Functional Gene Expression Profile Underlying Methotrexate-Induced Senescence in Human Colon Cancer Cells

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Tumor Biol. (2011) 32:965–976 DOI 10.1007/s13277-011-0198-x RESEARCH ARTICLE Functional gene expression profile underlying methotrexate-induced senescence in human colon cancer cells Magdalena Dabrowska & Marek Skoneczny & Wojciech Rode Received: 13 April 2011 /Accepted: 27 May 2011 /Published online: 16 June 2011 # The Author(s) 2011. This article is published with open access at Springerlink.com Abstract Cellular functions accompanying establishment Rho molecules and myosin regulatory light chains of premature senescence in methotrexate-treated human MYL12A and MYL12B, indicates acquisition of motility colon cancer C85 cells are deciphered in the present study by those cells. Mitogen-activated protein kinase p38 MAPK from validated competitive expression microarray data, β, extracellular signal-regulated kinases ERK2 and ERK5, analyzed with the use of Ingenuity Pathways Analysis protein kinase B AKT1, as well as calcium, are identified as (IPA) software. The nitrosative/oxidative stress, inferred factors coordinating signaling pathways in senescent C85 from upregulated expression of inducible nitric oxide cells. synthase (iNOS) and mitochondrial dysfunction-associated genes, including monoamine oxidases MAOA and MAOB, Keywords High-dose methotrexate . Colorectal β-amyloid precursor protein (APP) and presenilin 1 adenocarcinoma . Drug-induced senescence . Expression (PSEN1), is identified as the main determinant of signaling microarrays . Signaling pathways pathways operating during senescence establishment. Acti- vation of p53-signaling pathway is found associated with both apoptotic and autophagic components contributing to Introduction this process. Activation of nuclear factor κB (NF-κB), resulting from interferon γ (IFNγ), integrin, interleukin 1β Cellular senescence is a stable and conditionally reversible (IL-1β), IL-4, IL-13, IL-22, Toll-like receptors (TLRs) 1, 2 growth arrest evoked by stress signals culminating in the and 3, growth factors and tumor necrosis factor (TNF) induction of DNA damage response [1, 2]. It is viewed as a superfamily members signaling, is found to underpin metabolically active state of hypermitogenic stimulation inflammatory properties of senescent C85 cells. Upregula- counterbalanced by induction of cyclin-dependent kinase tion of p21-activated kinases (PAK2 and PAK6), several (CDK) inhibitors [1]. Apart from being originally described as a replicative form of senescence occurring in normal Electronic supplementary material The online version of this article cells that have reached a division limit, senescence induced (doi:10.1007/s13277-011-0198-x) contains supplementary material, by activated oncogenes and premature form of senescence, which is available to authorized users. also termed stress-induced or accelerated, or else M. Dabrowska (*) : W. Rode senescence-like growth arrest, were also identified [3, 4]. Nencki Institute of Experimental Biology, Premature senescence may proceed in normal, as well as in Polish Academy of Sciences, cancer cells, and in regard to the latter it is of interest as a Pasteura 3, consequence of DNA damage brought about by radio- and 02–093 Warsaw, Poland e-mail: [email protected] chemotherapy [4]. Two main issues concerning therapy- induced senescence that require elucidation, before it can be M. Skoneczny exploited as an anticancer strategy refer to (i) senescence Institute of Biochemistry and Biophysics, associated secretory phenotype (SASP), i.e., molecules Polish Academy of Sciences, Pawinskiego 5a, secreted by senescent cells among which growth- and 02–106 Warsaw, Poland inflammation-promoting as well as extracellular matrix 966 Tumor Biol. (2011) 32:965–976 (ECM)-modulating factors are present and (ii) irreversibility ml streptomycin (both from LGC Promochem). Cells were of the state of senescence [4, 5]. In view of the reports exposed for 48 h to 1 μM methotrexate (Schircks demonstrating that populations of cancer cells driven into Laboratory, Switzerland), a drug concentration therapy-induced senescence are able to regain proliferative corresponding to that clinically attained with the high dose functions, senescence associated with controlled cellular methotrexate therapy [13]. This treatment variant was self-destruction process, autophagy, is postulated to under- designated MTX48. Recovery of C85 cells after drug pin tumor dormancy in vivo [6]. exposure was carried out for 96 h in the regular medium Our previous work documented premature senescence as and this treatment variant was designated R96. the sole response of human colon cancer C85 cells to the treatment with high dose classic antifolate, methotrexate Expression microarray analysis [7–9]. C85 cells are driven into senescence by the drug treatment despite being also capable of