DOCSLIB.ORG

JOURNAL of NEMATOLOGY Phylogenetic Studies on Three

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
JOURNAL of NEMATOLOGY Phylogenetic Studies on Three JOURNAL OF NEMATOLOGY Article | DOI: 10.21307/jofnem-2019-033 e2019-33 | Vol. 51 Phylogenetic studies on three Helicotylenchus species based on 28S rDNA and mtCOI sequence data K. Rybarczyk-Mydłowska*, E. Dmowska and K. Kowalewska Abstract Museum and Institute of Zoology PAS, Wilcza 64, 00-679, Warsaw, To facilitate the process of spiral nematode species delineation, pop- Poland. ulations of Helicotylenchus canadensis, H. pseudorobustus, and H. varicaudatus deriving from various locations and diverse natural *E-mail: [email protected] and anthropogenic environments from Poland were investigated and This paper was edited by Erik J. characterized. For the first time, 28S rDNA sequences are reported for Ragsdale. H. canadensis and H. varicaudatus, whereas new mtCOI sequences Received for publication August 30, were acquired for all three analyzed species. A Bayesian phylogenet- 2018. ic analysis of the 28S rDNA fragments revealed that H. canadensis and H. varicaudatus are members of a clade that is a sister group to all other Helicotylenchus species; however, the closest known sister group to H. canadensis is H. vulgaris type A. Both 28S rDNA- and mtCOI-based phylogenetic results suggest that this clade excludes H. pseudorobustus, whose most recent common ancestor with the former species was inferred to be the ancestor of all Helicotylenchus species. Moreover, within the mtCOI sequences obtained from H. pseudorobustus, unlike from the other two, a simultaneous presence of TAG and TAA codons was identified. This may indicate mitochon- drial genetic code alterations or other genomic rearrangements in H. pseudorobustus. Key words Cytochrome c oxidase subunit I, Genetic code alterations, Helicot- ylenchus canadensis, H. pseudorobustus, H. varicaudatus, Riboso- mal DNA, Spiral nematodes. Spiral nematodes, which belong to the Helicotylen- not be overlooked. Analyses of molecular information chus spp. (Hoplolaimidae), are representatives of hidden in their genomes bring us closer to an expla- Tylenchomorpha, which is considered the most suc- nation why some groups of nematodes became more cessful lineage of plant parasitic nematodes. They successfully adapted to plant parasitism than others. evolved by gradual transitions from fungal feeders Unlike the closely related, sedentary endoparasitic through facultative plant parasites toward obligatory cyst nematodes, most representatives of the genus plant parasites (Holterman et al., 2017). Furthermore, Helicotylenchus (Steiner, 1945) are considered mild the phylogenetic tree of this group reveals main evo- plant pathogens of minor economic importance. lutionary pathways, leading from ectoparasitism or However, several species like H. dihystera (Cobb, migratory endoparasitism to the most specialized, 1893; Sher, 1961), H. digonicus (Perry in Perry, Darling sedentary endoparasitic lifestyles, exhibited by the & Thorne, 1959), H. multicinctus (Cobb, 1893; Golden, most harmful plant-damaging nematode species. 1956), H. pseudorobustus (Steiner, 1914; Golden, Although the majority of research focuses on the lat- 1956), or H. varicaudatus (Yuen, 1964) were proven to ter pests, the investigation of species that developed be associated with plant growth suppression or more less sophisticated mechanisms of parasitism should severe crop-plant damage (Perry et al., 1959; Siddiqi, © 2019 Authors. This is an Open Access article licensed under the Creative 1 Commons CC BY 4.0 license, https://creativecommons.org/licenses/by/4.0/ Phylogenetic studies on three Helicotylenchus species based on 28S rDNA and mtCOI sequence data 2000; Schreck Reis et al., 2010). They are classified characterization, occurrence, and distribution of plant as ectoparasites or semi-endoparasites and can be parasitic nematodes in Poland. Soil samples were found in root systems of diverse cultivated and un- derived from various habitats and vegetation types. cultivated plants (Siddiqi, 2000; Subbotin et al., 2011). Each sample (about 1 kg of soil) was taken to a depth In total, this cosmopolitan genus encompasses over of 30 cm from the root zone using a soil sampler. 