THE ROLE OF HYPOXIA IN MODULATING GLIOMA CELL TUMORIGENIC POTENTIAL
BY
JOHN MICHAEL HEDDLESTON
Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy
Dissertation Advisor: Jeremy N. Rich, M.D., M.H.Sc.
Program in Cell Biology
CASE WESTERN RESERVE UNIVERSITY
August, 2011
CASE WESTERN RESERVE UNIVERSITY
SCHOOL OF GRADUATE STUDIES
We hereby approve the thesis/dissertation of
John Michael Heddleston ______
Doctor of Philosophy candidate for the ______degree *.
Danny Manor (signed)______(chair of the committee)
Jeremy N. Rich ______
George R. Stark ______
Erik Andrulis ______
______
______
June 17, 2011 (date) ______
*We also certify that written approval has been obtained for any proprietary material contained therein.
Dedications
I would like to dedicate this dissertation to wife and family.
Katie, without your constant love and support, I would have not been able to
accomplish all that I have. Your gentle words of encouragement and
sympathetic ear has kept me sane and able to push on, even when I didn’t think I
could.
To my parents, Mike and Gi, and my sister, Sara, you have helped shaped the person I am today. I owe everything to your love and guidance. As I move forward in my career, I hope I can achieve great things that make you proud.
All my love,
John
Table of Contents
Chapter 1.1: Introduction ...... 1
1.2: Identification of Glioma Stem Cells ...... 4
1.3: Functional Characteristics of GSCs ...... 5
1.4: Other Characteristics of GSCs ...... 8
1.5: Immunophenotypic Characteristics of GSCs ...... 12
1.6: CD133 as a Marker for GSCs ...... 14
1.7: Alternative Cell Surface Markers for GSCs ...... 17
1.8: Identification of GSCs Independent of Surface Markers ...... 19
1.9: GSC Regulators on the Cell Surface ...... 21
1.10: Intracellular GSC Regulators ...... 26
1.11: Perivascular Microenvironmental Regulation of GSCs ...... 30
1.12: Hypoxia in Glioma ...... 36
1.13: GSCs, Hypoxia, and HIF2α ...... 42
1.14: Epigenetics ...... 45
1.15: Induced Pluripotency ...... 48
1.16: Epigenetic Modifiers in Glioma ...... 49
1.17: Targeting GSCs via the Microenvironment ...... 53
Chapter 2.1: Hypoxia Promotes the GSC Phenotype Through HIF2α ...... 56
i 2.2: The Role of HIFs in GSC Self-Renewal and Tumor Growth ...... 60
2.3: Hypoxia Reprograms Towards a Stem Phenotype ...... 62
2.4: HIF2α Promotes a Glioma Stem Cell State ...... 68
2.5: Discussion ...... 72
2.6: Materials and Methods ...... 78
Chapter 3.1: The Hypoxia Response in Glioma Cells Requires Epigenetic Modifying Factor, MLL1 ...... 83
3.2: Hypoxia Increases Expression of MLL1 ...... 87
3.3: HIF1α and HIF2α are Necessary for MLL Induction ...... 89
3.4: MLL1 can be Efficiently Targeted with shRNA ...... 93
3.5: MLL1 is Required for HIF2α Expression ...... 95
3.6: MLL1 is Preferentially Expressed in GSCs ...... 101
3.7: Hypoxia Regulates MLL1 Expression in GSCs ...... 105
3.8: Targeting MLL1 Reduces VEGF in GSCs ...... 108
3.9: Loss of MLL1 Inhibits GSC Growth and Self-Renewal ...... 108
3.10: Inhibition of MLL1 Reduces GSC Tumorigenicity ...... 112
3.11: Discussion ...... 113
3.12: Materials and Methods ...... 118
Chapter 4.1: Discussion ...... 126
4.2: Glioma Cells and Phenotypic Plasticity ...... 129
ii 4.3: Epigenetics of Glioma Cells ...... 133
4.4: The Importance of MLL1 in HIF2α Signaling ...... 135
4.5: Future Directions ...... 139
Bibliography ...... 143
iii List of Figures
1: Microenvironmental factors modulate intrinsic pathways ...... 31
2: Hypoxia enchances neurosphere formation and proliferation ...... 64
3: Exposure to hypoxia increases stem gene transcripts ...... 67
4: Ectopic expression of nondegradeable HIF2α causes morphological and phenotype changes in nonstem glioma cells ...... 69
5: Overexpression of HIF2α in nonstem glioma cells increases tumorigenic capacity ...... 71
6: The role of hypoxia in the glioma stem cell hypothesis ...... 77
7: MLL1 is a hypoxia responsive gene in nonstem glioma cells ...... 88
8: HIF1α and HIF2α are required for the MLL1 hypoxia response ...... 91
9: MLL1 is hypoxia responsive but not a direct binding target of HIF2α ...... 92
10: MLL1 can be successfully targeted by shRNA ...... 94
11: Targeting MLL1 via shRNA inhibits expression of HIF2α, but not HIF1α ...... 96
12: Targeting MLL1 by shRNA inhibits downstream hypoxic response ...... 98
13: MLL1 knockdown inhibits HIF2α expression and the downstream hypoxic response ...... 99
14: MLL1 modulates HIF2A transcription by chromatin regulation ...... 100
15: MLL1 expression is elevated in GSCs compared to nonstem glioma cells ...... 102
16: GSCs form neurospheres expressing stem cell markers ...... 103
17: MLL1 co-localizes with GSC enrichment marker, CD133 ...... 104
18: MLL1 is regulated by hypoxia and HIF2α in GSCs ...... 106
iv 19: Pharmacological inhibition of HIF2α reduces MLL1 expression ..... 107
20: Targeting MLL1 reduces GSC-mediated VEGF production and endothelial cell proliferation ...... 109
21: MLL1 knockdown decreases the growth of GSCs ...... 110
22: Targeting MLL1 via shRNA reduces neurosphere formation in GSCs ...... 111
23: MLL1 reduces tumor propagation in mice ...... 114
24: Treatment with doxycycline activates inducible construct ...... 141
v Acknowledgements
I would like to thank all current and previous members of the Rich Lab. Without your guidance this dissertation and my growth as a scientist would not have been possible. I have made life-long friends in this lab and I look forward to staying in contact with all of you throughout life. Although there are too many fun times to describe in this dissertation, I hope all of you know how important you are in my life and how much fun I had while in the Rich Lab.
In particular, I want to thank Justin Lathia, Monica Venere, and Anita Hjelmeland.
Justin, as one of the only remaining Duke Transfers I fondly remember the fun we had playing sand volleyball and not having to deal with snow for the better part of the year while in North Carolina. If I have learned anything from you, I will at least be moving forward with a honed skill in making nicknames and using cufflinks even though they serve no real purpose. I wish you all the best in your research endeavors and I know you’ll be amazingly successful. I’m sure that I’ll be back to the area to check in and see how large your lab has grown and how many Nature publications you have.
Monica, even though you have only been in the lab a short year, you have spent a good part of that year dealing with this annoying graduate student and resisting the urge to unleash your inner Jersey Girl and break my limbs. I know that inside that sweet, patient post doc is an unruly beast who would just as easily help with
vi a presentation as kick a whole through a wall. I truly appreciate all the help and
guidance you have given me and I always particularly enjoyed when your
wisdom was in opposition to Justin. It was similar to watching a Thunderdome
match. Along with Anita, you have become a lab mother to all us fledgling
scientists and I hope that future graduate students that work with you appreciate all the knowledge, help, and guidance you so readily give. I also expect season tickets when Shane has become a famous hockey or football player (well, OK just the football tickets. Who really likes hockey anyway?).
Anita, you have given of yourself to this lab and helped all of us achieve great things. Even though Jeremy is my official advisor, you have also served as a wonderful mentor to me throughout my years in the Rich Lab. Just as Jeremy is the “Lab Dad,” you have been the “Lab Mom” in so many ways. Whether baking strawberry pies for birthday celebrations or helping organize data so it looks good enough to be sent to Jeremy, you are a wonderful mentor and we are all lucky to have you.
Most importantly, I would like to thank my mentor, Jeremy Rich. Your guidance and mentorship has shaped who I am as a scientist and will continue to shape my career. I feel truly fortunate to have had the opportunity to be a member of your lab and I look forward to reading all the groundbreaking work that is still to come from your graduate students and post-docs. As I move forward in my
vii career, I hope my future accomplishments will make you feel proud to say that I was trained in your lab.
All the best,
John
viii List of Abbreviations
CSC: cancer stem cell
DFX: deferoxamine
GSC: glioma stem cell
H3K4: histone 3 lysine 4
H3K27: histone 3 lysine 27
HIF: hypoxia inducible factor
HMT: histone methyltransferase
HRE: hypoxia response elements
iPSC: induced pluripotent stem cell
MLL1: Mixed Lineage Leukemia 1
PGK1: phosphoglycerate kinase 1
VEGF: vascular endothelial growth factor
NSC: Neural stem cell
GBM: Glioblastoma multiforme
ECM: Extracellular matrix
EGFR: Epidermal growth factor receptor
EGF: Epidermal growth factor
bFGF: basic Fibroblast growth factor
PI3K: Phosphoinositide-3-kinase
TNFAIP3: Tumor necrosis factor, alpha-induced protein 3
A20: Tumor necrosis factor, alpha-induced protein 3
ix NF-KB: Nuclear Factor Kappa Beta mTOR: mechanistic Target of Rapamycin
PTEN: phosphatase and tensin homolog
AKT: Serine/threonine protein kinase Akt
SHH: Sonic hedgehog
EPO: Erythropoietin
EPOR: Erythropoietin receptor
L1CAM: L1 cellular adhesion molecule
NICD: Notch intracellular domain
BMP: Bone morphogenetic protein
TGF-B: Transforming growth factor beta
TGF-a: Transforming growth factor alpha
FACS: Fluorescent activated cell sorting
MACS: Magnetic activated cell sorting
SSEA-1: Stage specific embryonic antigen 1
Olig2: Oligodendrocyte transcription factor 2
Sox2: Sex-determining region Y box 2
Cox2: Cytochrome c oxidase subunit II
SDF-1: Stromal derived factor 1
MMP: Matrix metalloproteinase
FBS: Fetal bovine serum
STAT3: Signal transducer and activator of transcription 3
PDGF: Platelet derived growth factor
x NO: Nitrous oxide eNOS: Endothelial nitrous oxide synthase iNOS: Inducible nitrous oxide synthase
VEGFR: Vascular endothelial growth factor receptor
ROS: Reactive oxygen species
MGMT: O-6-methylguanine-DNA methyltransferase
DNA: Deoxyribonucleic acid
RNA: Ribonucleic acid
ARNT: aryl hydrocarbon receptor nuclear translocator
ARNT2: aryl hydrocarbon receptor nuclear translocator 2
EPAS1: Endothelial PAS domain protein 1 (HIF2α)
EZH2: Enhancer of zeste homolog 2
DZNep: 3-Deazaneplanocin A pVHL: Von Hippel Lindau factor
PHD: Prolyl hydroxylase
Tie-2: Endothelial specific receptor tyrosine kinase 2
Ang2: Angiogenin 2
Flt1: Vascular endothelial growth factor receptor 1
Flk1: Vascular endothelial growth factor receptor 2
Oct4 (POU5F1): POU class 5 homeobox 1
RCC: Renal cell carcinoma
LOX: Lysyl oxidase
EMT: Epithelial-to-mesenchymal transition
xi MET: Mesenchymal-to-epithelial transition
HMT: Histone methyltransferase
HDM: Histone demethylase
SET: Su(var), Enhancer of zeste, Trithorax
DNMT: DNA methyltransferase iPS: Induced pluripotent stem cell shRNA: Short hairpin RNA siRNA: Small interfering RNA
RNAi: RNA interference
JMJD1A: Jumonji domain containing protein 1A
JARID1B: lysine (K)-specific demethylase 5B
IL6: Interleukin 6
IL6R-a: Interleukin 6 receptor alpha
xii The Role of Hypoxia in Modulating Glioma Cell Tumorigenic Potential
Abstract
by
JOHN MICHAEL HEDDLESTON
Normal stem cells reside in functional niches critical for self-renewal and maintenance. Neural and hematopoietic stem cell niches, in particular, are characterized by restricted availability of oxygen and the resulting regulation by hypoxia inducible factors (HIFs). Glioblastoma multiforme (GBM) is the most common malignant brain tumor and typically contains regions of hypoxia.
Heterogeneity within the neoplastic compartment has been well characterized in
GBM and may be derived from genetic and epigenetic sources that co-evolve during malignant progression. The cellular heterogeneity of GBM is organized into a hierarchical structure; at the apex of the hierarchy is a self-renewing, tumorigenic, glioma stem cell (GSC). The significance of GSCs is underscored by their resistance to cytotoxic therapies, invasive potential, and promotion of angiogenesis. Recent experimental evidence has supported the importance of hypoxia in GSC niches. I hypothesized that hypoxia promotes a GSC-like phenotype within GBM and does so through HIF2α. Furthermore, HIF2α requires epigenetic modifying proteins for downstream signaling and promoting tumor malignancy in GBM. Here I demonstrate that culture in restricted oxygen
xiii or overexpression of HIF2α increases GSC-related gene expression and promotes tumor propagation in nonstem glioma cells. The hypoxic response in
GBM is regulated by the lysine histone methyltransferase Mixed-Lineage
Leukemia 1 (MLL1). MLL1 is induced by hypoxia and required for upregulation and downstream function of HIF2α, but not HIF1α. Targeting MLL1 by RNA interference inhibited expression of HIF2α and target genes, including VEGF.
GSCs expressed higher levels of MLL1 than matched nonstem tumor cells and depletion of MLL1 reduced GSC self-renewal, growth, and tumorigenicity. These studies have uncovered a novel mechanism linking GBM epigenetic modifying proteins to tumor propagation via the hypoxic niche. GSC-maintaining niches may therefore offer novel therapeutic targets but also signal additional complexity with perhaps different pools of GSCs governed by different epigenetic mechanisms. My work provides a rationale for more sophisticated therapeutic approaches and indicates that disrupting the GSC hypoxic niche and targeting
GSC epigenetics may improve patient outcome in the struggle against GBM.
xiv Chapter 1
Characterizing the Stem-Like Subpopulation in Glioblastoma Multiforme
and the Hypoxic Niche: An Introduction
1 1.1-Introduction
Despite many advances in tumor biology, glioblastoma (GBM) has
remained the most common and deadly adult brain tumor [1]. Recent advances
in clinical treatment have only modestly improved the average survival of a newly
diagnosed GBM patient to less than 15 months [1]. Insights into GBM
pathogenesis via genetically engineered mouse models [2] and global genetic
analyses [3] have increased our understanding of this malignant disease.
Current treatment consists of surgical resection to reduce tumor bulk followed by
concomitant chemo- and radiotherapy. Tumor recurrence is a frequent event and
palliative care is the most common route of treatment. Recent advances in
clinical therapeutics such as the drugs Temozolomide and bevacizumab have
been viewed as dramatic improvements in the treatment of GBM. However,
these drugs still fail to significantly increase patient survival. Follow-up studies in patients treated with bevacizumab have actually revealed an increase in tumor migration and decrease in long-term survival [4, 5]. These studies suggest that the initial pruning of tumor vasculature and subsequent loss of tumor bulk eventually enhances more efficient vessel formation and glioma cell migration away from the tumor bulk. While these data require more in depth investigation, they nonetheless reiterate that current GBM treatment is falling short of the expected patient impact. Contributing to GBM pathogenesis is the hierarchy of the heterogeneous neoplastic compartment, which was first described more than a century ago by Rudolf Virchow. At the pinnacle of the neoplastic hierarchy are glioma stem cells (GSCs, also known as tumor propagating cells or tumor
2 initiating cells) that are defined through their functional ability to self-renew and
propagate tumors in immunocompromised mouse models [6]. While studies
have refuted the GSC paradigm in certain cancers, the presence of a stem-like
subpopulation within GBMs has been well established [7]. The existence of
GSCs remains a point of debate due to the unresolved nature of the cell(s) of
origin, their immunophenotypes (markers), and their rarity within the neoplastic
cell population. Rigorous functional studies have been able to characterize the
GSC population [6, 8, 9] and provide evidence that GSCs are resistant to
radiation and chemotherapy [10, 11]. Identifying and understanding the intrinsic
GSC regulators driving these phenotypes has been a focus of interest, but the
importance of extrinsic factor regulation is increasing. Recent experimental
evidence has demonstrated that GSCs are enriched in specific niches around
tumor vessels and areas of necrosis [12, 13], the latter associated with restricted oxygen. Interrogation of the extracellular matrix (ECM) associated with the perivascular niche has revealed an important relationship between ECM components, such as laminin, and cell-surface proteins, such as the integrins found on GSCs [14]. Propagation of the GSC population as well as tumor growth was dependent on the communication between the extracellular matrix.
Additionally, studies support the hypoxic niche as important to GSCs: GSC maintenance requires both hypoxia inducible factor-1α (HIF1α) and hypoxia inducible factor-2α (HIF2α; [13, 15-17]), two canonical signaling pathways that respond to oxygen tension. The downstream pathways that hypoxia, and specifically HIF2α, utilizes to promote a stem-like state are not well
3 characterized, and the mechanisms driving HIF2α expression in GSCs are
unknown. Additional studies have further demonstrated that microenvironmental
conditions such as hypoxia and acidic stress actively promote GSC function in
multiple cell populations [15, 17, 18]. Collectively, these data suggest that there
is plasticity in the GSC phenotype that can be regulated by the
microenvironment. In order to develop more effective routes of clinical treatment,
the contribution of the microenvironment to overall GSC growth and tumor propagation must be appreciated. However, GSCs must first be prospectively identified and enriched from bulk tumor populations in order to interrogate their function within tumors.
1.2-Identification of Cancer Stem Cells
Many studies have provided evidence for the existence of a stem-like subpopulation in several tumor types. Cancer stem cells (CSCs) were first identified in acute myeloid leukemia (AML) following sorting for expression of cell surface markers previously associated with normal hematopoietic stem cells [19,
20]. Although prior studies indicated that human AML cells had finite replication capacity when assessed in clonogenic assays in vitro, a subset of AML cells was capable of engrafting the bone marrow of immunocompromised mice to give rise to de novo leukemia that bore many histologic similarities to the parental disease.
In the xenograft model, only leukemia cells bearing the CD34+/CD38- immunophenotype were able to reliably initiate AML [19, 20]. These studies
4 clearly demonstrated that a fraction of leukemic cells identified by specific marker
expression possessed leukemogenic capacity. Similar ectopic xenograft assays
in immunocompromised mouse models were utilized to identify CSCs in other
solid tumors, including breast, brain, bone, liver, colon, prostate, pancreas, head
and neck squamous cell carcinoma, and melanoma, although controversy still
exists over the CSC theory [6, 7, 21-43].
1.3-Required Functional Characteristics of Glioma Stem Cells
Real time identification of adult tissue specific stem cells is a technically challenging endeavor. Their rarity within normal tissue and relative quiescence
creates difficulties in identifying the resident stem cell population. Normal stem
cells in different organ systems also possess dramatically varied proliferation profiles as well as lineage potency. Although GSCs share many similarities with normal stem cells, such as marker expression and self-renewal, glioma inherently possesses aberrant cell behavior as well as unique gene profiles among the heterogeneous subpopulations. Intertumoral variability is reflected in variance of the GSC phenotypes. Keeping in mind this phenotypic diversity, care must be taken when defining the GSC population.
Given the dramatic variance in tumors between patients, the definition of GSC is necessarily functional. A GSC can be defined as a cell that is able, through
5 continuous proliferation and self-renewal, to maintain and propagate a glioma
that is a phenotypic copy of the parental tumor. In order to maintain a tumor, a
GSC must also have to ability to maintain its own subpopulation via self-renewal,
meaning reproducing non-differentiated stem cell-like copies following cell
division. A GSC that cannot self-renew will consequently exhaust the stem-like
fraction of the tumor responsible for propagation. In addition, GSCs should
exhibit the most important characteristic first enumerated by Koch: the cell should
have the ability, when introduced into a suitable environment, to recapitulate the
phenotype of the original tumor. These concepts are in accordance with the
commonly accepted current definition of a CSC: a cell that can self-renew, demonstrate sustained proliferation, and is capable of tumor propagation [44].
As there is currently no prospective way of selecting for cells that demonstrate self-renewal or sustained proliferation, this must be observed retrospectively.
The most widely used test for surrogate in vitro self-renewal is the serial passage of GSCs in suspended culture, in which single cells should form three dimensional structures termed neurospheres. This assay allows for measurement of the self-renewal through long-term generation of spheres, and neurosphere formation capacity in vitro may be an important indicator of glioma biology in vivo [45]. A retrospective study of the relationship between neurosphere formation, tumorigenic capacity, and patient outcome determined that sustained neurosphere formation in vitro was associated with tumor propagation in xenograft models and poor clinical outcome [45]. However,
6 there are limitations to this approach (reviewed in [46]). GSCs should be
cultured as single cells in suspension otherwise the assay may simply be
demonstrating anchorage-independent growth and cell aggregation rather than
self-renewal. Neurospheres are also an artifact of cell culture, as no in vivo correlate exists in either glioma or normal brain physiology. As the spheres expand, internal cellular heterogeneity increases, most likely due to diffusion limitations of oxygen, growth factors, and metabolic factors. Thus, the growth of a neurosphere does not definitively prove that a glioma cell is a GSC.
Additional consideration must also be given to the cell culture conditions of neurospheres. The typical culture media for GSCs contains supplemental epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF) which has been used to support the growth of normal neural stem cells [47-50], although proliferation of GSCs has been shown to occur independent of growth factor addition [51]. Typically, EGF and bFGF are included in culture media to support the growth of GSCs, inhibit spontaneous differentiation, and help to maintain genotypic similarity to the parental primary tumor. However the presence of strong pro-proliferative signals can eventually lead to selection for cells that possess high levels of the receptors (such as EGFR) or abnormal sensitivity to growth factors. The requirement of growth factors in media has raised concerns of cell culture bias and how this could alter in vitro data collection. The proper use and concentration of EGF and bFGF is a contested issue and it is still not entirely known what long-term effect EGF and bFGF can
7 have on GSCs in culture. This in combination for the potential for selection
makes it important to limit passage in cell culture and avoid the use of CSC lines,
which have been passaged long term.
The gold standard for the functional demonstration of a GSC remains tumor
propagation. In this assay, a limited number of cancer cells are introduced to an
orthotopic host location such as the brain of immunocompromised mice. More
accurately, a limiting-dilution assay is performed in which a decreasing number of
putative GSCs are intracranially injected to determine the minimal number of
cells required to form tumors, which then serves as a measure of the frequency
of tumor-propagation capable cells [7]. The theoretical ideal would be injection of
a single cell that would then generate a tumor, however this has not yet been
demonstrated. In practice, efficient cell sorting and subsequent survival of solid
tumor cells following flow cytometry varies widely. Currently, reliable tumor
formation has been demonstrated with only a few hundred cells [7, 52]. In addition to the technical limitations of flow sorting, the difficulty found in tumor propagation could also be due to a requirement for support from nonstem cells
[53]. Intracranial tumor formation, however, remains the only definitive way of determining the presence of functional GSCs, and as such, is absolutely required for any experimental interrogation that utilizes GSCs.
1.4-Other Functional Characteristics of Glioma Stem Cells
8 In addition the required functional characteristics of GSCs, there are several
pro-tumorigenic properties of GSCs, which contribute to the GSC phenotype but are not necessarily common for all isolated CSC subsets. Analysis of GBM cells positive for the GSC marker CD133 has suggested a molecular profile associated with invasion and angiogenesis [54], and both promotion of tumor angiogenesis and invasion are suggested as additional functional characteristics of GSCs. Tumors derived from GSCs are highly vascular [52] with more infiltration of normal tissue compared to standard glioma cell lines [55-58]. The angiogenic properties of GSCs are due, at least in part, to elevated production of
VEGF and stromal-derived factor 1 (SDF1) [52, 54, 59-61], and recent evidence suggests that GSCs can transdifferentiate to endothelial cells [62, 63]. Although the precise mechanisms responsible for differential GSC invasion are not clear,
GSCs may express differential activity of matrix metalloproteinases [55] or AKT, which contribute to invasion [64, 65]. In addition, some cell surface markers known to enrich for GSCs, such as L1CAM [66] and integrin α6 [14], can regulate invasion in glioma [67, 68]. These data suggest that angiogenesis and invasion may be driven by specific molecular pathways in GSCs within gliomas.
GSCs are also characterized by an ability to resist chemo- and radiotherapy.
Although surgery and radiation are a standard and effective therapy for GBM,
CD133 positive GBM cells retain the ability to propagate tumors in immunocompromised mouse models post irradiation [10, 69]. Irradiation actually increases the percentage of GSCs in tumors due to the preferential survival of
9 this tumor subset [10]. Preferential survival of the GSCs is due to their ability to
repair radiation-induced DNA damage via checkpoint kinase activation [10]. In
addition to radiation and surgery, GBM patients are treated with the oral
alkylating agent temozolomide [1]. However, GSCs were less sensitive to
temozolomide induced cell death than normal neural stem cells (NSCs) [70],
leukemia cells [71], or nonstem glioma cells [11, 72], although there are reports of preferential targeting of GSC lines by temozolomide [73]. Resistance to temozolomide in GBM cells was also associated with a stem cell-like gene signature that included expression of the GSC marker CD133 [74]. CD133+ or neurosphere forming GBM cells also displayed resistance to the type II topoisomerase inhibitors etoposide [11, 71, 75] and teniposide [76]. In converse experiments, overexpression of CD133 alone was suggested to promote resistance to other chemotherapies including the topoisomerase I inhibitor camptothecin and the DNA synthesis inhibitor doxorubicin [77]. This chemo- and radioresistance may be overcome by targeting of GSC molecular pathways. A cell surface protein known to enrich for GSCs, L1CAM [66], regulates the DNA damage checkpoint response of GSCs [58]. Targeting of L1CAM through directed shRNAs reduced DNA repair and sensitized GSCs to irradiation [58].
The CSC marker and polycomb group protein BMI1 has also been suggested to recruit DNA damage response proteins after irradiation to promote repair [78].
Although the importance of cyclooxygenase-2 (COX-2) signaling for the GSC phenotype is not well characterized, treatment of GSCs with the selective COX-2 inhibitor celecoxib potently decreased the ability to propagate tumors in vivo and
10 improved the efficacy of radiotherapy [69]. Treatment with the mTOR inhibitor
rapamycin also induced radiosensitivity through a mechanism that may involve
activation of autophagy [79]. Autophagy induced by loss of DNA-dependent protein kinase catalytic subunit (DNA-PKCs) was also associated with radiosensitization of GSCs [80], although other data has suggested that autophagy inhibitors would be beneficial for improving radiotherapies [81].
Together these data suggest that tumor recurrence is mediated by GSCs which survive therapy and should be targeted for better tumor control.
One final property of GSCs contributing to tumor propagation, which is only beginning to be understood, is their ability to suppress the immune system.
Multiple studies now demonstrate that GSCs can preferentially inhibit the proliferation of T-cells [82-84]. GSCs also produce cytokines known to recruit and promote immunosuppression by microglia, suggesting modulation of innate immunity [85]. Thus, GSCs may have several mechanisms through which they could escape immune surveillance. Taken together, all of these data suggest that many of the known properties of cancer which contribute to progression and make treatment difficult--the ability to drive angiogenesis, invade or metastasize, survive cytotoxic therapies, and suppress the immune system—are elevated in the CSC subset. Thus, targeting of GSCs within GBM may represent a significant advance in our ability to treat this devastating disease.
11 1.5-Immunophenotypic Characteristics of Glioma Stem Cells
In addition to the functional characteristics of GSCs mentioned above,
GSCs commonly express normal stem cell markers. Assaying the
immunophenotype by flow cytometry is a useful tool for enrichment of GSCs in a
laboratory setting, but there is no common antigenic profile that is representative
of all GSCs. This may be due to the inherent instability of glioma cells, as well as
heterogeneity in the microenvironment of the tumor. The expression of markers
within the GSC subpopulation of a single patient’s tumor may be widely varied.
This variation is exacerbated when comparing multiple patients who may present
with different stages of the disease as well as exposure to different treatment regimens. In addition, the diagnosis of GBM is now recognized to include many different subtypes with different genetic profiles [86-88]. Despite this variability, several markers have been successfully utilized for GSC enrichment in the laboratory setting as later discussed in detail. Use of these markers is not without limitations, and may only be reliable when utilized immediately following tumor resection, as exposure to an artificial culture environment may dramatically alter expression profiles of these markers [47, 89]. As a further complication, cell surface markers do not completely segregate as distinct populations with separate cytometric peaks. Rather, the population profiles of these markers is often continuous, with the CSC population enriched in distinct levels of marker expression. Ideally, each marker will also be functionally verified in each tumor using neurosphere formation and in vivo tumor propagation as discussed above.
Segregation for GSC-enriched populations should also be confirmed through
12 verification of enrichment for other intracellular stem cell markers such as Olig2,
Sox2, Bmi1, or Musashi [10, 41, 90-93]. These studies are important as a marker that efficiently separates a tumor-initiating fraction from one patient- derived tumor may not efficiently segregate in another patient-derived sample, due largely to the vast heterogeneity of the disease.
Although the percentage of cells expressing GSC markers within a tumor is usually a minority of the total, CSCs are not necessarily rare [7, 40, 51]; reviewed in [94]. The frequency of GSCs expressing stem cell markers is not fixed, and may depend on the region of the tumor used for GSC isolation. For example and as later further discussed, the perivascular niche may regulate the GSC phenotype and vascularity is regional [12, 14, 95]. Indeed, experimental evidence suggested that the proportion of neoplastic cells that can possess a
GSC phenotype may be significantly influenced by the microenvironment [15, 17,
18, 96]. In addition, the resistance of GSCs to radio- and chemotherapy facilitates enrichment for the GSC population in clinically treated patients [10,
11]. These data suggest that the observed portion of a tumor that is GSC marker- positive may be arbitrarily determined at the time of sorting and not reflective of the in vivo tumorigenic fraction.
While GSCs express stem cell markers, cells derived from GSCs can display lineage markers. The ability of CSCs to give rise to cells expressing markers of
13 multiple lineages is commonly observed in some tumor types, but is not
necessarily a property of CSCs. In glioma, GSCs have the capacity to generate cells that express markers of astrocyte, neuronal, and oligodendrocyte lineages
[10, 43]. This ability of GSCs is critical for recapitulating the phenotype of the parental tumor, which is characterized by histological variance, as the original name of grade IV glioma, Glioblastoma Multiforme, suggests. The presence of mutations, genetic instability, and cellular deregulation means that the differentiated cells in a tumor do not have counterparts in the normal physiological lineages. A differentiated glioma cell may express markers of different lineages simultaneously (for example the neuronal lineage marker β3-
Tubulin and the astrocytic lineage marker Glial Fibrillary Acidic Protein, GFAP could be expressed on the same glioma cell) which would not occur in normal brain cells [97, 98]. Thus, it is critical to recognize how the immunophenotype of
GSCs and their derivatives are regulated to continue to develop our understanding of the GSC phenotype.
1.6-CD133 as a Marker for Glioma Stem Cells
Immunophenotypes are used to enrich rather than identify CSCs, and there is debate regarding the best marker(s) to use for this purpose. GSCs were first identified in human specimens using positivity for the cell surface NSC marker,
CD133 (Prominin1) [99], to enrich for tumorigenic potential in immunocompromised mouse models [7, 43]. Their self-renewing potential was
14 also evaluated in the neurosphere assay [5, 35], and CD133 is now a frequently
used GSC-enriching marker. Although some papers have failed to show GSC
enrichment with CD133, these studies have generally used extensively cultured
cells which limits their interpretation [8, 100]. In studies with CD133-positive
GBM cells, gene expression profiles were similar to those of embryonic stem
cells, suggesting the involvement of a stem cell-like molecular profile [101, 102].
CD133 positive GBM cells are resistant to radiation or chemotherapeutic
treatment due to their capability to activate cell cycle check points, DNA repair
mechanisms, and anti-apopototic processes, as compared to their CD133-
negative counterparts [10, 11]. Further, gene expression profiling of chemo-
resistant glioma cells revealed that resistant cells are enriched for CD133
expression [74, 103]. These data regarding the preferential survival of GSCs
may explain findings that suggest that CD133 expression is associated with poor
clinical outcome, tumor re-growth, and malignant progression or therapeutic
resistance in gliomas [103-105]. Even though there is not a complete consensus
on the correlation between stem cell marker expression and glioma patient
prognosis (Neuropathology, 2011), these data do suggest that CD133 is a useful
marker to enrich for GSCs, and cells sorted for CD133 expression can be used to
help answer clinically relevant questions.
Although CD133 has been proven to be a useful GSC enrichment tool, its
biological function is not well understood. CD133 is a pentaspan transmembrane
glycoprotein enriched in the cholesterol-rich membrane microdomain and
15 localized to plasma membrane protrusions [106]. Its expression in epithelial cells is localized to the apical membrane as observed in neuroepithelial cells.
Asymmetric distribution of CD133 in neuroepithelial cells is postulated to be critical for neurogenesis [107]. Polarization of CD133 has been observed during cytokine-stimulated migration of hematopoietic cells [108]. Overexpression of
CD133 in glioma cells has also been demonstrated to activate MAP kinase pathways [109] and enhance drug resistance [77]. Down regulation of CD133 decreased proliferative activity of glioma [110]. These data demonstrate that
CD133 does have functional significance in glioma cells. Further investigation into the molecular regulation of CD133 could yield clues as to its mechanistic function.
CD133 expression is subject to multiple levels of regulation. The CD133 gene can be transcribed from multiple promoter sites and the resulting transcripts are edited to yield multiple splice variants, some of which are not recognized by anti-
CD133 antibodies due to improper protein localization [111-113]. CD133 protein can be post-translationally modified through glycosylation, which is required for recognition by some anti-CD133 antibodies [114]. The epitope availability is further modified by interaction between CD133 and sphingolipids, whose levels fluctuate according cell proliferation status [115]. With these complexities of
CD133 expression regulation and its interaction with other molecule, a careful assessment is required to interpret immunological detection of CD133. In addition, several other markers are being utilized as effective GSC markers.
16
1.7-Alternative Cell Surface Markers for Glioma stem cells
Several studies have demonstrated tumorigenic capacity of CD133-
negative cells that could be due to GSC populations that escaped antibody
labeling and sorting. Indeed, use of several cell surface markers such as stage- specific embryonic antigen (SSEA-1/CD15/LeX), integrin α6, A2B5, and CD44 and have been reported to help enrich for GSCs independent of CD133 [14, 116-
120]. These markers provide the benefit of being present on the cell surface, providing the opportunity for prospective isolation of live cells, whereas other
GSC markers (Olig2, Sox2, etc) are intracellular and cannot be directly utilized for sorting without cellular manipulations.
SSEA-1 selection was shown through functional assays to enrich for GSCs in that SSEA-1-positive cells were highly tumorigenic compared to SSEA-1- negative cells in immunocompromised mouse models [116, 119]. In addition,
SSEA-1 positive GBM cells were enriched for neurosphere formation capacity and cells derived from these neurospheres under differentiation-inducing conditions expressed markers of both the astrocyte and neuronal lineages [116,
119]. Interestingly, in tumors in which CD133 was expressed, SSEA-1 selection enriched for CD133 as well suggesting that cells can co-express validated GSC markers in certain tumors [116]. In addition to these data in human cells, SSEA-
1 also enriches for CSCs in medulloblastoma mouse models [121, 122].
17 Although SSEA-1 may be secreted from NSCs to modulate Wnt signaling through its binding affinity for Wnt-1 [123], the biological function of SSEA-1 in
GSCs remains to be fully elucidated.
Another cell surface marker that enriches for GSCs is integrin α6, as integrin α6- high cells are more tumorigenic than integrin α6-low cells [14]. Integrin α6 is co- expressed with conventional GSC markers including CD133 and Olig2, but integrin α6 positive cells are enriched for neurosphere formation capacity regardless of CD133 status. These data indicate that integrin α6 recognizes a broader pool of GSCs than that characterized by CD133 alone. Further demonstrating the biological importance of integrin α6 to the GSC phenotype, antibody-mediated neutralization or shRNA-mediated knockdown of integrin α6 significantly impeded neurosphere formation in vitro and tumor formation in vivo.