undergoing apopto- Total RNA was isolated using RNeasy Mini kit (Qiagen). sis [8]. The present study was aimed at delineation of cRNA labeling was performed with the use of Low RNA Input cellular functions, inferred from the pattern of activated Linear Amplification kit (Agilent Technologies). Two experi- signaling pathways, determining establishment of senescent mental variants of competitive hybridizations were carried out phenotype in this cellular system. It can be hypothesized with the Human whole genome expression microarrays that in C85 cells exposed to methotrexate interference with (Agilent Technologies): (i) MTX48 cells vs. untreated cells nitric oxide (NO) signaling acts as a molecular trigger for and (ii) R96 cells vs. untreated cells. Two-color hybridizations, nitrosative/oxidative stress generation upon senescence run in quadruplicates with dye swap between duplicates of the initiation. Maintenance of senescent phenotype is subse- same variant, were performed according to Agilent Two-Color quently executed by autostimulatory action of SASP Microarray-Based Analysis protocol. Axon GenePix 4000B components and paracrine cytokine stimulation, both scanner and GenePix software (Molecular Devices) were used determining pro-inflammatory characteristics of those cells. for feature extraction. Statistical evaluation employing Stu- The ability of C85 cells to reconstitute, after methotrexate dent’s t-test was performed in Acuity software (Molecular removal, a cell line displaying the same kinetics of the drug Devices). Upregulation of particular gene expression level in sensitivity [7], correlated with autophagy and expression of either variant was inferred from positive log2 ratio value. The ECM degrading SASP factors, indicates that in these data were submitted to ArrayExpress database and are cellular settings premature senescence might serve to available with E-MEXP-3018 accession at http://www.ebi.ac. enable treatment evasion rather than cancer eradication. uk/arrayexpress. This corresponds with known inefficacy of methotrexate applied as a single agent for colon cancer treatment. Signaling pathways analysis Pathway-directed intervention is postulated to be a future strategy in cancer treatment, as despite multitude mutations Data sets of statistically evaluated microarray results were of the genomes of cancer cells, limited is the number of loaded into Ingenuity Pathways Analysis (IPA) software intracellular signaling pathways underlying oncogenic (Ingenuity Systems, www.ingenuity.com). Two core analyses transformation and consequently, tumor response to therapy were run individually for gene lists corresponding to gene [10, 11]. Functional validation in various colon cancer cells expression profiles of MTX48 and R96 treatment variants. In of the signaling pathways herein identified as pertaining to each analysis expression parameters cut-offs were set at 0.5 the establishment of methotrexate-induced senescence in for log2 ratio and 0.05 for p value and, as the aim was to C85 cells may allow us to assess a putative therapeutic identify activated pathways, only upregulated identifiers, strategy aimed at the ultimate destabilization of the state of considered indicative of those activated pathways, were senescence rather than its maintenance. included. Particular pathway-eligible molecules were de- duced from an overlay of IPA canonical pathways, built within the software, with gene lists enriched according to the Material and methods applied expression parameters cut-offs. Activated signaling pathways predominant for MTX48 and R96 experimental Cell culture variants based on statistical significance (p value), were inferred from a comparison analysis of the two core analyses. Human colorectal adenocarcinoma C85 cells, originating from primary untreated tumor classified as Duke’s stage D Quantitative RT-PCR disease [12], were maintained in RPMI 1640 medium (Lonza, Belgium), supplemented with 10% fetal bovine Total RNA was isolated using RNeasy Mini kit (Qiagen). serum (Sigma-Aldrich), 100 units/ml penicillin and 100 μg/ Reverse transcription was performed using High-Capacity Tumor Biol. (2011) 32:965–976 967 cDNA Reverse Transcription kit and real-time polymerase CDK inhibitors p21waf1/cip1 and p15 being upregulated, and chain reaction (PCR), using Power SYBR Green PCR Master CDK4, cyclins B, cell division cycle (cdc) cdc2 and Mix, both from Applied Biosystems. The primers designed cdc25C being downregulated in the population of R96 with the use of PrimerExpress software (Applied Biosystems) cells [9]. The signaling pathways specific for each of the are listed in Table S1. Target gene expression level, senescence establishment phases, initiation and mainte- normalized to the expression of cyclophilin
Recommended publications
  • DNA Damage Activates a Spatially Distinct Late Cytoplasmic Cell-Cycle Checkpoint Network Controlled by MK2-Mediated RNA Stabilization