200 described species (Uzma et al., 2015), of which Nematode extraction was performed by the decan- many await a more detailed characterization. tation and sieving method, followed by the centrifugal To determine particular Helicotylenchus species, flotation method (van Bezooijen, 2006). Nematodes a precise evaluation of morphological and morpho- were killed with hot water at 60°C. The parts of the metrical features is used, usually after the preliminary samples of selected Hoplolaimidae were fixed in TAF recognition of the characteristic coiled body shape and designated for morphological analysis. The rest observed in the relaxed state or after death. However, of the samples were fixed in DESS and given to mo- the available keys do not always allow for proper spe- lecular studies. cies identification due to high intra-specific and -mi nor inter-specific variability within the genus (Fortuner, Morphological identification 1984; Fortuner et al., 1984). The proposed diagnostic characters and features can match and overlap be- Morphological observations and morphometrical anal- tween closely related species. Therefore, to facilitate yses were performed using Leica light microscope the species identification process as well as to de- with Nomarski differential interference contrast. Mor- lineate more phylogenetically distant species, which phological identification was performed using identifi- share the same morphology (cryptic species), the cation keys and descriptions by Waseem (1961), Yuen support of a molecular approach is needed. (1964), Sher (1966), Brzeski (1998), and Andrássy To date, only about 20% of Helicotylenchus species (2007). Nematodes fixed in DESS were subjected to has been molecularly characterized using mostly ribo- morphological vouchering and DNA amplification pro- somal DNA fragments (18S, ITS, 28S rDNA; GenBank cedure of Yoder et al. (2006). Nematodes were identi- resources). Mitochondrial cytochrome c oxidase sub- fied on the temporary slides, and subsequently multi- unit I (mtCOI) sequences were reported for one spe- focal images were made for every specimen. cies, the recently described H. oleae (Palomares-Rius et al., 2018), and a cytochrome c oxidase subunit II DNA extraction sequence was reported solely for H. dihystera (Riep- samen et al., 2011). A combination of both the nuclear After morphological identification, analyzed nema- genome-derived large subunit ribosomal DNA gene tode individuals were marked with specific codes (28S rDNA) and more variable genes such as mtCOI and assigned for further molecular studies. Genomic has been suggested to comprise valuable markers for DNA from single nematode specimens was extracted subsequent phylogenetic analyses in this group (Sub- using either GenElute™ Mammalian Genomic DNA botin et al., 2011; Palomares-Rius et al., 2018). Miniprep Kit (Sigma-Aldrich) or QIAamp DNA Micro The objectives of this study were as follows: to Kit (Qiagen) according to the manufacturers’ instruc- deliver molecular characteristics of three Hecicotylen- tions. For each sample, DNA was eluted in 30 μ l H2O. chus species commonly occurring in Poland, namely, Extracted DNA was stored at −20°C. H. canadensis, H. pseudorobustus and H. varicau- datus, by the use of nuclear 28S rDNA and mtCOI Primers, DNA amplification, and data, and to further evaluate the potential of mtCOI sequences for species identification and phylogenetic sequencing study of the genus Helicotylenchus. The mitochondrial DNA fragments of the mtCOI as well as the genomic DNA fragments of the large sub- Materials and methods unit rDNA (28S rDNA) were amplified from the