + 40996463 40996634 172 browser details YourSeq 88 171 318 3000 85.6% chr7 - 101803778 101803926 149 browser details YourSeq 88 115 298 3000 81.3% chr11 - 119389308 119389468 161 browser details YourSeq 85 114 291 3000 86.0% chr1 - 10747475 10747651 177 browser details YourSeq 83 115 291 3000 81.2% chr3 - 138888516 138888662 147 browser details YourSeq 80 195 365 3000 88.6% chr11 + 100299757 100300106 350 browser details YourSeq 79 171 291 3000 88.5% chrX + 12841761 12841881 121 browser details YourSeq 78 129 293 3000 81.1% chr13 - 55731164 55731301 138 browser details YourSeq 78 171 299 3000 81.5% chr12 - 71103258 71103386 129 browser details YourSeq 76 171 291 3000 86.8% chr14 - 39793487 39793607 121 browser details YourSeq 74 115 290 3000 81.0% chr12 - 83669922 83670053 132 browser details YourSeq 74 130 291 3000 90.6% chr10 - 63242386 63242553 168 browser details YourSeq 71 186 363 3000 77.3% chr10 + 80885356 80885473 118 browser details YourSeq 70 177 315 3000 81.8% chr12 + 4657690 4657826 137 browser details YourSeq 69 195 293 3000 93.9% chr13 - 98281750 98281848 99 browser details YourSeq 68 195 293 3000 91.6% chr12 - 43474998 43475096 99 browser details YourSeq 68 197 291 3000 93.7% chr8 + 85103786 85103880 95 browser details YourSeq 67 195 299 3000 89.5% chr12 + 89409575 89409679 105 browser details YourSeq 67 186 292 3000 88.3% chr10 + 59538000 59538105 106 Note: The 3000 bp section downstream of Exon 11 is BLAT searched against the genome. No significant similarity is found. Page 4 of 8 http://beta.alphaknockout.cyagen.net Gene and protein information: Nprl2 NPR2 like, GATOR1 complex subunit [ Mus musculus (house mouse) ] Gene ID: 56032, updated on 12-Aug-2019 Gene summary Official Symbol Nprl2 provided by MGI Official Full Name NPR2 like, GATOR1 complex subunit provided by MGI Primary source MGI:MGI:1914482 See related Ensembl:ENSMUSG00000010057 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as G21; NPR2L; Tusc4; 2810446G01Rik Expression Ubiquitous expression in CNS E18 (RPKM 22.0), whole brain E14.5 (RPKM 21.6) and 28 other tissues See more Orthologs human all Genomic context Location: 9; 9 F1 See Nprl2 in Genome Data Viewer Exon count: 11 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 9 NC_000075.6 (107542177..107545706) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 9 NC_000075.5 (107444540..107448037) Chromosome 9 - NC_000075.6 Page 5 of 8 http://beta.alphaknockout.cyagen.net Transcript information: This gene has 5 transcripts Gene: Nprl2 ENSMUSG00000010057 Description NPR2 like, GATOR1 complex subunit [Source:MGI Symbol;Acc:MGI:1914482] Gene Synonyms 2810446G01Rik, G21, NPR2L, NPRL2, Tusc4 Location Chromosome 9: 107,542,226-107,545,706 forward strand. GRCm38:CM001002.2 About this gene This gene has 5 transcripts (splice variants), 203 orthologues, is a member of 1 Ensembl protein family and is associated with 9 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Nprl2- ENSMUST00000010201.8 1441 380aa ENSMUSP00000010201.3 Protein coding CCDS23492 Q9WUE4 TSL:1 201 GENCODE basic APPRIS P1 Nprl2- ENSMUST00000195370.5 829 163aa ENSMUSP00000141746.1 Nonsense mediated - A0A0A6YWX8 TSL:3 205 decay Nprl2- ENSMUST00000193628.5 1736 No - Retained intron - - TSL:2 203 protein Nprl2- ENSMUST00000194848.1 637 No - Retained intron - - TSL:2 