    DNA Damage Activates a Spatially Distinct Late Cytoplasmic Cell-Cycle Checkpoint Network Controlled by MK2-Mediated RNA Stabilization

    DNA Damage Activates a Spatially Distinct Late Cytoplasmic Cell-Cycle Checkpoint Network Controlled by MK2-Mediated RNA Stabilization The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Reinhardt, H. Christian, Pia Hasskamp, Ingolf Schmedding, Sandra Morandell, Marcel A.T.M. van Vugt, XiaoZhe Wang, Rune Linding, et al. “DNA Damage Activates a Spatially Distinct Late Cytoplasmic Cell-Cycle Checkpoint Network Controlled by MK2-Mediated RNA Stabilization.” Molecular Cell 40, no. 1 (October 2010): 34–49.© 2010 Elsevier Inc. As Published http://dx.doi.org/10.1016/j.molcel.2010.09.018 Publisher Elsevier B.V. Version Final published version Citable link http://hdl.handle.net/1721.1/85107 Terms of Use Article is made available in accordance with the publisher's policy and may be subject to US copyright law. Please refer to the publisher's site for terms of use. Molecular Cell Article DNA Damage Activates a Spatially Distinct Late Cytoplasmic Cell-Cycle Checkpoint Network Controlled by MK2-Mediated RNA Stabilization H. Christian Reinhardt,1,6,7,8 Pia Hasskamp,1,10,11 Ingolf Schmedding,1,10,11 Sandra Morandell,1 Marcel A.T.M. van Vugt,5 XiaoZhe Wang,9 Rune Linding,4 Shao-En Ong,2 David Weaver,9 Steven A. Carr,2 and Michael B. Yaffe1,2,3,* 1David H. Koch Institute for Integrative Cancer Research, Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02132, USA 2Broad Institute of MIT and Harvard, Cambridge, MA 02132, USA 3Center for Cell Decision Processes,
  • Expression Profiling of KLF4