collect- ed Hoplolaimidae species. Initially, during the ongoing Sampling, nematode extraction, and survey project, the publicly available JB3 and JB4 conservation or JB5 mtCOI primers (Hu et al., 2002; Derycke et al., 2010) were tested for amplification of mtCOI Three Hoplolaimidae species originating from Poland fragments from numerous plant parasitic species. were analyzed: H. canadensis, H. pseudorobustus, However, from these primers, PCR amplification and H. varicaudatus. Nematodes were collected dur- failed. Therefore, a new set of primers was devel- ing a study conducted between 2010 and 2014 on the oped according to the slightly modified primer design 2 JOURNAL OF NEMATOLOGY Table 1. Overview of PCR primers designed in this study, which were used for mtCOI amplification from three Helicotylenchus spp. and one Rotylenchus sp. Name of species and Approximate Forward primer (5′-3′) Reverse primer (5′-3′) corresponding GenBank amplicon size sequence numbers M3.5F: M8aRa: 700 H. pseudorobustus: MG663105 GGAGTGGiACARGiTGAAC GCAACiACATAATAAGWATCATG R. uniformis: MG663121 M6.9R: 450 H. pseudorobustus: MG663104 ACCiACARTAAAiATATGATG H. varicaudatus: MG663116; MG663116; MG663116 R. uniformis: MG663122 M2Fb: RH1R: 600 H. canadensis: MG663099; ATTGGiGSTTTTGGTAATT CCAACAATGAATATATGATG MG663100 H. pseudorobustus: MG663106; MG663107; MG663109; MG663110; MG663111; MG663112; MG663113 H. varicaudatus: MG663115 RH2F: 350 H. canadensis: MG663098; GGTGGAAGAATTAATTTYTG MG663101 H. varicaudatus: MG663114; MG663118; MG663120 Note: i = inosine. aThis primer is a modified version of the COIR primer proposed by He et al. (2005). The primer was elongated by 4 nucleotides and two nucleotide modifications were incorporated; bThis primer is a short- ened and modified version of the COI-F1 primer proposed
Load more

Recommended publications
  • One New and Three Known Species of the Genus Helicotylenchus Steiner, 1945 Associated with Banana from West Bengal, India
    Rec. zool. Surv. India: 110(Part-3) : 7-12, 2010 ONE NEW AND THREE KNOWN SPECIES OF THE GENUS HELICOTYLENCHUS STEINER, 1945 ASSOCIATED WITH BANANA FROM WEST BENGAL, INDIA VISWA VENKAT GANTAITl *, TANMAY BHATTACHARYA2 AND AMALENDU CHATTERJEEl INemathelminthes Section, Zoological Survey of India, M-Block, New Alipur, Kolkata-700 053, West Bengal, India. 2Department of Zoology, Vzdyasagar University, Medinipur, 721102, Paschim Medinipur, West Bengal, India. * Corresponding author: [email protected] INTRODUCTION slow dehydration method (Seinhorst, 1959); mounted One new and three known species of plant parasitic on slides in anhydrous glycerin and sealed. nematodes belonging to the genus Helicotylenchus Measurements were taken with the help of an ocular Steiner, 1945, H. wasimi n. sp., H. crenacauda Sher, micrometer using BX 41 Olympus research microscope 1966, H. dihystera (Cobb, 1893) Sher, 1961 and H. with drawing tube attachment. Dimensions were hydrophilus Sher, 1966 are being described and tabulated in accordance with De Man's Formula (De illustrated. The species were collected from rhizospheric Man, 1884). Diagrams were drawn with the help of a soil of banana plantations (Musa paradisiaca L. cv camera lucida. Kanthali) in Paschim Medinipur district of West Bengal, Abbreviations used in the text as well as in the India, during a taxonomic survey from March 2004 to table are as follows : February 2006. H. wasimi n. sp. is characterized by its L body length rounded lip region without annulations, 26-27 ]lm long a body length / maximum body width spear with anteriorly indented knobs, posteriorly located b body length / oesophageal length (808-809 ]lm from head end) vulva, anterior genital c body length / tail length branch longer than posterior one, short hemispherical cl tail length / body width at anus tail with thick cuticular rounded terminus, tail with four v distance from head end to vulva x 100 / distinct striations and phasmids located opposite to body length anus.