204 protein Nprl2- ENSMUST00000192951.1 391 No - Retained intron - - TSL:3 202 protein Page 6 of 8 http://beta.alphaknockout.cyagen.net 23.48 kb Forward strand 107.535Mb 107.540Mb 107.545Mb 107.550Mb 107.555Mb Genes (Comprehensive set... Tmem115-201 >protein coding Nprl2-201 >protein coding Zmynd10-201 >protein coding Rassf1-210 >processed transcript Nprl2-205 >nonsense mediated decay Zmynd10-205 >processed transcript Rassf1-201 >protein coding Nprl2-203 >retained intron Zmynd10-203 >nonsense mediated decay Nprl2-204 >retained intron Zmynd10-204 >retained intron Nprl2-202 >retained intron Zmynd10-202 >retained intron Rassf1-209 >nonsense mediated decay Rassf1-202 >protein coding Rassf1-205 >retained intron Rassf1-204 >protein coding Contigs AL672219.7 > Genes < Cyb561d2-201protein coding < Gm34106-201antisense (Comprehensive set... < Cyb561d2-205protein coding < Cyb561d2-202protein coding < Cyb561d2-203processed transcript < Cyb561d2-204nonsense mediated decay Regulatory Build 107.535Mb 107.540Mb 107.545Mb 107.550Mb 107.555Mb Reverse strand 23.48 kb Regulation Legend CTCF Promoter Promoter Flank Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding processed transcript Page 7 of 8 http://beta.alphaknockout.cyagen.net Transcript: ENSMUST00000010201 3.48 kb Forward strand Nprl2-201 >protein coding ENSMUSP00000010... Pfam Nitrogen permease regulator 2 PANTHER Nitrogen permease regulator 2 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant splice region variant synonymous variant Scale bar 0 40 80 120 160 200 240 280 320 380 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC, VectorBuilder. Page 8 of 8.
Load more

Recommended publications
  • Mutational Inactivation of Mtorc1 Repressor Gene DEPDC5 in Human Gastrointestinal Stromal Tumors
    Mutational inactivation of mTORC1 repressor gene DEPDC5 in human gastrointestinal stromal tumors Yuzhi Panga,1, Feifei Xiea,1, Hui Caob,1, Chunmeng Wangc,d,1, Meijun Zhue, Xiaoxiao Liua, Xiaojing Lua, Tao Huangf, Yanying Sheng,KeLia, Xiaona Jiaa, Zhang Lia, Xufen Zhenga, Simin Wanga,YiHeh, Linhui Wangi, Jonathan A. Fletchere,2, and Yuexiang Wanga,2 aKey Laboratory of Tissue Microenvironment and Tumor, Shanghai Institutes for Biological Sciences–Changzheng Hospital Joint Center for Translational Medicine, Changzheng Hospital, Institutes for Translational Medicine, Chinese Academy of Sciences–Second Military Medical University, Shanghai Institute of Nutrition and Health, Shanghai Institutes for Biological Sciences, University of Chinese Academy of Sciences, Chinese Academy of Sciences, 200031 Shanghai, China; bDepartment of Gastrointestinal Surgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, 200127 Shanghai, China; cDepartment of Bone and Soft Tissue Sarcomas, Fudan University Shanghai Cancer Center, 200032 Shanghai, China; dDepartment of Oncology, Shanghai Medical College, Fudan University, 200032 Shanghai, China; eDepartment of Pathology, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; fShanghai Information Center for Life Sciences, Shanghai Institute of Nutrition and Health, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 200031 Shanghai, China; gDepartment of Pathology, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, 200127 Shanghai, China;
    [Show full text]