    Expression Profiling of KLF4

    Expression Profiling of KLF4 AJCR0000006 Supplemental Data Figure S1. Snapshot of enriched gene sets identified by GSEA in Klf4-null MEFs. Figure S2. Snapshot of enriched gene sets identified by GSEA in wild type MEFs. 98 Am J Cancer Res 2011;1(1):85-97 Table S1: Functional Annotation Clustering of Genes Up-Regulated in Klf4 -Null MEFs ILLUMINA_ID Gene Symbol Gene Name (Description) P -value Fold-Change Cell Cycle 8.00E-03 ILMN_1217331 Mcm6 MINICHROMOSOME MAINTENANCE DEFICIENT 6 40.36 ILMN_2723931 E2f6 E2F TRANSCRIPTION FACTOR 6 26.8 ILMN_2724570 Mapk12 MITOGEN-ACTIVATED PROTEIN KINASE 12 22.19 ILMN_1218470 Cdk2 CYCLIN-DEPENDENT KINASE 2 9.32 ILMN_1234909 Tipin TIMELESS INTERACTING PROTEIN 5.3 ILMN_1212692 Mapk13 SAPK/ERK/KINASE 4 4.96 ILMN_2666690 Cul7 CULLIN 7 2.23 ILMN_2681776 Mapk6 MITOGEN ACTIVATED PROTEIN KINASE 4 2.11 ILMN_2652909 Ddit3 DNA-DAMAGE INDUCIBLE TRANSCRIPT 3 2.07 ILMN_2742152 Gadd45a GROWTH ARREST AND DNA-DAMAGE-INDUCIBLE 45 ALPHA 1.92 ILMN_1212787 Pttg1 PITUITARY TUMOR-TRANSFORMING 1 1.8 ILMN_1216721 Cdk5 CYCLIN-DEPENDENT KINASE 5 1.78 ILMN_1227009 Gas2l1 GROWTH ARREST-SPECIFIC 2 LIKE 1 1.74 ILMN_2663009 Rassf5 RAS ASSOCIATION (RALGDS/AF-6) DOMAIN FAMILY 5 1.64 ILMN_1220454 Anapc13 ANAPHASE PROMOTING COMPLEX SUBUNIT 13 1.61 ILMN_1216213 Incenp INNER CENTROMERE PROTEIN 1.56 ILMN_1256301 Rcc2 REGULATOR OF CHROMOSOME CONDENSATION 2 1.53 Extracellular Matrix 5.80E-06 ILMN_2735184 Col18a1 PROCOLLAGEN, TYPE XVIII, ALPHA 1 51.5 ILMN_1223997 Crtap CARTILAGE ASSOCIATED PROTEIN 32.74 ILMN_2753809 Mmp3 MATRIX METALLOPEPTIDASE
  • The Piddosome, DNA-Damage-Induced Apoptosis and Beyond

    The Piddosome, DNA-Damage-Induced Apoptosis and Beyond

    Cell Death and Differentiation (2012) 19, 13–20 & 2012 Macmillan Publishers Limited All rights reserved 1350-9047/12 www.nature.com/cdd Review The PIDDosome, DNA-damage-induced apoptosis and beyond S Janssens*,1 and A Tinel*,2 P53-induced protein with a death domain (PIDD) was cloned as a death domain (DD)-containing protein whose expression is induced by p53. It was later described as the core of a molecular platform-activating caspase-2, named the PIDDosome. These first results pointed towards a role for PIDD in apoptosis, in response to DNA damage. Identification of new PIDDosome complexes involved in DNA repair and nuclear factor-jB signaling challenged this early concept. PIDD functions are growing as new complexes and new interaction partners are being discovered, and as additional functions are being revealed. A fascinating feature of PIDD lies within its complex and tight regulation mechanisms, which allow the molecule to fine-tune its different functions: from transcriptional regulation to the expression of different isoforms, and from the interaction with regulatory proteins to an ingenious post-translational cleavage mechanism generating various active fragments with specific functions. Further studies still need to be carried out to provide answers to many unresolved issues and to reconcile conflicting results. This review aims at providing an overview of the current PIDD knowledge status. Cell Death and Differentiation (2012) 19, 13–20; doi:10.1038/cdd.2011.162; published online 18 November 2011 Facts Is PIDD involved at all in caspase-2 activation (which is distinct from processing) in vivo? Are both proteins P53-induced protein with a death domain (PIDD) has operating in the same pathway or acting independently of been identified as a p53-inducible molecule implicated in each other? p53-dependent apoptosis.
  • Gadd45a Regulates B-Catenin Distribution and Maintains Cell–Cell Adhesion/ Contact

    Gadd45a Regulates B-Catenin Distribution and Maintains Cell–Cell Adhesion/ Contact