    [Show full text]
  • A Synopsis of the Genera and Species in the Tylenchorhynchinae (Tylenchoidea, Nematoda)1
    OF WASHINGTON, VOLUME 40, NUMBER 1, JANUARY 1973 123 Speer, C. A., and D. M. Hammond. 1970. tured bovine cells. J. Protozool. 18 (Suppl.): Development of Eimeria larimerensis from the 11. Uinta ground squirrel in cell cultures. Ztschr. Vetterling, J. M., P. A. Madden, and N. S. Parasitenk. 35: 105-118. Dittemore. 1971. Scanning electron mi- , L. R. Davis, and D. M. Hammond. croscopy of poultry coccidia after in vitro 1971. Cinemicrographic observations on the excystation and penetration of cultured cells. development of Eimeria larimerensis in cul- Ztschr. Parasitenk. 37: 136-147. A Synopsis of the Genera and Species in the Tylenchorhynchinae (Tylenchoidea, Nematoda)1 A. C. TARJAN2 ABSTRACT: The genera Uliginotylenchus Siddiqi, 1971, Quinisulcius Siddiqi, 1971, Merlinius Siddiqi, 1970, Ttjlenchorhynchus Cobb, 1913, Tetylenchus Filipjev, 1936, Nagelus Thome and Malek, 1968, and Geocenamus Thorne and Malek, 1968 are discussed. Keys and diagnostic data are presented. The following new combinations are made: Tetylenchus aduncus (de Guiran, 1967), Merlinius al- boranensis (Tobar-Jimenez, 1970), Geocenamus arcticus (Mulvey, 1969), Merlinius brachycephalus (Litvinova, 1946), Merlinius gaudialis (Izatullaeva, 1967), Geocenamus longus (Wu, 1969), Merlinius parobscurus ( Mulvey, 1969), Merlinius polonicus (Szczygiel, 1970), Merlinius sobolevi (Mukhina, 1970), and Merlinius tatrensis (Sabova, 1967). Tylenchorhynchus galeatus Litvinova, 1946 is with- drawn from the genus Merlinius. The following synonymies are made: Merlinius berberidis (Sethi and Swarup, 1968) is synonymized to M. hexagrammus (Sturhan, 1966); Ttjlenchorhynchus chonai Sethi and Swarup, 1968 is synonymized to T. triglyphus Seinhorst, 1963; Quinisulcius nilgiriensis (Seshadri et al., 1967) is synonymized to Q. acti (Hopper, 1959); and Tylenchorhynchus tener Erzhanova, 1964 is regarded a synonym of T.
    [Show full text]
  • 01F0aea77ca5bfffe05a43057a6a
    Journal of Nematology 49(3):233–235. 2017. Ó The Society of Nematologists 2017. Morphological and Molecular Identification of Longidorus euonymus and Helicotylenchus multicinctus from the Rhizosphere of Grapevine and Banana in Greece 1 2 2 2 EMMANUEL A. TZORTZAKAKIS, CAROLINA CANTALAPIEDRA-NAVARRETE, PABLO CASTILLO, JUAN E. PALOMARES-RIUS, 2 AND ANTONIO ARCHIDONA-YUSTE Abstract: Plant-parasitic nematodes such as Longidorus euonymus and Helicotylenchus multicintctus are species widely distributed in central Europe as well as in Mediterranean area. In Greece, both species have been previously reported but no morphometrics or molecular data were available for these species. Nematode surveys in the rhizosphere of grapevines in Athens carried out in 2016 and 2017, yielded a Longidorus species identified as Longidorus euonymus. Similarly, a population of Helicotylenchus multicinctus was detected infecting banana roots from an outdoor crop in Tertsa, Crete. For both species, morphometrics and molecular data of Greek populations were provided, resulting in the first integrative identification of both nematode species based on morphometric and molecular markers, confirming the occurrence of these two nematodes in Greece as had been stated in earlier reports. Key words: detection, needle and spiral nematodes, rDNA. Longidorus euonymus Mali and Hooper, 1974 is a spe- was found at a density of five nematodes per gram of cies widely distributed in central and south Europe root, after incubating macerated root pieces in modi- found in a wide range of hosts including perennial, fied Baerman funnels. woody, annual and herbaceous plants (Oro et al., Specimens to be observed under light microscopy 2005). In Greece, the only report of this nematode is were heat killed by adding hot 4% formaldehyde solu- from artichoke crop at Marathon area near Athens, but tion and processed to pure glycerin using De Grisse’s no molecular data are available for this population (1969) method.