  • Discovery of Novel Putative Tumor Suppressors from CRISPR Screens Reveals Rewired 2 Lipid Metabolism in AML Cells 3 4 W
    bioRxiv preprint doi: https://doi.org/10.1101/2020.10.08.332023; this version posted August 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Discovery of novel putative tumor suppressors from CRISPR screens reveals rewired 2 lipid metabolism in AML cells 3 4 W. Frank Lenoir1,2, Micaela Morgado2, Peter C DeWeirdt3, Megan McLaughlin1,2, Audrey L 5 Griffith3, Annabel K Sangree3, Marissa N Feeley3, Nazanin Esmaeili Anvar1,2, Eiru Kim2, Lori L 6 Bertolet2, Medina Colic1,2, Merve Dede1,2, John G Doench3, Traver Hart2,4,* 7 8 9 1 - The University of Texas MD Anderson Cancer Center UTHealth Graduate School of 10 Biomedical Sciences; The University of Texas MD Anderson Cancer Center, Houston, TX 11 12 2 - Department of Bioinformatics and Computational Biology, The University of Texas MD 13 Anderson Cancer Center, Houston, TX, USA 14 15 3 - Genetic Perturbation Platform, Broad Institute of MIT and Harvard, Cambridge, MA, USA 16 17 4 - Department of Cancer Biology, The University of Texas MD Anderson Cancer Center, 18 Houston, TX, USA 19 20 21 22 23 * - Corresponding author: [email protected] 24 25 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.08.332023; this version posted August 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Biology of Human Tumors Research Mir-409-3P/-5P Promotes Tumorigenesis, Epithelial-To-Mesenchymal Transition, and Bone Metastasis of Human Prostate Cancer
    Published OnlineFirst June 24, 2014; DOI: 10.1158/1078-0432.CCR-14-0305 Clinical Cancer Biology of Human Tumors Research miR-409-3p/-5p Promotes Tumorigenesis, Epithelial-to-Mesenchymal Transition, and Bone Metastasis of Human Prostate Cancer Sajni Josson1, Murali Gururajan1, Peizhen Hu1, Chen Shao1, Gina Chia-Yi Chu1, Haiyen E. Zhau1, Chunyan Liu1, Kaiqin Lao2, Chia-Lun Lu1, Yi-Tsung Lu1, Jake Lichterman1, Srinivas Nandana1, Quanlin Li3, Andre Rogatko3, Dror Berel3, Edwin M. Posadas1, Ladan Fazli4, Dhruv Sareen5, and Leland W.K. Chung1 Abstract Purpose: miR-409-3p/-5p is a miRNA expressed by embryonic stem cells, and its role in cancer biology and metastasis is unknown. Our pilot studies demonstrated elevated miR-409-3p/-5p expression in humanprostatecancerbonemetastaticcelllines; therefore, we defined the biologic impact of manipulation of miR-409-3p/-5p on prostate cancer progression and correlated the levels of its expression with clinical human prostate cancer bone metastatic specimens. Experimental Design: miRNA profiling of a prostate cancer bone metastatic epithelial-to-mesenchymal transition (EMT) cell line model was performed. A Gleason score human tissue array was probed for validation of specific miRNAs. In addition, genetic manipulation of miR-409-3p/-5p was performed to determine its role in tumor growth, EMT, and bone metastasis in mouse models. Results: Elevated expression of miR-409-3p/-5p was observed in bone metastatic prostate cancer cell lines and human prostate cancer tissues with higher Gleason scores. Elevated miR-409-3p expression levels correlated with progression-free survival of patients with prostate cancer. Orthotopic delivery of miR-409- 3p/-5p in the murine prostate gland induced tumors where the tumors expressed EMT and stemness markers.