    Oncogene (2007) 26, 6396–6405 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc ORIGINAL ARTICLE Gadd45a regulates b-catenin distribution and maintains cell–cell adhesion/ contact JJi1, R Liu1, T Tong, Y Song, S Jin, M Wu and Q Zhan State Key Laboratory of Molecular Oncology, Cancer Institute, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, PR China Gadd45a,a growth arrest and DNA-damage gene,plays 1999;Jin et al., 2000;Tong et al., 2005). Gadd45a important roles in the control of cell cycle checkpoints, also plays roles in negative regulation of cell malig- DNA repair and apoptosis. We show here that Gadd45a is nancy. Mouse embryonic fibroblasts (MEFs) derived involved in the control of cell contact inhibition and cell– from Gadd45a-null mice exhibited genomic instability, cell adhesion. Gadd45a can serve as an adapter to enhance single oncogene-mediated transformation, loss of nor- the interaction between b-catenin and Caveolin-1,and in mal cellular senescence, increased cellular proliferation, turn induces b-catenin translocation to cell membrane for centrosome amplification and reduced DNA repair maintaining cell–cell adhesion/contact inhibition. This is (Hollander et al., 1999;Smith et al., 2000). Gadd45a- coupled with reduction of b-catenin in cytoplasm and null mice have an increased frequency of tumorigenesis nucleus following Gadd45a induction,which is reflected by by ionizing radiation (IR), ultraviolet radiation (UVR) the downregulation of cyclin D1,one of the b-catenin and dimethylbenzanthracene (DMBA), although these targeted genes. Additionally,Gadd45a facilitates ultra- mice do not develop spontaneous tumors (Hollander violet radiation-induced degradation of cytoplasmic and et al., 1999, 2001;Hildesheim et al., 2002).
  • The Genetics of Bipolar Disorder

    The Genetics of Bipolar Disorder

    Molecular Psychiatry (2008) 13, 742–771 & 2008 Nature Publishing Group All rights reserved 1359-4184/08 $30.00 www.nature.com/mp FEATURE REVIEW The genetics of bipolar disorder: genome ‘hot regions,’ genes, new potential candidates and future directions A Serretti and L Mandelli Institute of Psychiatry, University of Bologna, Bologna, Italy Bipolar disorder (BP) is a complex disorder caused by a number of liability genes interacting with the environment. In recent years, a large number of linkage and association studies have been conducted producing an extremely large number of findings often not replicated or partially replicated. Further, results from linkage and association studies are not always easily comparable. Unfortunately, at present a comprehensive coverage of available evidence is still lacking. In the present paper, we summarized results obtained from both linkage and association studies in BP. Further, we indicated new potential interesting genes, located in genome ‘hot regions’ for BP and being expressed in the brain. We reviewed published studies on the subject till December 2007. We precisely localized regions where positive linkage has been found, by the NCBI Map viewer (http://www.ncbi.nlm.nih.gov/mapview/); further, we identified genes located in interesting areas and expressed in the brain, by the Entrez gene, Unigene databases (http://www.ncbi.nlm.nih.gov/entrez/) and Human Protein Reference Database (http://www.hprd.org); these genes could be of interest in future investigations. The review of association studies gave interesting results, as a number of genes seem to be definitively involved in BP, such as SLC6A4, TPH2, DRD4, SLC6A3, DAOA, DTNBP1, NRG1, DISC1 and BDNF.
  • DNA Excision Repair Proteins and Gadd45 As Molecular Players for Active DNA Demethylation

    DNA Excision Repair Proteins and Gadd45 As Molecular Players for Active DNA Demethylation