    [Show full text]
  • Transcriptome Profiling of the Root-Knot Nematode Meloidogyne Enterolobii During Parasitism and Identification of Novel Effector Proteins
    Ecole Doctorale de Sciences de la Vie et de la Santé Unité de recherche : UMR ISA INRA 1355-UNS-CNRS 7254 Thèse de doctorat Présentée en vue de l’obtention du grade de docteur en Biologie Moléculaire et Cellulaire de L’UNIVERSITE COTE D’AZUR par NGUYEN Chinh Nghia Etude de la régulation du transcriptome de nématodes parasites de plante, les nématodes à galles du genre Meloidogyne Dirigée par Dr. Bruno FAVERY Soutenance le 8 Décembre, 2016 Devant le jury composé de : Pr. Pierre FRENDO Professeur, INRA UNS CNRS Sophia-Antipolis Président Dr. Marc-Henri LEBRUN Directeur de Recherche, INRA AgroParis Tech Grignon Rapporteur Dr. Nemo PEETERS Directeur de Recherche, CNRS-INRA Castanet Tolosan Rapporteur Dr. Stéphane JOUANNIC Chargé de Recherche, IRD Montpellier Examinateur Dr. Bruno FAVERY Directeur de Recherche, UNS CNRS Sophia-Antipolis Directeur de thèse Doctoral School of Life and Health Sciences Research Unity: UMR ISA INRA 1355-UNS-CNRS 7254 PhD thesis Presented and defensed to obtain Doctor degree in Molecular and Cellular Biology from COTE D’AZUR UNIVERITY by NGUYEN Chinh Nghia Comprehensive Transcriptome Profiling of Root-knot Nematodes during Plant Infection and Characterisation of Species Specific Trait PhD directed by Dr Bruno FAVERY Defense on December 8th 2016 Jury composition : Pr. Pierre FRENDO Professeur, INRA UNS CNRS Sophia-Antipolis President Dr. Marc-Henri LEBRUN Directeur de Recherche, INRA AgroParis Tech Grignon Reporter Dr. Nemo PEETERS Directeur de Recherche, CNRS-INRA Castanet Tolosan Reporter Dr. Stéphane JOUANNIC Chargé de Recherche, IRD Montpellier Examinator Dr. Bruno FAVERY Directeur de Recherche, UNS CNRS Sophia-Antipolis PhD Director Résumé Les nématodes à galles du genre Meloidogyne spp.
    [Show full text]
  • Pathogenicity of Helicotylenchus Indicus Siddiqi, 1963 on Papaya and Impact of Some Bio-Organic Materials
    doi:10.14720/aas.2019.113.2.8 Original research article / izvirni znanstveni članek Pathogenicity of Helicotylenchus indicus Siddiqi, 1963 on papaya and impact of some bio-organic materials Shimaa F. DIAB 1, Ahlam M. EL-GHONIMY 2 and Hosny H. KESBA 1,3 Received April 02, 2019; accepted May 24, 2019. Delo je prispelo 02. aprila 2019, sprejeto 24. maja 2019. Pathogenicity of Helicotylenchus indicus Siddiqi, 1963 on pa- Patogenost ogorčice Helicotylenchus indicus Siddiqi, 1963 za paya and impact of some bio-organic materials papajo in vpliv nekaterih bio-organskih pripravkov Abstract: Two pot experiments were conducted to de- Izvleček: Izvedena sta bila dva lončna poskusa za določitev termine the growth response of papaya, ‘Solo’ and H. indicus rastnega odziva papaje ‘Solo’ in razmnoževanja ogorčice H. in- reproduction in relation to different levels of nematode inocula dicus glede na njeno različno število v inokulih (0, 1000, 2000, (0, 1000, 2000, 4000, 8000 and 12000 nematode/pot) and im- 4000, 8000 in 12000 ogorčic na lonec) in vpliv nekaterih komer- ® ® pact of some commercial products, e.g. Bio Tonic®, Hundz Soil®, cialnih pripravkov kot so Bio Tonic , Hundz Soil , Nemakey- ™ ® ® Nemakey-N™, Nemastop® and Nubtea® on nematode manage- N , Nemastop in Nubtea na upravljanje z ogorčicami, na rast ment, plant growth and NPK contents. As increase nematode rastlin in njihovo vsebnost NPK. Povečanje gostote ogorčic na density to 4000 and up to 12000 nematode/pot, significant re- 4000 do 12000 ogorčic na lonec je značilno zmanjšalo dolžino ductions in plant length, fresh or dry mass were detected. The rastlin, njihovo svežo in suho maso.