    [Show full text]
  • Gene Ontology Functional Annotations and Pleiotropy
    Network based analysis of genetic disease associations Sarah Gilman Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2013 Sarah Gilman All Rights Reserved ABSTRACT Network based analysis of genetic disease associations Sarah Gilman Despite extensive efforts and many promising early findings, genome-wide association studies have explained only a small fraction of the genetic factors contributing to common human diseases. There are many theories about where this “missing heritability” might lie, but increasingly the prevailing view is that common variants, the target of GWAS, are not solely responsible for susceptibility to common diseases and a substantial portion of human disease risk will be found among rare variants. Relatively new, such variants have not been subject to purifying selection, and therefore may be particularly pertinent for neuropsychiatric disorders and other diseases with greatly reduced fecundity. Recently, several researchers have made great progress towards uncovering the genetics behind autism and schizophrenia. By sequencing families, they have found hundreds of de novo variants occurring only in affected individuals, both large structural copy number variants and single nucleotide variants. Despite studying large cohorts there has been little recurrence among the genes implicated suggesting that many hundreds of genes may underlie these complex phenotypes. The question
    [Show full text]
  • Functional Characterization of the Candidate Tumor Suppressor Gene NPRL2/G21 Located in 3P21.3C
    [CANCER RESEARCH 64, 6438–6443, September 15, 2004] Functional Characterization of the Candidate Tumor Suppressor Gene NPRL2/G21 Located in 3p21.3C Jingfeng Li,1 Fuli Wang,1 Klas Haraldson,1 Alexey Protopopov,1 Fuh-Mei Duh,2,3 Laura Geil,2,3 Igor Kuzmin,2,3 John D. Minna,4 Eric Stanbridge,5 Eleonora Braga,6 Vladimir I. Kashuba,1,7 George Klein,1 Michael I. Lerman,2 and Eugene R. Zabarovsky1,8 1Microbiology and Tumor Biology Center, Center for Genomics and Bioinformatics, Karolinska Institute, Stockholm, Sweden; 2Cancer-Causing Genes Section, Laboratory of Immunobiology, Center for Cancer Research, National Cancer Institute, Frederick, Maryland; 3Basic Research Program, SAIC-Frederick, Inc., Frederick, Maryland; 4Hamon Center for Therapeutic Oncology, Research, University of Texas Southwestern Medical Center, Dallas, Texas; 5Department of Microbiology and Molecular Genetics, College of Medicine, University of California at Irvine, Irvine, California; 6Russian State Genetics Center, Moscow, Russia; 7Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kiev, Ukraine; and 8Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, Russia ABSTRACT accompanied by chromosome 3p homozygous deletions, is a charac- teristic feature of most major epithelial carcinomas, such as lung, Initial analysis identified the NPRL2/G21 gene located in 3p21.3C, the breast, cervical, oral cavity, ovary, and kidney (2, 3). These changes lung cancer region, as a strong candidate tumor suppressor gene. Here we indicate the involvement of multiple tumor suppressor genes. provide additional evidence of the tumor suppressor function of NPRL2/ G21. The gene has highly conserved homologs/orthologs ranging from We have performed a comprehensive deletion survey of 3p on more yeast to humans.
    [Show full text]
  • Concordance of Copy Number Loss and Down-Regulation of Tumor Suppressor Genes: a Pan-Cancer Study Min Zhao1 and Zhongming Zhao2,3,4,5*
    The Author(s) BMC Genomics 2016, 17(Suppl 7):532 DOI 10.1186/s12864-016-2904-y RESEARCH Open Access Concordance of copy number loss and down-regulation of tumor suppressor genes: a pan-cancer study Min Zhao1 and Zhongming Zhao2,3,4,5* From The International Conference on Intelligent Biology and Medicine (ICIBM) 2015 Indianapolis, IN, USA. 13-15 November 2015 Abstract Background: Tumor suppressor genes (TSGs) encode the guardian molecules to control cell growth. The genomic alteration of TSGs may cause tumorigenesis and promote cancer progression. So far, investigators have mainly studied the functional effects of somatic single nucleotide variants in TSGs. Copy number variation (CNV) is another important form of genetic variation, and is often involved in cancer biology and drug treatment, but studies of CNV in TSGs are less represented in literature. In addition, there is a lack of a combinatory analysis of gene expression and CNV in this important gene set. Such a study may provide more insights into the relationship between gene dosage and tumorigenesis. To meet this demand, we performed a systematic analysis of CNVs and gene expression in TSGs to provide a systematic view of CNV and gene expression change in TSGs in pan-cancer. Results: We identified 1170 TSGs with copy number gain or loss in 5846 tumor samples. Among them, 207 TSGs tended to have copy number loss (CNL), from which fifteen CNL hotspot regions were identified. The functional enrichment analysis revealed that the 207 TSGs were enriched in cancer-related pathways such as P53 signaling pathway and the P53 interactome.