These data demonstrated the functional significance of a cell surface GSC marker useful for prospective sorting and suggested targeting of integrin α6 as a potential therapy [14].
Additional studies have shown the utility of a cell surface ganglioside epitope expressed in white matter cells with NSC properties, A2B5 [124], to enrich for
GSCs. A2B5-positive cells sorted from GBM specimens formed tumors in immunocompromised mice at high frequency whereas A2B5-negative cells only rarely formed tumors [117, 120]. A2B5-positive cells were also enriched for the
18 capacity for form neurospheres, and cells from those spheres had the capacity
for multi-lineage differentiation in vitro A2B5 appeared to co-segregate with
CD133 as no A2B5-/CD133+ cells could be isolated via flow cytometry [117,
120]. However, A2B5-positive CD133-negative cells were still able to initiate tumors indicating that A2B5 could enrich for a tumorigenic population independently of CD133 [117, 120].
Markers for GSCs will continue to be identified as our understanding of the proteins expressed at the cell surface of GSCs rapidly expands. When interpreting these results, evaluation of cell isolation conditions and functional
GSC characteristics must be incorporated. In many cases, flow sorting based on surface markers is not efficient and the harsh conditions of sorting can force phenotypic changes in the cell. It is therefore critical to utilize additional methods to verify functional enrichment for the GSC population independent of surface marker expression.
1.8-Identification of Glioma Stem Cells Independent of Cell Surface Markers
GSCs can be also enriched using other approaches that do not rely on cell surface markers. NSCs can be highly enriched by cell sorting of a side population capable of excluding a DNA-staining fluorescent dye, Hoechst 33342
[125-127]. Similar side population cells sorted from embryonic stem cells
19 resembled pluripotent embryonic cell lineages [128], demonstrating that Hoechst
33342 exclusion is a good functional characteristic that can be utilized to enrich for stem cells. When applied to a glioma population, the side population approach enriched for tumorigenic glioma cells [129, 130]. Cells in the side population were enriched for the ability to form neurospheres as well as tumorigenic potential [129, 130]. Interestingly, loss of the tumor suppressor
PTEN was associated with an increase in the side population phenotype [129], suggesting that this common genetic alteration in glioblastoma may contribute to a GSC phenotype. As the ABC transporter protein ABCG2/Bcrp1 can mediate the side population phenotype [131] and may be elevated in GSCs [11], ABCG2 was also evaluated in the glioma samples. One paper indicated that ABCG2 identified the side population in glioma [127], whereas another indicated the tumorigenic capacity of the side population and ABCG2+ cells were distinct [128].
A more recent study also suggests that side population cells had decreased tumorigenic potential [132]. While some of the differences in results may be due to differences in cell types evaluated (primary specimens, established human glioma lines, or mouse cells), these studies are complicated by the fact that the dye can be toxic and the viability of cells without efflux pumps is reduced.
A recent report has also described an additional novel method to enrich for glioma growth, which may indicate GSC enrichment. When autofluorescent
(excitation at 480 nm, emission at 520 nm), large nongranular (high in forward scatter and low in side scatter) cells were freshly collected from human glioma
20 samples by fluorescence activated cell sorting (FACS), these cells were tumorigenic in xenograft assays. Interestingly, CD133 did not co-segregate with this autofluorescent and large nongranular phenotype [133]. Together these data suggest that enrichment for GSCs may be achieved through methods based on functional characteristics independent of cell surface marker expression, but no method identified to date is without caveats. Evaluation of enrichment efficiency is therefore vital regardless of the utilized method.
1.9-Glioma Stem Cell Regulators on the Cell Surface
Characterization of the molecules differentially expressed on or active in
GSCs is anticipated to yield novel targets for cancer therapy and define unique mechanisms for regulating cell fate. Although intrinsic GSC signals can be stimulated by microenvironmental conditions and secreted factors that could be targeted for therapy (as will be further discussed in later sections), we will presently focus on molecular mediators of GSC maintenance known to be present on the cell surface.
One of the core ingredients in media supporting GSC growth is epidermal growth factor (EGF); [47]. EGF binds to its receptor (EGFR) to initiate a signaling cascade known to regulate a variety of cellular behaviors including growth, survival, and differentiation [134]. For example, overexpression of wild-type
21 EGFR or a constitutively active mutant form, EGFRvIII, in NSCs promotes cell
proliferation and survival while decreasing differentiation towards a neuronal
lineage [135]. An important role for EGFR signaling in glioma has been
established with multiple prior studies in both humans and animal model systems
[68]. It is therefore not surprising that recent evidence demonstrates that EGFR
is also critical for the GSC phenotype [51, 136, 137]. EGFR-positive glioma cells form tumors at an increased rate compared to EGFR-negative cells [135]. Gain of EGFR function through overexpression increased tumorigenic potential.
Among EGFR-positive GSCs, targeting EGFR with shRNA or inhibitors reduced
GSC mediated tumor propagation or cell growth respectively [137]. Thus, stimulation of EGFR signaling through EGF is likely to be important for GSC maintenance in vivo.
The transforming growth factor beta (TGF-β) superfamily of proteins is another set of growth factors and their receptors involved in regulation of the GSC phenotype. The TGF-β superfamily includes TGF-β itself as well as the bone morphogenic proteins (BMPs) and is a well established regulator of stem cell self-renewal and differentiation (reviewed in [138]). TGF-β and BMP signal through receptor serine/threonine kinases that phosphorylate intracellular
mediators called SMADs. Autocrine TGF-β signaling has been shown to
maintain GSCs via regulation of the expression of Sox2/Sox4 and LIF [139, 140].
Addition of exogenous TGF-β promoted neurosphere formation from primary
GBM specimens, antagonized FBS induced differentiation, and promoted the
22 growth of tumors in vivo [140]. TGF-β receptor inhibitors may target GSCs, as
they decreased neurosphere formation capacity in vitro [140], and tumors from
TGF-β receptor inhibitor-treated mice had decreased expression of some GSC markers, including CD44 [118]. In contrast to these results suggesting that TGF-
β mediates GSC maintenance and similar to other biologies in which TGF-β and
BMPs are antagonistic, BMPs have been shown to promote GSC differentiation
[141, 142]. Exogenous BMP treatment decreased GSC marker expression, including CD133, while increasing differentiation marker expression [142].
Importantly, both in vitro exposure of GSCs to BMP or in vivo delivery of BMP reduced the growth of GSC-derived tumors and increased survival of mice bearing human glioma xenografts [142]. In these cells in which BMP promotes differentiation and reduces the GSC phenotype, BMP receptor signaling is intact.
If, however, the BMP receptor is epigenetically silenced, BMP can inhibit GSC differentiation [141]. Restoration of BMP receptor expression through either overexpression or promoter demethylation reduces glioma cell tumorigenic capacity and enables BMP mediated differentiation [141]. Together these results stress the potential significance of growth factor receptor signaling pathways, epigenetic modifications, as well as differences between GSC subsets.
Another growth factor receptor shown to be highly expressed on GSCs is erythropoietin (EPO) receptor [143]. Erythropoietin is a glycoprotein regulating red blood cell production, so erythropoietin stimulating agents (ESAs) were given to cancer patients to counteract anemia resulting from chemo- and radio-therapy
23 with sometimes adverse effects (reviewed in [144]). The enhanced tumor progression in ESA-treated cancer patients could be a result of the promotion of
GSC maintenance [143, 145]. GSCs were recently found to have an autocrine loop with elevated EPO production and EPO receptor expression [143], and EPO was shown to promote tumorsphere formation in CSCs isolated from both the brain and the breast [143, 145]. Prospective enrichment for EPO receptor- positive glioma cells selected for a tumor cell subset with increased capacity for neurosphere formation, and targeting EPO receptor with directed shRNAs reduced this ability. EPO receptor knockdown also reduced the capacity of
GSCs to propagate tumors in immunocompromised mouse models in association with reduced GSC growth and survival [143]. These data strongly suggest the potential clinical relevance of understanding the effects of growth factor receptor mediated signals on tumor cell subsets such as CSCs.
One cell surface molecule highly expressed in GSCs is the neural cell adhesion molecule, L1CAM [66]. L1CAM is overexpressed in glioma and other solid tumors in comparison to normal tissue [146-148] and is important for the regulation of neural cell growth, survival, and migration [149]. L1CAM is overexpressed in GSCs relative to nonstem glioma cells, where it plays a preferential role in GSC survival [71]. Targeting of L1CAM inhibits GSC growth and neurosphere formation potential in association with the induction of apoptosis. This biological effect is attributed to a decrease in expression of the
GSC marker Olig2 with a subsequent up-regulation of the growth regulator and
24 tumor suppressor p21WAF1/CIP1. Furthermore, L1CAM shRNA is sufficient to delay the growth of GSC initiated xenografts in vivo. These data demonstrate that
L1CAM is required for GSC maintenance [71].
Notch is another cell surface signaling pathway known to regulate NSCs
(reviewed in [150]) and now implicated in GSC maintenance [151-154]. Notch signaling is activated through cell-cell contacts in which a ligand present on a neighboring cell binds to the extracellular receptor promoting Notch intracellular domain (NICD), which is released after γ secretase-mediated protease cleavage.
Notch activation promoted neurosphere formation [154]. Similarly, γ-secretase
inhibitors that block Notch signaling inhibited the proliferation and neurosphere
formation capacity of isolated GSCs as well as promoted the expression of
differentiation markers [151, 153]. Inhibition of Notch signaling may also promote
sensitivity to chemo- and radio-therapies [155, 156], suggesting that there may
be benefit from the use of γ-secretase inhibitors in patients. Indeed, γ-secretase
inhibitors are now in clinical trials at multiple major institutions (see
ClinicalTrials.gov).
Similar to Notch signaling, the Sonic Hedgehog (SHH) pathway is a highly
conserved mechanism of regulating NSC biology (reviewed in [157]) which has
recently been shown to regulate GSCs [158]. In this pathway, SHH binding to
the Patched receptor relieves Patched-mediated repression of Smoothened,
25 leading to activation of the GLI transcription factors. Although data suggest that
there may be SHH-dependent and -independent GSC subtypes, targeting of GLI
via shRNA decreased the proliferation and survival of SHH-dependent GSCs in vitro, with a concomitant decrease in GSC tumorigenic potential in vivo [158].
These data are supplemented by recent findings indicating that SHH signaling is important for the infiltrative growth of GBM cell lines derived from CD133-positive cells [159], and that inhibition of SHH reduces chemo- and radio-resistance [155].
Based on these preclinical data, it will be interesting to determine the outcome of
SHH pathway inhibitors in clinical trials (see ClinicalTrials.gov) and to determine if there are any in vivo effects on CSCs in solid tumors such as gliomas.
1.10-Intracellular Glioma Stem Cell Regulators
In addition to cell surface regulators of the CSC phenotype, multiple intracellular molecules and pathways are now recognized to be important for
GSC maintenance. Although we do not comprehensively review all of the potential intracellular mediators of GSCs, we seek to introduce some key pathways that several publications have indicated are critical for GSC biology.
One promising molecular target is the PI3K/PTEN/AKT/mTOR pathway, a mediator of cell survival and invasion that is often activated in gliomas through either loss of the tumor suppressor PTEN or growth factor-mediated AKT
26 phosphorylation (reviewed in [160]). Suggesting involvement of the
PI3K/PTEN/AKT/mTOR pathway in GSCs, activation of AKT was associated with
acquisition of an invasive GSC phenotype [65]. AKT also regulates the ABCG2
transporter, which is involved in generation of the side population (discussed
above; [129]) demonstrating that AKT could directly modulate the dye exclusion technique used to prospectively enrich for GSCs. When AKT inhibitors were used to treat GSCs, GSCs displayed preferential sensitivity to AKT inhibition relative to the nonstem glioma cell fraction [64, 161]. Treatment of GSCs with multiple AKT inhibitors results in similar effects of decreased growth and neurosphere formation, and direct targeting AKT with shRNA improved the survival of mice bearing intracranial gliomas [64, 161]. In addition to effects of
AKT, targeting mTOR with the inhibitor rapamycin or directed shRNA reduced the expression of GSC markers and impaired the ability of to generate neurospheres [162]. Dual targeting of mTOR and PI3K with either rapamycin in combination with the PI3K inhibitor LY294002 or with the mTOR and PI3K inhibitor BEZ235 significantly increased the expression of a neuronal differentiation marker. BEZ235 was also capable of inhibiting the tumorigenic potential of GSCs in xenograft models [162]. These data strongly suggest that targeting of the PI3K/PTEN/Akt/mTOR pathway may represent an anti-GSC- based approach.
Another pathway now recognized to play an important role in the regulation of
NSCs (reviewed in [163]) and GSCs involves nuclear factor kappa-light-chain-
27 enhancer of activated B cells (NF-κB). In the canonical version of this pathway, a
variety of stimuli can lead to NF-κB activation through degradation of a cytoplasmic inhibitor of κB (IκB) which then permits nuclear localization of NF-κB
proteins. NSCs derived from the rat subventricular zone in the absence of
exogenous growth factors that could form colonies in a soft agar assay had a
high level of NF-κB activity [164]. NF-κB activation appeared to correlate with
adoption of a GSC-like phenotype in that there was an elevation of stem cell
markers, prolonged proliferation, and elevated expression of VEGF [164]. These
data suggested that constitutive activation of NF-κB was associated with the
acquisition of a GSC-like phenotype [164]. Indeed, several proteins shown to be
elevated in GSCs and mediators of the GSC phenotype are known to be targets
of NF-κB signaling. For example, it was recently found that the NF-κB target
gene Tumor Necrosis Factor inducible protein 3 (TNFAIP3), or A20, is expressed
at higher levels in GSCs in comparison to matched nonstem tumor cells
phenotype [165]. Targeting A20 reduces GSC growth in association with
decreased neurosphere formation. The decreased growth of GSCs in the
absence of A20 is due to increased apoptosis and may be related to the ability of
A20 to confer resistance to TNF alpha induced apoptosis.. Furthermore,
decreased A20 expression in GSCs reduces their tumorigenic potential
demonstrating a critical role for A20 in GSC maintenance [165].
One transcription factor being investigated as a potential target for glioma
therapy (reviewed in [166]) and recently recognized as an important regulator of
28 GSCs is signal transducer and activators of transcription 3 (STAT3). STAT3 is
activated through tyrosine phosphorylation by a variety of growth factor receptor
mediated signals, and is implicated in the regulation of NSC differentiation [167,
168]. Elevated phosphorylation of STAT3 was observed in GSCs relative to
nonstem glioma cells [53, 143, 169, 170]. Inhibition of STAT3 through small molecule inhibitors or directed shRNAs decreased GSC proliferation and neurosphere formation capacity [53, 143, 169, 170]. Targeting STAT3 in combination with temozolomide treatment also appears to sensitize GSCs to this standard of care chemotherapy [170], suggesting the potential for STAT3-based combinatorial therapies.
Another important transcription factor that regulates GSCs is the oncoprotein c-
Myc, which becomes active in response to mitogenic signals and has also has been identified as a significant regulator of stem cell biology, linking the normal stem cell and cancer fields [171]. In human tumors, the presence of overexpressed c-Myc is often linked to poor prognosis [172]. Studies have demonstrated that c-Myc expression correlates with the grade of malignancy of
GBMs. Furthermore, data has shown that not only is c-Myc required for glioma cancer cell proliferation, growth, and survival, but also, higher levels of c-Myc are expressed in GSCs in comparison to matched nonstem glioma cells [173]. In addition, when co-staining GSCs for the NSC marker Nestin and c-Myc more than 90% of the Nestin positive glioma cells were also c-Myc positive, suggesting that GSCs express high levels of c-Myc. These studies also demonstrated that
29 upon knockdown of c-Myc, GSC growth and proliferation was significantly
reduced, whereas the cell cycle progression of nonstem glioma cells was
minimally disturbed. In fact, upon knockdown of c-Myc the expression of
numerous cell cycle regulators downstream of c-Myc were altered in GSCs, but
not in nonstem cells. These data suggest that c-Myc, along with its downstream regulators, play a specific role in the regulation of GSC proliferation and growth.
1.11-Perivascular Microenvironmental Regulation of Glioma Stem Cells
Although intrinsic regulation of the GSC phenotype is important for tumor growth and maintenance, recent studies have revealed that the extrinsic influence of the tumor microenvironment plays an critical role in maintaining the
GSC population (Figure 1). It has been established that stem cells from multiple tissues reside in specified locations, or niches [174]. These niches, containing various differentiated cell types and secreted factors, direct the homeostasis of the stem cells by regulating the balance between self-renewal and differentiation.
In the case of normal NSCs, regions rich in blood vessels, or perivascular niches, are critical for their maintenance [175-179]. More recently, a perivascular niche has been described for GSCs (Figure 1B, 1B’, [12]). Although niche dependence between normal NSCs and CSCs is likely to differ greatly, insights have been made into components of the tumor perivascular niche that modulate GSC maintenance.
30
)( :(
-(
:>( ->(
-./0( )*#+'(,( !"#$%&'(
1$23456( 7*&$6'( 1$96'*(( :*$$<( 8(7*&$6'(-5**( 8(;456(-5**( 8(:9'&2(;49$6'( 8( =5335*(
Figure 1: Microenvironmental factors modulate intrinsic cell pathways. Several extrinsic factors originating from the microenvironment are able to modulate intrinsic cell phenotype. B. Interaction of the integrin cell surface proteins with the extracellular matrix within the perivascular space supports GSC maintenance. As shown by immunostaining from a human patient glioma (B’), cells expressing integrin alpha 6 are localized in the perivascular region denoted by CD31 staining of the blood vessel. Notch-ligand interaction between endothelial cells of the blood vessels and the cancer cell is also crucial for GSC maintenance. Inhibition of the Notch pathway has been shown to have detrimental effects on the CSC phenotype. C. The hypoxic niche is able to modulate cell phenotype via HIF signaling, which drives expression of stem cell related genes. The hypoxic niche can be visualized in intracranially injected glioma cells by staining of pimonidazole, a drug that binds protein adducts in cells under low oxygen conditions. As seen in (C’), hypoxia can be observed in distinct regions surrounding putative areas of necrosis (denoted by *). Acidic stress can also drive expression of stem cell related genes and the HIF proteins. (Figure made in collaboration with Dr. Justin D. Lathia)
31
The first report of GSC residence near vascularized areas within the tumor came from the Gilbertson lab (10). Using co-immunostaining for CD34 (to mark the vascular endothelial cells) and Nestin (to mark the GSCs) in primary brain tumors, they were able to demonstrate direct contact of the GSCs with the tumor capillaries and quantify that the majority of the Nestin-positive cells were localized in close proximity to the vasculature. It was found that GSCs preferentially associated with co-cultured endothelial cells as compared to the majority of the tumor cells. A direct effect on GSC maintenance through factors secreted by the endothelial cells was demonstrated through the use of a transwell assay. The results indicated that both self-renewal and an undifferentiated state were maintained and highlighted potential niche regulation of a GSC phenotype. Utilizing in vivo mouse models, co-transplantation of brain tumor stem cells and endothelial cells into immunocompromised mice resulted in higher capacity of the propagation and growth of tumors in the brain by endothelial-derived factors. This ability to maintain brain tumor stem cells was not exhibited by any other cell types, highlighting the specificity of the functional relationship between endothelial cells and brain tumor stem cells. Together, these results suggest that support by the endothelium can promote self-renewal of GSCs and growth of the tumor in vivo.
32 In their next series of experiments, the Gilbertson lab demonstrated that
disruption of the tumor vasculature, and hence the perivascular
microenvironment supporting the GSCs, could prevent tumor growth. To achieve
this, they treated mice bearing orthotopic xenograft tumors with an anti- angiogenic therapy. Importantly, the percentage of self-renewing GSCs was significantly reduced, indicating that without the vascular support, there is reduced maintenance of the stem-like population. Bidirectional interplay between the tumor vasculature and GSCs was elucidated when it was shown that GSCs could release vascular endothelial growth factor (VEGF) to promote endothelial cell migration and tube formation in vitro [52]. Therapeutic targeting of VEGF
expressed from GSCs with the humanized neutralizing anti-VEGF antibody
bevacizumab (Avastin) in a xenograft system resulted in decreased tumor growth
with a less vascular phenotype (64). Further in vivo evidence for GSC
contribution to tumor vasculature was shown using a VEGF-overexpressing
mouse model where increased production of VEGF by the GSCs resulted in larger tumors [60].
The relationship between GSCs and tumor vasculature was made more complex
by recent reports showing that endothelial cells of tumor origin were incorporated
into GBM microvessels [62, 63]. Ricci-Vitiani and colleagues showed that 20–
90% of the endothelial cells within each glioblastoma carry the same genomic alteration as the tumor cells, suggesting that a significant portion of the vascular
endothelium of tumors has a neoplastic origin. In vitro culture of GSCs under
33 conditions similar to those used for endothelial cells enhanced phenotypic and functional features characteristic of endothelial cells. In addition, tumor xenografts generated in immunocompromised mice by means of either orthotopic or subcutaneous injection of GSCs contain significant portions of human endothelial cells [90]. Wang et al. similarly demonstrated that a subpopulation of endothelial cells within glioblastomas has the same somatic mutations as the tumor cells, such as amplification of EGFR. In their study, a fraction of GSCs displayed vascular endothelial-cadherin (CD144) expression, known to be characteristic of endothelial progenitors giving rise to mature endothelial cells.
Traces of in vitro and in vivo lineage further support the notion that the fraction of
GSCs is multipotent and capable of differentiation along both the tumor and
endothelial lineages, possibly via an intermediate CD133+/CD144+ progenitor cell.
Interestingly, while treatments of GSCs with the clinical anti-angiogenesis agent bevacizumab or shRNA demonstrate that blocking VEGF or silencing VEGFR2 inhibits the maturation of tumor endothelial progenitors into endothelium but not the differentiation of CD133-positive cells into endothelial progenitors, whereas γ-
secretase inhibition or NOTCH1 silencing blocks the transition into endothelial progenitors [156]. These findings highlight that GSCs may not only depend on a perivascular niche for maintenance of their phenotype, but also may actually influence the establishment/maintenance of the niche.
The perivascular niche has also been shown to regulate the GSC phenotype through regulation of the Notch pathway [95]. Blockade of this pathway has been
34 demonstrated to deplete the GSC population through reduced proliferation and increased apoptosis as well as increase the sensitivity of GSCs to radiation- induced cell death, underscoring the importance of Notch in the regulation of
GSCs [151, 152, 156, 180]. Using a mouse model of PDGF-induced gliomas, it was shown that stem-like Nestin-positive cells, which also expressed Notch1 and sGC, the nitric oxide (NO) receptor, were located near vascular endothelial cells that expressed endothelial nitric oxide synthase (eNOS), which produces NO
[95]. Notch signaling in the stem-like cells was shown to be activated by NO in vitro and NO drove tumors in this system to have a more stem-cell like phenotype.
An additional molecule recently identified to regulate GSCs within the perivascular niche is integrin α6 (discussed above). In these studies, the authors identified integrin α6 expression adjacent to CD31 expressing endothelial cells in primary patient GBM specimens. They then went on to demonstrate the stem cell nature of integrin α6-expressing cells through in vitro analysis. Importantly, the ability of integrin α6 cells to form tumors in an orthotopic xenograft model was demonstrated. Interestingly, targeted inhibition of integrin α6 with RNA interference or with a blocking antibody reduced the stem cell phenotype and tumor formation. Although additional studies will likely elucidate additional pathways involved, these findings underscore the importance of perivascular niche regulation on GSC maintenance. In addition to the perivascular niche, the prevalence of hypoxic niches in GBM is becoming better understood as an
35 important factor in GSC maintenance.
1.12-Hypoxia in Gliomas
Oxygen concentration is tightly regulated at the tissue and cellular levels
due to its essential role in many biological processes. Hyperoxia can induce the
formation of reactive oxygen species (ROS), which may cause genotoxic effects
or cell death. In contrast, hypoxia can have extensive downstream
transcriptional effects, such as activation of pro-apoptotic and pro-angiogenic
pathways. As cells grow and divide, the neoplastic compartment rapidly expands
past the diffusion distance of oxygen in tissue (~100 µm). Large regions of the
tumor become hypoxic due to this spatial limitation. The immediate cellular
response (mediated by HIF proteins) is the influx of new vessels to provide
appropriate oxygenation to the tumor tissue. However, vessel in-growth cannot
maintain proper tissue oxygenation when faced with the rapid cellular expansion
of a tumor. The resulting irregular blood flow creates regions within a solid tumor
that experience cyclical periods of hypoxia, with oxygen tensions that range from
mild (2-5% O2) to severe (<1% O2; [181]). Several studies have shown that the constant acute cycling of hypoxic regions in a tumor lead to enhanced metastatic potential and HIF transcriptional activity beyond what is typical of healthy tissue
[182, 183]. The oxygenation status of tumor tissue cycles in both a spatial as
well as temporal manner. Studies in mice utilizing window chamber imaging
techniques demonstrated that hypoxic cycling occurs often in regions of
36 microvasculature due to the instability of red blood cell flow through the vessels
[184]. Consequently, this regional cycling results in fluctuating HIF activity, which
has been shown to directly correlate to tumor radiation resistance [181, 185]. As
such, hypoxia is an essential part of the tumor microenvironment. Gliomas, in
particular, have characteristic regions of pseudopallisading necrosis that develop
due to hypoxic regions.
Restricted oxygenation levels have been demonstrated to correlate with many aspects of tumorigenicity. Hypoxia is related to survival of patients, therapeutic resistance, and tumor aggression in many solid cancers [186]. Hypoxia is associated with resistance to traditional radiotherapies and chemotherapies that are used to treat GBM patients. For instance, resistance to temozolomide, the primary chemotherapeutic agent in clinical use for GBMs, has been linked to
DNA hypomethylation and increased expression of the DNA repair protein, O6- methylguanine-DNA-methyltransferase (MGMT). Hypoxia has been demonstrated to mediate MGMT expression and MGMT has been observed in hypoxic regions within gliomas [187]. These data suggest that restricted oxygen may be critical for the GSC response to DNA-damage inducing agents and cells that reside in hypoxic niches may be more able to evade treatment.
Due to the chaotic vascular architecture and fluctuating oxygen state, it is very challenging to directly disrupt the hypoxic niche. A more effective approach
37 would be to target the canonical hypoxia responsive signaling pathways. The
hypoxia inducible factors (HIFs) are transcription factors whose expression and
stability is regulated by oxygen tension. They exist as heterodimers, consisting
of an alpha and beta subunit. There are three isoforms of the alpha subunit:
HIF1α, HIF2α (also known as Endothelial PAS-domain protein 1, EPAS1), and
HIF3α. The HIFβ isoforms, also known as aryl hydrocarbon receptor nuclear translocator (ARNT and ARNT2), are constitutively and ubiquitously expressed across many cell types [188, 189]. The alpha subunit is oxygen-labile and degraded very rapidly in the presence of oxygen. Under low oxygen conditions, the alpha subunit is stabilized, translocates to the nucleus, binds to the beta subunit, and subsequently activates transcription. Although stable at low oxygen conditions, hypoxic cycling within a tumor has been suggested to promote the upregulation of HIF proteins to levels above those present in chronic hypoxic conditions. Hypoxic cycling also causes an increase in free radical generation, which is thought to also increase HIF protein translation [190].
HIF alpha subunits are regulated by the prolyl hydroxylase (PHD) family. In well- oxygenated environments, PHDs hydroxylate specific proline residues on HIFα subunits. The hydroxylation requires free iron and alpha-ketogluterate.
Chemical mimetics of hypoxia (such as deferoxamine mesylate) function via
PHD’s dependency on free iron. By chelating free iron in the cell, the alpha subunit cannot be hydroxylated and is then stabilized. However under normal conditions, this hydroxylation acts as a substrate for the E3 ligase, Von Hippel
38 Lindau factor (pVHL). pVHL binds the alpha subunit and targets it for
degradation by the proteasome.
The HIFα subunit is a basic helix-loop-helix protein whose structure and function
is evolutionarily conserved between mice and humans [191]. HIF1α has been
well-studied and is ubiquitously expressed in normal tissue. Further studies
characterized a second HIFα isoform as also being tightly regulated by oxygen
tension. Since its initial discovery, HIF2α was demonstrated to have shared
transcriptional targets with HIF1α such as VEGF, Tie-2, Ang2, and Flt1 (VEGF-
R1). HIF1α and HIF2α also bind homologous target DNA binding sequences
[192]. Despite their similarities, HIF2α expression was restricted to endothelial
cells of vascular organs and had several unique transcriptional targets such as
Oct4 and TGFα. These targets are outside the canonical pro-angiogenic hypoxic
response, which suggests an important and specific role for HIF2α in regulating
other cellular processes such as pluripotency. HIF2α is also induced at a
physiologic level of oxygen (around 7%), while HIF1α is only responsive to more
severe hypoxic conditions (<1% O2). While HIF1α and HIF2α share 75% homology, HIF2α is regulated at the transcriptional level as well as by traditional
PHD hydroxylation [193]) while HIF1α is only regulated at the protein level. Little is known about the third HIFα isoform. Several splice variants of HIF3α have been shown to be dominant-negative regulators of the other two alpha isoforms and has a limited expression pattern in the eye and cerebellum. Some HIF3α isoforms are also thought to be direct transcriptional targets of HIF1α activity
39 under hypoxia. Current studies are still unclear as to the primary function and regulatory mechanism through which HIF3α and its variants function [194, 195].
Induction of anaerobic metabolism and increased angiogenesis are important tumor functions regulated by the HIFs. HIF1α induces anaerobic metabolism by promoting glycolytic enzyme and glucose transporter expression [190]. It also promotes glucose flux through a nonoxidative arm of the pentose phosphate pathway. HIFs also mediate tumor invasion and metastasis as well as the cellular resistance to oxidative stress [196].
Certain disease states allow for the stabilization of the HIFα subunit even in the presence of oxygen. One of the more well-known conditions is renal cell carcinoma (RCC). In RCC, there is a biallelic inactivation of the E3 ubiquitin ligase responsible for targeting the HIFα subunits for degradation. Specimens from RCC patients have higher activity of HIF regulated pathways such as increased angiogenesis, altered glucose uptake and metabolism, and loss of growth control by mitogenic signals. HIF1α and HIF2α have unequal roles in
RCC and HIF2α is more important for disease progression. Inhibition of HIF2α suppresses in vivo tumor growth [197]. This suggests that in a system where both HIF1α and HIF2α are stabilized and functional, HIF2α is critical to tumor growth and survival whereas HIF1α is not.
40
In addition, in metastatic tumors such as breast cancer, HIFs upregulate the
expression of genes that promote the process of endothelial-mesenchymal
transition (EMT), including genes Twist1 and lysyl oxidase (LOX). LOX is an
enzyme involved in the remodeling of extracellular matrix to facilitate EMT.
Moreover, knockdown of HIF1α caused a reduction of tumor migration in vitro
and also impaired the invasive tumor phenotype in vivo [198].
HIF mediation of angiogenesis is particularly interesting in GBM, which are
classically tumors that are extremely vascularized. Vascular endothelial growth
factor (VEGF) is a downstream target of HIF proteins, as are other pro-
angiogenic factors such as angiopeitins[199, 200]. HIF induction will also lead to the downregulation of anti-angiogenic factors such as thrombospondin [201-203].
Viewing through mouse skin fold window chambers, Dewhirst and colleagues
observed angiogenesis as a response to hypoxia by expressing GFP under the
control of the VEGF HRE [181]. In their study, GFP induction was initially found
in regions lacking extensive blood vessels. In glioma, it has also been shown
that GSCs regulate angiogenesis through induction of VEGF [52]. The VEGF
inhibitor, Bevacizumab, has been shown to be useful in clinical trials to decrease
glioma growth [204]. The HIF signaling pathways in glioma present several
interesting therapeutic targets.
41 1.13-Glioma Stem Cells, Hypoxia, and HIF2α
The role of hypoxia in normal stem cell biology is well established.
Hematopoietic stem cells, for example, colonize hypoxic niches within the bone
marrow, where they are maintained in a quiescent state by hypoxia-induced
proteins such as osteopontin [205, 206]. Severe hypoxia inhibits the differentiation of normal NSCs [207]. Also, hypoxic conditions reduce differentiation in human embryonic stem cell cultures while not affecting their proliferation [208]. Hypoxia is also known to improve the generation of induced
pluripotent stem (IPS) cells [209].
Restricted oxygen has a significant role in GSC function (Figure 1C,C’). Hypoxia
promotes the formation of neurospheres in vitro of both GSCs and nonstem cells
[210]. In addition, stem cell genes such as Sox2 and Oct4 are upregulated in glioma cells under moderate hypoxia (5%). These data suggest that the hypoxic niche may act to maintain the GSC phenotype and may be able to induce changes in the functioning of GSC and nonstem glioma cells.
Current studies have revealed that both HIF1α and HIF2α are critical for GSC function. HIF1α is involved in maintaining the GSC population as stabilization of the protein expands the GSC population in a bulk tumor [16, 211, 212]. This effect is mediated in part by the PI3K/AKT and the Extracellular signaling related
42 kinase (ERK) 1/2 pathways [16]. HIF1α knockdown depletes the self-renewal capacity of GSCs, as measured by neurosphere formation [16, 198]. HIF1α also appears to antagonize the effects of the bone morphogenetic proteins [213].
Unfortunately, HIF1α is critical for the normal function of neural progenitor cells as well as normal endothethelial cells, thus limiting the potential for its inhibition for therapeutic benefit [13, 214].
In contrast, HIF2α has recently emerged as a potential therapeutic target for
GSCs. Specific stem cells factors such as Nanog, Oct4, and Sox2 are upregulated under moderate hypoxic conditions at which only HIF2α is stabilized
[210]. By evaluating in vitro measures of the cancer stem cell phenotype, such as neurosphere formation and stem cell marker expression, studies have shown that the stem-like population was enhanced. Using microarray techniques, they also determined that other genes related to stem cell functions, Sox2 and Oct4, were also increased in cells under hypoxia. Interestingly, these data showed genetic changes occurring at 7% oxygen where only HIF2α is known to be stabilized. This suggests a specific role of HIF2α in the plasticity of phenotype in cancer cells. A recent study revealed that HIF2α is preferentially expressed in the
GSC population [13, 17]. HIF2α is controlled at both transcriptional and post- translational levels whereas HIF1α mRNA is not. Specific knockdown of the
HIF2α gene reduces self-renewal of the GSCs, as measured by the formation of neurospheres in vitro. In vivo, HIF2α and HIF1α knockdown increases the survival of mice bearing intracranial gliomas. In neuroblastoma, HIF2α is also
43 upregulated in CSCs, which have a more immature neural crest-like phenotype,
indicating a link between HIF2α expression and a more stem-like cell state. [13,
17, 215]. Expression of HIF2α, specifically, marks neuroblastoma and breast
cancer cells with a more immature phenotype and the presence of HIF2α-positive
cells in tumors correlates with poor outcomes [215, 216].
HIF2α can also promote a more tumorigenic phenotype in nonstem glioma cells.
It has been previously shown that genes specifically regulated by HIF2α, such as
Oct4, Serpin B9, and Glut1, are preferentially expressed in GSCs [13]. I demonstrated that expression of non-degradable HIF2α in nonstem glioma cells is able to drive the expression of several stem cell genes, including Oct4, c-myc and Nanog [[15], detailed in Chapter 2]. Furthermore, the nonstem cells exhibited morphological changes from adherent astrocyte-like cells to neurospheres. Expression of non-degradeable HIF2α also increased the ratio of
GSCs to nonstem cells, as evidenced by cell surface marker expression. Lastly,
HIF2α overexpression in nonstem glioma cells conferred tumorigenic potential in
vivo in mouse flank xenografts. In addition to its role in maintaining the GSC
population, HIF2α has a limited expression in normal cells and has very low
expression in normal neural progenitors or other neural stroma [13]. These data
support HIF2α as a promising and novel clinical target for glioma.
Because of the clear reliance of GSCs on HIF proteins for their survival, there is
44 compelling evidence for HIF2α as a therapeutic target that could impair GSC responses to the hypoxic microenvironment thereby disrupting the niche. Several approaches are being explored to target HIF proteins. Drugs such as the aminoglycoside digoxin are currently used as a therapy for atrial fibrillation and other cardiac pathologies. In gliomas, digoxin has been shown to decrease HIF protein levels in vitro and to inhibit subcutaneous xenograft growth in mice [212].