    [Show full text]
  • Description of Helicotylenchus Persiaensis Sp. N. (Nematoda: Hoplolaimidae) from Iran
    Zootaxa 3785 (4): 575–588 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2014 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3785.4.6 http://zoobank.org/urn:lsid:zoobank.org:pub:987B039E-9EF7-475C-BFC4-ECBB8E0EB95F Description of Helicotylenchus persiaensis sp. n. (Nematoda: Hoplolaimidae) from Iran LEILA KASHI & AKBAR KAREGAR1 Department of Plant Protection, College of Agriculture, Shiraz University, Shiraz 71441-65186, Iran 1Corresponding author. E-mail: [email protected] Abstract In order to identify the species of Helicotylenchus Steiner, 1945 present in Iran, 497 soil and root samples were collected from the rhizosphere of different plants and localities throughout the country during 2009-2010. A new and several known species of Helicotylenchus were identified from the collected material. H. persiaensis sp. n. is characterized by its short tail (8-11 µm , c = 54.2–79.0, c′ = 0.6–1.2), usually with smooth terminus or with 1–3 very coarse annules, rarely with minor ventral, dorsal or lateral projection, conical and truncate head with 4–5 distinct annules, stylet 22–26 µm long with anteriorly flattened knobs, relatively short body length (570–730 µm) and absence of males. This species was collected from the rhizosphere of zelkova (Zelkova carpinifolia) and maple (Acer sp.) forest trees in Golestan province, northern Iran. Also observed were H. abunaamai Siddiqi, 1972, with a small ventral projection at the tail terminus, and H. crena- cauda Sher, 1966, with long projection and indented terminus, collected from sugarcane (Haft-Tapeh, Khuzestan prov- ince) and rice rhizosphere (Chabok-Sar, Gilan province), respectively.
    [Show full text]
  • Reproduction and Identification of Root-Knot Nematodes on Perennial Ornamental Plants in Florida
    REPRODUCTION AND IDENTIFICATION OF ROOT-KNOT NEMATODES ON PERENNIAL ORNAMENTAL PLANTS IN FLORIDA By ROI LEVIN A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2005 Copyright 2005 by Roi Levin ACKNOWLEDGMENTS I would like to thank my chair, Dr. W. T. Crow, and my committee members, Dr. J. A. Brito, Dr. R. K. Schoellhorn, and Dr. A. F. Wysocki, for their guidance and support of this work. I am honored to have worked under their supervision and commend them for their efforts and contributions to their respective fields. I would also like to thank my parents. Through my childhood and adult years, they have continuously encouraged me to pursue my interests and dreams, and, under their guidance, gave me the freedom to steer opportunities, curiosities, and decisions as I saw fit. Most of all, I would like to thank my fiancée, Melissa A. Weichert. Over the past few years, she has supported, encouraged, and loved me, through good times and bad. I will always remember her dedication, patience, and sacrifice while I was working on this study. I would not be the person I am today without our relationship and love. iii TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................................................................................. iii LIST OF TABLES............................................................................................................. vi LIST OF FIGURES ..........................................................................................................
    [Show full text]
  • The Plant-Parasitic Nematode Songbook Anthology
    THE PLANT-PARASITIC NEMATODE SONGBOOK ANTHOLOGY LYRICS BY KATHY MERRIFIELD I wrote the three volumes of The Plant-Parasitic Nematode Songbook in the late 1980s and early 1990s during work on an MS in Nematode Diseases of Plants and then as a research assistant with Professor Russ Ingham at Oregon State University. These included Volume I: Serious Music for Serious Pests, Volume II: More Serious Music for Serious Pests, and Volume III: Camp Songs. The melodies were hand-written on staff paper; the lyrics were also hand- written. Each of the three volumes existed as comb-bound hard copies. When my supply of hard copies ran low, I replaced them with The Plant-Parasitic Nematode Songbook Anthology, which was also produced as comb-bound hard copies. The lyrics were computer-printed, and the melodies were omitted. As in this digital version, I figured that most people don’t read music, so it really wouldn’t help much. Besides, many of the melodies are familiar. Maybe melodies can be added in the future – maybe even computer generated so they’re legible. The Anthology contained three new songs in addition to those from the first three volumes. These were cowboy songs from the forthcoming Volume IV: Cowboy Songs. Volume IV has now been forthcoming for about twenty years. PROCESSIONAL Melody: Kahinto Kamya, Processional (Camp Fire Girls) -- by Helen Gerrish Hughes, © Camp Fire, 1954 We dig the soil from our random design With measured tread and slow Because this stand is in deep decline Because it's infested with nematodes Nematodes, nematodes We harvest nematodes out of the soil With measured water and slow It's worth the hours of grueling toil To find parasitic nematodes Nematodes, nematodes We count a thousand samples a day With measured fingers and slow Our eyeballs twirl and our brains decay Because we've seen so many nematodes Nematodes, nematodes *********************************** Helen Gerrish Hughes was born Abbie Gerrish in 1863.