    [Show full text]
  • Functional Genetic Analysis Request Form
    Functional Genetic Analysis Request Form Please complete the form as far as possible. Completed forms can be faxed to 31-10-7043200, or sent as an encrypted PDF to the following email address: [email protected] For questions or further information, please contact [email protected]; [email protected]; [email protected] Patient information: Surname: First (given) name / initials: Date of birth (dd-mm-yyyy): Address: Medical insurance policy number: Material (where applicable); Blood: Fibroblasts: Other (please specify): please mark as appropriate Date sample was taken (if applicable): Gene variant information (HGVS nomenclature): Gene Name Reference transcript accession Nucleotide change (predicted protein variant) number Sender information Name: Email: Department (if applicable): Institute: Address: City: Country: version: 3 22-10-2018 Pag. 1/2 Functional Genetic Analysis Request Form Type of analysis requested: Diagnostic testing of a variant of uncertain clinical significance (VUS) Direct functional assay in patient material (eg. blood, fibroblasts, other) Functional test requested (please specify): Ciliopathies (fibroblasts required) Structural test, tubulin staining for cilia size and number Hedgehog signaling test DNA-repair defects (fibroblasts required) Xeroderma pigmentosum (XP) Ataxia telangiectasia (AT) Cockayne syndrome(CS) Nijmegen Breakage syndrome (NBS) Trichothiodystrophy (TTD) Mechanistic target of rapamycin (mTOR) signaling pathway (TSC1, TSC2, DEPDC5, NPRL2, NPRL3, AKT1, AKT3, TBC1D7)
    [Show full text]
  • SEA You Later Alli-GATOR – a Dynamic Regulator of the TORC1 Stress Response Pathway Svetlana Dokudovskaya1,* and Michael P
    © 2015. Published by The Company of Biologists Ltd | Journal of Cell Science (2015) 128, 2219-2228 doi:10.1242/jcs.168922 COMMENTARY SEA you later alli-GATOR – a dynamic regulator of the TORC1 stress response pathway Svetlana Dokudovskaya1,* and Michael P. Rout2 ABSTRACT equivalent of the vacuole) (Betz and Hall, 2013). Vacuoles and Cells constantly adapt to various environmental changes and lysosomes are the storage and recycling depots of the cell. Among their stresses. The way in which nutrient and stress levels in a cell feed many roles, they mediate protein degradation, store amino acids, and back to control metabolism and growth are, unsurprisingly, extremely sequester small ions and polyphosphates (Li and Kane, 2009; Luzio – complex, as responding with great sensitivity and speed to the ‘feast et al., 2007). These organelles are also key players in autophagy a or famine, slack or stress’ status of its environment is a central goal for process in which cytosol and organelles are sequestered within double- any organism. The highly conserved target of rapamycin complex 1 membraned vesicles, which deliver their contents to the vacuole or (TORC1) controls eukaryotic cell growth and response to a variety of lysosomefordegradationorrecycling (Yang and Klionsky, 2009). The signals, including nutrients, hormones and stresses, and plays the lysosome also plays an active role in amino acid sensing through its + key role in the regulation of autophagy. A lot of attention has been paid proton pump, the vacuolar type H -ATPase (v-ATPase) (Zoncu et al., recently to the factors in this pathway functioning upstream of TORC1. 2011), and it is likely that the vacuole plays a similar role.