However the caveat to broad spectrum drugs, such as digoxin, is that they indiscriminately affect both HIF1α and HIF2α, thereby leading to off-target effects in normal neural progenitors. More effective pharmacological inhibitors are currently in development that specifically target HIF2α. First reported by the
Iliopoulos group, the use of a chemical compound that is able to specifically bind to iron responsive elements (IREs) in the HIF2α transcript results in effective inhibition of HIF2α protein translation [217]. This inhibition disrupted downstream
HIF2α functions, including promotion of angiogenesis in a renal cell carcinoma model. These data suggest that it is possible to develop specific inhibitors for
HIF2α that could lead to effective clinical treatment and increased survival.
However, targeting of transcription factors, such as HIF2α, has been difficult and development of HIF2α-targeted drugs is still a field in its infancy. As more studies examine the specific role of the HIFs in GSCs, it is becoming clear that hypoxia is able to influence cell phenotype on a more global scale by regulating cancer epigenetics.
1.14-Epigenetics
45 Cancer is thought to be a genetic disease and significant research efforts have
been devoted to understanding how alterations in the genome can result in
cancer [218, 219]. However, it was discovered that additional levels of regulation and complexity lie within the physical structure of the chromosome. Epigenetics, or the study of changes in cell phenotype that involve mechanisms other than the underlying DNA sequence, revealed what was required in addition to transcription factors for specific genes to be transcribed. During active transcription, regions of the chromosome physically unwind in order to allow access to DNA sequences. DNA is further wound around proteins called histones
[220]. These histone-DNA complexes are referred to as nucleosomes. Histones
were originally identified in 1884 by Albrecht Kossel but were thought to only be
packing material for cellular DNA. It was not until 1990 that histones were
appreciated as the basis of an additional mode of cell phenotype regulation [220].
Core histones are comprised of four subunit proteins: H3, H4, H2a, and H2b; two
other histone proteins, H1 and H5, act as linker proteins between nucleosomes.
Each core histone protein possess amino acid “tails” that are post-translationally
modified and ultimately regulate the physical state of the histone and its
associated DNA. Modifications include methylation, acetylation, phosphorylation,
and sumylation. Histone methylation is the best-understood modification, which
is regulated by histone methyltransferases (HMTs) and demethylases (HDMs).
All histone-modifying enzymes recognize a specific substrate or amino acid on
the core histone tail. Upon binding their target amino acid, catalytic domains add
46 the post-translational modification. The modification then allows for changes in the nucleosome superstructure in order to permit or inhibit transcription factor binding of the DNA. For example, methylation of histone 3 at lysine 4 (H3K4) by
SET-domain (Su(var), enhancer of Zeste, trithorax) proteins causes a separation of the nucleosomes which then allows for recruitment of transcription factors as well as additional modification on other amino acid residues. In opposition, methylation of H3K27 causes a closure of open chromatin and inhibits DNA transcription. It is hypothesized that the balance of H3K4 and H3K27 methylation is a major contributor to whether a gene is actively transcribed [221-224].
Approximately 147 base pairs (bp) of DNA are wound around each set of core histone proteins. Upon modification of the histone amino tail, DNA can be released from the histone and accessed by transcription factors. However, specific base pairs within the DNA sequence can be epigenetically modified to prevent transcription as well. Specific families of proteins called DNA methyltransferases (DNMTs) recognize repeats of C-G base pairs (also referred to as CpG islands) and add a methyl group to the cytosine pyrimidine ring [225].
These methyl groups must be removed from the DNA in order for transcription to proceed; however no DNA demethylating proteins have yet been identified. The epigenetic phenotype is now recognized as a defining characteristic of cell state.
Recent experimental evidence has described how modulation of histones and
DNA methylation can control the pluripotency of cells in the body [226].
47
1.15-Induced Pluripotency
The pinnacle achievement of regenerative medicine would be to utilize a patient’s
own cells to generate new organs for replacement therapy. However somatic
cells, which contribute to nearly all of an adult’s cellular makeup were thought to
be terminally differentiated. Experimental evidence in the past five years has
demonstrated that differentiated cells maintain the capacity to become pluripotent
when stimulated with the appropriate factors. The Yamanaka group
demonstrated that mouse and human fibroblasts were capable of induced
pluripotency when transduced with stem cell factors Oct4, Sox2, c-Myc, and Klf4
[227-231]. These transcription factors promote the expression of other stem cell
genes and induce a pluripotent phenotype, creating a new cell type referred to as
induced pluripotent stem cells (iPSCs). However, the efficiency of transformation
is very low (<1%) [231]. Further studies revealed that the epigenetic state of the
target cells plays a vital role in determining efficiency. Microenvironmental
factors, such as oxygen tension, were found to promote cell reprogramming
largely due to the effect on histone modifications [209]. Subsequent studies have
further suggested that reprogramming cells in the epithelial cell state increased
efficiency. Induced pluripotency of fibroblasts required a change in cell
morphogoly, termed mesenchymal-to-epithelial transition (MET). However
reprogramming cells of epithelial origin significantly improved efficiency [232]. As
MET is likely to be involved chromatin remodeling, these studies suggest that
changes in cell phenotype require concomitant modifications to the epigenetic
48 phenotype. In the burgeoning field of GSC research, many similarities have
been observed between GSCs and normal stem cells. Recent experimental
evidence has demonstrated that nonstem glioma cells can be made tumorigenic following culture under specific conditions [15, 17, 18]. These data suggest that, like iPSCs, cancer cell epigenetics could play an important role in determining cell phenotype.
1.16-Epigenetic Modifiers in Glioma
The importance of CSC epigenetic pathways is not well understood. Initial studies focused on the role of DNA methylation in mediating gene transcription in glioma [233, 234]. These data revealed that many tumor suppressor genes were
hypermethylated (inhibiting transcription) and pro-proliferation genes were
hypomethylated (promoting transcription) at their DNA promoter sequence. For
example, DNA repair gene O(6)-methylguanine-DNA-methyltransferase (MGMT) was found to be hypermethylated in many forms of glioma. This marker could serve as a prognostic indicator for the widely used clinical drug, Temozolomide, as sensitivity to the drug had been dependent on MGMT status. Cells lacking
MGMT activity underwent apoptosis when treated with Temozolomide whereas cells that had high levels of MGMT were more resistant to treatment [235-237].
In general, gliomas that possessed low MGMT DNA methylation were resistant to
DNA damage-inducing chemotherapeutics. Although DNA methylation status provided promising biomarkers of tumor treatment resistance, it is still unknown
49 which proteins are responsible for methylating CpG islands within gene
promoters.
The polycomb genes (e.g. Bmi1 , EZH2 [Enhancer of Zeste-2]) repress
transcription by methylating Histone 3 at Lysine 27 (H3K27). Previous studies
have demonstrated the role of Bmi1 as a regulator of leukemic stem cell
proliferation [238, 239]. Continuing studies have identified a significant role for
Bmi1 in gliomas as well [240, 241]. However, the specific function of Bmi1 in
glioma is not understood. In leukemia, Bmi1 signaling through Ink4a/Arf
promotes cancer cell proliferation. Loss of Bmi1 or Ink4a/Arf can prevent tumor
formation and cells lacking Bmi1 demonstrate reduced differentiation potential.
Recent experimental evidence has demonstrated a particular importance of
EZH2 in GSC self-renewal [141, 242]. Inhibition of EZH2 by short-hairpin RNA
(shRNA) or pharmacologic disruption by S-adenosylhomocysteine hydrolase
inhibitor 3-deazaneplanocin A (DZNep) caused a loss of in vitro self-renewal and
in vivo tumor propagation by the GSC population. Although the complete
mechanism is not known, it is thought that EZH2 silences c-Myc [172], a known
GSC regulator [173]. Loss of EZH2 allows for unrestricted transcription of c-Myc, which then induces tumor formation. These data demonstrate that the function of epigenetic modifier, EZH2, in GSCs is a crucial regulator of the cell phenotype and suggest that the heterogeneous nature of glioma may be due in part to the function of epigenetic modifying proteins.
50
Opposite the polycomb proteins, the trithorax group activates transcription by
methylating histone 3 at lysine 4 (H3K4). Trithorax proteins have been less well
studied in the context of glioma but observations from leukemia indicate a
potential role for these enzymes in promoting a GSC phenotype. In particular,
the Mixed Lineage Leukemia 1 (MLL1) gene is involved in chromosomal
rearrangements in a variety of leukemias [243, 244]. MLL1 encodes a large
protein that includes a catalytic SET-domain [245, 246]. The loss of regulatory domains and aberrant downstream activity is common among MLL1 fusion proteins [247, 248] in leukemia, while alterations in MLL2 and MLL3 have been
implicated in glioma [219, 249]. MLL1 along with its binding partners may regulate
large numbers of genes during embryonic development and hematopoiesis, but
the number of target genes may be much smaller in adult tissues [246]. MLL1 function has been primarily investigated in leukemia models utilizing gene fusions that can aberrantly promote expression of tumorigenic target genes such as
HoxA9 [250]. Little is known about the wild-type function of MLL1 but a recent report demonstrated that DNA damage leads to MLL1 phosphorylation and checkpoint regulation [251]. In Chapter 3, I describe in detail my recent work concerning the novel function of MLL1 as a regulator of the hypoxic response in
GBM. These data implicate MLL1 and its family members as critical cellular regulators of normal stem cell biology (particularly in the brain) and leukemogenesis.
51 Lysine-specific demethylase 5B (JARID1B) is an epigenetic modifying protein
that is localized to the CSC fraction within melanoma [252]. Recent studies
demonstrated that JARID1B was present in a fraction of melanoma cells and
sorting based on JARID1B expression enriched for a slow-cycling population.
This population was able to give rise to highly proliferative and tumorigenic
progeny. Furthermore, JARID1B expression patterns did not conform to
previously observed CSC markers. Increased JARID1B has been observed in
other solid tumors such as those of prostate and breast cancer [253, 254], however its function in glioma is still unknown. Another epigenetic protein family, the jumonji-domain (JMJ) proteins have been shown to coordinate with JARID proteins and have also been implicated in neural cells and normal stem cells.
The JMJ-containing proteins are a family of histone demethylases that have been implicated in normal stem cell maintenance [255]. Recent studies have described the relationship between JMJ and JARID families and how they coordinate target gene occupancy in normal pluripotent cells [256, 257].
Additionally, JMJ family members have been shown to be required for demethylation of H3K27 and subsequent commitment of neuronal lineages [258,
259]. In several of these normal organ systems, the JMJ family is modulated by hypoxia [260-263]. These data suggest that functioning of specific epigenetic factors can be modulated by microenvironmental conditions. This is particularly interesting in the context of glioma, where clinical studies have demonstrated strong correlation of hypoxia to poor patient prognosis [264]. No studies to date
52 have elucidated the contribution of JMJ proteins in neural malignancies.
Furthermore, the already established role of hypoxia in maintaining the GSC population suggests that epigenetics could be critical for their function and further investigation is warranted. Considering the previous data that have demonstrated the intricate relationship between the microenvironment, tumorigenicity, and GSC phenotype, advances in clinical therapy may come from targeting the microenvironmental niche.
1.17-Opportunities for Targeting Glioma Stem Cells Via the Tumor
Microenvironment and Secreted Factors
While the majority of novel molecular based approaches have focused on targets present on tumor cells, the ability of the microenvironment to promote GSC maintenance provides new avenues for therapeutic intervention. Malignant gliomas display increased angiogenesis as well as increased expression of
VEGFs, supporting the creation of blood vessels through endothelial precursors
[52]. VEGF is a protein secreted by tumor cells that promote endothelial cell survival, migration and proliferation by binding to specific high affinity transmembrane receptors expressed predominantly on endothelial cells. Studies demonstrate that using bevacizumab (Avastin), a neutralizing anti-VEGF antibody approved by the United States Food and Drug Administration for the treatment of GBMs, reduce GBM growth [167, 204, 265]. Studies have shown that GSCs generate highly vascularized tumors in immunocompromised mice in
53 association with increased levels of VEGF [52, 266]. Treating endothelial cells
with conditioned media from GSCs treat with bevacizumab inhibited the
endothelial cell migration and tube formation [52]. Treating mice bearing GSC
initiated xenografts with bevacizumab or other anti-angiogenic agents (such as anti-SDF1 drug AMD3100) delayed tumor growth in vivo due in part to a decrease in tumor blood vessels as well as the percentage of GSCs [52, 59, 266-
268] However, several recent studies have called into question the long-term efficacy of anti-VEGF treatments [269, 270]. These studies have raised concerns that system anti-VEGF treatment may improve short-term patient outcome, but may ultimately lead to more aggressive malignancies. By “pruning” leaky vessels, anti-VEGF drugs like bevacizumab may in fact improve overall tumor vasculature. This could lead to increased invasion and more aggressive growth.
Another secreted factor known to support angiogenesis and can be produced by the tumor microenvironment is the cytokine interleukin 6 (IL6). IL6 production and signaling are highly correlated with tumor propagation as well as poor patient survival in many types of cancers, including GBM. Higher levels of IL6 protein are found in GBM samples in comparison to those of normal brains, and higher levels of IL6 mRNA are directly linked to poor patient survival [53]. Interestingly, within the neoplastic compartment the majority of IL6 is produced by the nonstem glioma cells whereas the IL6 receptors, gp130 and IL6Rα, are preferentially expressed on GSCs. These data suggest the importance of a paracrine loop
54 within the glioma cell populations. However, IL6 can also be secreted by
endothelial and immune cells and its expression can be stimulated by hypoxia, all
of which are important components of the tumor microenvironment [53]. Recent
data demonstrate that directly targeting IL6 or IL6Rα by shRNA impairs GSC
growth and survival in vitro, suggesting the significance of IL6 autocrine signals
in GSC maintenance [51]. Importantly, administration of anti-IL6 antibody
delayed the growth of tumors initiated with GSCS. These data strongly suggest
that targeting IL6 may be useful as anti-glioma therapies. The potential of anti-IL6
therapy is strengthened by data from clinical laboratories where anti-IL6 receptor
antibodies have been approved for Rheumatoid arthritis treatment, which
suggest that these therapies are tolerated well in patients [271].
From this background, it is clear that the cellular heterogeneity present in GBM
plays a critical role in tumor propagation and recurrence. Although there have
been concerted research efforts directed towards better understanding of GBM
pathology, the survival of patients has not drastically improved. In the following chapters, I detail my work in elucidating the contribution of the hypoxic microenvironment in tumor propagation. Furthermore, I describe the role of epigenetic modifying protein, MLL1, in regulating HIF2α transcription and ultimately the tumorigenicity of GSCs.
55
Chapter 2
Hypoxia Promotes the Glioma Stem Cell Phenotype Through HIF2α
Work done in collaboration with Zhizhong Li, Ph.D.
56 2.1-Introduction
Targeted therapies of GBM have largely failed in clinical trials with the notable exception of bevacizumab (Avastin), a neutralizing antibody against vascular endothelial growth factor (VEGF) that has shown promise in short term treatments [265, 272]. However several recent studies have suggested that continued treatment with anti-angiogenic agents results in a more aggressive malignancy [4, 5]. Despite substantial research efforts, the mechanisms underlying the overwhelming lethality of GBM remains unclear. GBMs frequently recur after therapy in a nodular pattern suggesting a clonal source of tumor growth. The functional cellular heterogeneity in the neoplastic compartment of cancers has been modeled with two proposed paradigms, a stochastic or random model in which every neoplastic cell has an equal chance of acquiring genetic changes required for tumor maintenance and a hierarchical model in which different populations have distinct capacities for tumor growth based on differentiation status [273].
Several groups have demonstrated that brain tumors (gliomas,
medulloblastomas, and ependymomas) display a functional cellular
heterogeneity with a potential hierarchy of differentiation [7, 41, 43, 274-276].
Glioma stem cells -- also known as tumor initiating cells or tumor propagating
cells -- are self-renewing cells that propagate tumors phenotypically similar to the
parental tumor. GSCs share some characteristics with normal neural stem cells:
57 expression of neural stem cell markers, capacity for self-renewal and long term
proliferation, formation of neurospheres, and ability for multi-lineage
differentiation into nervous system lineages (neurons, astrocytes, and
oligodendrocytes) [6, 10]. In contrast, solid cancer stem cells differ from normal stem cells in frequency, proliferation, aberrant expression of differentiation markers, chromosomal abnormalities, and tumor formation. The potent tumor initiation of cancer stem cells together with their radioresistance and chemoresistance suggests that these cells contribute to tumor maintenance and recurrence and targeting cancer stem cells may be important cellular targets [10,
11, 52, 160, 277-280]. The cancer stem cell hypothesis has been recently validated in a breast cancer clinical trial in which patients receiving cytotoxic chemotherapy displayed an increase in breast cancer stem cell frequency in residual tumor while a targeted therapeutic with an anti-cancer stem cell therapy stabilized the cancer stem cell population [281].
Normal stem cells are physically located in specific physical and functional
anatomical locations or niches that are essential for maintenance of self-renewal
and an undifferentiated state [266, 282]. We and others have found that GSCs
reside in a perivascular niche [12, 52] that recapitulates a relationship between
normal neural stem/progenitors and the vasculature [179, 283]. GSCs also promote the development of their own perivascular niche through the secretion of pro-angiogenic factors, prominently VEGF, but remain dependent on the niche
[284]. Florid angiogenesis is a defining hallmark of glioblastomas but these
58 tumors are also characterized by hypoxic regions of pseudopallisading necrosis.
Oxygen tension is tightly regulated in normal physiology and is an important
signal in development with low oxygen tension associated with maintenance of
an undifferentiated cell state. Hypoxia promotes the self-renewal of embryonic
stem (ES) cells and prevents the differentiation of neural stem cells in vitro [285-
287]. In vivo, hypoxia is likely to be a functional component of a normal stem cell niche as well. Hematopoietic stem cells are maintained in bone marrow, which contains a hypoxic niche [288]. However, the importance of the hypoxic niche in
GSC maintenance remains largely unknown.
In comparison to normal tissues, tumor cells have greater plasticity and this suggests that they can dramatically change their phenotypes depending on microenvironmental context [289]. Several studies have shown that restricted oxygen conditions expand the fraction of cells positive for a cancer stem cell marker or the side population in established cancer cell lines or cultures from human tumors may and increase expression of stem cell markers in stem cell marker positive cells [210, 277, 290-293]. These descriptive studies have left two important unresolved questions: 1) how does hypoxia regulate cancer stem cell self-renewal and tumor growth and 2) can nonstem cells be converted or reprogrammed towards a cancer stem cell phenotype? These questions are not only potentially important to basic tumor biology but also to the design of anti- cancer stem cell therapies as plasticity in cell state will inform the utility of these therapies.
59 2.2.-The Role of Hypoxia Inducible Factors in Cancer Stem Cell Self-
Renewal and Tumor Growth
In response to hypoxia, cells undergo modification of the transcriptome leading to
many alterations in cell biology – regulation of cell survival pathways,
proliferation, motility, and secretion of paracrine factors including pro-angiogenic
factors. Multiple mechanisms mediate these effects of hypoxia but prominent are
the hypoxia inducible factors (HIFs). While HIF1α is the focus of most HIF
studies, HIF2α serves a non-overlapping role in both normal physiology and
cancer biology, particularly in renal cell carcinomas, which contain mutations of the von Hippel Lindau factor (VHL, an E3 ligase for HIFα). We had previously demonstrated that GSCs preferentially stimulated tumor angiogenesis compared to nonstem glioblastoma cells through VEGF secretion and that bevacizumab specifically targeted the pro-angiogenic effects of cancer stem cells [52].
To build on these observations and investigate the molecular responses of cancer stem cells to hypoxia, we interrogated the expression and function of the
HIFs in cancer stem cell models [13]. Under hypoxic conditions, cancer stem cells displayed a specific pattern of gene expression relative to the nonstem cells. In addition to increased VEGF, cancer stem cells specifically regulated several targets (HIF2A and transcriptional targets of HIF2α: Oct4, Glut1, and
Serpin B9) under hypoxia to a greater degree than nonstem cells [13].
Conventional wisdom holds that hypoxia regulates HIF1α via post-translational
60 modification and proteosomal degradation – which we saw in our studies as well
– but HIF2α appears more complex with regulation at both transcriptional and
post-translational levels. Of note, different oxygen levels had different effects
when we measured HIF protein levels. GSCs displayed high levels of HIF2α under oxygen levels as high as 5% (within the normal physiologic range of oxygen in the brain and most tumor areas [294, 295]) whereas HIF1α was present in both GSC and nonstem cells only at more severe hypoxic conditions
(≤1%). The regulation of HIF2α was not a general stem cell phenomenon, as normal neural progenitors expressed essentially no HIF2α mRNA or protein [13].
To extend these studies into the original tumors, we performed dual labeling immunofluorescence studies of human glioblastoma surgical biopsy specimens and detected stem cell markers (CD133, Olig2) and HIF2α in two locations: perivascular locations and around areas of necrosis [13]. Strikingly, nearly all
HIF2α positive cells expressed stem cell markers but the HIF2α positive cells marked a subpopulation of cells that expressed stem cell markers suggesting that these cells are a subpopulation in stem or progenitor cells.
We interrogated the functions of HIF1α and HIF2α in both cancer stem cells and nonstem cells through RNA interference in functional assays. Depleting either
HIF1α or HIF2α inhibited serial neurosphere generation (an indication of attenuated self renewal) and proliferation while inducing apoptosis but only
HIF1α regulated nonstem glioblastoma cell proliferation and survival [13].
Further, we were able to address the regulation of VEGF in these studies and
61 found that both HIF1α and HIF2α controlled cancer stem cell VEGF levels
(indeed, in results not included in the paper we found this regulation to be non- overlapping and additive) and endothelial cell proliferation whereas only HIF1α functioned in nonstem glioblastoma cells. The most important assay in defining cancer stem cells is tumor propagation. We found that selected glioblastoma stem cells with targeted HIF1α or HIF2α did not initiate tumors on xenotransplantation supporting an essential role for both HIFs. Finally, in silico analysis of the HIFs at the mRNA level in a patient database (REMBRANDT) showed that HIF2α but not HIF1α levels informed negative survival [13]. Taken together, these studies show that cellular responses to restricted oxygen levels are necessary for cancer stem cell maintenance with both HIF1α and HIF2α important but HIF2α more specific and selective for cancer stem cells.
2.3-Hypoxia Reprogams Nonstem Cancer Cells towards a Stem-like
Phenotype
Based on the association of hypoxia with glioma stem cells established in our previous study and indications from other studies that bulk tumor populations may increase the number of glioma stem cell marker positive cells, we hypothesized that hypoxia may induce a stem cell phenotype in nonstem glioma cells (inducing a plasticity of differentiation). I now demonstrate that extended exposure to hypoxia can result in a phenotypic shift in the nonstem population to mirror that of the stem-like subset and promote cell growth and self-renewal. I
62 investigated how hypoxia contributes to the glioma stem cell phenotype and whether nonstem glioma cells area able to respond to changes in the hypoxic microenvironment by altering growth and gene expression patterns.
To determine the effect of hypoxia on stem and nonstem cells, I created cultures of cells enriched or depleted for glioma stem cells from patient biopsies using our previously described methodology [10]. After separation of these distinct populations, I validated enrichment or depletion of the stem population by in vitro functional assays, including fluorescence-activated cell sorting (FACS) for known glioma stem cell markers such as CD133, and in vivo tumorigenic propagation.
The conventional in vitro method of measuring self-renewal is the neurosphere formation assay. This assay displays a cell’s ability to self renew by generating neurospheres (suspended spheroids of cells) starting with as little as a single cell. Cells were pretreated in hypoxia and sorted into low adhesion culture plates.
I found that nonstem cells cultured under hypoxia were able to form neurospheres at twice the rate of control cells in normoxia (Figure 2A).
Additionally, when closely examining the spheroids, nonstem cells under hypoxia formed larger neurospheres compared to control cells grown in normoxia (Figure
1B). This observation was true for both glioma cell populations. This result suggests that a hypoxic microenvironment plays a critical role in promoting and maintaining the ability of stem-like cells to self-renew and can even confer self- renewal capability to the nonstem population. Self-renewal is closely tied to proliferation. I next investigated how cellular proliferation may play a role in this neurosphere forming phenotype and how hypoxia alters glioma cell proliferation.
63
Figure 2. Hypoxia enhances neurosphere formation and cell proliferation. (A) Glioma nonstem and glioma stem cells were harvested from a T4121 primary human patient specimen. Cells were plated at a density of 10 cells/well and cultured in 21% or 2% oxygen. Values were recorded as a percentage of positive wells divided by total wells. (B) Following 1 day or 14 days of treatment, representative phase contrast images were taken at 20x magnification on a Leica wide field microscope. Images of the glioma stem cells at the single cell level were not included due to space considerations. (C) T4121 Glioma nonstem and glioma stem cells were plated at a density of 500 cells/well. Cells were cultured at 2% or 21% oxygen immediately after plating for 0, 5, or 10 days per condition. Cell titer was measured by Cell Titer Glo (Promega). *, p < 0.05 (D) Following 5 or 10 days treatment, T4121 nonstem glioma cells were plated on glass cover slips. The following day cells were treated with 10 µM EdU (Invitrogen) for 1 hour. Ten representative fields for each condition at Day 5 and Day 10 were analyzed by Image J software for number of EdU positive cells divided by the total cell number. *, p < 0.01 with Student’s t-test comparison of hypoxia cultured cells to cells grown under normoxia. 64 T4121 glioma stem and nonstem cells were pretreated in hypoxia for several days and then sorted onto 96-well culture plates. After long-term culture at normoxic or hypoxic conditions, distinct growth advantages were noted (Figure
2A-C). Cells grown in hypoxia had increased growth over long term observation compared to cells grown in normoxia, suggesting a cellular response sensitive to changes in the microenvironment. Interestingly, altered cell growth was observed in both the stem and nonstem population, indicating a conserved response mechanism between the two populations. I quantified the percentage of actively proliferating cells during hypoxic culture. This differential growth response was quantified by incorporation of 5-ethnyl-2’-deoxyuridine (EdU, a thymidine analog; Figure 2D). The labeling showed that after 5 days, cells growing under hypoxia had slightly fewer proliferating cells than cells growing in normoxia, as was expected from our previous cell titer data. At day 10 the number of actively proliferating cells was significantly higher under hypoxia compared to cells grown under normoxia. Thus, in hypoxic conditions nonstem glioma cells acquire self-renewal and long term proliferative potential.
To elucidate potential mechanisms underlying these observations, we measured the changes in gene expression in the nonstem population following long term culture at normoxia or hypoxia. Using semi-quantitative real time PCR, I measured the levels of several important genes related to stem cell function. Of the stem genes measured, OCT4, NANOG, and c-MYC displayed significant and consistent increase in T4121 nonstem glioma cells in addition to several other
65 patient biopsy cell lines exposed to hypoxia (Figure 3A and data not shown) to basal levels in the matched glioma stem cell populations at normoxic conditions.
This may indicate a role of gene expression in promoting growth and survival when cells are exposed to microenvironmental (hypoxic) stress. This finding is also important due to the known functions of OCT4, NANOG, and c-MYC in embryonic stem cells. c-MYC has been shown to be important in controlling a wide variety of stem cell functions such as proliferation, self-renewal, and apoptosis. It is also known as a potent oncogene and is known to be an important factor in the creation of induced pluripotent stem cells. NANOG is known to work in complex with OCT4 and plays a major role in maintaining pluripotency in embryonic stem cells [296, 297]. My study was one of the first to indicate that NANOG is downstream target of hypoxia. OCT4 is also required for maintenance of self-renewal in stem cells and is tightly regulated in order to maintain appropriate levels of self-renewal in the embryo [298]. Additionally, recent studies have shown that OCT4 is a downstream target of HIF2α [299].
This study shows that the nonstem cells are able to upregulate stem cell-related genes in a similar manner to the GSC population. I confirmed the expression of
HIF2α in nonstem cells under long-term hypoxia by immunoblotting (Figure 3B) and Nanog expression by immunofluoresence (Figure 3C). These data confirm that hypoxia can induce plasticity in cellular differentiation and reprogram nonstem cells towards a more stem cell-like state.
66
Figure 3. Exposure to long-term hypoxia increases mRNA levels of known stem genes. (A) T4121 stem and nonstem glioma cells were cultured in hypoxia at 1% oxygen for 10 days. *, p < 0.05 compared to GSC grown at 21% oxygen #, p < 0.05 compared to nonstem glioma cell grown at 21% oxygen Bars show standard error of the mean (SEM) for two separate reactions. (B) Hypoxia was chemically induced in T4121 nonstem glioma cells by using 100 µM deferoxamine for 48 hours. Left lane is control T4121 nonstem glioma cells treated with equal volume of water only. (C) T4121 stem and nonstem cells were cultured in 1% oxygen or normoxia at 21% oxygen in 8-well chamber slides (Nunc) for 10 days. Images were taken on a Leica wide field fluorescent microscope and are representative fields. White scale bars denote 25 µM.
67 2.4-HIF2α Promotes a Glioma Stem Cell State
We previously demonstrated that HIF2α is necessary to maintain a glioma stem cell phenotype and HIF1α is expressed in all hypoxic tumor cells. I therefore hypothesized that HIF2α may be sufficient to induce a glioma stem cell phenotype in nonstem glioma cells. To determine the specific role of HIF2α in cellular reprogramming in cancer, I expressed HIF2α in normoxic conditions to avoid other hypoxia-induced mechanisms. I utilized two complementary strategies: the first being delivery of ectopic HIF2α and the second being use of a non-degradable HIF2α mutant (referred to as HIF2α-PA, a kind gift of William
Kaelin). The latter HIF2α construct contains two proline residues mutated to alanine [300]. This mutation prevents prolyl hydroxylase from hydroxylating the
HIF2α protein and targeting it for proteosomal degradation. The non-degradable form of the protein was transduced into three nonstem cell populations of patient biopsy lines: D456MG, T3946, and T4302. To demonstrate that the construct was functional we harvested lysates from transduced D456MG cells cultured under normoxia and immunoblotted for HIF2α (Figure 4A). The cells showed strong protein expression of HIF2α at normoxic conditions, indicating successful delivery of stable HIF2α to the cells. T3946 and T4302 nonstem glioma cells were transduced with ectopic HIF2α and cultured for 7 days in serum-free media.
Under standard conditions, glioma nonstem cells grow as adherent monolayers
(Figure 4B, “Vector”) while HIF2α transduction induced morphological changes
(Figure 4B, “HIF2α”) similar to the detached spheroids of glioma stem cells or hypoxic nonstem cells. Although imperfect [8], CD133 has been employed as a
68
Figure 4. Ectopic expression of non-degradable HIF2α causes morphological and phenotypic changes in nonstem glioma cells. (A) D54MG glioma cells were transfected with non-degradable HIF2α or empty pBabe vector control. Lysates were immunoblotted for the presence of HIF2α. Left lane is negative control cells containing empty pBbabe vector backbone. (B) T3946 and T4302 nonstem glioma cells were transfected with non- degradable HIF2α. Phase contrast images were taken 9 days after transfection. (C) Cells were analyzed by flow cytometry for the presence of surface marker CD133 (Prominin-1). *, p < 0.05. (D) U87MG glioma cells transfected with non-degradable HIF2α were harvested for total RNA after puromycin selection. PCR data was normalized to Actin for each measurement. *, p < 0.05.
69 surface marker to enrich for brain tumor stem cells [7, 13, 18, 43, 168]. We quantified the CD133 positive fractions of T3946 and T4302 cultures transduced with either vector control or HIF2α and found that HIF2α induced an increase in the CD133 positive fraction (Figure 4C). In data not shown, I found that HIF2α induces only a small direct increase in CD133 mRNA suggesting that the primary effect of HIF2α is not direct transcriptional control but rather a conversion to a more glioma stem cell state. Next, I measured levels of stem genes with HIF2α expression that were preferentially upregulated under hypoxia in the studies above. T4121 nonstem glioma cells were transduced with non-degradable
HIF2α and 72 hours later I quantified the transcript levels of target stem genes I had previously showed to be increased under hypoxia using semi-quantitative
PCR. In HIF2α expressing cells, OCT4, NANOG, and c-MYC transcripts were significantly upregulated (Figure 4D). These data support my hypothesis that
HIF2α is sufficient to induce a glioma stem cell phenotype.
To determine the contribution of HIF2α in inducing a glioma stem cell phenotype in vivo, nonstem D456MG cells were transduced with either vector control or non-degradable HIF2α and grown in serum-free media for 7 days. To optimally control in vivo conditions, I implanted vector control or non-degradable HIF2α in contralateral flanks of immunocompromised mice. D456MG cells expressing non-degradable HIF2α formed significantly larger tumors than vector control
(Figure 5A,B). In sum, these data show that HIF2α alone can reprogram differentiated, nonstem glioma cells towards an undifferentiated state.
70
Figure 5. Overexpression of HIF2α in glioma nonstem cells increased tumorigenic capacity. (A) Glioma nonstem cells isolated from D456MG glioma xenograft were transfected with vector alone or HIF2α constructs. 100,000 cells were injected into nude mice subcutaneously. Image shows a representative mouse with apparent tumor from glioma nonstem cells that overexpress HIF2α but not vector alone. (B) Tumor-bearing mice were sacrificed at day 43 and tumors were excised and measured. (C) The growth of tumors were monitored and measured at a daily rate. *, p < 0.05.
71 2.5-DISCUSSION
Glioblastoma is among the most lethal cancers and current treatment modalities
are limited in increasing the lifespan of patients [1, 301, 302]. We and others
have shown that glioma stem cells potentially contribute to glioblastoma
treatment failure as glioma stem cells are resistant to radiotherapy and
chemotherapy [10, 11, 69, 71, 72, 74, 76, 77, 156, 277, 303]. The limited efficacy of cytotoxic therapies in most advanced cancers has led to the development of many novel molecularly targeted therapies. The targets of these therapies are varied but a common biologic target of the more successful of these therapies is angiogenesis [12, 304]. The neutralizing VEGF antibody bevacizumab has been approved for the treatment of several solid cancers, including recurrent glioblastoma. The mechanism by which bevacizumab functions has been an unresolved area of active investigation but recent work from our laboratory and others suggest that bevacizumab may target glioma stem cell induced angiogenesis and disrupt the functional perivascular niche in which glioma stem cells reside [12, 52, 60]. These studies are important as the clinical application of anti-angiogenic therapies remains to be optimized and methods of resistance are being identified. For example, patients with recurrent glioblastomas treated with a low molecular weight VEGF receptor antagonist, cediranib (AZD2171), displayed increases in bFGF, the SDF1α chemokine, and viable circulating endothelial cells [305]. As bFGF and SDF1α regulate glioma stem cell proliferation, maintenance, and motility, these escape mechanisms may indicate a contribution of glioma stem cells to resistance to yet another cancer
72 treatment. Indeed, anti-angiogenic therapy may induce invasion and metastasis
[4, 5], which are strongly linked to the glioma stem cell phenotype [306].
Hypoxia is one of the most potent driving forces for tumor angiogenesis. Hypoxia has also been linked to tumor progression, metastasis, invasion, and therapeutic resistance in cancer biology. As these characteristics are enriched in glioma
stem cells, it is not surprising that hypoxia may regulate glioma stem cells.
Indeed, several studies have shown that hypoxia increases the number of cells
that express glioma stem cell markers in bulk populations [16, 277, 290-293], but
these studies used bulk cells limiting the ability to distinguish effects of hypoxia
on neoplastic subpopulations. Two potential explanations are evident: an
increase in glioma stem cell proliferation or a conversion of nonstem glioma cells
to a glioma stem cell phenotype. In our current studies, we see evidence of both
effects – hypoxia augments maintenance of glioma stem cells and reprograms
nonstem cells towards a more stem cell behavior. These results potentially
inform the development of anti-glioma stem cell therapies. Targeting only glioma
stem cells may be insufficient to improve patient outcomes because the nonstem
cells may acquire stem cell characteristics due to effects of the
microenvironment. Indeed, simultaneous targeting the tumor microenvironment
may be essential for efficacy of glioma stem cell therapies.
These studies also suggest that standard culture conditions may fail to maintain
73 the cellular heterogeneity present in parental tumors. Previous research has
already shown that cancer cells grown on extracellular matrix display striking
differences compared to all grown on plastic [307]. Recent studies have now shown that similar approaches may improve maintenance of glioma stem cells
[308, 309]. Serum has also been used in culture but serum induces differentiation and irreversibly alters gene expression of cancer cells [47]. Our work and that of others suggest that cancer cells should be maintained under restricted oxygen conditions, much like embryonic stem cell growth and in vitro fertilization can be facilitated with oxygen levels lower than the level in room air.