    [Show full text]
  • Morphological and Molecular Characterisation of Helicotylenchus
    Nematology 17 (2015) 27-52 brill.com/nemy Morphological and molecular characterisation of Helicotylenchus pseudorobustus (Steiner, 1914) Golden, 1956 and related species (Tylenchida: Hoplolaimidae) with a phylogeny of the genus ∗ Sergei A. SUBBOTIN 1,2, ,NicolaVOVLAS 3, Gregor W. YEATES†, Johannes HALLMANN 4, Sebastian KIEWNICK 5,VladimirN.CHIZHOV 2,RosaH.MANZANILLA-LÓPEZ 6, Renato N. INSERRA 7 and Pablo CASTILLO 8 1 Plant Pest Diagnostic Center, California Department of Food and Agriculture, 3294 Meadowview Road, Sacramento, CA 95832, USA 2 Center of Parasitology of A.N. Severtsov Institute of Ecology and Evolution of the Russian Academy of Sciences, Leninskii Prospect 33, Moscow 117071, Russia 3 Istituto per la Protezione Sostenibile delle Piante (IPSP), Consiglio Nazionale delle Ricerche (C.N.R.), U.O.S. di Bari, Via G. Amendola 122D, 70126 Bari, Italy 4 Julius Kühn-Institut, Bundesforschungsinstitut für Kulturpflanzen Institut für Epidemiologie und Pathogendiagnostik Toppheideweg 88, 48161 Münster, Germany 5 Agroscope, Institute for Plant Production Sciences, IPS, Schloss 1, P.O. Box, 8820 Wädenswil, Switzerland 6 Department of AgroEcology, Rothamsted Research, Harpenden, Herts, AL5 2JQ, UK 7 Florida Department of Agriculture and Consumer Services, DPI, Nematology Section, P.O. Box 147100, Gainesville, FL 32614-7100, USA 8 Institute for Sustainable Agriculture (IAS), Spanish National Research Council (CSIC), Avenida Menéndez Pidal s/n, Apdo. 4084, 14080-Córdoba, Spain Received: 17 September 2014; revised: 28 October 2014 Accepted for publication: 29 October 2014; available online: 2 December 2014 Summary – Morphological identification of spiral nematodes of the genus Helicotylenchus is a difficult task because most characters used for their diagnosis vary within species.
    [Show full text]
  • Responses of Root-Feeding Nematodes (Helicotylenchus Spp.) to Local and Non-Local Populations of the Host Plant Ammophila Arenaria
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Estudo Geral applied soil ecology 39 (2008) 245–253 available at www.sciencedirect.com journal homepage: www.elsevier.com/locate/apsoil Review Responses of root-feeding nematodes (Helicotylenchus spp.) to local and non-local populations of the host plant Ammophila arenaria Catarina Schreck Reis a,*, Helena Freitas a, Wim H. van der Putten b,c a Centre for Functional Ecology, Department of Botany, University of Coimbra, Calc¸ada Martim de Freitas, 3000-456 Coimbra, Portugal b Netherlands Institute of Ecology (NIOO-KNAW), Department of Multitrophic Interactions, Boterhoeksestraat 48, PO Box 40, 6666 ZG, Heteren, The Netherlands c Laboratory of Nematology, Wageningen University and Research Centre, PO Box 8123, 6700 ES Wageningen, The Netherlands article info abstract Article history: The root-feeding nematode community of wild plants may vary throughout their natural Received 9 November 2007 range. Little is known about how the variation of wild plants along their range affects their Received in revised form relationship with root-feeding nematodes. In the present study, we examined local and non- 15 January 2008 local combinations of host plants and root-feeding nematodes to test the hypothesis that Accepted 18 January 2008 nematode reproduction is favoured by local hosts. In two indoor experiments, we exposed populations of the wild dune grass Ammophila arenaria from northern and southern Eur- opean coastal sand dunes to plant parasitic nematode species (Helicotylenchus spp.) from Keywords: those same geographical origins. First, we used the southern nematode species to determine Coastal sand dunes whether the effect of a local versus a non-local host may depend on nematode density.