    Cell Cycle ISSN: 1538-4101 (Print) 1551-4005 (Online) Journal homepage: http://www.tandfonline.com/loi/kccy20 DNA excision repair proteins and Gadd45 as molecular players for active DNA demethylation Dengke K. Ma, Junjie U. Guo, Guo-li Ming & Hongjun Song To cite this article: Dengke K. Ma, Junjie U. Guo, Guo-li Ming & Hongjun Song (2009) DNA excision repair proteins and Gadd45 as molecular players for active DNA demethylation, Cell Cycle, 8:10, 1526-1531, DOI: 10.4161/cc.8.10.8500 To link to this article: http://dx.doi.org/10.4161/cc.8.10.8500 Published online: 15 May 2009. Submit your article to this journal Article views: 135 View related articles Citing articles: 92 View citing articles Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=kccy20 Download by: [University of Pennsylvania] Date: 27 April 2017, At: 12:48 [Cell Cycle 8:10, 1526-1531; 15 May 2009]; ©2009 Landes Bioscience Perspective DNA excision repair proteins and Gadd45 as molecular players for active DNA demethylation Dengke K. Ma,1,2,* Junjie U. Guo,1,3 Guo-li Ming1-3 and Hongjun Song1-3 1Institute for Cell Engineering; 2Department of Neurology; and 3The Solomon Snyder Department of Neuroscience; Johns Hopkins University School of Medicine; Baltimore, MD USA Abbreviations: DNMT, DNA methyltransferases; PGCs, primordial germ cells; MBD, methyl-CpG binding protein; NER, nucleotide excision repair; BER, base excision repair; AP, apurinic/apyrimidinic; SAM, S-adenosyl methionine Key words: DNA demethylation, Gadd45, Gadd45a, Gadd45b, Gadd45g, 5-methylcytosine, deaminase, glycosylase, base excision repair, nucleotide excision repair DNA cytosine methylation represents an intrinsic modifica- silencing of gene activity or parasitic genetic elements (Fig.
  • LRDD (PIDD1) (NM 145887) Human Tagged ORF Clone Product Data

    LRDD (PIDD1) (NM 145887) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG203713 LRDD (PIDD1) (NM_145887) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: LRDD (PIDD1) (NM_145887) Human Tagged ORF Clone Tag: TurboGFP Symbol: PIDD1 Synonyms: LRDD; PIDD Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 LRDD (PIDD1) (NM_145887) Human Tagged ORF Clone – RG203713 ORF Nucleotide >RG203713 representing NM_145887 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTGCAACGGTGGAGGGGCCAGAGCTGGAGGCAGCTGCTGCCGCAGGAGATGCTTCAGAGGATTCGG ACGCAGGGTCCAGGGCGCTGCCTTTCCTGGGCGGCAACCGGCTGAGCTTGGACCTGTACCCCGGGGGCTG CCAGCAGCTGCTGCACCTGTGTGTCCAGCAGCCTCTGCAGCTGCTGCAGGTGGAATTCTTGCGTCTGAGC ACTCACGAGGACCCTCAGCTGCTGGAGGCCACCCTGGCCCAGCTGCCTCAGAGCCTGTCCTGCCTCCGCT CCCTGGTCCTCAAAGGAGGGCAACGCCGGGACACACTGGGTGCCTGTCTCCGGGGTGCCCTGACCAACCT GCCCGCTGGTCTGAGTGGCCTGGCCCATCTGGCCCACCTGGACCTGAGCTTCAACAGCCTGGAGACACTG CCGGCCTGTGTCCTGCAGATGCGAGGTCTGGGTGCGCTCTTGCTGTCTCACAACTGCCTCTCTGAGCTGC CTGAGGCTCTGGGGGCCCTCCCCGCCCTCACCTTCCTCACAGTGACACACAACCGCCTGCAGACGCTGCC CCCAGCACTGGGGGCCCTATCCACCCTGCAGCGCCTCGATCTCTCTCAGAATCTGCTGGACACGCTACCT
  • The Human Gene Connectome As a Map of Short Cuts for Morbid Allele Discovery

    The Human Gene Connectome As a Map of Short Cuts for Morbid Allele Discovery

    The human gene connectome as a map of short cuts for morbid allele discovery Yuval Itana,1, Shen-Ying Zhanga,b, Guillaume Vogta,b, Avinash Abhyankara, Melina Hermana, Patrick Nitschkec, Dror Friedd, Lluis Quintana-Murcie, Laurent Abela,b, and Jean-Laurent Casanovaa,b,f aSt. Giles Laboratory of Human Genetics of Infectious Diseases, Rockefeller Branch, The Rockefeller University, New York, NY 10065; bLaboratory of Human Genetics of Infectious Diseases, Necker Branch, Paris Descartes University, Institut National de la Santé et de la Recherche Médicale U980, Necker Medical School, 75015 Paris, France; cPlateforme Bioinformatique, Université Paris Descartes, 75116 Paris, France; dDepartment of Computer Science, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel; eUnit of Human Evolutionary Genetics, Centre National de la Recherche Scientifique, Unité de Recherche Associée 3012, Institut Pasteur, F-75015 Paris, France; and fPediatric Immunology-Hematology Unit, Necker Hospital for Sick Children, 75015 Paris, France Edited* by Bruce Beutler, University of Texas Southwestern Medical Center, Dallas, TX, and approved February 15, 2013 (received for review October 19, 2012) High-throughput genomic data reveal thousands of gene variants to detect a single mutated gene, with the other polymorphic genes per patient, and it is often difficult to determine which of these being of less interest. This goes some way to explaining why, variants underlies disease in a given individual. However, at the despite the abundance of NGS data, the discovery of disease- population level, there may be some degree of phenotypic homo- causing alleles from such data remains somewhat limited. geneity, with alterations of specific physiological pathways under- We developed the human gene connectome (HGC) to over- come this problem.
  • The RNA Splicing Response to DNA Damage