Hypoxia alters the expression levels of hundreds or thousands of genes so it is unlikely that a single mechanism will explain the cellular responses of glioma stem cells or reprogramming effects of hypoxia. However, we recently described essential roles of the hypoxia inducible factors (HIFs) in promoting tumorigenesis
[13]. While HIF1α was expressed in all neoplastic cells and normal neural progenitors suggesting a potentially limited therapeutic index, HIF2α functioned specifically in glioma stem cells without expression in the normal progenitors. In support, a recent study of neuroblastoma biopsy specimens showed that HIF2α marked a perivascular location with cells that express immature neural crest markers. Thus, HIF2α inhibitors may be a relatively specific anti-glioma stem cell therapy for nervous system cancers. Small molecule inhibitors of HIF2α translation are under development68 and may have utility for glioma stem cells.
74
In the current study, we have also shown that hypoxia induces the expression of
key stem cell genes, specifically Nanog, Oct4, and c-Myc, in nonstem glioma cells. These genes have gained attention as Yamanaka and co-workers demonstrated that these factors with Sox2 reprogram fully differentiated fibroblasts into pluripotent stem cells (i.e. induced pluripotent stem cells, iPSCs)
[230, 231]. While Nanog has yet to be fully investigated in glioblastomas, Oct4 has been shown to be expressed by human gliomas and induces colony formation [310] while we and the DePinho laboratory have shown that c-Myc is
important in glioblastoma stem cell maintenance [173, 311]. Oct4 is a specific
target of HIF2α in cell lines [299], which we were able to confirm in glioma stem
cells [13, 15, 96]. HIF2α interacts with c-Myc by binding and stabilizing c-Myc containing complexes, while HIF1α disrupts these complexes [312]. Therefore,
HIF2α may directly regulate core stem cell pathways that are essential in glioma stem cell maintenance.
There are a number of other potential molecular targets of hypoxia with direct relevance to glioma stem cells. Hypoxia requires Notch signaling to maintain an
undifferentiated state and prevent neuronal and myogenic differentiation in
normal cells, and similar Notch dependence has been demonstrated in hypoxia-
induced epithelial-mesenchymal transition (EMT) and invasion [313]. Hypoxia
and the HIFs may also attenuate the ability of bone morphogenic proteins
75 (BMPs) to induce differentiation of gliomas [213]. BMPs regulate cell fate
decisions in the central nervous system and regulate brain tumor stem cell differentiation and proliferation [142].
In conclusion, recent studies and my current data strongly support a novel
significance in hypoxia and the hypoxia inducible factors in cancer biology
through regulation of cellular differentiation and the glioma stem cell phenotype.
We must now revise the hierarchical model to include a bidirectional relationship
with differentiation potential as hypoxia and HIF2α may induce a glioma stem cell
phenotype (Figure 6A). It is also clear that glioma stem cells can reside within at
least two niches within the same tumor type, a perivascular niche and a hypoxic
niche (Figure 6B). However it is not clear by what mechanism the hypoxic niche
and HIF2α exert their effects. By drawing comparisons to the field of iPS, recent
experimental evidence would suggest that glioma cell epigenetic modifications
may play a critical role in the hypoxic response. Specifically, changes in
methylation patterns of H3K4 and H3K27 are indicative of alterations in the cell
phenotype. However the function of histone modifying factors is not well known
in glioma. Few studies have examined the relative expression of these factors in
GSCs and no studies have interrogated the effect of hypoxia on histone
methyltransferases. In order to elucidate the contribution of epigenetic modifying
factors to tumor propagation, I next determined the relative expression and
hypoxic response of histone modifying proteins.
76
Figure 6. The Role of Hypoxia in the Glioma Stem Cell Hypothesis. (A) The hierarchical model of tumor heterogeneity includes plasticity of cellular differentiation based on the effects of the tumor microenvironment. (B) Cancer stem cells reside in two niches: (1) the perivascular niche and (2) areas of hypoxia.
77 2.6-Materials and Methods
Isolation of Glioma Stem Cells and Nonstem Glioma Cells
Matched cultures enriched or depleted for GSCs were isolated from primary human brain tumor patient specimens or human glioblastoma xenografts as previously described in accordance with a Duke University Institutional Review
Board approved protocol concurrent with national regulatory standards with patients signing informed consent [10, 13]. Briefly, tumors were disaggregated by Papain Dissociation System (Miltenyi) and filtered using a 70 µm cell strainer according to the manufacturer’s instructions. Cells were then cultured in stem cell culture medium supplemented as detailed below for at least four to five hours to recover surface antigens. Cells were then labeled with APC- or PE-conjugated
CD133 antibody, and sorted by fluorescence-activated cell sorting (FACS).
Alternatively, cells were separated using a magnetic sorting column, using microbead-conjugated CD133 antibodies. CD133-positive cells were designated as GSCs whereas CD133-negative cells utilized as nonstem glioma cells.
Tissue Culture and Hypoxia Induction
GSCs were cultured in Neurobasal media with B27 (without Vitamin A,
Invitrogen), basic fibroblast growth factor (10 ng/ml) and epidermal growth factor
(10 ng/ml). After trypsinizing, nonstem tumor cells were cultured overnight in
Dulbecco’s minimal essential media (DMEM) and 10% serum to allow cell
78 attachment and survival. Then, in some cases, DMEM medium was removed iand the cells cultured in supplemental Neuralbasal medium in order for experiments to be performed in identical media. In order to induce hypoxia, cells were cultured in multi-gas chambers (Sanyo). Nitrogen gas was supplied to the chambers in order to compensate for the reduced percentage of oxygen.
Alternatively, cells were treated by 200 µM hypoxia-mimetic deferoxamine mesylate (DFX, Sigma).
Neurosphere Culture Assay
T4121 Stem and Nonstem glioma cells were cultured in normoxia (21% oxygen) or hypoxia (2% oxygen) in Neurobasal media with B27 plus growth factors (stem cells) or DMEM plus 10% serum (nonstem cells) for 10 days prior to plating. At day 10 cells were trypsinized and sorted by trypan blue counting into 24 well low adhesion plates containing Neurobasal media with B27 plus growth factors at a density of 10 cells/well. Wells were observed over 14 days. Wells were counted as positive for neurosphere formation if they contained at least spheroid.
Cell Titer Assay
T4121 nonstem glioma cells were trypsinized and plated into 96 well plates contained DMEM plus 10% serum at a density of 500 cells/well. They were cultured in 2% or 21% oxygen for 0, 5, or 10 days. At each time point total ATP
79 per well was measured by Cell Titer Glo kit (Promega) and subsequent
luminescence was read by illuminometer (PerkinElmer).
Immunofluorescent Imaging
Cells were fixed in 4% paraformaldehyde (Sigma) for 15 minutes at room
temperature. After fixation, cells were washed with PBS. Blocking buffer containing normal goat serum plus Triton X-100 in PBS were added to the washed cells for 30 minutes at room temperature. Following blocking, primary antibody, NANOG (Santa Cruz), was added at appropriate dilutions as noted by the manufacturer. Antibodies were incubated at 4° Celsius overnight. The next day secondary antibodies conjugated to fluorescent isotopes (Alexa Fluor,
Invitrogen) were added to cells at appropriate dilutions. After incubation in secondary antibody, Hoescht 3342 nuclear stain was added to the cells for 5 minutes.
EdU Labeling and Imaging
Following 5 or 10 days culture in hypoxia, T4121 nonstem glioma cells were trypsinized and plated on glass cover slips at a density of 10,000 or 20,000 cells per slip. After 24 hours recovery in hypoxia or normoxia, cells were dosed for 1 hour with 10 µM of EdU (Invitrogen). Following dosing cells were fixed by 4% paraformaldehyde (PFA) and blocked using 3% BSA in PBS. The slides were
80 then stained using fluorescent secondary antibody directed against Edu, and stained with Hoescht 33342 nuclear dye. All images were taken on a Leica wide field fluorescent microscope. Ten representative fields for each condition were quantified for number of Edu positive cells divided by total number of cells using
Image J software.
Semi-Quantitative PCR
PCR was performed on cDNA generated by Superscript III reverse transcriptase
(Invitrogen). Total RNA was harvested from cells using RNAeasy Kit (Qiagen).
Primers used were as follows: OCT4 forward 5’-
GAGAACCGAGTGAGAGGCAACC-3’ and reverse 5’-
CATAGTCGCTGCTTGATCGCTTG-3’. NANOG forward 5’-
AATACCTCAGCCTCCAGCAGATG-3’ and reverse 5’-
TGCGTCACACCATTGCTATTCTTC-3’. c-MYC forward 5’-
TCAAGAGGCGAACACACAAC-3’ and reverse 5’-GGCCTTTTCATTGTTTTCCA-
3’. HIF1α forward 5’-TCCATGTGACCATGAGGAAA-3’ and reverse 5’-
CCAAGCAGGTCATAGGTGGT-3’. HIF2α forward 5’-
CCACCAGCTTCACTCTCTCC-3’ and reverse 5’-
TCAGAAAAAGGCCACTGCTT-3’. All data was normalized to Actin or GAPDH transcript levels.
81 In Vivo Tumor Formation Assays
Intracranial or subcutaneous transplantation of GSCs into nude mice was performed as described in accordance with a Cleveland Clinic Foundation
Institutional Animal Care and Use Committee approved protocol concurrent with national regulatory standards. Briefly, 72 hours after hypoxic treatment, cells were counted and certain number cells were implanted into the right frontal lobes of athymic BALB/c nu/nu mice. In some cases, 48 hours after infection, 1 mg/ml puromycin was applied to select infected cells for 48 hours before counting. Mice were maintained up to 25 weeks or until the development of neurological signs.
Brains of euthanized mice were collected, fixed in 4% Paraformaldehyde (PFA), and paraffin embedded.
Statistical Analysis
Descriptive statistical analysis was generated for all repeated quantitative data with inclusion of means and standard error. Significance was tested by one- way analysis of variance (ANOVA) or Student’s t-Test using SigmaStat 3.5
(Chicago, IL).
82 Chapter 3
The Hypoxic Response in Glioma Cells
Requires the Epigenetic Modifier, MLL1
83 3.1-Introduction
Glioblastomas (GBMs) are one of the most lethal adult malignancies with current therapy offering only palliation [1, 302]. Recent elegant genetically engineered models [2] and systematic genomic analyses [3, 218] have provided new insights into GBM pathogenesis. Characterization of GBM molecular subtypes has further refined our understanding of the intertumoral heterogeneous nature of the disease [86-88]. Additional complexity in tumor biology is deterived from intratumoral heterogeneitity within the neoplastic compartment. Cellular heterogeneity is driven by two complementary forces: stochastic genetic mutations and epigenetic hierarchies [6]. At the apex of the tumor hierarchy are cancer stem cells (CSCs, also known as tumor initiating cells or tumor propagating cells), which are functionally defined by their capacities for self- renewal and ability to propagate tumors [6]. While some cancers may not follow the CSC model, GBMs have been the subject of numerous studies supporting the presence of GBM stem cells (GSCs) [8, 10, 13, 14, 59, 104, 136, 143, 168,
276]. GSCs remain controversial due to the unresolved nature of the cell(s) of origin, immunophenotypes (enrichment markers), and frequency within tumors.
Rigorous functional studies have permitted the identification and characterization of GSCs [8, 11, 54] and provided evidence that GSCs are resistant to conventional therapy [10, 71, 72, 78, 156, 303]. GSCs are enriched in regions around tumor vessels and necrosis [12, 13], the latter associated with restricted oxygen/hypoxia. GSC maintenance requires both hypoxia inducible factor-1α
(HIF1α) and hypoxia inducible factor-2α (HIF2α) with HIF2α being preferentially
84 expressed in the GSC compartment [13, 15-17]. However, the molecular
mechanisms mediating the effects of hypoxia and HIF2a promote a stem-like
state are poorly characterized, and the regulation HIF2a expression in GSCs is
unknown. Microenvironmental conditions such as hypoxia and acidic stress
actively promote the expression of GSC markers and functional characteristics
[15-18], suggesting that the GSC phenotype is plastic and can be modulated by
the microenvironment, reminiscent of induced pluripotency [209, 230, 231].
Indeed, molecular regulators of induced pluripotent stem cells (iPSCs), such as
Sox2 and c-myc, are expressed by GSCs and regulated by the microenvironment
[91, 173]. As normal stem cells exhibit characteristic chromatin patterns [222,
314-317], we interrogated GSC chromatin regulation in response to hypoxia.
The polycomb proteins (e.g. Bmi1), which repress transcription, have received substantial attention in glioma and GSCs [78, 90, 240], but the trithorax proteins, which activate transcription, has been less well studied and may represent important molecular regulators of cancer phenotypes. One member of the trithorax group involved in cancer is Mixed-Lineage Leukemia 1 (MLL1) [also known as HRX (human trithorax) or ALL-1 (acute lymphocytic leukemia-1)], which is involved in chromosomal rearrangements in a variety of leukemias, including the majority of infant leukemias [243, 247, 248, 318, 319]. MLL1 encodes a large protein (3969 amino acids) with several functional domains, including a SET (Su(var), Enhancer of zeste, Trithorax) domain that contains histone methyltransferase (HMT) activity [243, 245, 250, 251, 320]. The loss of
85 regulatory domains and aberrant downstream activity are common among MLL1
fusion proteins [244, 247, 318] in leukemia. MLL1 has not been associated with
brain tumors to date, but MLL2 and MLL3 are mutated or amplified in medulloblastomas and GBMs [219, 249]. Methylation of specific histone lysine residues may either activate or silence gene expression. Concurrent modification of H3K4 and H3K27 is commonly found in stem cell populations and causes genes to be silenced but poised for activation by MLL1 or other chromatin modifying proteins, as observed in normal neurogenesis from postnatal neural progenitor cells [321]. MLL1 directly functions as a histone 3 lysine 4 (H3K4) methyltransferase but can also recruit histone 3 lysine 27 (H3K27) demethylases into its complex [245, 246]. Although the MLL1 complex may regulate large
numbers of genes in some cell types during embryonic development and
hematopoiesis, the number of target genes may be much smaller in adult tissues
[246]. The significance of MLL1 has been largely investigated in leukemia models
using gene fusions [247, 248, 250, 322], which transform hematopoietic progenitors and can aberrantly promote expression of tumorigenic target genes such as the homeobox gene, HoxA9. Little is known about wild-type MLL1, but a recent report demonstrated that DNA damage leads to MLL1 phosphorylation and checkpoint regulation [251]. Further, the core stem cell regulators p53 and b- catenin associate with MLL1 during transcriptional activation [323]. Thus, MLL1 and its family members are critical cellular regulators of normal stem cell biology
(particularly in the brain) and oncogenesis that integrate a variety of pathways in transcriptional regulation.
86
Based on this background I hypothesized that MLL1 may be implicated in the hypoxia response of GBMs and in regulating the tumorigenicity of GSCs. In this study, I examined the relationship between hypoxia and the histone modifier
MLL1. Furthermore, I sought to better understand how MLL1 might regulate
HIF2α expression and downstream hypoxia responses that have been previously
described as important to the tumorigenic phenotype. Finally, I interrogated the
effect on tumor propagation following modulation of MLL1 in GSCs.
3.2-Hypoxia increases expression of histone methyltransferase, MLL1.
As studies have defined the ability of hypoxia to regulate epigenetic modifiers
[209], I interrogated the importance of epigenetic regulators on the hypoxia- induced GSC phenotype. One epigenetic modifier previously implicated in leukemia stem cells is the histone methyltransferase MLL1. To determine if MLL1 could play a role in GBM hypoxia response, I evaluated the transcriptional response of MLL1 to environmental oxygen using xenograft-derived 4121 and
387 nonstem cells, which had been previously characterized to gain GSC characteristics after exposure to hypoxia [15]. MLL1 mRNA levels were significantly increased under hypoxia (1% O2) or treatment with the hypoxia
mimetic deferoxamine mesylate (DFX, Figure 7A,B). These results were
confirmed in newly derived CW619 nonstem tumor cells exposed to DFX (Figure
7C). The ability of either 1% O2 or DFX to induce hypoxic gene responses was confirmed by significant induction of HIF2α (Figure 7D,E,F)
87 4121 Non-Stem Glioma Cells
A D G 2 40 * 8 * 35 ** 30 * * 25 * 1 2 4
1 Relative MLL1 mRNA Relative VEGF mRNA 0 Relative HIF2A mRNA 0 0 % O 21 1 21 % O2 21 1 21 % O2 21 1 21 2 DFX - - + DFX - - + DFX - - + 387 Non-Stem Glioma Cells
B E * H ** 3 * 18 70 17 60 ** 2 16 50 2 * 20 ** 1 1 10 Relative MLL1 mRNA
0 Relative VEGF mRNA Relative HIF2A mRNA 0 0 % O2 21 1 21 % O2 21 1 21 % O2 21 1 21 DFX - - + DFX - - + DFX - - +
CW619 Non-Stem Glioma Cells C F I ** * 5 * 14 3 12 4 10 2 3 8 2 6 1 4 1 2 Relative MLL1 mRNA Relative HIF2A mRNA 0 0 Relative VEGF-A mRNA 0 DFX - + DFX - + DFX - +
Figure 7. MLL1 is a hypoxia-responsive gene in nonstem glioblastoma cells. 4121, 387, or CW619 nonstem tumor cells were cultured in 1% oxygen for four days or treated with 200 µM DFX for 24 hours as indicated. Following hypoxic treatment, total RNA was harvested, cDNA generated by reverse transcription, and mRNA evaluated for (A,B,G) MLL1, (C, D,H) HIF2A, and (E,F,I) VEGF. HIF2A and VEGF levels were used as internal hypoxic conrols. *, p < 0.001; **, p < 0.05.
88 and VEGF (Figure 7G,H,I) as in our prior report [13]. These data support the
hypothesis that microenvironmental hypoxia induces expression of MLL1 mRNA.
3.3-HIF1α and HIF2α are necessary for MLL1 induction.
HIFa isoforms have differential effects and expression within gliomas [13].
Overexpression of nondegradable HIF2α promotes tumorigenicity in nonstem
GBM cells and HIF2α is preferentially expressed in the GSCs in response to
hypoxia [15, 17]. Although HIF2α is preferentially expressed in GSCs, HIF1α is
also present in GBM subpopulations. To determine if HIF1α or HIF2α is required
for MLL1 hypoxic regulation, 4302, 4121, and 387 nonstem glioma cells were
treated with HIF1A or HIF2A shRNA and then subjected to hypoxia via DFX. I
confirmed specificity of the HIF shRNA constructs Figure 9A-D). Both HIFs
modulated MLL1, suggesting that MLL1 is a general hypoxic target (Figure 8A-
C). To rule out off-target effects of the HIF shRNA, I utilized a HIF2α small molecule inhibitor (inhibitor 77, generated by the Iliopoulos Laboratory) that prevents HIF2A translation thereby reducing HIF2a protein levels [217]. To verify the efficacy of the drug, U87MG glioma cells stably expressing hypoxia responsive elements (HRE) driving luciferase expression were treated with the
HIF2a inhibitor (Figure 8D). HRE activity under moderate hypoxia (2% O2) was decreased by greater than 80% when cells were treated with HIF2α inhibitor,
whereas more modest effects (50% inhibition) were observed with severe
hypoxia (1% O2) (Figure 8D). These data were consistent with evidence that
89 HIF2α but not HIF1a is stabilized at oxygen tensions greater than 1%, and both
HIF1a and HIF2a proteins are stable at ≤ 1% O2 [13]. Attenuated responses to hypoxia were associated with the ability of the HIF2α inhibitor to reduce HIF2α protein expression as expected (Figure 8E). After confirming that the HIF2α inhibitor was effective in glioma cells, I measured inhibitor effects on MLL1 expression. Unfractionated and GSC-enriched 4121 cells were exposed to hypoxia induced by DFX treatment in the presence and absence of HIF2a inhibitor. Treatment with the HIF2α inhibitor did not alter HIF2A transcript levels
(Figure 8F) but caused a complete loss of the hypoxic response of MLL1 mRNA levels (Figure 8G). I next determined if MLL1 was a direct transcriptional target of the HIFs. Promoter analysis of MLL1 revealed a lack of consensus HRE binding sites typically found in HIF targets, like VEGF (data not shown). To further evaluate HIF binding, ChIP was performed on HIF2α and the presence of MLL1
DNA was analyzed. In comparison to VEGF positive control, I observed no significant difference in HIF2α binding to MLL1 DNA in 21% or 1% O2 cultured cells, which suggests that MLL1 is not a direct transcriptional target of the HIFs
(Figure 9E). These data define MLL1 as a novel hypoxia response gene indirectly regulated by the HIFs.
90
A 4302 Non-Stem Glioma Cells B 387 Non-Stem Glioma Cells C 4121 Non-Stem Glioma Cells 3 2 NT * NT 2 NT ** HIF1A shRNA HIF1A shRNA HIF1A shRNA 2.5 HIF2A shRNA HIF2A shRNA HIF2A shRNA 1.5 * 1.5 2 ** ** 1.5 1 1
1 0.5 0.5 0.5 Relative MLL1 mRNA Relative MLL1 mRNA Relative MLL1 mRNA 0 0 0 Control DFX Control DFX Control DFX
U87 HRE-Luciferase T4121 Unfractionated Tumor
) 5 10 * D * E F 6 * G 2 ** 8 DFX - + + 5 * * HIF2! Inhib. - - + 4 6 HIF2! ** 3 1 4 Tubulin 2 2 ** 1 Relative MLL1 mRNA Relative MLL1 mRNA Relative HIF2A mRNA mRNA Relative HIF2A Relative Luciferase (x10 0 0 0 DFX - + + DFX - + + % O2 21 2 2 1 1 HIF2! Inhib. - - + - + HIF2! Inhib. - - + HIF2! Inhib. - - +
Figure 8. HIF1α and HIF2α are required for MLL1 hypoxic response. A,B,C. 4302, 387, or 4121 nonstem glioma cells were stablely infected with HIF1A or HIF2A shRNA then treated with 200 µM DFX for 24 hours. Following treatment, RNA was harvested and cDNA generated by reverse transcriptase for analysis by RT-qPCR. D. U87 cells expressing a hypoxia response element (HRE) driving luciferase expression were pre- treated with or without HIF2α inhibitor and subsequently exposed to 24 hours of culture at 1%, 2%, or 21% (control) oxygen tension with concurrent inhibitor treatment. Relative luciferase units were subsequently measured using a luminometer. E. HIF2α inhibitor prevents expression of HIF2a protein. Bulk glioma cells isolated from a 4121 xenograft were pre-treated with HIF2α inhibitor for 24 hours prior to concurrent inhibitor and DFX treatment. Total cell lysates were analyzed via immunoblotting using antibodies against HIF2α and tubulin as a loading control. F,G. HIF2α inhibitor does not alter HIF2A transcript levels, but reduces MLL1 expression. Following dissociation of bulk tumor cells from a 4121 xenograft, cells were pre-treated with HIF2α inhibitor for 24 hours prior to incubation with DFX and concurrent inhibitor treatment. Total RNA was harvested and analyzed via RT-qPCR for HIF2A (C) or MLL1 (D). *, p < 0.001; **, p < 0.05.
91 387 Glioma Stem Cell
1.8 NT 8 ** A HIF1 KD B 1.6 7 NT HIF2 KD ** HIF1 KD 1.4 6 ** 1.2 HIF2 KD 5 1 4 0.8 3 0.6 *
HIF2A mRNA Level mRNA HIF2A 2
HIF1A mRNA Level mRNA HIF1A 0.4 0.2 1 0 0 21% Oxygen 1% Oxygen 21% Oxygen 1% Oxygen 4302 Non-Stem Glioma Cell
NT 1.8 ** 25 NT C HIF1 KD D * 1.6 HIF1 KD ** HIF2 KD 1.4 20 HIF2 KD ** 1.2 15 1 0.8 10 0.6 HIF1A mRNA Level mRNA HIF1A
0.4 Level mRNA HIF2A 5 0.2 ** 0 0 21% Oxygen 1% DFXOxygen 21% Oxygen 1% DFXOxygen
2 HIF2! IP E ** 21% Oxygen 1.5 1% Oxygen
1
0.5 ChIP DNA/Input ChIP
0 MLL1 HoxA9 VEGF
Figure 9. MLL1 is hypoxia responsive but is not a direct binding target of HIF2α. A-D. To confirm specificity of HIF1A or HIF2A shRNA, 387 GSCs or 4302 nonstem glioma cells were stably transduced with NT, HIF1A, or HIF2A shRNA then treated with 1% O2 for five days or 200 µM DFX for 24 hours. Total RNA was harvested and analyzed by RT-qPCR for (A,C) HIF1A or (B,D) HIF2A mRNA. Both shRNA constructs displayed specific targeting. E. To assess direct HIF2a binding to the MLL1 promoter, ChIP was performed on 387 GSCs. Following five days of culture at 21% or 1% O2, protein-DNA complexes were immunoprecipitated with 5 µg of HIF2a polyclonal antibody. DNA was analyzed by RT-qPCR for MLL1, HoxA9 (negative control), or VEGF (positive control). *, p < 0.001; **, p < 0.05.
92 3.4-MLL1 can be efficiently targeted with shRNA
To further define the functional roles of MLL1 in GBM, I characterized the ability
of multiple shRNAs directed against MLL1 in comparison to a non-targeting (NT)
control to decrease the expression of MLL1 in GBM cells (data not shown). I
identified two different shRNAs against MLL1, designated shRNA1 and shRNA2,
which were effective in reducing the expression of MLL1 mRNA in 4121 nonstem
glioma cells at 21% O2 and under hypoxia (Figure 10A). The reduction of MLL1 mRNA was sufficient to decrease MLL1 protein expression
(Figure 10B), suggesting the shRNAs may inhibit MLL1 mediated downstream effects. As MLL1 is a H3K4 methyltransferase, I measured global H3K4 triple
methylation by western blot with MLL1 knockdown. No difference was seen in
global H3K4m3 levels (data not shown), similar to reports suggesting that H3K4
methyltransferases contain familial redundancy and knockout of specific factors
only affects a small subset of genes [246]. However, I did confirm that targeting
MLL1 had functional consequences as MLL1 shRNA decreased the expression of HoxA9, a downstream target of MLL1 (Figure 10C) [323]. These data demonstrate the ability to effectively reduce MLL1 expression and function through introduction of specific shRNAs.
93
A 3.5 * NT 3 MLL1 shRNA 1 2.5 MLL1 shRNA 2 2 * 1.5 * 1 0.5
Relative MLL1 mRNA Relative MLL1 mRNA 0 Control DFX B
NT shRNA1 shRNA2 MLL1 Tubulin
NT C * 1.2 * MLL1 shRNA 1 MLL1 shRNA 2 * * 0.8
0.4
Relative HoxA9 mRNA Relative HoxA9 mRNA 0 Control DFX
Figure 10. MLL1 can be successfully targeted by shRNA A,C. Following stable incorporation of either NT or MLL1 shRNA, 4121 nonstem glioma cells were treated with 200 µM DFX for 24 hours. Total RNA was harvested and levels of MLL1 (A) or HoxA9 (C) were measured using RT-qPCR And normalized to the Actin housekeeping gene. B. Total cell lysates were harvested using RIPA buffer and immunoblotted for MLL1 protein and tubulin as a loading control.
94 3.5-MLL1 is required for HIF2a expression and hypoxia-induced signaling
To further elucidate the role of MLL1 in hypoxia responses, I determined the
effect of MLL1 knockdown on nonstem tumor cells in which hypoxia was
previously characterized to promote phenotypic changes [15]. I first examined the
effect on HIF1a and HIF2a protein levels following MLL1 knockdown.
Surprisingly, although both HIFs are required for hypoxic regulation of MLL1,
knockdown of MLL1 has a specific effect on HIF2a. Inhibition of MLL1 via
shRNA in 387 nonstem glioma cells induced a decrease of HIF2a protein levels
as assessed by immunoblotting (Figure 11A) and immunofluorescence (Figure
11B and Figure 13A) but did not affect HIF1a levels (Figure 11A). Our results
demonstrated co-distribution of MLL1 and HIF2α as well as loss of HIF2α
expression in cells without MLL1. Hypoxia induced transcription of HIF2A (Figure
12A and Figure 13B) was significantly down regulated by MLL1 inhibition as well.
While these data suggest that MLL1 regulates HIF1A transcript (Figure 12B and
Figure 13C), the greater than 85% reduction in HIF2A transcript levels under hypoxia with MLL1 targeting (Figure 12A) demonstrates more potent and specific effects on HIF2A versus HIF1A. I also confirmed that targeting MLL1 decreased overall HIF activity by evaluating HRE activity via luciferase expression (Figure
12E). To further elucidate the effects of MLL1 targeting on hypoxia signaling, I evaluated the mRNA expression of known HIF target genes. I found that levels of
VEGF
95 A
NT shRNA1 shRNA2 MLL1 HIF1! HIF2! Actin B Non- MLL1 MLL1 Targeting shRNA1 shRNA2
MLL MLL MLL
HIF2! HIF2! HIF2!
387 Non-Stem Glioma Cell Nuclei Nuclei Nuclei
Merge Merge Merge
Figure 11. Targeting MLL1 via shRNA inhibits expression of HIF2α, but not HIF1α. A. 387 nonstem glioma cells were treated with 200 µM DFX for 24 hours in order to stablize HIF protein. Totale lysates were harvested using RIPA buffer and then immunoblotted for MLL1, HIF1a, or HIF2a. Tubulin was used as loading control. B. 387 nonstem glioma cells were plated on treated coverslips following treatment with NT or MLL1 shRNA. Cells were treated with 200 µM DFX for 24 hours then fixed. MLL1 or HIF2a was labeled with antibody then detected by immunofluorescence. 96 (Figure 12C and Figure 13D) and phosphoglycerate kinase 1 (PGK1, Figure 12D
and Figure 13E) are both potently reduced by MLL1 knockdown.
I next performed ChIP to determine the mechanism by which MLL1 regulated
HIF2A transcription. I hypothesized that the mode of action of MLL1 on HIF2A was due to changes in histone modification at the HIF2A promoter. By analyzing the relative levels of regions proximal to the HIF2A start site on triple-
methylated histone 3 lysines 4 (H3K4m3) and 27 (H3K27m3), I found that
inhibition of MLL caused a loss of H3K4m3 (a pro-transcriptional signal, Figure
14A,B) and an increase in H3K27m3 (a transcriptional repressive signal; Figure
14C,D). This is similar to previously published results that observed in MLL1-
knockout mice that MLL1 target genes had increased H3K27m3 marks upon
target disruption of MLL1 [321]. These data demonstrate that MLL1 is required
for HIF2A transcription, likely by post-translational modifications of histone
moieties near the HIF2A start site.
97
A B ** * ** * 2 18 NT NT MLL1 shRNA 1 16 MLL1 shRNA 1 1.6 14 MLL1 shRNA 2 MLL1 shRNA 2 12 1.2 10 8 0.8 6 4 ** 0.4
** mRNA Relative HIF1A 2 0 Relative HIF2A mRNA mRNA Relative HIF2A 0 Control DFX Control DFX
25 * D * C NT * 20 * 20 MLL1 shRNA 1 NT MLL1 shRNA 2 16 MLL1 shRNA 1 MLL1 shRNA 2 15 12 10 8 5 4 Relative VEGF-A mRNA mRNA Relative VEGF-A 0 Relative PGK1 mRNA 0 Control DFX Control DFX
U87 HRE-Luciferase E %"& * NT MLL1 shRNA 1 MLL1 shRNA 2 !"$
!"# Relative Luciferase Units !
Figure 12. Targeting MLL1 by shRNA inhibits downstream hypoxic response. A-D. Following treatment with NT or MLL shRNA, 4121 nonstem glioma cells were treated for 24 hours with 200 µM DFX. Harvested mRNA was then analyzed using RT-qPCR to measure relative mRNA of (A) HIF2A, (B) HIF1A, (C) VEGF, or (D) PGK1. E. U87 cells expressing a hypoxia response element (HRE) containing promoter driving luciferase were treated with NT or MLL1 directed shRNAs and relative luciferase units subsequently measured using a luminometer. *, p < 0.001; **, p < 0.05.
98
A Non-Targeting shRNA1 shRNA2
MLL MLL MLL
HIF2! HIF2! HIF2!
Nuclei Nuclei Nuclei 387 Nonstem Glioma Cells
Merge Merge Merge
387 Non-Stem Glioma Cell
4 ** 5 NT B NT C ** MLL1 shRNA 1 MLL1 shRNA 1 4 MLL1 shRNA 2 3 MLL1 shRNA 2 ** 3 2 * 2 1 1 HIF2A mRNA Levels mRNA HIF2A Levels mRNA HIF1A
0 0 21% O2 1% O2 21% O2 1% O2
15 * 3.5 ** D NT E NT MLL1 shRNA 1 3 MLL1 shRNA 1 MLL1 shRNA 2 MLL1 shRNA 2 2.5 10 2
1.5 * 5 1 PGK1 mRNA Levels PGK1 mRNA VEGF mRNA Levels VEGF mRNA * 0.5 0 0 21% O2 1% O2 21% O2 1% O2
Figure 13. MLL1 knockdown inhibits HIF2α expression and the downstream hypoxic response. A. 387 nonstem glioma cells were plated on treated coverslips following treatment with NT or MLL1 shRNA. Cells were treated with 200 µM DFX for 24 hours then fixed. MLL1 or HIF2α was labeled with antibody then detected by immunofluorescence. These data are additional fields to those in Figure 3E. B-E. In order to confirm previous results performed with DFX (Figure 3F-I), we treated 387 nonstem glioma cells with 1% O2 for five days. Total RNA was harvested and analyzed by RT-qPCR for (B) HIF2A, (C) HIF1A, (D) VEGF, or (E) PGK1. *, p < 0.001; **, p < 0.05. 99
Unfractionated 387 Glioma Cells A C 1.2 * NT 8 * NT 1 MLL shRNA1 MLL shRNA1 MLL shRNA2 6 0.8 MLL shRNA2 ** 0.6 4
0.4 HIF2A/Input
HIF2A/Input 2 0.2 0 0 H3K4m3 H3K27m3
B 1.2 ** D 20 NT NT 1 * MLL shRNA1 15 MLL shRNA1 0.8 MLL shRNA2 MLL shRNA2 0.6 10 ** 0.4 HoxA9/Input HoxA9/Input 5 0.2 0 0 H3K4m3 H3K27m3
Figure 14. MLL1 modulated HIF2A transcription by chromatin regulation. Following stable incorporation of NT or MLL1 shRNA, unfractionated 387 glioma cells were treated with 1% O2 for four days. Cells were fixed, lysed, and chromatin sheared by sonication. Following immunoprecipitation with H3K4m3 (A,B) or H3K27m3 (C, D) antibodies and purification, DNA was analyzed by RT-qPCR for regions proximal to the (A,C) HIF2A or (B,D) HoxA9 transcriptional start site. All values are normalized to 1% input loading control. *, p < 0.001; **, p < 0.05
100 3.6-MLL1 is preferentially expressed in GSCs.
As GSCs possess elevated levels of HIF2α [13] that may be regulated by MLL1, I
hypothesized that MLL1 is preferentially expressed in GSCs. Our laboratory and
others have previously determined that GSCs often can be prospectively
enriched from many human glioma xenografts and patient specimens using cell
surface marker CD133 (Prominin-1). I previously employed CD133-enrichment to
derive cultures that fulfill GSC functional characteristics (self-renewal,
multilineage differentiation, stem cell marker expression, and tumor propagation).
In our models, CD133-positive GBM cells have an increased ability to form
neurospheres that express glioma stem cell markers including Nestin and Olig2
(Figure 16). Using matched GSCs and nonstem GBM cells (4121 and 387 tumor specimens), I utilized a PCR screen for epigenetic modifiers to determine if MLL1 or other factors displayed preferential expression. Out of 96 epigenetic regulators, only MLL1 demonstrated consistent preferential expression in the
GSCs (Figure 15A). As these data suggested an important role for MLL1 in
GSCs, I examined additional samples that were enriched or depleted for GSCs.