    [Show full text]
  • Nprl2 (NM 018879) Mouse Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR205929 Nprl2 (NM_018879) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Nprl2 (NM_018879) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Nprl2 Synonyms: 2810446G01Rik; G21; NPR2L; Tusc4 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR205929 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCAGCAGCTGCCGCATCGAATGTATATTCTTCAGCGAGTTCCACCCAACGCTGGGACCCAAAATTA CCTATCAGGTCCCTGAGGATTTCATCTCGCGAGAACTGTTTGACACGGTCCAGGTGTACATCATCACCAA GCCCGAGTTACAGAACAAGCTCATCACTGTCACAGCCATGGAGAAGAAGCTGATTGGCTGCCCCGTGTGC ATTGAACACAAGAAGTACAGCCGCAATGCTCTCCTCTTCAACCTGGGCTTTGTGTGTGACGCTCAGGCTA AGACTTGTGCCCTGGAACCCATCGTTAAAAAGCTGGCCGGCTACTTGACCACGCTGGAGCTTGAGAGCAG CTTTGTATCCAACGAGGAGAGCAAGCAGAAGCTGGTGCCCATCATGACCATCCTGCTGGAAGAGCTGAAT GCCTCCGGCCGCTGCACTCTGCCCATTGACGAATCCAACACCATCCACTTGAAGGTGATCGAGCAGCGGC CAGACCCTCCTGTTGCGCAGGAGTATGATGTGCCCGTCTTTACAAAGGACAAGGAGGATTTCTTCAGCTC GCAGTGGGACCTTACCACACAGCAGATCCTGCCCTACATTGACGGGTTTCGCCATGTCCAGAAGATCTCC GCTGAGGCAGACGTGGAACTCAACCTGGTGCGCATCGCCATTCAGAACCTGCTGTACTATGGTGTTGTGA CACTGGTATCCATCCTCCAGTACTCCAATGTGTATTGCCCAACACCAAAAGTCCAGGATCTGGTGGATGA CAAGTCCCTGCAGGAGGCATGTCTGTCCTACGTCACCAAGCAAGGACACAAAAGGGCCAGTCTCCGAGAT GTGTTCCAGCTATACTGCAGCCTGAGCCCTGGTACCACTGTGCGAGACCTCATCGGCCGCCACCCCCAGC
    [Show full text]
  • Hdl 124036.Pdf
    Neurobiology of Disease 134 (2020) 104640 Contents lists available at ScienceDirect Neurobiology of Disease journal homepage: www.elsevier.com/locate/ynbdi Functional screening of GATOR1 complex variants reveals a role for mTORC1 deregulation in FCD and focal epilepsy T Ruby E. Dawsona,c, Alvaro F. Nieto Guilb,c, Louise J. Robertsonb,c, Sandra G. Piltzb,c, ⁎ James N. Hughesa,c, Paul Q. Thomasb,c,d, a School of Biological Sciences, University of Adelaide, Adelaide, SA 5005, Australia b School of Medicine, University of Adelaide, Adelaide, SA 5005, Australia c Robinson Research Institute, University of Adelaide, Adelaide, SA 5005, Australia d Precision Medicine Theme, South Australia Health and Medical Research Institute, Adelaide, SA 5000, Australia ARTICLE INFO ABSTRACT Keywords: Mutations in the GAP activity toward RAGs 1 (GATOR1) complex genes (DEPDC5, NPRL2 and NPRL3) have been Neurodevelopment associated with focal epilepsy and focal cortical dysplasia (FCD). GATOR1 functions as an inhibitor of the Epilepsy mTORC1 signalling pathway, indicating that the downstream effects of mTORC1 deregulation underpin the Focal cortical dysplasia disease. However, the vast majority of putative disease-causing variants have not been functionally assessed for Molecular genetics mTORC1 repression activity. Here, we develop a novel in vitro functional assay that enables rapid assessment of Functional testing GATOR1-gene variants. Surprisingly, of the 17 variants tested, we show that only six showed significantly im- Developmental genetics CRISPR/CAS9 paired mTORC1 inhibition. To further investigate variant function in vivo, we generated a conditional Depdc5 Disease model mouse which modelled a ‘second-hit’ mechanism of disease. Generation of Depdc5 null ‘clones’ in the embryonic Mouse model brain resulted in mTORC1 hyperactivity and modelled epilepsy and FCD symptoms including large dysmorphic mTOR neurons, defective migration and lower seizure thresholds.