    [Show full text]
  • Effect of Long-Term Soil Management Practices on Nematode Population in an Alfisol Under Continuous Maize in Northern Guinea Savanna of Nigeria
    International Journal of Agricultural Policy and Research Vol.1 (3), pp. 080-086, May 2013 Available online at http://www.journalissues.org/journals-home.php?id=1 © 2013 Journal Issues Original Research Paper Effect of long-term soil management practices on nematode population in an Alfisol under continuous maize in Northern Guinea Savanna of Nigeria Accepted April 15, 2013 *Eche1 Nkechi Mary, A field study was carried out at Samaru throughout 2006 and 2007 seasons Iwuafor1 Emmanuel by using some organic and inorganic treatments on nematode community dynamics under a long-term continuous maize trial established in 1997. The Nathan Oyema, experiment was laid out in a randomized complete block design and the 1 Amapui shaku Yo'ila treatments involved were urea fertilizer, animal manure, and legumes. and Results showed that the population of fungivorous nematodes; Bruns2 MaryAnn Victoria Aphelenchoides spp. was greater in plots amended with legumes and urea than plots amended with animal manure in two seasons. Populations of 1Department of Soil Science, nematodes in this trophic group significantly (p<0.05) increased in 2007 Ahmadu Bello University, Zaria, season compared to 2006 season. Populations of plant parasitic nematodes Nigeria. were reduced by using animal manure treatment compared to urea and 2Department of Ecosystem legumes especially with Helicotylenchus spp. having the highest population Science and Management, Penn followed by Hoplolaimus spp., Pratylenchus spp. and Scutellonema spp. in State University, U.S.A. that order. Plant parasitic nematodes were the most abundant group irrespective of soil amendment. They ranged from 91.9 to 98.9% in 2006 and *Corresponding author 93.8 to 97.8% in 2007 of the total nematode community and had a colonizer- Email: [email protected] persister (c-p) value of 3.
    [Show full text]
  • Relationships of Plant Parasitic Nematodes to Sites in Native Iowa Prairies ~
    Relationships of Plant Parasitic Nematodes to Sites in Native Iowa Prairies ~ D. P. SCHMITT and D. C. NORTON 2 Abstract: Soil samples were collected from three native Iowa prairies and analyzed for plant paiasitic nematodes and selected soil properties. Sites or nematodes were clustered with similarities related to habitat by a cluster analysis of site by nematode species and of nematodes by site. Some nematodes occurred in a wide range of prairie habitats, whereas others were more restricted. For example, greater numbers of Xiphinema americanum were in the low, well-drained sites than in the low wet sites or upland dry sites. Wet sites contained fewer nematodes than well-drained sites. Well-drained sites contained mainly Tylenchorhynchus maximus, Helicotylenchus pseudorobustus, and X. americanum. Wetter sites contained almost exclusively X. chambersi, H. hydrophilus, Telylenchus ]octus, and an undescribed species of Tylenchorhynchus. Key words: habitat relationships, H. leiocephalus, Aorolaimus torpidus, T. nudus. Investigations of plant parasitic nematodes Moraine. Hayden Prairie in Howard County is in native grasslands in the United States have about 135 miles northeast of the Kalsow Prairie resulted mostly in faunistic lists and associated and about 200 miles east of the Cayler Prairie, plants (4, 5, 6, 11). That more nematode and is in the Cresco-Lourdes-Clyde soil studies in native areas have not been made is association. These prairies have never been surprising, since most nematodes in USA cultivated, and they have been set aside as cultivated soils probably had their ancestry in preserves, two of them being registered Natural virgin areas in relatively recent times. Studies in Landmarks.
    [Show full text]