The differential mRNA expression translated into increased MLL1 protein in
GSCs as verified by immunoblotting (Figure 15B). Using real-time PCR, preferential mRNA expression of MLL1 was observed in two additional specimens (Figure 15C) in the GSC subpopulation as confirmed through
elevated Olig2 mRNA (Figure 15D). In GSCs grown in suspension culture, MLL1
demonstrated high levels of co-localization with validated GSC marker, CD133,
in three
101
A B
T4121 Glioma T387 Glioma Gene CD133+ CD133- CD133+ CD133- T387 DNMT1 0.93 1.00 2.46 1.00 CD133 DNMT3A 0.84 1.00 3.68 1.00 + - DNMT3B 1.73 1.00 2.86 1.00 MLL1 MLL 2.44 1.00 3.88 1.00 MLL3 1.45 1.00 1.93 1.00 Tubulin MLL5 0.83 1.00 2.71 1.00 SETD1A 1.05 1.00 1.83 1.00 SETD1B 0.98 1.00 1.42 1.00
C D 7 CD133- 45 * * CD133- 6 CD133+ 40 35 CD133+ 5 30 4 ** * 25 3 20 2 15 * 10 1 *
Relative MLL1 mRNA Relative MLL1 mRNA 5 0 Relative Olig2 mRNA 0 T4302 T4121 T387 T4302 T4121 T387
Figure 15. MLL1 Expression is elevated in glioma stem cells compared to nonstem glioma cells. Patient-derived glioma specimens were dissociated and enriched for GSCs as previously described [9]. A. A PCR screen for epigenetic modifiers determined that out of 96 epigenetic regulators only MLL1 demonstrated consistent preferential expression in the GSCs when RNA isolated from 4121 and 387 GSC and nonstem cell fractions were compared. B. These data were confirmed with total lysates immunoblotted for MLL1. C. Real-time PCR demonstrated MLL1 mRNA was consistently upregulated in GSC fractions. D. The cancer stem cell nature of the GSC fractions was confirmed through elevation of Olig2 mRNA. All mRNA levels were normalized to Actin. *, p < 0.001; **, p < 0.05.
102 GSC Neurospheres
CD133 Nuclei Merge
Nestin Nuclei Merge
Olig2 Nuclei Merge
pCNA Nuclei Merge
Figure 16. Glioma stem cells form neurospheres expressing stem cell markers. We confirmed enrichment for GSCs by plating cells in suspension culture. Following neurosphere formation, we sectioned and stained for typical markers of the CSC phenotype including CD133, Nestin, Olig2, and PCNA. The staining pattern of the selected markers demonstrated efficient enrichment of GSCs
103
387 GSC CD133 MLL1 Nuclei Merge 4302 GSC CD133 MLL1 Nuclei Merge 4121 GSC CD133 MLL1 Nuclei Merge
Figure 17. MLL1 co-localizes with GSC enrichment marker, CD133. Co- localization of MLL1 and putative GSC marker, CD133, was visualized by staining of sectioned neurospheres in 387, 4302, and 4121 patient-derived specimens.
104 separate specimens (Figure 17). These findings implicate MLL1 in glioma maintenance.
3.7-Hypoxia regulates MLL1 expression in GSCs
Our data demonstrated that MLL1 was preferentially expressed in GSCs and hypoxia regulated in glioma cells. I therefore sought to determine whether MLL1 was regulated by hypoxia in GSCs. Minimally cultured 387 and 4121 GSCs were exposed to hypoxic conditions induced through culture at 1% O2 or exposure to
DFX. Both treatments significantly increased MLL1 mRNA in the GSCs (Figure
18A,B) and induced other hypoxic gene responses as confirmed by the induction of HIF2α (Figure 18C,D) and VEGF (Figure 18E, F). To determine whether hypoxia mediated elevation of MLL1 in GSCs required functional HIFs, I transduced 387 and 4121 GSCs with HIF1α or HIF2α shRNA. Similar to the nonstem glioma cells, both HIF1α or HIF2α are necessary for the hypoxic induction of MLL1 (Figure 18G,H). It is important to note, however, that MLL1 still exhibited a hypoxic response when one HIF was inhibited (Figure 18G,H).
This could be due to higher basal activity of the HIFs in GSCs that our lab previously established [13, 15]. To confirm our observed effects of HIF shRNA, I utilized the HIF2α small molecule inhibitor. The inhibitor had no effect on hypoxia induced HIF2α mRNA (Figure 19A) but significantly reduced MLL1 mRNA levels
(Figure 19B). Together, these data demonstrated MLL1 is hypoxia responsive and a HIF2a target gene in GSCs.
105
387 Glioma Stem Cell
30 * A 3 * C 25 * E 20 ** ** 20 2 15
10 10 1 ** 5 MLL1 mRNA Level MLL1 mRNA HIF2A mRNA Level mRNA HIF2A 0 0 Level VEGF mRNA 0 % O2 21 1 21 % O2 21 1 21 % O2 21 1 21 DFX - - + DFX - - + DFX - - + 4302 Glioma Stem Cell B 7 ** D 10 ** F 7 ** 6 6 8 5 5 4 6 4 3 4 3 2 2 2 1 1 MLL1 mRNA Level MLL1 mRNA VEGF mRNA Level VEGF mRNA
0 Level mRNA HIF2A 0 0
% O2 21 1 21 % O2 21 1 21 % O2 21 1 21 DFX - - + DFX - - + DFX - - +
387 Glioma Stem Cell G H 4121 Glioma Stem Cell NT shRNA 1.2 ** NT shRNA 1.5 ** HIF1 shRNA 1 HIF1 shRNA ** ** HIF2 shRNA HIF2 shRNA 0.8 1 0.6 0.4 0.5 0.2 MLL1 mRNA Level MLL1 mRNA MLL1 mRNA Level MLL1 mRNA 0 0 % O2 21 1 % O2 21 1
Figure 18. MLL1 is regulated by hypoxia and HIF2α in GSCs. 4302 or 387 GSCs were cultured in Neurobasal media at 1% oxygen for four days or treated with 200 µM DFX for 24 hours as indicated. Following hypoxic treatment, total RNA was harvested, cDNA generated by reverse transcription, and mRNA evaluated for (A,B) MLL1, (C,D) HIF2A, and (E,F) VEGF. HIF2A and VEGF levels were used as internal hypoxic controls. G,H. 387 or 4121 GSCs were stably infected with HIF1a or HIF2a shRNA then treated with 1% O2 for five days. Following treatment, RNA was harvested and cDNA generated by reverse transcriptase for analysis by RT-qPCR *, p < 0.001; **, p < 0.05.
106
4121 Glioma Stem Cell
30 4 A B * * * 3 20 2 10 1 Relative MLL1 mRNA Relative MLL1 mRNA Relative HIF2A mRNA mRNA Relative HIF2A 0 0 DFX - + + DFX - + + HIF2! Inhib. - - + HIF2! Inhib. - - +
Figure 19. Pharmacological inhibition of HIF2α reduces MLL1 expression. A,B. Following enrichment for 4121 GSCs, cells were pre-treated with HIF2a inhibitor for 24 hours prior to incubation with DFX and concurrent inhibitor treatment. Total RNA was harvested and analyzed via RT- qPCR for HIF2A (A) or MLL1 (B).*, p < 0.001; **, p < 0.05.
107 3.8-Targeting MLL1 in GSCs reduces VEGF expression and GSC-mediated
endothelial cell growth
As GSCs contribute to tumor growth through the hypoxia responsive gene VEGF
to promote tumor angiogenesis [52], I determined the contribution of MLL1 to
VEGF production. Knockdown of MLL1 in 4121 (Figure 20A) or 387 (Figure 20B)
GSCs led to a significant decrease of secreted VEGF. Conditioned media from
the same patient-derived specimens was also applied to HUVECs and the
relative HUVEC growth was assessed by incorporation of tritiated thymidine
(Figure 20C). Conditioned media from MLL1 depleted glioma cells displayed
significantly reduced ability to stimulate HUVEC growth (Figure 20C). These
data indicate that hypoxic induction of MLL1 contributes to the angiogenic nature
of glioblastoma cells. MLL1 is not only important for VEGF regulation in GSCs,
but targeting of MLL1 has downstream biological consequences on GSC growth
as well.
3.9-Loss of MLL1 inhibits GSC growth and self-renewal.
Central to the CSC paradigm is the notion that the stem-like subpopulation
exhibits sustained proliferation and self-renewal that contributes to tumor propagation [6]. I therefore examined whether MLL1 contributes to the growth and self-renewal capacity of GSCs in vitro. Following stable incorporation of
MLL1 directed shRNA or NT control into GSCs isolated from 4121 (Figure 21A) or 387 (Figure 21B) xenografts, I sequentially measured GSC growth. Depletion of
108 GSC Conditioned Media
A 4121 B 387 ** ** 200 250 * 160 200 150 120 100 80 VEGF (pg/mL) 50 VEGF (pg/mL) 40 0 0 NT shRNA + - - NT shRNA + - - MLL shRNA - sh1 sh2 MLL shRNA - sh1 sh2
C * 1.2 *
0.8
0.4 Relative Cell Number
Thymidine Incorporation 0 NT shRNA + - - MLL shRNA - sh1 sh2
Figure 20. Targeting MLL1 reduces GSC-mediated VEGF production and endothelial cell proliferation. Following puromycin selection of infected GSCs isolated from (A) 4121 or (B) 387 xenografts, fresh GSC cell culture media without growth factors was added for 48 hours. Conditioned media were passaged through a 0.22 micron syringe filter and then used to measure VEGF production by ELISA. C. Following a similar media collection as detailed above and as shown in the diagram at left, HUVECs grown in the conditioned media for 24 hours prior to addition of tritiated thymidine for 4 hours. Thymidine incorporation was measured using a scintillation counter. *, p < 0.001; **, p < 0.05.
109
A C 9 8 NT ** 12 MLL1 shRNA 1 NT * 7 MLL1 shRNA 2 10 MLL1 shRNA 1 MLL1 shRNA 2 6 8 5 6 4 3 4 2 2 4121 Nonstem Cell Relative Cell Number Relative Cell Number T4121 Cancer Stem Cell 1 * 0 0 Day 0 Day 1 Day 3 Day 7 Day 0 Day 1 Day 3 Day 7 B 6 NT 5 MLL1 shRNA 1 ** MLL1 shRNA 2 4 3 2 1 * Relative Cell Number * T387 Cancer Stem Cell 0 Day 0 Day 1 Day 3 Day 7
Figure 21. MLL1 knockdown decreases the growth of glioma stem cells. Following shRNA viral infection and drug selection, (A) 4121 GSCs, (B) 387 GSCs, or (C) 4121 nonstem glioma cells were plated at 1000 cells/well in 96 well plates. Cell growth was measured using a Cell Titer Glo Kit (Promega) at the indicated times. *, p < 0.001; **, p < 0.05.
110
A B T4121 GSC
* NT 1.4 * 1.2 1 0.8 shRNA 1 0.6 0.4 0.2 Neurospheres per Well Neurospheres per Well 0 shRNA 2 NT shRNA + - - MLL shRNA - sh1 sh2
Figure 22. Targeting MLL1 by shRNA reduces neurosphere formation in GSCs. 4121 GSCs were sorted into a 96-well plate at a density of 10 cells per well. Cells were left in culture for 14 days in normal GSC media and the number of spheres per well counted. Images on right were taken on Day 14 by wide-field microscope. *, p < 0.001; **, p < 0.05.
111 MLL1 significantly reduced GSC growth within three days and led to a greater
than five fold reduction in the number of cells at seven days in both GSC
samples. I also compared the effects of MLL1 knockdown on growth rates of nonstem tumor cultures (Figure 21C). Although I observed statistically significant growth inhibition in the nonstem tumor cells, the extent of the reduction in cell numbers was always greater in the GSCs. These data demonstrate that MLL1 is important in both glioma subpopulations tested, but MLL1 is especially critical for the growth of GSCs.
As an in vitro measure of a stem cell-like behavior, neurosphere formation demonstrates the ability to proliferate and is also utilized as a surrogate measure of self-renewal. I measured the ability of GSCs to form neurospheres following
MLL1 inhibition. GSCs stably expressing MLL1 shRNA formed significantly fewer neurospheres compared to cells infected with NT shRNA (Figure 22A).
MLL1-depleted cells rarely formed small collections of cells, which contrasted sharply with the large, tight spheres typical of normal GSCs (Figure 22B).
Together these data suggest that MLL1 is an important factor in the biological function of the CSC subpopulation in GBM.
3.10-Inhibition of MLL1 Reduces Tumorigenic Capacity
112 Orthotopic transplantation of GSCs is the gold standard for determining
tumorigenicity. To measure the effect of MLL1 inhibition on tumor formation,
GSCs stably expressing MLL1 shRNA and GFP (as a visual marker for shRNA
expression) were intracranially implanted into immunocompromised hosts. Upon
the development of neurological deficit, tumor-bearing mice were examined for
the presence of GBM. GSCs transduced MLL1 shRNA formed tumors at a
significantly greater latency (Figure 23A). Furthermore, tumors that arose from
the shRNA cohort had very few cells expressing the shRNA construct as
assessed by GFP marker expression (Figure 23B). These data suggest MLL1
plays an important role in GSC-driven tumor propagation by modulating the
growth characteristics of GSCs.
3.11-Discussion
Cancer cell heterogeneity is increasingly appreciated as an important
component of tumor propagation and recurrence following therapy. Previously
CSCs were thought to undergo unidirectional lineage commitment and
irreversible differentiation. However, aberrant differentiation is a hallmark of
cancer, suggesting that a rigid cellular hierarchy is likely not present. Several publications have demonstrated the ability of the nonstem tumor bulk to become more tumorigenic and exhibit functional characteristics of CSCs in the presence of microenvironmental stimuli. For example, publications from our lab and others have demonstrated that culture under low oxygen conditions promotes the ability
113 387 Glioma Stem Cell A 100 NT MLL1 shRNA1 MLL1 shRNA2 80 *, p<0.01
60
40
20 * * 0 Survival probability (%) 35 40 45 50 55 Time (Days) B NT NT
GFP Nuclei Merge
GFP Nuclei Merge shRNA1
GFP Nuclei Merge shRNA2
Figure 23. MLL1 inhibition reduces tumor propagation in mice. A. 387 GSCs bearing stable NT or MLL1 shRNA tagged with GFP was implanted into the right frontal lobe of athymic nu/nu mice. Mice were monitored for signs of neurologic deficits. *, p < 0.01. B. Following euthanasia, whole mouse brains were fixed and frozen. 10 µM sections were stained for GFP in order to assess the presence of cells transduced with NT or MLL1 shRNAs. Tumors from shRNA bearing mice (n = 3 per group) contained fewer GFP- positive cells, indicating that tumors forming in the cohort were likely from an contaminating GFP-negative cells.
114 of nonstem tumor cells to form tumors and upregulates genes typically
associated with CSCs, such as Nanog and c-myc [15-17]. Whether these
biological phenomena are products of selection or true reprogramming similar to
induced pluripotency remains unclear and warrants further investigation. As
bevacizumab and other targeted therapies may function as anti-cancer agents
through disruption of the tumor microenvironment, increasing our understanding
of the microenvironmental factors regulating the CSC phenotype will be vital for
defining therapeutic interventions to target this highly tumorigenic subpopulation.
While recent experimental evidence suggests plasticity in the CSC phenotype,
the mechanisms through which associated molecular and biologic changes could
arise in the absence of novel genetic mutations remain unknown. In the iPS field where phenotypic plasticity has been well characterized, epigenetic regulation is recognized as a gatekeeper for downstream global genomic changes [317]. In particular, methylation status of H3K4 and H3K27 are well known markers for the transcriptional state of the cell. H3K4 trimethylation (H3K4m3) proximal to the gene promoter, for example, associates with actively transcribed genes [246].
These histone modifications are regulated primarily by histone modifying enzymes, of which there are many families that are evolutionarily well-conserved.
Extrinsic and intrinsic communication between histone modifiers and the cell environment is not well understood. Through the field of induced pluripotency, hypoxia is being appreciated as a possible regulator of histone modifier activity
[209]. However, the contribution of specific epigenetic modifying proteins to the
115 CSC phenotype has not been well studied. Relatively few publications have
addressed the epigenomic phenotype of the hetergenous tumor subpopulations,
although it is now becoming a larger focus of research.
In this study I sought to elucidate the relationship between hypoxia and MLL1, a
histone methyltransferase that has been previously associated with
tumorigenicity in leukemia. We first demonstrated that restricted oxygen can
modulate the expression of MLL1 in CSC and nonstem tumor populations. This
is a particularly novel finding, as HMTs were not typically thought to be hypoxia- responsive. Notably, this increase in MLL1 transcript levels requires functional
HIF1α and HIF2α, as shRNA and pharmacologic HIF inhibition abrogated the
MLL1 hypoxic response. Interestingly, the HIF regulation of MLL1 does not appear to be through direct binding of the HIF2α protein. ChIP of HIF2α did not display significant binding to the MLL1 promoter and we also observed a lack consensus HIF binding sequence in the MLL1 promoter. Previous publications have shown that hypoxia regulates the demethylating families of enzymes
(specifically Jumonji proteins; [261]) but this effect was thought to be restricted to epigenetic proteins that suppress gene expression. Due to the complexity of the hypoxic response in CSCs, we evaluated the importance of MLL1 within the HIF transcriptional pathway. Surprisingly, depletion of MLL1 caused nearly total loss of the hypoxic response of HIF2α but not HIF1α. To further elucidate this mechanism, we measured changes in the relative abundance of H3K4m3 and
H3K27m3 on the HIF2A promoter. Inhibition of MLL led to a decrease in
116 H3K4m3 and an increase in H3K27m3, which suggests that MLL1 reduces
HIF2A transcription via chromatin modification. However it is important to note
that there may be still undiscovered regulatory mechanisms of HIF2α and further
studies are needed. However, these novel data suggest that MLL1 is required
for transcriptional upregulation and downstream activity of HIF2α in glioma cells. I
confirmed loss of HIF response by evaluating HRE transcriptional activity as well
as downstream function of well-characterized HIF targets such as VEGF.
Indeed, cells depleted of MLL1 demonstrated significant reduction in VEGF
production, even when stimulated by hypoxia. Not only do these data describe a
novel mechanism of HIF2A mRNA regulation, but these studies demonstrate that
the hypoxia response involves epigenetic pathways. Furthermore, our studies suggest that critical aspects of the CSC phenotype, high rates of proliferation and self-renewal, depend on MLL1. This extends in vivo where inhibition of MLL1 caused a marked decrease in tumor propagation.
Together our data provide the first evidence that epigenetic modifier, MLL1, is a
hypoxia responsive gene. I also demonstrate for the first time that MLL1 has a
significant role in glioma biology through the regulation of HIF2α and downstream
HIF2α targets. Specifically, hypoxia-driven upregulation of the pro-angiogenic
factor, VEGF, was significantly inhibited in MLL1-depleted cells. Our data further
demonstrates the importance of HMT and MLL1 activity in the ability of GSCs to
propagate tumors in vivo. These data suggest that epigenetic modifying proteins
play a vital role in promoting tumor growth through the regulation of the hypoxic
117 response in CSCs and that the ability to alter the epigenetic landscape of tumor
cells could yield novel therapeutic opportunities.
3.12-Materials and Methods
Isolation and Culture of Glioma stem cells and Nonstem glioma cells
Cultures enriched or depleted for GSCs were isolated from primary human brain tumor patient specimens or human glioblastoma xenografts as previously described in accordance with a Duke University or Cleveland Clinic Foundation
Institutional Review Board approved protocol concurrent with national regulatory standards with patients signing informed consent as previously described [10].
GSCs were cultured in Neurobasal media with B27 (without Vitamin A,
Invitrogen), basic fibroblast growth factor (bFGF, 10 ng/ml) and epidermal growth
factor (EGF, 10 ng/ml). After trypsinization, nonstem glioma cells were cultured
overnight in Dulbecco’s minimal essential media (DMEM) and 10% fetal bovine
serum (FBS) to allow cell attachment and survival. Then, in some cases, DMEM
medium was removed and the cells cultured in supplemental Neurobasal
medium in order for experiments to be performed in identical media. To induce
hypoxia, cells were cultured in multi-gas chambers (Sanyo). Nitrogen gas was
supplied to the chambers in order to compensate for the reduced percentage of
oxygen. Alternatively, cells were treated by 200 µM hypoxia-mimetic
deferoxamine mesylate (DFX, Sigma).
118
Semi-Quantitative PCR
Total RNA was harvested from cells using RNAeasy Kit (Qiagen). PCR was performed on cDNA generated by Superscript III reverse transcriptase
(Invitrogen) or qScript Reverse Transcriptase (Quanta Biosciences) and subsequent semi-quantitative PCR was performed using SYBR Green Master
Mix (Qiagen). Primers used were as follows: MLL1 forward 5’-
CAGATAAAGTCCAGGAAGCTCG-3’ and reverse 5’-
GTAATTTCGACAGTGCTTGGC-3’; HIF1α forward 5’-
TCCATGTGACCATGAGGAAA-3’ and reverse 5’-
CCAAGCAGGTCATAGGTGGT-3’; Vascular Endothelial Growth Factor (VEGF) forward 5’-AGTCCAACATCACCATGCAG-3’ and reverse 5’-
TTCCCTTTCCTCGAACTGATTT-3’; HIF2α forward 5’-
CCACCAGCTTCACTCTCTCC-3’ and reverse 5’-
TCAGAAAAAGGCCACTGCTT-3’; HoxA9 forward 5’- aatgctgagaatgagagcgg-3’ and reverse 5’- gggtctggtgttttgtataggg-3’; phosphoglycerate kinase 1 (PGK1) forward 5’- gcttctgggaacaaggttaaag-3’ and reverse 5’- ctgtggcagattgactcctac-3’; and Olig2 forward 5’- agctcctcaaatcgcatcc-3’ and reverse 5’- atagtcgtcgcagctttcg-
3’. All data were normalized to Actin transcript levels.
HIF2α Small Molecule Inhibition
119 U87 or 4121 cells were treated with 10 µM (final concentration) of HIF2α inhibitor
77 or vehicle control for 24 hours prior to hypoxic stimulation. Media were changed every 24 hours with inhibitor or control added following media change.
Luciferase Assay
U87 cells bearing the hypoxia response element (HRE) driving luciferase expression construct were cultured in DMEM with 10% FBS. Following 24 hours of pre-treatment with HIF2α inhibitor, the cells were treated with 1%, 2%, or 21% oxygen and the inhibitor concurrently. After 24 hours of treatment, total cell lysates were harvested by passive lysis buffer containing luciferin (Promega).
Luciferase activity was measured using a luminometer (Perkin-Elmer).
Immunoblotting
Prior to lysis, cells were washed once with cold phosphate buffered saline (PBS).
Total cell lysates were prepared by the addition of RIPA lysis buffer (Sigma) containing protease inhibitors (Sigma) and placed at -20°C for no less than 1 hour. Brief sonication with a wand-style sonicator (Fisher Scientific) at 10% duty cycle was used to ensure complete lysis of the nuclear membrane. Total protein was separated on bis-acrylamide gels and transferred to polyvinylidene fluoride
(PVDF) membranes. Primary antibodies for MLL1 (1: 500, Abcam), TUBULIN
(1:10,000, Millipore), or HIF2α (1:1000, Novus) were incubated overnight at 4°C.
120 Secondary antibodies conjugated to horseradish peroxidase (HRP, Jackson
Labs) or infrared epitopes (Licor) were incubated for 1 hour at room temperature,
protected from light.
Immunofluorescent Imaging
Brain sections or cells were fixed in 4% paraformaldehyde (PFA, Sigma) for 15
minutes at room temperature. After fixation, samples were washed with PBS.
Prior to blocking, sodium citrate boiling was performed for 5 minutes to enhance antigen retrieval. Samples were blocked in buffer containing 10% normal goat serum, 0.1% Triton X-100, and 0.01% Sodium Azide in PBS for 30 minutes at room temperature. Following blocking, primary antibody, [green fluorescent protein (GFP;1:500, Aves Labs), MLL1 (1:100, Abcam), CD133 (1:500, Abcam) or HIF2α (1:500, Millipore)], was added and incubated at 4°C overnight. The next day secondary antibodies conjugated to fluorescent isotopes (Alexa Fluor,
Invitrogen) were added to cells at appropriate dilutions. After incubation,
Hoescht 33342 nuclear stain was added for 5 minutes. Images were taken on a wide-field inverted fluorescent or confocal microscope (Leica).
Targeting of MLL1 by RNA interference
To screen RNA interference vectors, 293T cells were transfected with control or
MLL1 short hairpin RNA (shRNA) containing lentiviral plasmids with packaging
121 DNA and resulting virus containing media used to infect glioma cells. A non-
targeting (NT) vector designed to activate the RISC and RNAi pathways, but not
target any human genes, was used as control (Sigma-Aldrich). shRNA plasmids
(Sigma-Aldrich) used for experiments were:
shRNA 1 sequence, targeting the coding sequence:
CCGGGATTATGACCCTCCAATTAAACTCGAGTTTAATTGGAGGGTCATAATC
TTTTTG; shRNA 2 sequence, targeting the 3’ untranslated region:
CCGGTGCCTGGAAGGAGCCTATTATCTCGAGATAATAGGCTCCTTCCAGGC
ATTTTTG.
VEGF ELISA
GSCs were plated at equal density on reduced growth factor extracellular matrix
(Geltrex, Invitrogen) treated tissue culture dishes in standard GSC media without
bFGF or EGF. Following 24 hours of culture, media were harvested, filtered, and
VEGF quantified using a QuantiGlo chemiluminescent EISA kit (R&D Systems)
with a luminometer (PerkinElmer).
Thymidine Incorporation
Human umbilical vein endothelial cells (HUVECs, ATCC) were plated at a density of 10,000 cells/well in six-well dishes in appropriate media and allowed to recover
122 overnight. The following day the media were replaced with conditioned media
collected from GSCs transduced with MLL1 shRNA or NT shRNA (as described
above), and HUVECs cultured with conditioned media for an additional 24 hours.
Tritiated thymidine was then added for six hours followed by quantification using
a scintillation counter.
Cell Titer Assay
GSCs and nonstem GBM cells were trypsinized and plated into 96-well plates
containing appropriate growth media at a density of 1000 cells/well on Day 0.
Adenosine triphosphate (ATP) levels were measured over time using a Cell Titer
Glo kit (Promega) and luminometer (PerkinElmer).
Neurosphere Culture Assay
GSCs were cultured in Neurobasal media with B27 in the presence of growth
factors for at least 24 hours prior to plating. Cells were sorted by flow cytometry
into 96-well plates (Sarstedt) at 10 cells per well. Wells were serially observed over 14 days and the number of neurospheres per well was counted. Images of neurospheres were taken using a wide-field microscope (Leica).
Chromatin Immunoprecipitation (ChIP)
123 Following transduction with shRNA and hypoxia, unfractionated GBM cells were
grown on Geltrex in 10cm tissue culture treated dishes. ChIP was performed
according to manufacturer’s instructions (Millipore). Briefly, cells were fixed for
10 minutes at room temperature with 1% (final concentration) PFA. 125 mM
(final concentration) Glycine was added for 5 minutes at room temperature to
quench unreacted PFA. Cells were collected and lysed in a 1% Sodium Dodecyl
Sulfate (SDS) solution. Cells were subjected to sonication at 30% duty cycle
using a wand-style sonicator (Fischer Scientific) for 15 seconds then put on ice
for no less than 60 seconds. This cycle was repeated 5 times for each sample.
Following sonication, 100 µL aliquots were diluted into 900 µL ChIP dilution buffer (Millipore) and pre-cleared with 60 µL Protein A-agarose/Salmon Sperm
DNA beads. 5 µg of primary antibody (H3K4m3 or H3K27m3, Millipore) were added overnight. The following day the bead-antibody complexes were washed, crosslinks reversed, and DNA purified by phenol/chloroform extraction.
Orthotopic Transplantation Assays
Intracranial implantation of GBM cells was performed in accordance with
Cleveland Clinic Foundation Institutional Animal Care and Use Committee approved protocols concurrent with national regulatory standards. GSCs bearing
MLL1 shRNA or NT control in a volume of 20 µL were implanted into the right frontal lobes of athymic nu/nu mice. Mice were monitored daily for signs of neurological deficit. At the development of neurological impairment, the mice
124 were perfused with 4% PFA, brains removed, and placed in 4% PFA. Brains were then cryo-protected in a 30% sucrose solution and frozen.
Immunofluorescent imaging was performed as described above.
Statistical Analysis
Descriptive statistical analysis was generated for all repeated quantitative data with inclusion of means and standard error. Significance was tested by one-way analysis of variance (ANOVA) or Student’s t-Test using SigmaStat 3.5 (Chicago,
IL).
125 Chapter 4
A Discussion of Hypoxia and Epigenetic Modifiers in GBM
126 4.1-Classification of Glioma Subtypes
GBM is the most common brain tumor and remains a deadly malignancy.
Victims of other solid tumors have seen significant improvements in survival over the past several decades. In many cases, improved survival has come from advances in disease prevention or more sophisticated treatment modalities [1,
73, 204, 237, 265, 269, 272]. Unfortunately GBM patients have not experienced
similar improvements and median survival remains low at 15 months [1, 302].
The difficulty in effectively treating GBM is largely due to the heterogeneous nature of the disease. It is clear from immunohistological examination that GBM is a disease that displays heterogeneity in its cellular appearance. In fact, the name “multiforme” itself indicates its highly variable nature. There have been significant research efforts focused on improving our understanding of the disease. Recent work has further categorized the general GBM term into several molecular subtypes: neural, proneural, classical, and mesenchymal [86, 88]. As its name suggests, the GBM neural subtype are characterized by alterations in neuron-related genes, including GABRA1 and SLC12A5. The proneural subtype frequently contains TP53 mutations and mutations and amplifications involving the PDGFRA gene. Proneural GBMs can also have point mutations in IDH1. The classical subtype all share cytogenetic abnormalities; a chromosome 7 amplification and a chromosome 10 deletion. Amplification of EGF and EGFR are also common to the classical subtype. Furthermore, mutations in the TP53 gene are uncommon, as opposed to the neural subtype. Finally, the mesenchymal subtype is characterized by deletions on chromosome 17 at location 17q11.2.
127 Mesenchymal GBMs also tend to have high levels of CHI3L1 and MET. These classifications allow for a more sophisticated anaylsis of tumor characteristics and could reveal avenues of treatment that could be effective against certain
GBM subtypes. However currently these studies are largely retrospective and
GBM subtypes are not sufficiently understood to be modeled ex vivo.
Elegant mouse models [2] and genomic characterization [218] of GBM patient cohorts has also provided insight into the nature of the disease. Originating in the Holland lab, the TVA inducible brain tumor mouse model is a useful tool in understanding the initiation and progression of glioma [324-326]. By driving overexpression of PDGF via an avian virus, GBMs can be initiated in mice in a controlled way. Unfortunately, these models do not replicate the same level of heterogeneity found in patient specimens. By driving PDGF overexpression in a large subset of cells within the mouse brain (typically all Nestin- or GFAP-positive cells), the resulting tumor is homogeneous. Likewise, large-scale genomic characterization of GBM patient specimens has yielded a plethora of data regarding specific gene expression patterns common to GBMs. However, similar to GBM mouse models, current genomic analyses have failed to differentiate tumor subpopulations and thereby ignoring the complexity that makes GBM a deadly disease. By directly studying cellular heterogeneity, we can better understand GBM and design more sophisticated therapeutics.
128 4.2-Glioma Cells and Phenotypic Plasticity
Intratumoral heterogeneity is driven by two co-evolving mechanisms: genomic instability (mutation) and epigenetic adaptation. These mechanisms lead to cells within a tumor being organized into a pseudo-hierarchy (Figure 6A). Cells at the apex of the hierarchy are termed glioma stem cells, also known as tumor propagating cells. These cells are responsible for propagation of the parental tumor. Although controversial, the GSC paradigm suggests that this subpopulation of glioma cells exhibit enhanced proliferation, tumorigenicity, and the ability to evade typical chemo- and radio-therapy. The GSC population is
also thought to contribute to tumor recurrence, a major factor in patient survival.
Enrichment of the GSC population relies on expression of particular surface
markers. The choice of marker has been hotly debated. CD133, also known as
Prominin-1, is the canonical GSC enrichment marker whose origins are found in
the normal neural stem cell field. However very little is known about the
biological function of CD133 and several studies have elucidated the importance
of post-translational modification of CD133 and its enrichment capabilities. In
response to the unreliability of CD133, many groups have investigated the use of
better-understood factors as a golden marker for tumor propagating cells. A2B5 and integrin alpha 6, in particular, have demonstrated efficient separation of tumorigenic and non-tumorigenic tumor cell populations [14, 117, 120]. Rather, it demonstrates that there may exist a stratification of tumor propagating cells that all exhibit slight differences in genomic composition and marker expression but maintain the same ability to propagate a phenotypic copy of the parental tumor.
129
There have been many studies establishing the hierarchy of GSCs, but recent
experimental evidence, including studies detailed in this dissertation, have called
into question the rigidity of the GSC organizational structure. My interrogation of
the hypoxic response in glioma cells and how it can promote a stem-like state
was one of the first studies to identify plasticity in the GSC hierarchy driven by
microenvironmental conditions (Chapter 2). Previous studies from our lab have
established the importance of hypoxia and the HIFs in the GSCs. shRNA
inhibition of either HIF led to total loss in tumor formation. It was not immediately
clear if this was due to a rapid increase in cell death or if HIF inhibition resulted in
a signaling pathway failure required for tumor propagation.
Following up these studies, which were done primarily in GSCs, I interrogated
the importance of hypoxia and the HIFs on nonstem glioma cells. GSCs are
characterized by high levels of proliferation compared to the nonstem tumor bulk.
This is further emphasized by the ability of GSCs to form neurospheres starting
from a single cell. In contrast, nonstem glioma cells are typically unable to form
neurospheres. Previous studies have demonstrated that severe hypoxia (1% O2) slows the growth of cancer cells however higher levels of oxygen (2-5% O2) have
not been as well studied. I interrogated the effect of moderate levels of hypoxia
on the nonstem glioma cells. Surprisingly, I observed a significant increase in
cell growth as measured by cell titer. By measuring EdU (a thymidine analog)
130 incorporation, I demonstrated that the increase in proliferation was due to an
increase in cell cycling. Furthermore, moderate hypoxia also promoted
neurosphere formation in the nonstem glioma cells. These data suggested that
there are differential effects of low or moderate oxygen tension on cell growth
and cycling.
To elucidate possible mechanisms occurring under hypoxia, I examined the gene
expression of nonstem glioma cells. In addition to their growth characteristics,
GSCs also display a pattern of gene expression reminiscent of normal neural stem cells. Several groups have examined the importance of stem cell related
gene expression, such as Bmi-1, Nanog, c-Myc, and Oct4, in the GSCs (detailed
in Chapter 1). I have also observed preferential expression of stem genes in the
GSC population. I hypothesized that the changes in growth of nonstem cells is
indicative of a change in phenotype promoted by hypoxia. Indeed, nonstem
glioma cells expressed Nanog, Oct4, and c-Myc at levels similar to GSCs when
cultured under restricted oxygen. These data suggested that hypoxia is able to
modify glioma cell phenotype and different levels of restricted oxygen can have
significantly different outcomes on cell phenotype. The contribution of HIF2α was
particularly interesting; previous publications have demonstrated preferential
expression of HIF2α in the GSCs and my own studies revealed that nonstem
cells forms spheres at 2% O2. This suggests that at moderate (2-5% O2) hypoxia, where only HIF2α is stabilized, there is a promotion of the GSC phenotype. To elucidate the importance of HIF2α, I expressed a nondegradable
131 form of HIF2α at 21% O2. HIF2α overexpression was able to replicate a similar cell phenotype observed under hypoxia. Additionally, HIF2α overexpression was able to promote tumor formation in nonstem glioma cells. These data suggest that the preferential expression of HIF2α in GSCs is vital for the tumorigenic phenotype. Therapeutic targeting of HIF2α could lead to innovative treatments and improved patient survival by specifically reducing the GSC subpopulation.