    The RNA Splicing Response to DNA Damage

    Biomolecules 2015, 5, 2935-2977; doi:10.3390/biom5042935 OPEN ACCESS biomolecules ISSN 2218-273X www.mdpi.com/journal/biomolecules/ Review The RNA Splicing Response to DNA Damage Lulzim Shkreta and Benoit Chabot * Département de Microbiologie et d’Infectiologie, Faculté de Médecine et des Sciences de la Santé, Université de Sherbrooke, Sherbrooke, QC J1E 4K8, Canada; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-819-821-8000 (ext. 75321); Fax: +1-819-820-6831. Academic Editors: Wolf-Dietrich Heyer, Thomas Helleday and Fumio Hanaoka Received: 12 August 2015 / Accepted: 16 October 2015 / Published: 29 October 2015 Abstract: The number of factors known to participate in the DNA damage response (DDR) has expanded considerably in recent years to include splicing and alternative splicing factors. While the binding of splicing proteins and ribonucleoprotein complexes to nascent transcripts prevents genomic instability by deterring the formation of RNA/DNA duplexes, splicing factors are also recruited to, or removed from, sites of DNA damage. The first steps of the DDR promote the post-translational modification of splicing factors to affect their localization and activity, while more downstream DDR events alter their expression. Although descriptions of molecular mechanisms remain limited, an emerging trend is that DNA damage disrupts the coupling of constitutive and alternative splicing with the transcription of genes involved in DNA repair, cell-cycle control and apoptosis. A better understanding of how changes in splice site selection are integrated into the DDR may provide new avenues to combat cancer and delay aging.
  • The Human Gene Connectome As a Map of Short Cuts for Morbid Allele Discovery

    The Human Gene Connectome As a Map of Short Cuts for Morbid Allele Discovery

    The human gene connectome as a map of short cuts for morbid allele discovery Yuval Itana,1, Shen-Ying Zhanga,b, Guillaume Vogta,b, Avinash Abhyankara, Melina Hermana, Patrick Nitschkec, Dror Friedd, Lluis Quintana-Murcie, Laurent Abela,b, and Jean-Laurent Casanovaa,b,f aSt. Giles Laboratory of Human Genetics of Infectious Diseases, Rockefeller Branch, The Rockefeller University, New York, NY 10065; bLaboratory of Human Genetics of Infectious Diseases, Necker Branch, Paris Descartes University, Institut National de la Santé et de la Recherche Médicale U980, Necker Medical School, 75015 Paris, France; cPlateforme Bioinformatique, Université Paris Descartes, 75116 Paris, France; dDepartment of Computer Science, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel; eUnit of Human Evolutionary Genetics, Centre National de la Recherche Scientifique, Unité de Recherche Associée 3012, Institut Pasteur, F-75015 Paris, France; and fPediatric Immunology-Hematology Unit, Necker Hospital for Sick Children, 75015 Paris, France Edited* by Bruce Beutler, University of Texas Southwestern Medical Center, Dallas, TX, and approved February 15, 2013 (received for review October 19, 2012) High-throughput genomic data reveal thousands of gene variants to detect a single mutated gene, with the other polymorphic genes per patient, and it is often difficult to determine which of these being of less interest. This goes some way to explaining why, variants underlies disease in a given individual. However, at the despite the abundance of NGS data, the discovery of disease- population level, there may be some degree of phenotypic homo- causing alleles from such data remains somewhat limited. geneity, with alterations of specific physiological pathways under- We developed the human gene connectome (HGC) to over- come this problem.
  • PERP Expression Stabilizes Active P53 Via Modulation of P53-MDM2 Interaction in Uveal Melanoma Cells