    [Show full text]
  • Nprl2/Tusc4 Functions As a Tumor Suppressor by Regulating Brca1's
    Texas Medical Center Library DigitalCommons@TMC UT GSBS Dissertations and Theses (Open Access) Graduate School of Biomedical Sciences 12-2014 NPRL2/TUSC4 FUNCTIONS AS A TUMOR SUPPRESSOR BY REGULATING BRCA1’S STABILITY VIA THE E3 UBIQUITINATION PATHWAY Yang Peng Follow this and additional works at: http://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Medical Cell Biology Commons Recommended Citation Peng, Yang, "NPRL2/TUSC4 FUNCTIONS AS A TUMOR SUPPRESSOR BY REGULATING BRCA1’S STABILITY VIA THE E3 UBIQUITINATION PATHWAY" (2014). UT GSBS Dissertations and Theses (Open Access). 536. http://digitalcommons.library.tmc.edu/utgsbs_dissertations/536 This Dissertation (PhD) is brought to you for free and open access by the Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in UT GSBS Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. NPRL2/TUSC4 FUNCTIONS AS A TUMOR SUPPRESSOR BY REGULATING BRCA1’S STABILITY VIA THE E3 UBIQUITINATION PATHWAY by YANG PENG, M.S. APPROVED: ______________________ Shiaw-Yih Lin, Ph.D. Supervisory Professor ______________________ Ju-Seog Lee, Ph.D. ______________________ Jessica Tyler, Ph.D. ______________________ Hui-Kuan Lin, Ph.D. ______________________ Chun Li, Ph.D. APPROVED: ______________________ Dean, The University of Texas Graduate School of Biomedical Sciences i NPRL2/TUSC4 FUNCTIONS AS A TUMOR SUPPRESSOR BY REGULATING BRCA1’S STABILITY VIA THE E3 UBIQUITINATION PATHWAY A DISSERTATION Presented to the Faculty of The University of Texas Health Science Center at Houston and The University of Texas MD Anderson Cancer Center Graduate School of Biomedical Sciences in Partial Fulfillment of the Requirements for the degree of DOCTOR OF PHILOSOPHY by Yang Peng, M.S.
    [Show full text]
  • Chromosome 3P and Breast Cancer
    B.J Hum Jochimsen Genet et(2002) al.: Stetteria 47:453–459 hydrogenophila © Jpn Soc Hum Genet and Springer-Verlag4600/453 2002 MINIREVIEW Qifeng Yang · Goro Yoshimura · Ichiro Mori Takeo Sakurai · Kennichi Kakudo Chromosome 3p and breast cancer Received: April 30, 2002 / Accepted: May 27, 2002 Abstract Solid tumors in humans are now believed to are now believed to develop through a multistep process develop through a multistep process that activates that activates oncogenes and inactivates tumor suppressor oncogenes and inactivates tumor suppressor genes. Loss of genes (Lopez-Otin and Diamandis 1998). Inactivation of a heterozygosity at chromosomes 3p25, 3p22–24, 3p21.3, tumor suppressor gene (TSG) often involves mutation of 3p21.2–21.3, 3p14.2, 3p14.3, and 3p12 has been reported in one allele and loss or replacement of a chromosomal seg- breast cancers. Retinoid acid receptor 2 (3p24), thyroid ment containing another allele. Loss of heterozygosity hormone receptor 1 (3p24.3), Ras association domain fam- (LOH) has been found on chromosomes 1p, 1q, 3p, 6q, 7p, ily 1A (3p21.3), and the fragile histidine triad gene (3p14.2) 11q, 13q, 16q, 17p, 17q, 18p, 18q, and 22q in breast cancer have been considered as tumor suppressor genes (TSGs) for (Smith et al. 1993; Callahan et al. 1992; Sato et al. 1990; breast cancers. Epigenetic change may play an important Hirano et al. 2001a); the commonly deleted regions include role for the inactivation of these TSGs. Screens for pro- 3p, 6q, 7p, 11q, 16q, and 17p (Smith et al. 1993; Hirano et al. moter hypermethylation may be able to identify other TSGs 2001a).
    [Show full text]