Since publication of these studies, several groups have demonstrated that microenvironmental conditions such as acidic stress and hypoxia maintain a
stem-like phenotype [17]. Although in many studies (including my own) restricted
oxygen of 1-7% is referred to as “hypoxic,” it is a physiologically relevant level of
O2 [295, 327]. In the human body, the highest concentration of oxygen (11%)
can be found in the major arteries. Oxygen levels in the brain can range from 1-
7%. In pathological conditions such as brain tumors, there is a higher prevalence
of restricted oxygen (near 1%) and anoxic conditions near regions of necrosis
[295, 327]. The presence of moderate hypoxic conditions (2-5% O2) is conducive to HIF2α stabilization throughout the tumor and suggest that hypoxic niches may exist that support the growth of GSCs. These niches provide a method of promoting tumorigenesis when large portions of the GSC population are removed via surgery, chemo-, or radio-therapy. When faced with extrinsic stress, certain populations of nonstem glioma cells within the hypoxic niche can modify their phenotype in order to ensure the continued propagation of the tumor. This has important ramifications when considering glioma treatment. These studies
132 suggest that the GSC hierarchy contains a degree of plasticity, reminiscent of
iPSCs.
Modulation of glioma cell phenotype increases the difficulty of effectively
targeting the neoplastic population responsible for tumorigenesis. Even therapies
that are purported to target GSCs may prove ineffective if nonstem glioma cells
can then become GSCs at a later time post-treatment. In order to effectively treat GBM and other gliomas, the microenvironment must be considered. Novel therapeutics that inhibit the glioma cell-microenvironment interaction are vital for clinical efficacy. In addition to adjuvant chemotherapy, disruption of the microenvironmental niche would prevent glioma cell adaptation and could lead to better long-term patient survival. Although plasticity of the glioma cell phenotype has been well established, the signaling pathways required for this adaptation to microenvironmental stress is not understood. In hypoxia, HIF2α is a key component in promoting the tumorigenic ability of nonstem glioma cells. In trying to understand the mechanisms involved in GBM, it is useful to observe how hypoxia and reprogramming play a role in normal stem cell systems.
4.3-Epigenetics of Glioma Cells
The advent of induced pluripotency has revealed many opportunities for effective tissue replacement therapeutic strategies. iPS has also challenged the dogma
133 that differentiated cells are unable to revert to a more stem-like state. Likewise in
glioma, recent experimental evidence has demonstrated that microenvironmental
cues, such as hypoxia, can promote a phenotypic plasticity in non-tumorigenic
cancer cells. The pathways utilized by hypoxia in glioma are not well
understood. However, studies of iPS have elucidated a relationship between
hypoxia and reprogramming in the normal stem cell system. To reprogram
somatic cells, specific factors, such as c-Myc and Oct4, are delivered to the cells
[227-231]. To measure reprogramming efficiency, the formation of colonies
(similar to the neurosphere formation assay) and changes in histone
modifications are indicative of successful phenotype shift to a more pluripotent
state [209, 230]. Importantly, when reprogramming is performed under moderate
hypoxia (5% O2) there is a significant increase in colony formation, indicating
increased reprogramming efficiency [209]. There are similar changes in histone
modifications. In pluripotent stem cells, triple methylation of H3K4 near the
promoters of key factors (such as Oct4) indicates active transcription. Similarly,
successfully reprogrammed fibroblasts have increased H3K4m3 signatures on stem cell-related genes and display an overall shift in epigenetic phenotype to that of normal pluripotent cells. The epigenetic phenotype of GBM cells have begun to receive greater attention. Like iPSCs, induced phenotype changes in glioma cells could rely on epigenetic modifications. Furthermore, recent experimental evidence has drawn a link between hypoxia and a stem-like state in both normal and tumor systems. I hypothesized that my previously published observations that demonstrated the importance of HIF2α and hypoxia in
134 promoting the GSC phenotype required modifications of histones, specifically
H3K4. Several groups have recently investigated the importance of epigenetic
modifying proteins in cancer [141, 234, 238, 328]. In many cases histone demethylating enzymes were shown to have heterogeneous expression within tumors and preferential expression of specific enzymes, like JARID1B, was indicative of a tumorigenic population [252, 263]. Several reports suggested hypoxia was able to regulate a subset of epigenetic modifying proteins [262, 263,
329] however these studies were limited to histone demethylases. Heretofore no study interrogated the relationship between hypoxia, HIF2α, and H3K4 methyltransferases.
4.4-The Importance of MLL1 in HIF2α Signaling and Tumor Propagation
I hypothesized that epigenetic modifying proteins were regulated by HIF2α in the GSCs and critical for the downstream hypoxic response in glioma cells.
Using a PCR screen of epigenetic modifying proteins on patient-derived glioma specimens, I observed consistent preferential expression of a small subset of genes in the GSCs. Of this subset, only one target, MLL1, was previously established as a proto-oncogene in another cancer system as well as having normal function as a histone methyltransferase [243, 247, 248, 250, 318, 319,
322]. In leukemia, translocation of the MLL1 gene is an initiating factor in some forms of adult and juvenile leukemia. However there have been no studies examining its wild-type role in GBM. It should be noted that additional studies are
135 required utilizing a larger scale technique, such as microarrays, in order to better
elucidate other epigenetic signaling pathway involvement in addition to MLL1.
Regardless, I observed that in nonstem glioma cells and GSCs, MLL1 was
upregulated under hypoxic conditions. Contrary to my initial hypothesis, shRNA
studies revealed that this upregulation was not specific to HIF2α. Although HIF2A
inhibition tended to have a more substantial effect on MLL1 expression, HIF1α
was also required for modulation of MLL1 levels. Examination of MLL1 promoter
revealed a lack of consensus HIF binding sites and further analysis by ChIP of
HIF2α demonstrated no direct binding to MLL1. These data suggest that there may be intermediary factors responsible for hypoxic upregulation of MLL1. It is likely that B-Catenin is a factor in upregulating MLL1. Recent experimental evidence has shown a link between oxygen level, HIFs, and B-Catenin stabilization [330, 331]. It has also been published that B-Catenin acts to establish MLL leukemic stem cells. Through my own analysis of the MLL1 promoter, there are multiple binding sites of downstream B-Catenin transcriptional target, TCF. This suggests a regulatory role for the Wnt/B-Catenin pathway and a possible explanation as to why MLL1 is hypoxia regulated but not directly bound by HIFs. Additional in depth analysis of the promoter region of
MLL1 is necessary. Little is known about the precise regions required for
transcription of the MLL1 gene, which created logistical difficulty in performing
more rigorous analyses in my studies.
It was clear that hypoxia increased expression of MLL1 but did not require direct
136 binding of the HIFs. Conversely, I observed a loss of hypoxia response of HIF2A
in cells that were transduced with MLL1 shRNA. These studies were the first
known experiments to demonstrate transcriptional regulation of HIF2A and the downstream hypoxia response. Through ChIP analysis, I demonstrated that the regulation of HIF2A required, in part, modulation of histone modifications. Cells transduced with MLL1 shRNA revealed a loss in H3K4m3 and an increase of
H3K27m3 on the HIF2A promoter region. These data suggest that loss of MLL1 represses transcription of HIF2A.
Although the data presented clearly shows a change in histone methylation on
HIF2A following MLL1 inhibition, if treated with restricted oxygen the effect of the shRNA is diminished (data not shown). The mechanism behind this is not known.
I have consistently observed that baseline levels of H3K4m3 and H3K27m3 decrease and increase, respectively, with hypoxic treatment. Interpretation of these data are difficult since there is familial redundancy within the H3K4 methyltransferase family and prior reports have observed that knockout of one family member can be compensated by others [246]. Furthermore, no other studies have examined histone modification of HIF2A. The stress state of hypoxia may induce H3K4 demethylation as there have been studies observing hypoxic regulation of H3K4 demethylase activity [263]. Additionally, recent experimental evidence has demonstrated that some transcription factors required direct methylation by histone modifying factors to function [332-334]. Sufficient
post-translational modification analysis of HIF2A has not been performed and is
137 a question that requires further study.
My work has not completely defined the signaling mechanism between MLL1 and
HIF2A, but it has shown that the function of MLL1 is HIF2α-specific and
downstream hypoxic responses are significantly diminished when MLL1 is
inhibited by shRNA. Furthermore tumor propagation is significantly inhibited
following MLL1 shRNA transduction but this relationship is not fully understood.
An earlier report described MLL1 being required for cell cycle progression so it is
not clear if the knockdown effect on tumorigenicity is due to MLL1‘s function on
HIF2α or a separate signaling pathway. Regardless, these data demonstrate
that the function of HIF2α in the hypoxic response and in promoting tumorigenicity require MLL1. This is the first report of a methyltransferase playing a critical role in tumor propagation and suggests that the importance of HIF2α
previously observed (Chapter 2) is ultimately regulated by glioma cell
epigenetics.
The work I have performed in this dissertation describes the intricate relationship
between the hypoxic niche found within GBM and the tumorigenic ability of
GSCs. I have shown that HIF2α is of particular importance in promoting tumor propagation and is able to induce a GSC phenotype in nonstem glioma cells, which were previously thought to be terminally differentiated progeny. Since my initial report, other studies have demonstrated that the tumor microenvironment is
138 of critical importance to tumor propagation. I further elucidated the contribution of glioma cell epigenetic modifying protein, MLL1, in the hypoxia response in
GBM. This was the first report of any methyltransferase regulating HIF2α and the hypoxic response. My work has provided rationale for the design of more sophisticated therapeutic treatments targeting not only the hypoxic niche, but glioma cell epigenetics as well. Disruption of the GSC niche will inhibit cellular adaptation to microenvironmental changes following patient treatment and subsequent inhibition of epigenetic modification can reduce GSC-driven angiogenesis and tumor propagation by preventing transcription of HIF2A.
Although these data demonstrate promising avenues of treatment, more work is required to fully elucidate the relationship between hypoxia and glioma cell tumorigenicity.
4.5-Future Directions
There are several important questions related to my dissertation work that would help elucidate the role of hypoxia and MLL1 in GBM tumor propagation. The first question is if MLL1 plays a differential role in tumor maintenance compared to tumor initiation. My current work has focused on the role of MLL1 in tumor initation, however in a clinical setting, almost no patients are treated prior to formation of a malignancy. Therefore it is important to evaluate the function of
MLL1 in a more clinically relevant system. However implementing an in vivo system is not straight-forward. Current limitations of shRNA constructs include
139 stably expressing the construct before intracranial implantation of glioma cells.
Downstream effects of inhibiting MLL1 are occurring as the cells are adjusting to the microenvironment of the mouse brain. This may cause unintended cell death as there could be signaling pathways not related to tumor propagation but essential for cell engraftment that is depleted with MLL1 inhibition. A more sophisticated method of interrogating MLL1 function in tumor propagation is needed. Several groups have begun using inducible shRNA constructs that are
TET-on systems controlled by doxycyclin delivery. These constructs are also commercially available under the pTripZ backbone (Open Biosystems). By modifying the pTripZ backbone and replacing the drug selection marker with GFP and the activation of shRNA measured by RFP, a dual color system can be utilized for regulating expression of shRNA. This would allow for stable incorporation of the construct (evidenced by GFP expression) but the shRNA would remain silent until doxycycline is delivered. Following cell engraftment, the mice would be given doxycycline in their water to activate the construct. Once tumors form, they can be analyzed by immunofluorescence for presence of the construct (GFP) and activation of the shRNA (RFP). By varying the time of shRNA activation, the contribution of MLL1 at different stages of tumor formation can be assessed. Real time analysis of tumor growth can be done using this inducible shRNA system in cells that express luciferase. Using a animal imaging system (Xenogen), the implanted glioma cells can be directly quantified by luciferase expression. Activation of the shRNA will cause changes in luciferase levels, thereby indicating how MLL1 inhibition affects tumor maintenance.
140 Although use of inducible shRNA will elucidate MLL1 contribution to tumor
initiation and maintenance, the major drawback to this system is that it relies on
implantation of human cells into a mouse, which creates an tumor in an artificial
environment. Use of a mouse model could inform on how MLL1 is involved in
tumor formation in a native neural system. Several groups have recently published studies using a MLL1-floxed mouse model system [321]. Restriction of
CRE expression to specific cells of the brain will lead to homozygous knockout of
MLL1. Combined with the Eric Holland Nestin-Tva model [335, 336], these
studies could elucidate the role of MLL1 in tumor formation and in maintenance
of the hypoxic niche. This would also give an opportunity for extensive
characterization of the hypoxic niche during different stages of tumor formation.
Differentiating between tumor initiation and tumor maintenance is crucial for
properly treating patients; all treated patients present with symptoms from a
already growing tumor. To design an appropriate course of therapy, the role of
the hypoxic niche and MLL1 during tumor maintenance has to be better
understood.
141
GFP
387GSC GFP RFP Merge Infection Control +Doxycycline
Figure 24. Treatment with Doxycyline activates inducible construct. 387 GSCs were cultured on minimal growth factor ECM (Geltrex). Cells were transduced with inducible constructs bearing GFP as infection control and RFP as marker for activated TRE. shRNA mir insertion site was left empty. Observation of RFP-positive cells following 24 hours of Doxycyline treatment indicates functional construct.
142 Bibliography
[1] Stupp R, Hegi ME, Neyns B, Goldbrunner R, Schlegel U, Clement PM,
Grabenbauer GG, Ochsenbein AF, Simon M, Dietrich PY, Pietsch T,
Hicking C, Tonn JC, Diserens AC, Pica A, Hermisson M, Krueger S,
Picard M, Weller M. Phase I/IIa study of cilengitide and temozolomide with
concomitant radiotherapy followed by cilengitide and temozolomide
maintenance therapy in patients with newly diagnosed glioblastoma. J Clin
Oncol, 2010; 28: 2712-8.
[2] Hesselager G, Holland EC. Using mice to decipher the molecular genetics
of brain tumors. Neurosurgery, 2003; 53: 685-94; discussion 695.
[3] Brennan C, Momota H, Hambardzumyan D, Ozawa T, Tandon A, Pedraza
A, Holland E. Glioblastoma subclasses can be defined by activity among
signal transduction pathways and associated genomic alterations. PLoS
One, 2009; 4: e7752.
[4] Ebos JM, Lee CR, Cruz-Munoz W, Bjarnason GA, Christensen JG, Kerbel
RS. Accelerated metastasis after short-term treatment with a potent
inhibitor of tumor angiogenesis. Cancer Cell, 2009; 15: 232-9.
[5] Paez-Ribes M, Allen E, Hudock J, Takeda T, Okuyama H, Vinals F, Inoue
M, Bergers G, Hanahan D, Casanovas O. Antiangiogenic therapy elicits
malignant progression of tumors to increased local invasion and distant
metastasis. Cancer Cell, 2009; 15: 220-31.
143 [6] Vescovi AL, Galli R, Reynolds BA. Brain tumour stem cells. Nat Rev
Cancer, 2006; 6: 425-36.
[7] Singh SK, Clarke ID, Hide T, Dirks PB. Cancer stem cells in nervous
system tumors. Oncogene, 2004; 23: 7267-73.
[8] Beier D, Hau P, Proescholdt M, Lohmeier A, Wischhusen J, Oefner PJ,
Aigner L, Brawanski A, Bogdahn U, Beier CP. CD133(+) and CD133(-)
glioblastoma-derived cancer stem cells show differential growth
characteristics and molecular profiles. Cancer Res, 2007; 67: 4010-5.
[9] Rosen JM, Jordan CT. The increasing complexity of the cancer stem cell
paradigm. Science, 2009; 324: 1670-3.
[10] Bao S, Wu Q, McLendon RE, Hao Y, Shi Q, Hjelmeland AB, Dewhirst
MW, Bigner DD, Rich JN. Glioma stem cells promote radioresistance by
preferential activation of the DNA damage response. Nature, 2006; 444:
756-60.
[11] Liu G, Yuan X, Zeng Z, Tunici P, Ng H, Abdulkadir IR, Lu L, Irvin D, Black
KL, Yu JS. Analysis of gene expression and chemoresistance of CD133+
cancer stem cells in glioblastoma. Mol Cancer, 2006; 5: 67.
[12] Calabrese C, Poppleton H, Kocak M, Hogg TL, Fuller C, Hamner B, Oh
EY, Gaber MW, Finklestein D, Allen M, Frank A, Bayazitov IT, Zakharenko
SS, Gajjar A, Davidoff A, Gilbertson RJ. A perivascular niche for brain
tumor stem cells. Cancer Cell, 2007; 11: 69-82.
144 [13] Li Z, Bao S, Wu Q, Wang H, Eyler C, Sathornsumetee S, Shi Q, Cao Y,
Lathia J, McLendon RE, Hjelmeland AB, Rich JN. Hypoxia-inducible
factors regulate tumorigenic capacity of glioma stem cells. Cancer Cell,
2009; 15: 501-13.
[14] Lathia JD, Gallagher J, Heddleston JM, Wang J, Eyler CE, Macswords J,
Wu Q, Vasanji A, McLendon RE, Hjelmeland AB, Rich JN. Integrin alpha 6
regulates glioblastoma stem cells. Cell Stem Cell, 2010; 6: 421-32.
[15] Heddleston JM, Li Z, McLendon RE, Hjelmeland AB, Rich JN. The hypoxic
microenvironment maintains glioblastoma stem cells and promotes
reprogramming towards a cancer stem cell phenotype. Cell Cycle, 2009;
8.
[16] Soeda A, Park M, Lee D, Mintz A, Androutsellis-Theotokis A, McKay RD,
Engh J, Iwama T, Kunisada T, Kassam AB, Pollack IF, Park DM. Hypoxia
promotes expansion of the CD133-positive glioma stem cells through
activation of HIF-1alpha. Oncogene, 2009; 28: 3949-59.
[17] Seidel S, Garvalov BK, Wirta V, von Stechow L, Schanzer A, Meletis K,
Wolter M, Sommerlad D, Henze AT, Nister M, Reifenberger G, Lundeberg
J, Frisen J, Acker T. A hypoxic niche regulates glioblastoma stem cells
through hypoxia inducible factor 2 alpha. Brain : a journal of neurology,
2010; 133: 983-95.
145 [18] Hjelmeland AB, Wu Q, Heddleston JM, Choudhary GS, Macswords J,
Lathia JD, McLendon R, Lindner D, Sloan A, Rich JN. Acidic stress
promotes a glioma stem cell phenotype. Cell Death Differ, 2011; 18: 829-
40.
[19] Lapidot T, Sirard C, Vormoor J, Murdoch B, Hoang T, Caceres-Cortes J,
Minden M, Paterson B, Caligiuri MA, Dick JE. A cell initiating human acute
myeloid leukaemia after transplantation into SCID mice. Nature, 1994;
367: 645-8.
[20] Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a
hierarchy that originates from a primitive hematopoietic cell. Nat Med,
1997; 3: 730-7.
[21] Bertolini G, Roz L, Perego P, Tortoreto M, Fontanella E, Gatti L, Pratesi G,
Fabbri A, Andriani F, Tinelli S, Roz E, Caserini R, Lo Vullo S, Camerini T,
Mariani L, Delia D, Calabro E, Pastorino U, Sozzi G. Highly tumorigenic
lung cancer CD133+ cells display stem-like features and are spared by
cisplatin treatment. Proc Natl Acad Sci U S A, 2009; 106: 16281-6.
[22] Curley MD, Therrien VA, Cummings CL, Sergent PA, Koulouris CR, Friel
AM, Roberts DJ, Seiden MV, Scadden DT, Rueda BR, Foster R. CD133
expression defines a tumor initiating cell population in primary human
ovarian cancer. Stem Cells, 2009; 27: 2875-83.
146 [23] Fang D, Nguyen TK, Leishear K, Finko R, Kulp AN, Hotz S, Van Belle PA,
Xu X, Elder DE, Herlyn M. A tumorigenic subpopulation with stem cell
properties in melanomas. Cancer Res, 2005; 65: 9328-37.
[24] Fang DD, Kim YJ, Lee CN, Aggarwal S, McKinnon K, Mesmer D, Norton
J, Birse CE, He T, Ruben SM, Moore PA. Expansion of CD133(+) colon
cancer cultures retaining stem cell properties to enable cancer stem cell
target discovery. Br J Cancer, 2010; 102: 1265-75.
[25] Haraguchi N, Ohkuma M, Sakashita H, Matsuzaki S, Tanaka F, Mimori K,
Kamohara Y, Inoue H, Mori M. CD133+CD44+ population efficiently
enriches colon cancer initiating cells. Ann Surg Oncol, 2008; 15: 2927-33.
[26] Held MA, Curley DP, Dankort D, McMahon M, Muthusamy V, Bosenberg
MW. Characterization of melanoma cells capable of propagating tumors
from a single cell. Cancer Res, 2010; 70: 388-97.
[27] Hu L, McArthur C, Jaffe RB. Ovarian cancer stem-like side-population
cells are tumourigenic and chemoresistant. Br J Cancer, 2010; 102: 1276-
83.
[28] O'Brien CA, Pollett A, Gallinger S, Dick JE. A human colon cancer cell
capable of initiating tumour growth in immunodeficient mice. Nature, 2007;
445: 106-10.
[29] Puglisi MA, Sgambato A, Saulnier N, Rafanelli F, Barba M, Boninsegna A,
Piscaglia AC, Lauritano C, Novi ML, Barbaro F, Rinninella E, Campanale
147 C, Giuliante F, Nuzzo G, Alfieri S, Doglietto GB, Cittadini A, Gasbarrini A.
Isolation and characterization of CD133+ cell population within human
primary and metastatic colon cancer. Eur Rev Med Pharmacol Sci, 2009;
13 Suppl 1: 55-62.
[30] Ricci-Vitiani L, Lombardi DG, Pilozzi E, Biffoni M, Todaro M, Peschle C,
De Maria R. Identification and expansion of human colon-cancer-initiating
cells. Nature, 2007; 445: 111-5.
[31] Tirino V, Camerlingo R, Franco R, Malanga D, La Rocca A, Viglietto G,
Rocco G, Pirozzi G. The role of CD133 in the identification and
characterisation of tumour-initiating cells in non-small-cell lung cancer. Eur
J Cardiothorac Surg, 2009; 36: 446-53.
[32] Tirino V, Desiderio V, d'Aquino R, De Francesco F, Pirozzi G, Graziano A,
Galderisi U, Cavaliere C, De Rosa A, Papaccio G, Giordano A. Detection
and characterization of CD133+ cancer stem cells in human solid tumours.
PLoS One, 2008; 3: e3469.
[33] Tirino V, Desiderio V, Paino F, De Rosa A, Papaccio F, Fazioli F, Pirozzi
G, Papaccio G. Human primary bone sarcomas contain CD133+ cancer
stem cells displaying high tumorigenicity in vivo. FASEB J, 2011.
[34] Tomuleasa C, Soritau O, Rus-Ciuca D, Pop T, Todea D, Mosteanu O,
Pintea B, Foris V, Susman S, Kacso G, Irimie A. Isolation and
148 characterization of hepatic cancer cells with stem-like properties from
hepatocellular carcinoma. J Gastrointestin Liver Dis, 2010; 19: 61-7.
[35] Wang J, Guo LP, Chen LZ, Zeng YX, Lu SH. Identification of cancer stem
cell-like side population cells in human nasopharyngeal carcinoma cell
line. Cancer Res, 2007; 67: 3716-24.
[36] Wright MH, Calcagno AM, Salcido CD, Carlson MD, Ambudkar SV,
Varticovski L. Brca1 breast tumors contain distinct CD44+/CD24- and
CD133+ cells with cancer stem cell characteristics. Breast Cancer Res,
2008; 10: R10.
[37] Zhu Z, Hao X, Yan M, Yao M, Ge C, Gu J, Li J. Cancer stem/progenitor
cells are highly enriched in CD133+CD44+ population in hepatocellular
carcinoma. Int J Cancer, 2010; 126: 2067-78.
[38] Boiko AD, Razorenova OV, van de Rijn M, Swetter SM, Johnson DL, Ly
DP, Butler PD, Yang GP, Joshua B, Kaplan MJ, Longaker MT, Weissman
IL. Human melanoma-initiating cells express neural crest nerve growth
factor receptor CD271. Nature, 2010; 466: 133-7.
[39] Dou J, Li Y, Zhao F, Hu W, Wen P, Tang Q, Chu L, Wang Y, Cao M, Jiang
C, Gu N. Identification of tumor stem-like cells in a mouse myeloma cell
line. Cell Mol Biol (Noisy-le-grand), 2009; 55 Suppl: OL1151-60.
149 [40] Quintana E, Shackleton M, Sabel MS, Fullen DR, Johnson TM, Morrison
SJ. Efficient tumour formation by single human melanoma cells. Nature,
2008; 456: 593-8.
[41] Hemmati HD, Nakano I, Lazareff JA, Masterman-Smith M, Geschwind DH,
Bronner-Fraser M, Kornblum HI. Cancerous stem cells can arise from
pediatric brain tumors. Proc Natl Acad Sci U S A, 2003; 100: 15178-83.
[42] Schatton T, Frank MH. Cancer stem cells and human malignant
melanoma. Pigment Cell Melanoma Res, 2008; 21: 39-55.
[43] Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C, Squire J, Dirks
PB. Identification of a cancer stem cell in human brain tumors. Cancer
Res, 2003; 63: 5821-8.
[44] Clarke MF, Dick JE, Dirks PB, Eaves CJ, Jamieson CH, Jones DL,
Visvader J, Weissman IL, Wahl GM. Cancer stem cells--perspectives on
current status and future directions: AACR Workshop on cancer stem
cells. Cancer Res, 2006; 66: 9339-44.
[45] Laks DR, Masterman-Smith M, Visnyei K, Angenieux B, Orozco NM,
Foran I, Yong WH, Vinters HV, Liau LM, Lazareff JA, Mischel PS,
Cloughesy TF, Horvath S, Kornblum HI. Neurosphere formation is an
independent predictor of clinical outcome in malignant glioma. Stem Cells,
2009; 27: 980-7.
150 [46] Wan F, Zhang S, Xie R, Gao B, Campos B, Herold-Mende C, Lei T. The
utility and limitations of neurosphere assay, CD133 immunophenotyping
and side population assay in glioma stem cell research. Brain Pathol,
2010; 20: 877-89.
[47] Lee J, Kotliarova S, Kotliarov Y, Li A, Su Q, Donin NM, Pastorino S,
Purow BW, Christopher N, Zhang W, Park JK, Fine HA. Tumor stem cells
derived from glioblastomas cultured in bFGF and EGF more closely mirror
the phenotype and genotype of primary tumors than do serum-cultured
cell lines. Cancer Cell, 2006; 9: 391-403.
[48] Santa-Olalla J, Covarrubias L. Basic fibroblast growth factor promotes
epidermal growth factor responsiveness and survival of mesencephalic
neural precursor cells. J Neurobiol, 1999; 40: 14-27.
[49] Vescovi AL, Reynolds BA, Fraser DD, Weiss S. bFGF regulates the
proliferative fate of unipotent (neuronal) and bipotent (neuronal/astroglial)
EGF-generated CNS progenitor cells. Neuron, 1993; 11: 951-66.
[50] Villa A, Snyder EY, Vescovi A, Martinez-Serrano A. Establishment and
properties of a growth factor-dependent, perpetual neural stem cell line
from the human CNS. Exp Neurol, 2000; 161: 67-84.
[51] Kelly JJ, Stechishin O, Chojnacki A, Lun X, Sun B, Senger DL, Forsyth P,
Auer RN, Dunn JF, Cairncross JG, Parney IF, Weiss S. Proliferation of
151 human glioblastoma stem cells occurs independently of exogenous
mitogens. Stem Cells, 2009; 27: 1722-33.
[52] Bao S, Wu Q, Sathornsumetee S, Hao Y, Li Z, Hjelmeland AB, Shi Q,
McLendon RE, Bigner DD, Rich JN. Stem cell-like glioma cells promote
tumor angiogenesis through vascular endothelial growth factor. Cancer
Res, 2006; 66: 7843-8.
[53] Wang H, Lathia JD, Wu Q, Wang J, Li Z, Heddleston JM, Eyler CE,
Elderbroom J, Gallagher J, Schuschu J, Macswords J, Cao Y, McLendon
RE, Wang XF, Hjelmeland AB, Rich JN. Targeting Interleukin 6 Signaling
Suppresses Glioma Stem Cell Survival and Tumor Growth. Stem Cells,
2009.
[54] Garcia JL, Perez-Caro M, Gomez-Moreta JA, Gonzalez F, Ortiz J, Blanco
O, Sancho M, Hernandez-Rivas JM, Gonzalez-Sarmiento R, Sanchez-
Martin M. Molecular analysis of ex-vivo CD133+ GBM cells revealed a
common invasive and angiogenic profile but different proliferative
signatures among high grade gliomas. BMC Cancer, 2010; 10: 454.
[55] Inoue A, Takahashi H, Harada H, Kohno S, Ohue S, Kobayashi K, Yano
H, Tanaka J, Ohnishi T. Cancer stem-like cells of glioblastoma
characteristically express MMP-13 and display highly invasive activity. Int
J Oncol, 2010; 37: 1121-31.
152 [56] Brehar FM, Ciurea AV, Zarnescu O, Bleotu C, Gorgan RM, Dragu D,
Matei L. Infiltrating growing pattern xenografts induced by glioblastoma
and anaplastic astrocytoma derived tumor stem cells. Chirurgia (Bucur),
2010; 105: 685-94.
[57] Wakimoto H, Kesari S, Farrell CJ, Curry WT, Jr., Zaupa C, Aghi M,
Kuroda T, Stemmer-Rachamimov A, Shah K, Liu TC, Jeyaretna DS,
Debasitis J, Pruszak J, Martuza RL, Rabkin SD. Human glioblastoma-
derived cancer stem cells: establishment of invasive glioma models and
treatment with oncolytic herpes simplex virus vectors. Cancer Res, 2009;
69: 3472-81.
[58] Cheng L, Wu Q, Huang Z, Guryanova OA, Huang Q, Shou W, Rich JN,
Bao S. L1CAM regulates DNA damage checkpoint response of
glioblastoma stem cells through NBS1. EMBO J, 2011; 30: 800-13.
[59] Folkins C, Shaked Y, Man S, Tang T, Lee CR, Zhu Z, Hoffman RM, Kerbel
RS. Glioma tumor stem-like cells promote tumor angiogenesis and
vasculogenesis via vascular endothelial growth factor and stromal-derived
factor 1. Cancer Res, 2009; 69: 7243-51.
[60] Oka N, Soeda A, Inagaki A, Onodera M, Maruyama H, Hara A, Kunisada
T, Mori H, Iwama T. VEGF promotes tumorigenesis and angiogenesis of
human glioblastoma stem cells. Biochem Biophys Res Commun, 2007;
360: 553-9.
153 [61] Yao XH, Ping YF, Chen JH, Xu CP, Chen DL, Zhang R, Wang JM, Bian
XW. Glioblastoma stem cells produce vascular endothelial growth factor
by activation of a G-protein coupled formylpeptide receptor FPR. J Pathol,
2008; 215: 369-76.
[62] Ricci-Vitiani L, Pallini R, Biffoni M, Todaro M, Invernici G, Cenci T, Maira
G, Parati EA, Stassi G, Larocca LM, De Maria R. Tumour vascularization
via endothelial differentiation of glioblastoma stem-like cells. Nature, 2010;
468: 824-8.
[63] Wang R, Chadalavada K, Wilshire J, Kowalik U, Hovinga KE, Geber A,
Fligelman B, Leversha M, Brennan C, Tabar V. Glioblastoma stem-like
cells give rise to tumour endothelium. Nature, 2010; 468: 829-33.
[64] Eyler CE, Foo WC, LaFiura KM, McLendon RE, Hjelmeland AB, Rich JN.
Brain cancer stem cells display preferential sensitivity to Akt inhibition.
Stem Cells, 2008; 26: 3027-36.
[65] Molina JR, Hayashi Y, Stephens C, Georgescu MM. Invasive glioblastoma
cells acquire stemness and increased Akt activation. Neoplasia, 2010; 12:
453-63.
[66] Bao S, Wu Q, Li Z, Sathornsumetee S, Wang H, McLendon RE,
Hjelmeland AB, Rich JN. Targeting cancer stem cells through L1CAM
suppresses glioma growth. Cancer Res, 2008; 68: 6043-8.
154 [67] Goldbrunner RH, Haugland HK, Klein CE, Kerkau S, Roosen K, Tonn JC.
ECM dependent and integrin mediated tumor cell migration of human
glioma and melanoma cell lines under serum-free conditions. Anticancer
Res, 1996; 16: 3679-87.
[68] Cheng L, Wu Q, Guryanova OA, Huang Z, Huang Q, Rich JN, Bao S.
Elevated invasive potential of glioblastoma stem cells. Biochem Biophys
Res Commun, 2011; 406: 643-8.
[69] Ma HI, Chiou SH, Hueng DY, Tai LK, Huang PI, Kao CL, Chen YW, Sytwu
HK. Celecoxib and radioresistant glioblastoma-derived CD133+ cells:
improvement in radiotherapeutic effects. Laboratory investigation. J
Neurosurg, 2011; 114: 651-62.
[70] Gong X, Schwartz PH, Linskey ME, Bota DA. Neural stem/progenitors and
glioma stem-like cells have differential sensitivity to chemotherapy.
Neurology, 2011; 76: 1126-34.
[71] Eramo A, Ricci-Vitiani L, Zeuner A, Pallini R, Lotti F, Sette G, Pilozzi E,
Larocca LM, Peschle C, De Maria R. Chemotherapy resistance of
glioblastoma stem cells. Cell Death Differ, 2006; 13: 1238-41.
[72] Fu J, Liu ZG, Liu XM, Chen FR, Shi HL, Pangjesse CS, Ng HK, Chen ZP.
Glioblastoma stem cells resistant to temozolomide-induced autophagy.
Chin Med J (Engl), 2009; 122: 1255-9.
155 [73] Beier D, Rohrl S, Pillai DR, Schwarz S, Kunz-Schughart LA, Leukel P,
Proescholdt M, Brawanski A, Bogdahn U, Trampe-Kieslich A, Giebel B,
Wischhusen J, Reifenberger G, Hau P, Beier CP. Temozolomide
preferentially depletes cancer stem cells in glioblastoma. Cancer Res,
2008; 68: 5706-15.
[74] Gaspar N, Marshall L, Perryman L, Bax DA, Little SE, Viana-Pereira M,
Sharp SY, Vassal G, Pearson AD, Reis RM, Hargrave D, Workman P,
Jones C. MGMT-independent temozolomide resistance in pediatric
glioblastoma cells associated with a PI3-kinase-mediated HOX/stem cell
gene signature. Cancer Res, 2010; 70: 9243-52.
[75] Jin F, Zhao L, Guo YJ, Zhao WJ, Zhang H, Wang HT, Shao T, Zhang SL,
Wei YJ, Feng J, Jiang XB, Zhao HY. Influence of Etoposide on anti-
apoptotic and multidrug resistance-associated protein genes in CD133
positive U251 glioblastoma stem-like cells. Brain Res, 2010; 1336: 103-11.
[76] Qin K, Jiang X, Zou Y, Wang J, Qin L, Zeng Y. Study on the proliferation
and drug-resistance of human brain tumor stem-like cells. Cell Mol
Neurobiol, 2010; 30: 955-60.
[77] Angelastro JM, Lame MW. Overexpression of CD133 promotes drug
resistance in C6 glioma cells. Mol Cancer Res, 2010; 8: 1105-15.
[78] Facchino S, Abdouh M, Chatoo W, Bernier G. BMI1 confers
radioresistance to normal and cancerous neural stem cells through
156 recruitment of the DNA damage response machinery. J Neurosci, 2010;
30: 10096-111.
[79] Zhuang W, Li B, Long L, Chen L, Huang Q, Liang Z. Induction of
autophagy promotes differentiation of glioma-initiating cells and their
radiosensitivity. Int J Cancer, 2011.
[80] Zhuang W, Li B, Long L, Chen L, Huang Q, Liang ZQ. Knockdown of the
DNA-dependent protein kinase catalytic subunit radiosensitizes glioma-
initiating cells by inducing autophagy. Brain Res, 2011; 1371: 7-15.
[81] Lomonaco SL, Finniss S, Xiang C, Decarvalho A, Umansky F, Kalkanis
SN, Mikkelsen T, Brodie C. The induction of autophagy by gamma-
radiation contributes to the radioresistance of glioma stem cells. Int J
Cancer, 2009; 125: 717-22.
[82] Wei J, Barr J, Kong LY, Wang Y, Wu A, Sharma AK, Gumin J, Henry V,
Colman H, Sawaya R, Lang FF, Heimberger AB. Glioma-associated
cancer-initiating cells induce immunosuppression. Clin Cancer Res, 2010;
16: 461-73.