    PERP Expression Stabilizes Active P53 Via Modulation of P53-MDM2 Interaction in Uveal Melanoma Cells

    Citation: Cell Death and Disease (2011) 2, e136; doi:10.1038/cddis.2011.19 & 2011 Macmillan Publishers Limited All rights reserved 2041-4889/11 www.nature.com/cddis PERP expression stabilizes active p53 via modulation of p53-MDM2 interaction in uveal melanoma cells L Davies1, D Spiller2, MRH White2, I Grierson1 and L Paraoan*,1 The activation and regulation of target genes by the tumour-suppressor p53 dictates the fate of a cell, with cell cycle arrest or apoptosis being two distinct outcomes. PERP (p53 apoptosis effector related to PMP-22), a p53 transcriptional target, is induced specifically during apoptosis but not cell cycle arrest. Downregulation of PERP is associated with the aggressive, monosomy 3-type of uveal melanoma (UM), the most common primary intraocular tumour in adults, and increased PERP expression has a pro-apoptotic effect in UM cells. Here, we identify a novel effect of PERP expression, as elevated PERP protein positively influences active levels of its own transcriptional regulator, p53. Using fluorescent fusion proteins of PERP, p53 and MDM2, we demonstrate in single living UM cells that PERP expression significantly enhances p53 activity and its nuclear localization, increases p53-dependent transcription (including that of MDM2) while allowing oscillatory nucleo-cytoplasmic shuttling of p53/ MDM2 complexes. Phosphorylation of p53 serine residues that interfere with the interaction between p53 and its negative regulator MDM2 and enhance pro-apoptotic gene transcription also occurs subsequent to PERP expression. These results implicate a role for PERP in amplifying functional p53 levels that promote p53-dependent apoptosis, and reveal a potential target for exploitation in enhancing p53 activity.
  • DNA Damage-Induced Apoptosis

    DNA Damage-Induced Apoptosis

    Oncogene (2004) 23, 2797–2808 & 2004 Nature Publishing Group All rights reserved 0950-9232/04 $25.00 www.nature.com/onc DNA damage-induced apoptosis Chris J Norbury1 and Boris Zhivotovsky*,2 1Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford OX1 3RE, UK; 2Institute of Environmental Medicine, Karolinska Institutet, Box 210, Nobels va¨g. 13, SE-171 77 Stockholm, Sweden Unicellular organisms respond to the presence of DNA phila melanogaster.The combination of data from these lesions by activating cell cycle checkpoint and repair genetically amenable models with those from mamma- mechanisms, while multicellular animals have acquired the lian and other vertebrate species has revealed conserva- further option of eliminating damaged cells by triggering tion of several key molecular mechanisms, as well as apoptosis. Defects in DNA damage-induced apoptosis species-specific variations on these themes. contribute to tumorigenesis and to the resistance of cancer Most of the morphological criteria that were first used cells to a variety of therapeutic agents. The intranuclear to distinguish apoptosis from necrosis relate to the mechanisms that signal apoptosis after DNA damage nucleus (Kerr et al., 1972). Degradation of chromoso- overlap with those that initiate cell cycle arrest and DNA mal DNA into oligonucleosome length fragments in repair, and the early events in these pathways are highly irradiated lymphoid tissues was reported as early as conserved. In addition, multiple independent routes have 1976 (Skalka et al., 1976). This observation was first recently been traced by which nuclear DNA damage can linked to endonuclease activation in 1980 (Wyllie, 1980) be signalled to the mitochondria, tipping the balance in and has since been used as a biochemical marker of favour of cell death rather than repair and survival.