[83] Wei J, Barr J, Kong LY, Wang Y, Wu A, Sharma AK, Gumin J, Henry V,
Colman H, Priebe W, Sawaya R, Lang FF, Heimberger AB. Glioblastoma
cancer-initiating cells inhibit T-cell proliferation and effector responses by
the signal transducers and activators of transcription 3 pathway. Mol
Cancer Ther, 2010; 9: 67-78.
157 [84] Di Tomaso T, Mazzoleni S, Wang E, Sovena G, Clavenna D, Franzin A,
Mortini P, Ferrone S, Doglioni C, Marincola FM, Galli R, Parmiani G,
Maccalli C. Immunobiological characterization of cancer stem cells
isolated from glioblastoma patients. Clin Cancer Res, 2010; 16: 800-13.
[85] Wu A, Wei J, Kong LY, Wang Y, Priebe W, Qiao W, Sawaya R,
Heimberger AB. Glioma cancer stem cells induce immunosuppressive
macrophages/microglia. Neuro Oncol, 2010; 12: 1113-25.
[86] Verhaak RG, Hoadley KA, Purdom E, Wang V, Qi Y, Wilkerson MD, Miller
CR, Ding L, Golub T, Mesirov JP, Alexe G, Lawrence M, O'Kelly M,
Tamayo P, Weir BA, Gabriel S, Winckler W, Gupta S, Jakkula L, Feiler
HS, Hodgson JG, James CD, Sarkaria JN, Brennan C, Kahn A, Spellman
PT, Wilson RK, Speed TP, Gray JW, Meyerson M, Getz G, Perou CM,
Hayes DN. Integrated genomic analysis identifies clinically relevant
subtypes of glioblastoma characterized by abnormalities in PDGFRA,
IDH1, EGFR, and NF1. Cancer Cell, 2010; 17: 98-110.
[87] Phillips HS, Kharbanda S, Chen R, Forrest WF, Soriano RH, Wu TD,
Misra A, Nigro JM, Colman H, Soroceanu L, Williams PM, Modrusan Z,
Feuerstein BG, Aldape K. Molecular subclasses of high-grade glioma
predict prognosis, delineate a pattern of disease progression, and
resemble stages in neurogenesis. Cancer Cell, 2006; 9: 157-73.
[88] Zheng S, Houseman EA, Morrison Z, Wrensch MR, Patoka JS, Ramos C,
Haas-Kogan DA, McBride S, Marsit CJ, Christensen BC, Nelson HH,
158 Stokoe D, Wiemels JL, Chang SM, Prados MD, Tihan T, Vandenberg SR,
Kelsey KT, Berger MS, Wiencke JK. DNA hypermethylation profiles
associated with glioma subtypes and EZH2 and IGFBP2 mRNA
expression. Neuro Oncol, 2011; 13: 280-9.
[89] Wang J, Sakariassen PO, Tsinkalovsky O, Immervoll H, Boe SO,
Svendsen A, Prestegarden L, Rosland G, Thorsen F, Stuhr L, Molven A,
Bjerkvig R, Enger PO. CD133 negative glioma cells form tumors in nude
rats and give rise to CD133 positive cells. Int J Cancer, 2008; 122: 761-8.
[90] Abdouh M, Facchino S, Chatoo W, Balasingam V, Ferreira J, Bernier G.
BMI1 sustains human glioblastoma multiforme stem cell renewal. J
Neurosci, 2009; 29: 8884-96.
[91] Gangemi RM, Griffero F, Marubbi D, Perera M, Capra MC, Malatesta P,
Ravetti GL, Zona GL, Daga A, Corte G. SOX2 silencing in glioblastoma
tumor-initiating cells causes stop of proliferation and loss of tumorigenicity.
Stem Cells, 2009; 27: 40-8.
[92] Godlewski J, Nowicki MO, Bronisz A, Williams S, Otsuki A, Nuovo G,
Raychaudhury A, Newton HB, Chiocca EA, Lawler S. Targeting of the
Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma
proliferation and self-renewal. Cancer Res, 2008; 68: 9125-30.
[93] Ligon KL, Huillard E, Mehta S, Kesari S, Liu H, Alberta JA, Bachoo RM,
Kane M, Louis DN, Depinho RA, Anderson DJ, Stiles CD, Rowitch DH.
159 Olig2-regulated lineage-restricted pathway controls replication
competence in neural stem cells and malignant glioma. Neuron, 2007; 53:
503-17.
[94] Girouard SD, Murphy GF. Melanoma stem cells: not rare, but well done.
Lab Invest, 2011; 91: 647-64.
[95] Charles N, Ozawa T, Squatrito M, Bleau AM, Brennan CW,
Hambardzumyan D, Holland EC. Perivascular nitric oxide activates notch
signaling and promotes stem-like character in PDGF-induced glioma cells.
Cell Stem Cell, 2010; 6: 141-52.
[96] Heddleston JM, Li Z, Lathia JD, Bao S, Hjelmeland AB, Rich JN. Hypoxia
inducible factors in cancer stem cells. Br J Cancer, 2010; 102: 789-95.
[97] Martinez-Diaz H, Kleinschmidt-DeMasters BK, Powell SZ, Yachnis AT.
Giant cell glioblastoma and pleomorphic xanthoastrocytoma show different
immunohistochemical profiles for neuronal antigens and p53 but share
reactivity for class III beta-tubulin. Arch Pathol Lab Med, 2003; 127: 1187-
91.
[98] Perry A, Miller CR, Gujrati M, Scheithauer BW, Zambrano SC, Jost SC,
Raghavan R, Qian J, Cochran EJ, Huse JT, Holland EC, Burger PC,
Rosenblum MK. Malignant gliomas with primitive neuroectodermal tumor-
like components: a clinicopathologic and genetic study of 53 cases. Brain
Pathol, 2009; 19: 81-90.
160 [99] Uchida N, Buck DW, He D, Reitsma MJ, Masek M, Phan TV, Tsukamoto
AS, Gage FH, Weissman IL. Direct isolation of human central nervous
system stem cells. Proc Natl Acad Sci U S A, 2000; 97: 14720-5.
[100] Patru C, Romao L, Varlet P, Coulombel L, Raponi E, Cadusseau J,
Renault-Mihara F, Thirant C, Leonard N, Berhneim A, Mihalescu-Maingot
M, Haiech J, Bieche I, Moura-Neto V, Daumas-Duport C, Junier MP,
Chneiweiss H. CD133, CD15/SSEA-1, CD34 or side populations do not
resume tumor-initiating properties of long-term cultured cancer stem cells
from human malignant glio-neuronal tumors. BMC Cancer, 2010; 10: 66.
[101] Ben-Porath I, Thomson MW, Carey VJ, Ge R, Bell GW, Regev A,
Weinberg RA. An embryonic stem cell-like gene expression signature in
poorly differentiated aggressive human tumors. Nat Genet, 2008; 40: 499-
507.
[102] Yan X, Ma L, Yi D, Yoon JG, Diercks A, Foltz G, Price ND, Hood LE, Tian
Q. A CD133-related gene expression signature identifies an aggressive
glioblastoma subtype with excessive mutations. Proceedings of the
National Academy of Sciences of the United States of America, 2011; 108:
1591-6.
[103] Murat A, Migliavacca E, Gorlia T, Lambiv WL, Shay T, Hamou MF, de
Tribolet N, Regli L, Wick W, Kouwenhoven MC, Hainfellner JA, Heppner
FL, Dietrich PY, Zimmer Y, Cairncross JG, Janzer RC, Domany E,
Delorenzi M, Stupp R, Hegi ME. Stem cell-related "self-renewal" signature
161 and high epidermal growth factor receptor expression associated with
resistance to concomitant chemoradiotherapy in glioblastoma. J Clin
Oncol, 2008; 26: 3015-24.
[104] Pallini R, Ricci-Vitiani L, Banna GL, Signore M, Lombardi D, Todaro M,
Stassi G, Martini M, Maira G, Larocca LM, De Maria R. Cancer stem cell
analysis and clinical outcome in patients with glioblastoma multiforme. Clin
Cancer Res, 2008; 14: 8205-12.
[105] Zeppernick F, Ahmadi R, Campos B, Dictus C, Helmke BM, Becker N,
Lichter P, Unterberg A, Radlwimmer B, Herold-Mende CC. Stem cell
marker CD133 affects clinical outcome in glioma patients. Clin Cancer
Res, 2008; 14: 123-9.
[106] Corbeil D, Marzesco AM, Wilsch-Brauninger M, Huttner WB. The
intriguing links between prominin-1 (CD133), cholesterol-based membrane
microdomains, remodeling of apical plasma membrane protrusions,
extracellular membrane particles, and (neuro)epithelial cell differentiation.
FEBS Lett, 2010; 584: 1659-64.
[107] Beckmann J, Scheitza S, Wernet P, Fischer JC, Giebel B. Asymmetric cell
division within the human hematopoietic stem and progenitor cell
compartment: identification of asymmetrically segregating proteins. Blood,
2007; 109: 5494-501.
162 [108] Giebel B, Corbeil D, Beckmann J, Hohn J, Freund D, Giesen K, Fischer J,
Kogler G, Wernet P. Segregation of lipid raft markers including CD133 in
polarized human hematopoietic stem and progenitor cells. Blood, 2004;
104: 2332-8.
[109] Dong L, Qi N, Ge RM, Cao CL, Lan F, Shen L. Overexpression of CD133
promotes the phosphorylation of Erk in U87MG human glioblastoma cells.
Neurosci Lett, 2010; 484: 210-4.
[110] Yao J, Zhang T, Ren J, Yu M, Wu G. Effect of CD133/prominin-1
antisense oligodeoxynucleotide on in vitro growth characteristics of Huh-7
human hepatocarcinoma cells and U251 human glioma cells. Oncol Rep,
2009; 22: 781-7.
[111] Kemper K, Sprick MR, de Bree M, Scopelliti A, Vermeulen L, Hoek M,
Zeilstra J, Pals ST, Mehmet H, Stassi G, Medema JP. The AC133 epitope,
but not the CD133 protein, is lost upon cancer stem cell differentiation.
Cancer Res, 2010; 70: 719-29.
[112] Osmond TL, Broadley KW, McConnell MJ. Glioblastoma cells negative for
the anti-CD133 antibody AC133 express a truncated variant of the CD133
protein. Int J Mol Med, 2010; 25: 883-8.
[113] Shmelkov SV, St Clair R, Lyden D, Rafii S. AC133/CD133/Prominin-1. Int
J Biochem Cell Biol, 2005; 37: 715-9.
163 [114] Kemper K, Tol MJ, Medema JP. Mouse tissues express multiple splice
variants of prominin-1. PLoS One, 2010; 5: e12325.
[115] Taieb N, Maresca M, Guo XJ, Garmy N, Fantini J, Yahi N. The first
extracellular domain of the tumour stem cell marker CD133 contains an
antigenic ganglioside-binding motif. Cancer Lett, 2009; 278: 164-73.
[116] Son MJ, Woolard K, Nam DH, Lee J, Fine HA. SSEA-1 is an enrichment
marker for tumor-initiating cells in human glioblastoma. Cell Stem Cell,
2009; 4: 440-52.
[117] Ogden AT, Waziri AE, Lochhead RA, Fusco D, Lopez K, Ellis JA, Kang J,
Assanah M, McKhann GM, Sisti MB, McCormick PC, Canoll P, Bruce JN.
Identification of A2B5+CD133- tumor-initiating cells in adult human
gliomas. Neurosurgery, 2008; 62: 505-14; discussion 514-5.
[118] Anido J, Saez-Borderias A, Gonzalez-Junca A, Rodon L, Folch G,
Carmona MA, Prieto-Sanchez RM, Barba I, Martinez-Saez E, Prudkin L,
Cuartas I, Raventos C, Martinez-Ricarte F, Poca MA, Garcia-Dorado D,
Lahn MM, Yingling JM, Rodon J, Sahuquillo J, Baselga J, Seoane J. TGF-
beta Receptor Inhibitors Target the CD44(high)/Id1(high) Glioma-Initiating
Cell Population in Human Glioblastoma. Cancer Cell, 2010; 18: 655-68.
[119] Mao XG, Zhang X, Xue XY, Guo G, Wang P, Zhang W, Fei Z, Zhen HN,
You SW, Yang H. Brain Tumor Stem-Like Cells Identified by Neural Stem
Cell Marker CD15. Transl Oncol, 2009; 2: 247-57.
164 [120] Tchoghandjian A, Baeza N, Colin C, Cayre M, Metellus P, Beclin C,
Ouafik L, Figarella-Branger D. A2B5 cells from human glioblastoma have
cancer stem cell properties. Brain Pathol, 2010; 20: 211-21.
[121] Read TA, Fogarty MP, Markant SL, McLendon RE, Wei Z, Ellison DW,
Febbo PG, Wechsler-Reya RJ. Identification of CD15 as a marker for
tumor-propagating cells in a mouse model of medulloblastoma. Cancer
Cell, 2009; 15: 135-47.
[122] Ward RJ, Lee L, Graham K, Satkunendran T, Yoshikawa K, Ling E,
Harper L, Austin R, Nieuwenhuis E, Clarke ID, Hui CC, Dirks PB.
Multipotent CD15+ cancer stem cells in patched-1-deficient mouse
medulloblastoma. Cancer Res, 2009; 69: 4682-90.
[123] Capela A, Temple S. LeX is expressed by principle progenitor cells in the
embryonic nervous system, is secreted into their environment and binds
Wnt-1. Dev Biol, 2006; 291: 300-13.
[124] Dubois C, Manuguerra JC, Hauttecoeur B, Maze J. Monoclonal antibody
A2B5, which detects cell surface antigens, binds to ganglioside GT3 (II3
(NeuAc)3LacCer) and to its 9-O-acetylated derivative. J Biol Chem, 1990;
265: 2797-803.
[125] Kim M, Morshead CM. Distinct populations of forebrain neural stem and
progenitor cells can be isolated using side-population analysis. J Neurosci,
2003; 23: 10703-9.
165 [126] Lechner A, Leech CA, Abraham EJ, Nolan AL, Habener JF. Nestin-
positive progenitor cells derived from adult human pancreatic islets of
Langerhans contain side population (SP) cells defined by expression of
the ABCG2 (BCRP1) ATP-binding cassette transporter. Biochem Biophys
Res Commun, 2002; 293: 670-4.
[127] Murayama A, Matsuzaki Y, Kawaguchi A, Shimazaki T, Okano H. Flow
cytometric analysis of neural stem cells in the developing and adult mouse
brain. J Neurosci Res, 2002; 69: 837-47.
[128] Vieyra DS, Rosen A, Goodell MA. Identification and characterization of
side population cells in embryonic stem cell cultures. Stem Cells Dev,
2009; 18: 1155-66.
[129] Bleau AM, Hambardzumyan D, Ozawa T, Fomchenko EI, Huse JT,
Brennan CW, Holland EC. PTEN/PI3K/Akt pathway regulates the side
population phenotype and ABCG2 activity in glioma tumor stem-like cells.
Cell Stem Cell, 2009; 4: 226-35.
[130] Patrawala L, Calhoun T, Schneider-Broussard R, Zhou J, Claypool K,
Tang DG. Side population is enriched in tumorigenic, stem-like cancer
cells, whereas ABCG2+ and ABCG2- cancer cells are similarly
tumorigenic. Cancer Res, 2005; 65: 6207-19.
[131] Zhou S, Schuetz JD, Bunting KD, Colapietro AM, Sampath J, Morris JJ,
Lagutina I, Grosveld GC, Osawa M, Nakauchi H, Sorrentino BP. The ABC
166 transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and
is a molecular determinant of the side-population phenotype. Nat Med,
2001; 7: 1028-34.
[132] Broadley KW, Hunn MK, Farrand KJ, Price KM, Grasso C, Miller RJ,
Hermans IF, McConnell MJ. Side population is not necessary or sufficient
for a cancer stem cell phenotype in glioblastoma multiforme. Stem Cells,
2011; 29: 452-61.
[133] Clement V, Marino D, Cudalbu C, Hamou MF, Mlynarik V, de Tribolet N,
Dietrich PY, Gruetter R, Hegi ME, Radovanovic I. Marker-independent
identification of glioma-initiating cells. Nat Methods, 2010; 7: 224-8.
[134] Hatanpaa KJ, Burma S, Zhao D, Habib AA. Epidermal growth factor
receptor in glioma: signal transduction, neuropathology, imaging, and
radioresistance. Neoplasia, 2010; 12: 675-84.
[135] Ayuso-Sacido A, Moliterno JA, Kratovac S, Kapoor GS, O'Rourke DM,
Holland EC, Garcia-Verdugo JM, Roy NS, Boockvar JA. Activated EGFR
signaling increases proliferation, survival, and migration and blocks
neuronal differentiation in post-natal neural stem cells. J Neurooncol,
2010; 97: 323-37.
[136] Howard BM, Gursel DB, Bleau AM, Beyene RT, Holland EC, Boockvar JA.
EGFR signaling is differentially activated in patient-derived glioblastoma
stem cells. J Exp Ther Oncol, 2010; 8: 247-60.
167 [137] Mazzoleni S, Politi LS, Pala M, Cominelli M, Franzin A, Sergi Sergi L,
Falini A, De Palma M, Bulfone A, Poliani PL, Galli R. Epidermal growth
factor receptor expression identifies functionally and molecularly distinct
tumor-initiating cells in human glioblastoma multiforme and is required for
gliomagenesis. Cancer Res, 2010; 70: 7500-13.
[138] Watabe T, Miyazono K. Roles of TGF-beta family signaling in stem cell
renewal and differentiation. Cell Res, 2009; 19: 103-15.
[139] Ikushima H, Todo T, Ino Y, Takahashi M, Miyazawa K, Miyazono K.
Autocrine TGF-beta signaling maintains tumorigenicity of glioma-initiating
cells through Sry-related HMG-box factors. Cell Stem Cell, 2009; 5: 504-
14.
[140] Penuelas S, Anido J, Prieto-Sanchez RM, Folch G, Barba I, Cuartas I,
Garcia-Dorado D, Poca MA, Sahuquillo J, Baselga J, Seoane J. TGF-beta
increases glioma-initiating cell self-renewal through the induction of LIF in
human glioblastoma. Cancer Cell, 2009; 15: 315-27.
[141] Lee J, Son MJ, Woolard K, Donin NM, Li A, Cheng CH, Kotliarova S,
Kotliarov Y, Walling J, Ahn S, Kim M, Totonchy M, Cusack T, Ene C, Ma
H, Su Q, Zenklusen JC, Zhang W, Maric D, Fine HA. Epigenetic-mediated
dysfunction of the bone morphogenetic protein pathway inhibits
differentiation of glioblastoma-initiating cells. Cancer Cell, 2008; 13: 69-80.
168 [142] Piccirillo SG, Reynolds BA, Zanetti N, Lamorte G, Binda E, Broggi G,
Brem H, Olivi A, Dimeco F, Vescovi AL. Bone morphogenetic proteins
inhibit the tumorigenic potential of human brain tumour-initiating cells.
Nature, 2006; 444: 761-5.
[143] Cao Y, Lathia JD, Eyler CE, Wu Q, Li Z, Wang H, McLendon RE,
Hjelmeland AB, Rich JN. Erythropoietin Receptor Signaling Through
STAT3 Is Required For Glioma Stem Cell Maintenance. Genes Cancer,
2010; 1: 50-61.
[144] Arcasoy MO. Erythropoiesis-stimulating agent use in cancer: preclinical
and clinical perspectives. Clin Cancer Res, 2008; 14: 4685-90.
[145] Phillips TM, Kim K, Vlashi E, McBride WH, Pajonk F. Effects of
recombinant erythropoietin on breast cancer-initiating cells. Neoplasia,
2007; 9: 1122-9.
[146] Boo YJ, Park JM, Kim J, Chae YS, Min BW, Um JW, Moon HY. L1
expression as a marker for poor prognosis, tumor progression, and short
survival in patients with colorectal cancer. Ann Surg Oncol, 2007; 14:
1703-11.
[147] Izumoto S, Ohnishi T, Arita N, Hiraga S, Taki T, Hayakawa T. Gene
expression of neural cell adhesion molecule L1 in malignant gliomas and
biological significance of L1 in glioma invasion. Cancer Res, 1996; 56:
1440-4.
169 [148] Suzuki T, Izumoto S, Fujimoto Y, Maruno M, Ito Y, Yoshimine T.
Clinicopathological study of cellular proliferation and invasion in
gliomatosis cerebri: important role of neural cell adhesion molecule L1 in
tumour invasion. J Clin Pathol, 2005; 58: 166-71.
[149] Maness PF, Schachner M. Neural recognition molecules of the
immunoglobulin superfamily: signaling transducers of axon guidance and
neuronal migration. Nat Neurosci, 2007; 10: 19-26.
[150] Louvi A, Artavanis-Tsakonas S. Notch signalling in vertebrate neural
development. Nat Rev Neurosci, 2006; 7: 93-102.
[151] Fan X, Khaki L, Zhu TS, Soules ME, Talsma CE, Gul N, Koh C, Zhang J,
Li YM, Maciaczyk J, Nikkhah G, Dimeco F, Piccirillo S, Vescovi AL,
Eberhart CG. NOTCH pathway blockade depletes CD133-positive
glioblastoma cells and inhibits growth of tumor neurospheres and
xenografts. Stem Cells, 2010; 28: 5-16.
[152] Hovinga KE, Shimizu F, Wang R, Panagiotakos G, Van Der Heijden M,
Moayedpardazi H, Correia AS, Soulet D, Major T, Menon J, Tabar V.
Inhibition of notch signaling in glioblastoma targets cancer stem cells via
an endothelial cell intermediate. Stem Cells, 2010; 28: 1019-29.
[153] Hu YY, Zheng MH, Cheng G, Li L, Liang L, Gao F, Wei YN, Fu LA, Han H.
Notch signaling contributes to the maintenance of both normal neural stem
cells and patient-derived glioma stem cells. BMC Cancer, 2011; 11: 82.
170 [154] Zhang XP, Zheng G, Zou L, Liu HL, Hou LH, Zhou P, Yin DD, Zheng QJ,
Liang L, Zhang SZ, Feng L, Yao LB, Yang AG, Han H, Chen JY. Notch
activation promotes cell proliferation and the formation of neural stem cell-
like colonies in human glioma cells. Mol Cell Biochem, 2008; 307: 101-8.
[155] Ulasov IV, Nandi S, Dey M, Sonabend AM, Lesniak MS. Inhibition of Sonic
hedgehog and Notch pathways enhances sensitivity of CD133(+) glioma
stem cells to temozolomide therapy. Mol Med, 2011; 17: 103-12.
[156] Wang J, Wakeman TP, Lathia JD, Hjelmeland AB, Wang XF, White RR,
Rich JN, Sullenger BA. Notch promotes radioresistance of glioma stem
cells. Stem Cells, 2010; 28: 17-28.
[157] Briscoe J. Making a grade: Sonic Hedgehog signalling and the control of
neural cell fate. EMBO J, 2009; 28: 457-65.
[158] Xu Q, Yuan X, Liu G, Black KL, Yu JS. Hedgehog signaling regulates
brain tumor-initiating cell proliferation and portends shorter survival for
patients with PTEN-coexpressing glioblastomas. Stem Cells, 2008; 26:
3018-26.
[159] Uchida H, Arita K, Yunoue S, Yonezawa H, Shinsato Y, Kawano H, Hirano
H, Hanaya R, Tokimura H. Role of sonic hedgehog signaling in migration
of cell lines established from CD133-positive malignant glioma cells. J
Neurooncol, 2011.
171 [160] Hambardzumyan D, Squatrito M, Carbajal E, Holland EC. Glioma
formation, cancer stem cells, and akt signaling. Stem Cell Rev, 2008; 4:
203-10.
[161] Gallia GL, Tyler BM, Hann CL, Siu IM, Giranda VL, Vescovi AL, Brem H,
Riggins GJ. Inhibition of Akt inhibits growth of glioblastoma and
glioblastoma stem-like cells. Mol Cancer Ther, 2009; 8: 386-93.
[162] Sunayama J, Matsuda K, Sato A, Tachibana K, Suzuki K, Narita Y, Shibui
S, Sakurada K, Kayama T, Tomiyama A, Kitanaka C. Crosstalk between
the PI3K/mTOR and MEK/ERK pathways involved in the maintenance of
self-renewal and tumorigenicity of glioblastoma stem-like cells. Stem
Cells, 2010; 28: 1930-9.
[163] Widera D, Mikenberg I, Kaltschmidt B, Kaltschmidt C. Potential role of NF-
kappaB in adult neural stem cells: the underrated steersman? Int J Dev
Neurosci, 2006; 24: 91-102.
[164] Kaus A, Widera D, Kassmer S, Peter J, Zaenker K, Kaltschmidt C,
Kaltschmidt B. Neural stem cells adopt tumorigenic properties by
constitutively activated NF-kappaB and subsequent VEGF up-regulation.
Stem Cells Dev, 2010; 19: 999-1015.
[165] Hjelmeland AB, Wu Q, Wickman S, Eyler C, Heddleston J, Shi Q, Lathia
JD, Macswords J, Lee J, McLendon RE, Rich JN. Targeting A20
172 decreases glioma stem cell survival and tumor growth. PLoS Biol, 2010; 8:
e1000319.
[166] Liu Y, Li C, Lin J. STAT3 as a Therapeutic Target for Glioblastoma.
Anticancer Agents Med Chem, 2010; 10: 512-9.
[167] Cheng L, Bao S, Rich JN. Potential therapeutic implications of cancer
stem cells in glioblastoma. Biochem Pharmacol, 2010; 80: 654-65.
[168] Guryanova OA, Wu Q, Cheng L, Lathia JD, Huang Z, Yang J, Macswords
J, Eyler CE, McLendon RE, Heddleston JM, Shou W, Hambardzumyan D,
Lee J, Hjelmeland AB, Sloan AE, Bredel M, Stark GR, Rich JN, Bao S.
Nonreceptor Tyrosine Kinase BMX Maintains Self-Renewal and
Tumorigenic Potential of Glioblastoma Stem Cells by Activating STAT3.
Cancer Cell, 2011; 19: 498-511.
[169] Sherry MM, Reeves A, Wu JK, Cochran BH. STAT3 is required for
proliferation and maintenance of multipotency in glioblastoma stem cells.
Stem Cells, 2009; 27: 2383-92.
[170] Villalva C, Martin-Lanneree S, Cortes U, Dkhissi F, Wager M, Le Corf A,
Tourani JM, Dusanter-Fourt I, Turhan AG, Karayan-Tapon L. STAT3 is
essential for the maintenance of neurosphere-initiating tumor cells in
patients with glioblastomas: a potential for targeted therapy? Int J Cancer,
2011; 128: 826-38.
173 [171] Murphy MJ, Wilson A, Trumpp A. More than just proliferation: Myc function
in stem cells. Trends Cell Biol, 2005; 15: 128-37.
[172] Vita M, Henriksson M. The Myc oncoprotein as a therapeutic target for
human cancer. Semin Cancer Biol, 2006; 16: 318-30.
[173] Wang J, Wang H, Li Z, Wu Q, Lathia JD, McLendon RE, Hjelmeland AB,
Rich JN. c-Myc is required for maintenance of glioma cancer stem cells.
PLoS One, 2008; 3: e3769.
[174] Moore KA, Lemischka IR. Stem cells and their niches. Science, 2006; 311:
1880-5.
[175] Louissaint A, Jr., Rao S, Leventhal C, Goldman SA. Coordinated
interaction of neurogenesis and angiogenesis in the adult songbird brain.
Neuron, 2002; 34: 945-60.
[176] Palmer TD, Willhoite AR, Gage FH. Vascular niche for adult hippocampal
neurogenesis. J Comp Neurol, 2000; 425: 479-94.
[177] Ramirez-Castillejo C, Sanchez-Sanchez F, Andreu-Agullo C, Ferron SR,
Aroca-Aguilar JD, Sanchez P, Mira H, Escribano J, Farinas I. Pigment
epithelium-derived factor is a niche signal for neural stem cell renewal. Nat
Neurosci, 2006; 9: 331-9.
174 [178] Shen Q, Goderie SK, Jin L, Karanth N, Sun Y, Abramova N, Vincent P,
Pumiglia K, Temple S. Endothelial cells stimulate self-renewal and expand
neurogenesis of neural stem cells. Science, 2004; 304: 1338-40.
[179] Tavazoie M, Van der Veken L, Silva-Vargas V, Louissaint M, Colonna L,
Zaidi B, Garcia-Verdugo JM, Doetsch F. A specialized vascular niche for
adult neural stem cells. Cell Stem Cell, 2008; 3: 279-88.
[180] Fan X, Matsui W, Khaki L, Stearns D, Chun J, Li YM, Eberhart CG. Notch
pathway inhibition depletes stem-like cells and blocks engraftment in
embryonal brain tumors. Cancer Res, 2006; 66: 7445-52.
[181] Dewhirst MW, Cao Y, Moeller B. Cycling hypoxia and free radicals
regulate angiogenesis and radiotherapy response. Nat Rev Cancer, 2008;
8: 425-37.
[182] Cairns RA, Kalliomaki T, Hill RP. Acute (cyclic) hypoxia enhances
spontaneous metastasis of KHT murine tumors. Cancer Res, 2001; 61:
8903-8.
[183] Peng YJ, Yuan G, Ramakrishnan D, Sharma SD, Bosch-Marce M, Kumar
GK, Semenza GL, Prabhakar NR. Heterozygous HIF-1alpha deficiency
impairs carotid body-mediated systemic responses and reactive oxygen
species generation in mice exposed to intermittent hypoxia. J Physiol,
2006; 577: 705-16.
175 [184] Kimura H, Braun RD, Ong ET, Hsu R, Secomb TW, Papahadjopoulos D,
Hong K, Dewhirst MW. Fluctuations in red cell flux in tumor microvessels
can lead to transient hypoxia and reoxygenation in tumor parenchyma.
Cancer Res, 1996; 56: 5522-8.
[185] Moeller BJ, Cao Y, Li CY, Dewhirst MW. Radiation activates HIF-1 to
regulate vascular radiosensitivity in tumors: role of reoxygenation, free
radicals, and stress granules. Cancer Cell, 2004; 5: 429-41.
[186] Evans SM, Jenkins KW, Chen HI, Jenkins WT, Judy KD, Hwang WT,
Lustig RA, Judkins AR, Grady MS, Hahn SM, Koch CJ. The Relationship
among Hypoxia, Proliferation, and Outcome in Patients with De Novo
Glioblastoma: A Pilot Study. Transl Oncol, 2010; 3: 160-9.
[187] Pistollato F, Abbadi S, Rampazzo E, Persano L, Della Puppa A, Frasson
C, Sarto E, Scienza R, D'Avella D, Basso G. Intratumoral hypoxic gradient
drives stem cells distribution and MGMT expression in glioblastoma. Stem
Cells, 2010; 28: 851-62.
[188] Keith B, Adelman DM, Simon MC. Targeted mutation of the murine
arylhydrocarbon receptor nuclear translocator 2 (Arnt2) gene reveals
partial redundancy with Arnt. Proc Natl Acad Sci U S A, 2001; 98: 6692-7.
[189] Maltepe E, Schmidt JV, Baunoch D, Bradfield CA, Simon MC. Abnormal
angiogenesis and responses to glucose and oxygen deprivation in mice
lacking the protein ARNT. Nature, 1997; 386: 403-7.
176 [190] Majmundar AJ, Wong WJ, Simon MC. Hypoxia-inducible factors and the
response to hypoxic stress. Mol Cell, 2010; 40: 294-309.
[191] Iyer NV, Leung SW, Semenza GL. The human hypoxia-inducible factor
1alpha gene: HIF1A structure and evolutionary conservation. Genomics,
1998; 52: 159-65.
[192] Lau KW, Tian YM, Raval RR, Ratcliffe PJ, Pugh CW. Target gene
selectivity of hypoxia-inducible factor-alpha in renal cancer cells is
conveyed by post-DNA-binding mechanisms. Br J Cancer, 2007; 96:
1284-92.
[193] Nilsson MB, Zage PE, Zeng L, Xu L, Cascone T, Wu HK, Saigal B,
Zweidler-McKay PA, Heymach JV. Multiple receptor tyrosine kinases
regulate HIF-1alpha and HIF-2alpha in normoxia and hypoxia in
neuroblastoma: implications for antiangiogenic mechanisms of multikinase
inhibitors. Oncogene, 2010; 29: 2938-49.
[194] Makino Y, Cao R, Svensson K, Bertilsson G, Asman M, Tanaka H, Cao Y,
Berkenstam A, Poellinger L. Inhibitory PAS domain protein is a negative
regulator of hypoxia-inducible gene expression. Nature, 2001; 414: 550-4.
[195] Maynard MA, Qi H, Chung J, Lee EH, Kondo Y, Hara S, Conaway RC,
Conaway JW, Ohh M. Multiple splice variants of the human HIF-3 alpha
locus are targets of the von Hippel-Lindau E3 ubiquitin ligase complex. J
Biol Chem, 2003; 278: 11032-40.
177 [196] Zhong H, De Marzo AM, Laughner E, Lim M, Hilton DA, Zagzag D,
Buechler P, Isaacs WB, Semenza GL, Simons JW. Overexpression of
hypoxia-inducible factor 1alpha in common human cancers and their
metastases. Cancer Res, 1999; 59: 5830-5.
[197] Kondo K, Kim WY, Lechpammer M, Kaelin WG, Jr. Inhibition of HIF2alpha
is sufficient to suppress pVHL-defective tumor growth. PLoS Biol, 2003; 1:
E83.
[198] Mendez O, Zavadil J, Esencay M, Lukyanov Y, Santovasi D, Wang SC,
Newcomb EW, Zagzag D. Knock down of HIF-1alpha in glioma cells
reduces migration in vitro and invasion in vivo and impairs their ability to
form tumor spheres. Mol Cancer, 2010; 9: 133.
[199] Yamakawa M, Liu LX, Belanger AJ, Date T, Kuriyama T, Goldberg MA,
Cheng SH, Gregory RJ, Jiang C. Expression of angiopoietins in renal
epithelial and clear cell carcinoma cells: regulation by hypoxia and
participation in angiogenesis. Am J Physiol Renal Physiol, 2004; 287:
F649-57.
[200] Simon MP, Tournaire R, Pouyssegur J. The angiopoietin-2 gene of
endothelial cells is up-regulated in hypoxia by a HIF binding site located in
its first intron and by the central factors GATA-2 and Ets-1. J Cell Physiol,
2008; 217: 809-18.
178 [201] Chen JK, Zhan YJ, Yang CS, Tzeng SF. Oxidative stress-induced
attenuation of thrombospondin-1 expression in primary rat astrocytes. J
Cell Biochem, 2011; 112: 59-70.
[202] Tenan M, Fulci G, Albertoni M, Diserens AC, Hamou MF, El Atifi-Borel M,
Feige JJ, Pepper MS, Van Meir EG. Thrombospondin-1 is downregulated
by anoxia and suppresses tumorigenicity of human glioblastoma cells. J
Exp Med, 2000; 191: 1789-98.
[203] Laderoute KR, Alarcon RM, Brody MD, Calaoagan JM, Chen EY, Knapp
AM, Yun Z, Denko NC, Giaccia AJ. Opposing effects of hypoxia on
expression of the angiogenic inhibitor thrombospondin 1 and the
angiogenic inducer vascular endothelial growth factor. Clin Cancer Res,
2000; 6: 2941-50.
[204] Friedman HS, Prados MD, Wen PY, Mikkelsen T, Schiff D, Abrey LE,
Yung WK, Paleologos N, Nicholas MK, Jensen R, Vredenburgh J, Huang
J, Zheng M, Cloughesy T. Bevacizumab alone and in combination with
irinotecan in recurrent glioblastoma. J Clin Oncol, 2009; 27: 4733-40.
[205] Stier S, Ko Y, Forkert R, Lutz C, Neuhaus T, Grunewald E, Cheng T,
Dombkowski D, Calvi LM, Rittling SR, Scadden DT. Osteopontin is a
hematopoietic stem cell niche component that negatively regulates stem
cell pool size. J Exp Med, 2005; 201: 1781-91.
179 [206] Nilsson SK, Johnston HM, Whitty GA, Williams B, Webb RJ, Denhardt DT,
Bertoncello I, Bendall LJ, Simmons PJ, Haylock DN. Osteopontin, a key
component of the hematopoietic stem cell niche and regulator of primitive
hematopoietic progenitor cells. Blood, 2005; 106: 1232-9.
[207] Santilli G, Lamorte G, Carlessi L, Ferrari D, Rota Nodari L, Binda E, Delia
D, Vescovi AL, De Filippis L. Mild hypoxia enhances proliferation and
multipotency of human neural stem cells. PLoS One, 2010; 5: e8575.
[208] Ezashi T, Das P, Roberts RM. Low O2 tensions and the prevention of
differentiation of hES cells. Proc Natl Acad Sci U S A, 2005; 102: 4783-8.
[209] Yoshida Y, Takahashi K, Okita K, Ichisaka T, Yamanaka S. Hypoxia
enhances the generation of induced pluripotent stem cells. Cell Stem Cell,
2009; 5: 237-41.
[210] McCord AM, Jamal M, Shankavarum UT, Lang FF, Camphausen K,
Tofilon PJ. Physiologic oxygen concentration enhances the stem-like
properties of CD133+ human glioblastoma cells in vitro. Mol Cancer Res,
2009; 7: 489-97.
[211] Bar EE. Glioblastoma, cancer stem cells and hypoxia. Brain Pathol, 2011;
21: 119-29.
[212] Bar EE, Lin A, Mahairaki V, Matsui W, Eberhart CG. Hypoxia increases
the expression of stem-cell markers and promotes clonogenicity in
glioblastoma neurospheres. Am J Pathol, 2010; 177: 1491-502.
180 [213] Pistollato F, Chen HL, Rood BR, Zhang HZ, D'Avella D, Denaro L,
Gardiman M, te Kronnie G, Schwartz PH, Favaro E, Indraccolo S, Basso
G, Panchision DM. Hypoxia and HIF1alpha repress the differentiative
effects of BMPs in high-grade glioma. Stem Cells, 2009; 27: 7-17.
[214] Zhao T, Zhang CP, Liu ZH, Wu LY, Huang X, Wu HT, Xiong L, Wang X,
Wang XM, Zhu LL, Fan M. Hypoxia-driven proliferation of embryonic
neural stem/progenitor cells--role of hypoxia-inducible transcription factor-
1alpha. FEBS J, 2008; 275: 1824-34.
[215] Pietras A, Hansford LM, Johnsson AS, Bridges E, Sjolund J, Gisselsson
D, Rehn M, Beckman S, Noguera R, Navarro S, Cammenga J, Fredlund
E, Kaplan DR, Pahlman S. HIF-2alpha maintains an undifferentiated state
in neural crest-like human neuroblastoma tumor-initiating cells. Proc Natl
Acad Sci U S A, 2009; 106: 16805-10.
[216] Pietras A, Gisselsson D, Ora I, Noguera R, Beckman S, Navarro S,
Pahlman S. High levels of HIF-2alpha highlight an immature neural crest-
like neuroblastoma cell cohort located in a perivascular niche. J Pathol,
2008; 214: 482-8.
[217] Zimmer M, Ebert BL, Neil C, Brenner K, Papaioannou I, Melas A, Tolliday
N, Lamb J, Pantopoulos K, Golub T, Iliopoulos O. Small-molecule
inhibitors of HIF-2a translation link its 5'UTR iron-responsive element to
oxygen sensing. Molecular cell, 2008; 32: 838-48.
181 [218] Network CGAR. Comprehensive genomic characterization defines human
glioblastoma genes and core pathways. Nature, 2008; 455: 1061-8.
[219] Parsons DW, Li M, Zhang X, Jones S, Leary RJ, Lin JC, Boca SM, Carter
H, Samayoa J, Bettegowda C, Gallia GL, Jallo GI, Binder ZA, Nikolsky Y,
Hartigan J, Smith DR, Gerhard DS, Fults DW, VandenBerg S, Berger MS,
Marie SK, Shinjo SM, Clara C, Phillips PC, Minturn JE, Biegel JA, Judkins
AR, Resnick AC, Storm PB, Curran T, He Y, Rasheed BA, Friedman HS,
Keir ST, McLendon R, Northcott PA, Taylor MD, Burger PC, Riggins GJ,
Karchin R, Parmigiani G, Bigner DD, Yan H, Papadopoulos N, Vogelstein
B, Kinzler KW, Velculescu VE. The genetic landscape of the childhood
cancer medulloblastoma. Science, 2011; 331: 435-9.
[220] Hulton CS, Seirafi A, Hinton JC, Sidebotham JM, Waddell L, Pavitt GD,
Owen-Hughes T, Spassky A, Buc H, Higgins CF. Histone-like protein H1
(H-NS), DNA supercoiling, and gene expression in bacteria. Cell, 1990;
63: 631-42.
[221] Barski A, Cuddapah S, Cui K, Roh TY, Schones DE, Wang Z, Wei G,
Chepelev I, Zhao K. High-resolution profiling of histone methylations in the
human genome. Cell, 2007; 129: 823-37.
[222] Berger SL. The complex language of chromatin regulation during
transcription. Nature, 2007; 447: 407-12.
182 [223] Li B, Carey M, Workman JL. The role of chromatin during transcription.
Cell, 2007; 128: 707-19.
[224] Turner BM. Cellular memory and the histone code. Cell, 2002; 111: 285-
91.
[225] Jair KW, Bachman KE, Suzuki H, Ting AH, Rhee I, Yen RW, Baylin SB,
Schuebel KE. De novo CpG island methylation in human cancer cells.
Cancer Res, 2006; 66: 682-92.
[226] Kim K, Doi A, Wen B, Ng K, Zhao R, Cahan P, Kim J, Aryee MJ, Ji H,
Ehrlich LI, Yabuuchi A, Takeuchi A, Cunniff KC, Hongguang H, McKinney-
Freeman S, Naveiras O, Yoon TJ, Irizarry RA, Jung N, Seita J, Hanna J,
Murakami P, Jaenisch R, Weissleder R, Orkin SH, Weissman IL, Feinberg
AP, Daley GQ. Epigenetic memory in induced pluripotent stem cells.
Nature, 2010; 467: 285-90.
[227] Nakagawa M, Koyanagi M, Tanabe K, Takahashi K, Ichisaka T, Aoi T,
Okita K, Mochiduki Y, Takizawa N, Yamanaka S. Generation of induced
pluripotent stem cells without Myc from mouse and human fibroblasts. Nat
Biotechnol, 2008; 26: 101-6.
[228] Okita K, Ichisaka T, Yamanaka S. Generation of germline-competent
induced pluripotent stem cells. Nature, 2007; 448: 313-7.
183 [229] Okita K, Nakagawa M, Hyenjong H, Ichisaka T, Yamanaka S. Generation
of mouse induced pluripotent stem cells without viral vectors. Science,
2008; 322: 949-53.
[230] Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K,
Yamanaka S. Induction of pluripotent stem cells from adult human
fibroblasts by defined factors. Cell, 2007; 131: 861-72.
[231] Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse
embryonic and adult fibroblast cultures by defined factors. Cell, 2006; 126:
663-76.
[232] Li R, Liang J, Ni S, Zhou T, Qing X, Li H, He W, Chen J, Li F, Zhuang Q,
Qin B, Xu J, Li W, Yang J, Gan Y, Qin D, Feng S, Song H, Yang D, Zhang
B, Zeng L, Lai L, Esteban MA, Pei D. A mesenchymal-to-epithelial
transition initiates and is required for the nuclear reprogramming of mouse
fibroblasts. Cell Stem Cell, 2010; 7: 51-63.
[233] Cadieux B, Ching TT, VandenBerg SR, Costello JF. Genome-wide
hypomethylation in human glioblastomas associated with specific copy
number alteration, methylenetetrahydrofolate reductase allele status, and
increased proliferation. Cancer Res, 2006; 66: 8469-76.
[234] Hong C, Maunakea A, Jun P, Bollen AW, Hodgson JG, Goldenberg DD,
Weiss WA, Costello JF. Shared epigenetic mechanisms in human and
184 mouse gliomas inactivate expression of the growth suppressor SLC5A8.
Cancer Res, 2005; 65: 3617-23.
[235] Dunn J, Baborie A, Alam F, Joyce K, Moxham M, Sibson R, Crooks D,
Husband D, Shenoy A, Brodbelt A, Wong H, Liloglou T, Haylock B, Walker
C. Extent of MGMT promoter methylation correlates with outcome in
glioblastomas given temozolomide and radiotherapy. Br J Cancer, 2009;
101: 124-31.
[236] Esteller M, Garcia-Foncillas J, Andion E, Goodman SN, Hidalgo OF,
Vanaclocha V, Baylin SB, Herman JG. Inactivation of the DNA-repair gene
MGMT and the clinical response of gliomas to alkylating agents. N Engl J
Med, 2000; 343: 1350-4.
[237] Hegi ME, Diserens AC, Gorlia T, Hamou MF, de Tribolet N, Weller M,
Kros JM, Hainfellner JA, Mason W, Mariani L, Bromberg JE, Hau P,
Mirimanoff RO, Cairncross JG, Janzer RC, Stupp R. MGMT gene
silencing and benefit from temozolomide in glioblastoma. N Engl J Med,
2005; 352: 997-1003.
[238] Lessard J, Sauvageau G. Polycomb group genes as epigenetic regulators
of normal and leukemic hemopoiesis. Exp Hematol, 2003; 31: 567-85.
[239] Lessard J, Sauvageau G. Bmi-1 determines the proliferative capacity of
normal and leukaemic stem cells. Nature, 2003; 423: 255-60.
185 [240] Bruggeman SW, Hulsman D, Tanger E, Buckle T, Blom M, Zevenhoven J,
van Tellingen O, van Lohuizen M. Bmi1 controls tumor development in an
Ink4a/Arf-independent manner in a mouse model for glioma. Cancer Cell,
2007; 12: 328-41.
[241] Leung C, Lingbeek M, Shakhova O, Liu J, Tanger E, Saremaslani P, Van
Lohuizen M, Marino S. Bmi1 is essential for cerebellar development and is
overexpressed in human medulloblastomas. Nature, 2004; 428: 337-41.
[242] Suva ML, Riggi N, Janiszewska M, Radovanovic I, Provero P, Stehle JC,
Baumer K, Le Bitoux MA, Marino D, Cironi L, Marquez VE, Clement V,
Stamenkovic I. EZH2 is essential for glioblastoma cancer stem cell
maintenance. Cancer research, 2009; 69: 9211-8.
[243] Somervaille TC, Matheny CJ, Spencer GJ, Iwasaki M, Rinn JL, Witten
DM, Chang HY, Shurtleff SA, Downing JR, Cleary ML. Hierarchical
maintenance of MLL myeloid leukemia stem cells employs a
transcriptional program shared with embryonic rather than adult stem
cells. Cell Stem Cell, 2009; 4: 129-40.
[244] Tkachuk DC, Kohler S, Cleary ML. Involvement of a homolog of
Drosophila trithorax by 11q23 chromosomal translocations in acute
leukemias. Cell, 1992; 71: 691-700.
186 [245] Dou Y, Milne TA, Ruthenburg AJ, Lee S, Lee JW, Verdine GL, Allis CD,
Roeder RG. Regulation of MLL1 H3K4 methyltransferase activity by its
core components. Nat Struct Mol Biol, 2006; 13: 713-9.
[246] Wang P, Lin C, Smith ER, Guo H, Sanderson BW, Wu M, Gogol M,
Alexander T, Seidel C, Wiedemann LM, Ge K, Krumlauf R, Shilatifard A.
Global analysis of H3K4 methylation defines MLL family member targets
and points to a role for MLL1-mediated H3K4 methylation in the regulation
of transcriptional initiation by RNA polymerase II. Mol Cell Biol, 2009; 29:
6074-85.
[247] Krivtsov AV, Armstrong SA. MLL translocations, histone modifications and
leukaemia stem-cell development. Nat Rev Cancer, 2007; 7: 823-33.
[248] Somervaille TC, Cleary ML. Identification and characterization of leukemia
stem cells in murine MLL-AF9 acute myeloid leukemia. Cancer Cell, 2006;
10: 257-68.
[249] Huntsman DG, Chin SF, Muleris M, Batley SJ, Collins VP, Wiedemann
LM, Aparicio S, Caldas C. MLL2, the second human homolog of the
Drosophila trithorax gene, maps to 19q13.1 and is amplified in solid tumor
cell lines. Oncogene, 1999; 18: 7975-84.
[250] Faber J, Krivtsov AV, Stubbs MC, Wright R, Davis TN, van den Heuvel-
Eibrink M, Zwaan CM, Kung AL, Armstrong SA. HOXA9 is required for
187 survival in human MLL-rearranged acute leukemias. Blood, 2009; 113:
2375-85.
[251] Liu H, Takeda S, Kumar R, Westergard TD, Brown EJ, Pandita TK, Cheng
EH, Hsieh JJ. Phosphorylation of MLL by ATR is required for execution of
mammalian S-phase checkpoint. Nature, 2010; 467: 343-6.
[252] Roesch A, Fukunaga-Kalabis M, Schmidt EC, Zabierowski SE, Brafford
PA, Vultur A, Basu D, Gimotty P, Vogt T, Herlyn M. A temporarily distinct
subpopulation of slow-cycling melanoma cells is required for continuous
tumor growth. Cell, 2010; 141: 583-94.
[253] Barrett A, Santangelo S, Tan K, Catchpole S, Roberts K, Spencer-Dene B,
Hall D, Scibetta A, Burchell J, Verdin E, Freemont P, Taylor-Papadimitriou
J. Breast cancer associated transcriptional repressor PLU-1/JARID1B
interacts directly with histone deacetylases. Int J Cancer, 2007; 121: 265-
75.
[254] Xiang Y, Zhu Z, Han G, Ye X, Xu B, Peng Z, Ma Y, Yu Y, Lin H, Chen AP,
Chen CD. JARID1B is a histone H3 lysine 4 demethylase up-regulated in
prostate cancer. Proc Natl Acad Sci U S A, 2007; 104: 19226-31.
[255] Shen X, Kim W, Fujiwara Y, Simon MD, Liu Y, Mysliwiec MR, Yuan GC,
Lee Y, Orkin SH. Jumonji modulates polycomb activity and self-renewal
versus differentiation of stem cells. Cell, 2009; 139: 1303-14.
188 [256] Pasini D, Cloos PA, Walfridsson J, Olsson L, Bukowski JP, Johansen JV,
Bak M, Tommerup N, Rappsilber J, Helin K. JARID2 regulates binding of
the Polycomb repressive complex 2 to target genes in ES cells. Nature,
2010; 464: 306-10.
[257] Peng JC, Valouev A, Swigut T, Zhang J, Zhao Y, Sidow A, Wysocka J.
Jarid2/Jumonji coordinates control of PRC2 enzymatic activity and target
gene occupancy in pluripotent cells. Cell, 2009; 139: 1290-302.
[258] Burgold T, Spreafico F, De Santa F, Totaro MG, Prosperini E, Natoli G,
Testa G. The histone H3 lysine 27-specific demethylase Jmjd3 is required
for neural commitment. PLoS One, 2008; 3: e3034.
[259] Strobl-Mazzulla PH, Sauka-Spengler T, Bronner-Fraser M. Histone
demethylase JmjD2A regulates neural crest specification. Dev Cell, 2010;
19: 460-8.
[260] Beyer S, Kristensen MM, Jensen KS, Johansen JV, Staller P. The histone
demethylases JMJD1A and JMJD2B are transcriptional targets of hypoxia-
inducible factor HIF. J Biol Chem, 2008; 283: 36542-52.
[261] Uemura M, Yamamoto H, Takemasa I, Mimori K, Hemmi H, Mizushima T,
Ikeda M, Sekimoto M, Matsuura N, Doki Y, Mori M. Jumonji domain
containing 1A is a novel prognostic marker for colorectal cancer: in vivo
identification from hypoxic tumor cells. Clin Cancer Res, 2010; 16: 4636-
46.
189 [262] Yang J, Jubb AM, Pike L, Buffa FM, Turley H, Baban D, Leek R, Gatter
KC, Ragoussis J, Harris AL. The histone demethylase JMJD2B is
regulated by estrogen receptor alpha and hypoxia, and is a key mediator
of estrogen induced growth. Cancer Res, 2010; 70: 6456-66.
[263] Yang J, Ledaki I, Turley H, Gatter KC, Montero JC, Li JL, Harris AL. Role
of hypoxia-inducible factors in epigenetic regulation via histone
demethylases. Ann N Y Acad Sci, 2009; 1177: 185-97.
[264] Vaupel P, Mayer A. Hypoxia in cancer: significance and impact on clinical
outcome. Cancer Metastasis Rev, 2007; 26: 225-39.
[265] Vredenburgh JJ, Desjardins A, Herndon JE, 2nd, Marcello J, Reardon DA,
Quinn JA, Rich JN, Sathornsumetee S, Gururangan S, Sampson J,
Wagner M, Bailey L, Bigner DD, Friedman AH, Friedman HS.
Bevacizumab plus irinotecan in recurrent glioblastoma multiforme. J Clin
Oncol, 2007; 25: 4722-9.
[266] Gilbertson RJ, Rich JN. Making a tumour's bed: glioblastoma stem cells
and the vascular niche. Nat Rev Cancer, 2007; 7: 733-6.
[267] Folkins C, Man S, Xu P, Shaked Y, Hicklin DJ, Kerbel RS. Anticancer
therapies combining antiangiogenic and tumor cell cytotoxic effects reduce
the tumor stem-like cell fraction in glioma xenograft tumors. Cancer Res,
2007; 67: 3560-4.
190 [268] Kioi M, Vogel H, Schultz G, Hoffman RM, Harsh GR, Brown JM. Inhibition
of vasculogenesis, but not angiogenesis, prevents the recurrence of
glioblastoma after irradiation in mice. J Clin Invest, 2010; 120: 694-705.
[269] Thompson EM, Frenkel EP, Neuwelt EA. The paradoxical effect of
bevacizumab in the therapy of malignant gliomas. Neurology, 2011; 76:
87-93.
[270] Verhoeff JJ, van Tellingen O, Claes A, Stalpers LJ, van Linde ME, Richel
DJ, Leenders WP, van Furth WR. Concerns about anti-angiogenic
treatment in patients with glioblastoma multiforme. BMC Cancer, 2009; 9:
444.
[271] Trikha M, Corringham R, Klein B, Rossi JF. Targeted anti-interleukin-6
monoclonal antibody therapy for cancer: a review of the rationale and
clinical evidence. Clin Cancer Res, 2003; 9: 4653-65.
[272] Vredenburgh JJ, Desjardins A, Herndon JE, 2nd, Dowell JM, Reardon DA,
Quinn JA, Rich JN, Sathornsumetee S, Gururangan S, Wagner M, Bigner
DD, Friedman AH, Friedman HS. Phase II trial of bevacizumab and
irinotecan in recurrent malignant glioma. Clin Cancer Res, 2007; 13: 1253-
9.
[273] Reya T, Morrison SJ, Clarke MF, Weissman IL. Stem cells, cancer, and
cancer stem cells. Nature, 2001; 414: 105-11.
191 [274] Galli R, Binda E, Orfanelli U, Cipelletti B, Gritti A, De Vitis S, Fiocco R,
Foroni C, Dimeco F, Vescovi A. Isolation and characterization of
tumorigenic, stem-like neural precursors from human glioblastoma.
Cancer Res, 2004; 64: 7011-21.
[275] Taylor MD, Poppleton H, Fuller C, Su X, Liu Y, Jensen P, Magdaleno S,
Dalton J, Calabrese C, Board J, Macdonald T, Rutka J, Guha A, Gajjar A,
Curran T, Gilbertson RJ. Radial glia cells are candidate stem cells of
ependymoma. Cancer Cell, 2005; 8: 323-35.
[276] Yuan X, Curtin J, Xiong Y, Liu G, Waschsmann-Hogiu S, Farkas DL, Black
KL, Yu JS. Isolation of cancer stem cells from adult glioblastoma
multiforme. Oncogene, 2004; 23: 9392-400.
[277] Blazek ER, Foutch JL, Maki G. Daoy medulloblastoma cells that express
CD133 are radioresistant relative to CD133- cells, and the CD133+ sector
is enlarged by hypoxia. Int J Radiat Oncol Biol Phys, 2007; 67: 1-5.
[278] Hambardzumyan D, Becher OJ, Rosenblum MK, Pandolfi PP, Manova-
Todorova K, Holland EC. PI3K pathway regulates survival of cancer stem
cells residing in the perivascular niche following radiation in
medulloblastoma in vivo. Genes Dev, 2008; 22: 436-48.
[279] Todaro M, Alea MP, Di Stefano AB, Cammareri P, Vermeulen L, Iovino F,
Tripodo C, Russo A, Gulotta G, Medema JP, Stassi G. Colon cancer stem
192 cells dictate tumor growth and resist cell death by production of
interleukin-4. Cell Stem Cell, 2007; 1: 389-402.
[280] Wulf GG, Wang RY, Kuehnle I, Weidner D, Marini F, Brenner MK,
Andreeff M, Goodell MA. A leukemic stem cell with intrinsic drug efflux
capacity in acute myeloid leukemia. Blood, 2001; 98: 1166-73.
[281] Li X, Lewis MT, Huang J, Gutierrez C, Osborne CK, Wu MF, Hilsenbeck
SG, Pavlick A, Zhang X, Chamness GC, Wong H, Rosen J, Chang JC.
Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J
Natl Cancer Inst, 2008; 100: 672-9.
[282] Kiel MJ, Morrison SJ. Uncertainty in the niches that maintain
haematopoietic stem cells. Nat Rev Immunol, 2008; 8: 290-301.
[283] Shen Q, Wang Y, Kokovay E, Lin G, Chuang SM, Goderie SK, Roysam B,
Temple S. Adult SVZ stem cells lie in a vascular niche: a quantitative
analysis of niche cell-cell interactions. Cell Stem Cell, 2008; 3: 289-300.
[284] Yang ZJ, Wechsler-Reya RJ. Hit 'em where they live: targeting the cancer
stem cell niche. Cancer Cell, 2007; 11: 3-5.
[285] Clarke L, van der Kooy D. Low oxygen enhances primitive and definitive
neural stem cell colony formation by inhibiting distinct cell death pathways.
Stem Cells, 2009; 27: 1879-86.
193 [286] Silvan U, Diez-Torre A, Arluzea J, Andrade R, Silio M, Arechaga J.
Hypoxia and pluripotency in embryonic and embryonal carcinoma stem
cell biology. Differentiation, 2009; 78: 159-68.
[287] Simon MC, Keith B. The role of oxygen availability in embryonic
development and stem cell function. Nat Rev Mol Cell Biol, 2008; 9: 285-
96.
[288] Parmar K, Mauch P, Vergilio JA, Sackstein R, Down JD. Distribution of
hematopoietic stem cells in the bone marrow according to regional
hypoxia. Proc Natl Acad Sci U S A, 2007; 104: 5431-6.
[289] Bissell MJ, Kenny PA, Radisky DC. Microenvironmental regulators of
tissue structure and function also regulate tumor induction and
progression: the role of extracellular matrix and its degrading enzymes.
Cold Spring Harb Symp Quant Biol, 2005; 70: 343-56.
[290] Das B, Tsuchida R, Malkin D, Koren G, Baruchel S, Yeger H. Hypoxia
enhances tumor stemness by increasing the invasive and tumorigenic side
population fraction. Stem Cells, 2008; 26: 1818-30.
[291] Giuntoli S, Rovida E, Gozzini A, Barbetti V, Cipolleschi MG, Olivotto M,
Dello Sbarba P. Severe hypoxia defines heterogeneity and selects highly
immature progenitors within clonal erythroleukemia cells. Stem Cells,
2007; 25: 1119-25.
194 [292] Jogi A, Ora I, Nilsson H, Lindeheim A, Makino Y, Poellinger L, Axelson H,
Pahlman S. Hypoxia alters gene expression in human neuroblastoma cells
toward an immature and neural crest-like phenotype. Proc Natl Acad Sci U
S A, 2002; 99: 7021-6.
[293] Tavaluc RT, Hart LS, Dicker DT, El-Deiry WS. Effects of low confluency,
serum starvation and hypoxia on the side population of cancer cell lines.
Cell Cycle, 2007; 6: 2554-62.
[294] Cardenas-Navia LI, Mace D, Richardson RA, Wilson DF, Shan S,
Dewhirst MW. The pervasive presence of fluctuating oxygenation in
tumors. Cancer Res, 2008; 68: 5812-9.
[295] Carmeliet P, Jain RK. Angiogenesis in cancer and other diseases. Nature,
2000; 407: 249-57.
[296] Chambers I, Tomlinson SR. The transcriptional foundation of pluripotency.
Development, 2009; 136: 2311-22.
[297] Pan GJ, Pei DQ. Identification of two distinct transactivation domains in
the pluripotency sustaining factor nanog. Cell Res, 2003; 13: 499-502.
[298] Niwa H, Masui S, Chambers I, Smith AG, Miyazaki J. Phenotypic
complementation establishes requirements for specific POU domain and
generic transactivation function of Oct-3/4 in embryonic stem cells. Mol
Cell Biol, 2002; 22: 1526-36.
195 [299] Covello KL, Kehler J, Yu H, Gordan JD, Arsham AM, Hu CJ, Labosky PA,
Simon MC, Keith B. HIF-2alpha regulates Oct-4: effects of hypoxia on
stem cell function, embryonic development, and tumor growth. Genes
Dev, 2006; 20: 557-70.
[300] Yan Q, Bartz S, Mao M, Li L, Kaelin WG, Jr. The hypoxia-inducible factor
2alpha N-terminal and C-terminal transactivation domains cooperate to
promote renal tumorigenesis in vivo. Mol Cell Biol, 2007; 27: 2092-102.
[301] Furnari FB, Fenton T, Bachoo RM, Mukasa A, Stommel JM, Stegh A,
Hahn WC, Ligon KL, Louis DN, Brennan C, Chin L, DePinho RA, Cavenee
WK. Malignant astrocytic glioma: genetics, biology, and paths to
treatment. Genes Dev, 2007; 21: 2683-710.
[302] Stupp R, Hegi ME, Mason WP, van den Bent MJ, Taphoorn MJ, Janzer
RC, Ludwin SK, Allgeier A, Fisher B, Belanger K, Hau P, Brandes AA,
Gijtenbeek J, Marosi C, Vecht CJ, Mokhtari K, Wesseling P, Villa S,
Eisenhauer E, Gorlia T, Weller M, Lacombe D, Cairncross JG, Mirimanoff
RO. Effects of radiotherapy with concomitant and adjuvant temozolomide
versus radiotherapy alone on survival in glioblastoma in a randomised
phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol,
2009; 10: 459-66.
[303] Diehn M, Cho RW, Lobo NA, Kalisky T, Dorie MJ, Kulp AN, Qian D, Lam
JS, Ailles LE, Wong M, Joshua B, Kaplan MJ, Wapnir I, Dirbas FM, Somlo
G, Garberoglio C, Paz B, Shen J, Lau SK, Quake SR, Brown JM,
196 Weissman IL, Clarke MF. Association of reactive oxygen species levels
and radioresistance in cancer stem cells. Nature, 2009; 458: 780-3.
[304] Jain RK, di Tomaso E, Duda DG, Loeffler JS, Sorensen AG, Batchelor TT.
Angiogenesis in brain tumours. Nat Rev Neurosci, 2007; 8: 610-22.
[305] Batchelor TT, Sorensen AG, di Tomaso E, Zhang WT, Duda DG, Cohen
KS, Kozak KR, Cahill DP, Chen PJ, Zhu M, Ancukiewicz M, Mrugala MM,
Plotkin S, Drappatz J, Louis DN, Ivy P, Scadden DT, Benner T, Loeffler
JS, Wen PY, Jain RK. AZD2171, a pan-VEGF receptor tyrosine kinase
inhibitor, normalizes tumor vasculature and alleviates edema in
glioblastoma patients. Cancer Cell, 2007; 11: 83-95.
[306] Mani SA, Guo W, Liao MJ, Eaton EN, Ayyanan A, Zhou AY, Brooks M,
Reinhard F, Zhang CC, Shipitsin M, Campbell LL, Polyak K, Brisken C,
Yang J, Weinberg RA. The epithelial-mesenchymal transition generates
cells with properties of stem cells. Cell, 2008; 133: 704-15.
[307] Kenny PA, Lee GY, Myers CA, Neve RM, Semeiks JR, Spellman PT,
Lorenz K, Lee EH, Barcellos-Hoff MH, Petersen OW, Gray JW, Bissell MJ.
The morphologies of breast cancer cell lines in three-dimensional assays
correlate with their profiles of gene expression. Mol Oncol, 2007; 1: 84-96.
[308] Fael Al-Mayhani TM, Ball SL, Zhao JW, Fawcett J, Ichimura K, Collins PV,
Watts C. An efficient method for derivation and propagation of
197 glioblastoma cell lines that conserves the molecular profile of their original
tumours. J Neurosci Methods, 2009; 176: 192-9.
[309] Pollard SM, Yoshikawa K, Clarke ID, Danovi D, Stricker S, Russell R,
Bayani J, Head R, Lee M, Bernstein M, Squire JA, Smith A, Dirks P.
Glioma stem cell lines expanded in adherent culture have tumor-specific
phenotypes and are suitable for chemical and genetic screens. Cell Stem
Cell, 2009; 4: 568-80.
[310] Du Z, Jia D, Liu S, Wang F, Li G, Zhang Y, Cao X, Ling EA, Hao A. Oct4
is expressed in human gliomas and promotes colony formation in glioma
cells. Glia, 2009; 57: 724-33.
[311] Zheng H, Ying H, Yan H, Kimmelman AC, Hiller DJ, Chen AJ, Perry SR,
Tonon G, Chu GC, Ding Z, Stommel JM, Dunn KL, Wiedemeyer R, You
MJ, Brennan C, Wang YA, Ligon KL, Wong WH, Chin L, dePinho RA.
Pten and p53 converge on c-Myc to control differentiation, self-renewal,
and transformation of normal and neoplastic stem cells in glioblastoma.
Cold Spring Harb Symp Quant Biol, 2008; 73: 427-37.
[312] Gordan JD, Bertout JA, Hu CJ, Diehl JA, Simon MC. HIF-2alpha promotes
hypoxic cell proliferation by enhancing c-myc transcriptional activity.
Cancer Cell, 2007; 11: 335-47.
198 [313] Sahlgren C, Gustafsson MV, Jin S, Poellinger L, Lendahl U. Notch
signaling mediates hypoxia-induced tumor cell migration and invasion.
Proc Natl Acad Sci U S A, 2008; 105: 6392-7.
[314] Jiang G, Yang F, Sanchez C, Ehrlich M. Histone modification in
constitutive heterochromatin versus unexpressed euchromatin in human
cells. J Cell Biochem, 2004; 93: 286-300.
[315] Kouzarides T. Chromatin modifications and their function. Cell, 2007; 128:
693-705.
[316] Ohm JE, McGarvey KM, Yu X, Cheng L, Schuebel KE, Cope L,
Mohammad HP, Chen W, Daniel VC, Yu W, Berman DM, Jenuwein T,
Pruitt K, Sharkis SJ, Watkins DN, Herman JG, Baylin SB. A stem cell-like
chromatin pattern may predispose tumor suppressor genes to DNA
hypermethylation and heritable silencing. Nat Genet, 2007; 39: 237-42.
[317] Guenther MG, Frampton GM, Soldner F, Hockemeyer D, Mitalipova M,
Jaenisch R, Young RA. Chromatin structure and gene expression
programs of human embryonic and induced pluripotent stem cells. Cell
Stem Cell, 2010; 7: 249-57.
[318] Mohan M, Lin C, Guest E, Shilatifard A. Licensed to elongate: a molecular
mechanism for MLL-based leukaemogenesis. Nat Rev Cancer, 2010; 10:
721-8.
199 [319] Yokoyama A, Wang Z, Wysocka J, Sanyal M, Aufiero DJ, Kitabayashi I,
Herr W, Cleary ML. Leukemia proto-oncoprotein MLL forms a SET1-like
histone methyltransferase complex with menin to regulate Hox gene
expression. Mol Cell Biol, 2004; 24: 5639-49.
[320] Avdic V, Zhang P, Lanouette S, Groulx A, Tremblay V, Brunzelle J,
Couture JF. Structural and biochemical insights into MLL1 core complex
assembly. Structure, 2011; 19: 101-8.
[321] Lim DA, Huang YC, Swigut T, Mirick AL, Garcia-Verdugo JM, Wysocka J,
Ernst P, Alvarez-Buylla A. Chromatin remodelling factor Mll1 is essential
for neurogenesis from postnatal neural stem cells. Nature, 2009; 458: 529-
33.
[322] Stubbs MC, Kim YM, Krivtsov AV, Wright RD, Feng Z, Agarwal J, Kung
AL, Armstrong SA. MLL-AF9 and FLT3 cooperation in acute myelogenous
leukemia: development of a model for rapid therapeutic assessment.
Leukemia, 2008; 22: 66-77.
[323] Sierra J, Yoshida T, Joazeiro CA, Jones KA. The APC tumor suppressor
counteracts beta-catenin activation and H3K4 methylation at Wnt target
genes. Genes Dev, 2006; 20: 586-600.
[324] Hu X, Pandolfi PP, Li Y, Koutcher JA, Rosenblum M, Holland EC. mTOR
promotes survival and astrocytic characteristics induced by Pten/AKT
signaling in glioblastoma. Neoplasia, 2005; 7: 356-68.
200 [325] Uhrbom L, Kastemar M, Johansson FK, Westermark B, Holland EC. Cell
type-specific tumor suppression by Ink4a and Arf in Kras-induced mouse
gliomagenesis. Cancer Res, 2005; 65: 2065-9.
[326] Lassman AB, Dai C, Fuller GN, Vickers AJ, Holland EC. Overexpression
of c-MYC promotes an undifferentiated phenotype in cultured astrocytes
and allows elevated Ras and Akt signaling to induce gliomas from GFAP-
expressing cells in mice. Neuron Glia Biol, 2004; 1: 157-63.
[327] Bertout JA, Patel SA, Simon MC. The impact of O2 availability on human
cancer. Nat Rev Cancer, 2008; 8: 967-75.
[328] Nagarajan RP, Costello JF. Epigenetic mechanisms in glioblastoma
multiforme. Semin Cancer Biol, 2009; 19: 188-97.
[329] Mazumdar J, O'Brien WT, Johnson RS, LaManna JC, Chavez JC, Klein
PS, Simon MC. O2 regulates stem cells through Wnt/beta-catenin
signalling. Nat Cell Biol, 2010; 12: 1007-13.
[330] Wang Y, Krivtsov AV, Sinha AU, North TE, Goessling W, Feng Z, Zon LI,
Armstrong SA. The Wnt/beta-catenin pathway is required for the
development of leukemia stem cells in AML. Science, 2010; 327: 1650-3.
[331] Yeung J, Esposito MT, Gandillet A, Zeisig BB, Griessinger E, Bonnet D,
So CW. beta-Catenin mediates the establishment and drug resistance of
MLL leukemic stem cells. Cancer Cell, 2010; 18: 606-18.
201 [332] Stark GR, Wang Y, Lu T. Lysine methylation of promoter-bound
transcription factors and relevance to cancer. Cell Res, 2011; 21: 375-80.
[333] Yang J, Huang J, Dasgupta M, Sears N, Miyagi M, Wang B, Chance MR,
Chen X, Du Y, Wang Y, An L, Wang Q, Lu T, Zhang X, Wang Z, Stark GR.
Reversible methylation of promoter-bound STAT3 by histone-modifying
enzymes. Proc Natl Acad Sci U S A, 2010; 107: 21499-504.
[334] Lu T, Jackson MW, Wang B, Yang M, Chance MR, Miyagi M, Gudkov AV,
Stark GR. Regulation of NF-kappaB by NSD1/FBXL11-dependent
reversible lysine methylation of p65. Proc Natl Acad Sci U S A, 2010; 107:
46-51.
[335] Holland EC, Hively WP, DePinho RA, Varmus HE. A constitutively active
epidermal growth factor receptor cooperates with disruption of G1 cell-
cycle arrest pathways to induce glioma-like lesions in mice. Genes Dev,
1998; 12: 3675-85.
[336] Holland EC, Hively WP, Gallo V, Varmus HE. Modeling mutations in the
G1 arrest pathway in human gliomas: overexpression of CDK4 but not
loss of INK4a-ARF induces hyperploidy in cultured mouse astrocytes.
Genes Dev, 1998; 12: 3644-9.
202