DOCSLIB.ORG

RNA Polymerase II/III Transcription Specificity Determined by TATA Box

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
RNA Polymerase II/III Transcription Specificity Determined by TATA Box Proc. Natl. Acad. Sci. USA Vol. 92, pp. 8606-8610, September 1995 Biochemistry RNA polymerase II/III transcription specificity determined by TATA box orientation (in vitro transcription/basal transcription machinery/TATA box-binding protein/transcription factor IID/transcription factor IIIB) YAN WANG AND WILLLAM E. STUMPH* Department of Chemistry and Molecular Biology Institute, San Diego State University, San Diego, CA 92182-1030 Communicated by E. Peter Geiduschek University of California, San Diego, CA, June 13, 1995 (received for review May 31, 1995) ABSTRACT The TATA box sequence in eukaryotes is canonical TATA box sequence and a nuclear extract with located about 25 bp upstream of many genes transcribed by similar amounts of Pol II and Pol III activity, we find that a RNA polymerase II (Pol II) and some genes transcribed by "forward" TATA box specifically directs Pol II transcription, RNA polymerase III (Pol III). The TATA box is recognized in whereas a "reverse" TATA box specifically directs Pol III a sequence-specific manner by the TATA box-binding protein transcription. (TBP), an essential factor involved in the initiation of tran- scription by all three eukaryotic RNA polymerases. We have investigated the recognition of the TATA box by the Pol II and MATERIAL AND METHODS Pot III basal transcription machinery and its role in estab- Construction of Templates. The D "Forward" TATA and D lishing the RNA polymerase specificity of the promoter. "Reverse" TATA templates (shown in Fig. 1) were con- Artificial templates were constructed that contained a canon- structed in two steps. First, synthetic DNA sequences that ical TATA box as the sole promoter element but differed in the represent a hybrid of the Drosophila Ul and U6 snRNA gene orientation of the 8-bp TATA box sequence. As expected, Pol transcription start sites (11, 12) were inserted between the II initiated transcription in unfractionated nuclear extracts BamHI and Xba I restriction sites of the polylinker of pUC18. downstream of-the "forward" TATA box. In distinct contrast, After isolation of this recombinant plasmid, synthetic oligo- transcription that initiated downstream of the "reverse" nucleotides that contained the TATA sequence in either the TATA box was carried out specifically by Pol III. Importantly, forward or reverse orientation were inserted between the Kpn this effect was observed regardless of the source of the DNA I and BamHI restriction sites of the polylinker. either upstream or downstream of the TATA sequence. These To construct the H/D "Forward" TATA and H/D "Re- findings suggest that TBP may bind in opposite orientations verse" TATA templates (shown in Fig. 2), synthetic oligonu- on Pol II and Pol III promoters and that opposite, yet cleotides containing a combination of DNA sequences near homologous, surfaces ofTBP may be utilized by the Pol II and the transcription start sites of human Ul, U2, and U6 snRNA Pol III basal machinery for the initiation of transcription. genes (8, 13, 14) were inserted between the EcoRI and Kpn I restriction sites of the D "Forward" TATA and D "Reverse" The TATA box was originally identified as a regulatory signal TATA templates. This placed the human sequences in the upstream of many protein-coding genes transcribed by RNA opposite orientation and in an upstream position relative to the polymerase II (Pol II). However, some tRNA and 5S RNA Drosophila sequences. genes and most RNA polymerase III (Pol III)-transcribed To construct the pUC18 "Forward" TATA and pUC18 genes with external promoters also possess TATA boxes "Reverse" TATA templates (shown in Fig. 3), the Drosophila- -25-30 bp upstream of the transcription start site. When like sequences were deleted from the D "Forward" TATA and present in Pol III promoters, the TATA box can have a D "Reverse" TATA templates by digestion with BamHI and significant effect on the efficiency and accuracy of transcrip- Sal I. After filling in the overhanging ends with the Klenow tion of these genes by Pol III (1-6). Interestingly, a better fragment of DNA polymerase, the plasmids were recircular- match to a canonical TATA sequence often becomes apparent ized. Plasmids were grown in Escherichia coli TOP10 cells if the TATA sequences in Pol III promoters are read in the (Invitrogen), purified by using Qiagen (Chatsworth, CA) Plas- qpposite orientation. As one example, transcription of plant mid Midi kits, and used as templates for in vitro transcription. small nuclear RNA (snRNA) genes by either Pol II (Ul, U2, In Vitro Transcription Assays. Transcription reactions (25 ,ul U4, and U5) or Pol III (U3 and U6) requires a TATA box (7). final volume) were carried out for 1 h at 25°C with 10 ,ul of However, the 8-nt consensus sequence for plant Pol II- soluble nuclear fraction (SNF) prepared from Drosophila transcribed genes is 5'-TATAAAAN-3' (a canonical TATA embryos (15-17), 5.5 ,ul HEMG buffer [25 mM Hepes, pH sequence), whereas the consensus sequence for plant Pol 7.6/12.5 mM MgCl2/0.1 mM EDTA/10% (vol/vol) glycerol/ III-transcribed snRNA genes is 5'-TTTATATA-3' (7). (The 1.5 mM dithiothreitol] containing 0.1 M KCl, 7.5 ,ul of complementary strand sequence, in this case 5'-TATATAAA- ribonucleoside triphosphate (rNTP) mix (1.7 mM each rNTP 3', represents the better match to a canonical TATA se- in 67 mM Hepes, pH 7.6), and 2 pul of plasmid DNA (0.2 mg/ml quence.) Other examples of genes with TATA sequences that in 10 mM Tris-HCl, pH 8.0/1 mM EDTA). The drugs a-aman- can be better interpreted as inverted TATA boxes range itin (a specific inhibitor of Pol II but not insect Pol III) and evolutionarily from the human U6 and 7SK genes to several tagetitoxin [Tagetin, Epicentre Technologies, Madison, WI; a yeast tRNA genes (5, 8-10). specific Pol III inhibitor (18)] were added to the indicated These and other observations prompted us to investigate reactions at final concentrations of 2 or 200 ,ug/ml and 400 whether the orientation ofthe TATA box, in the absence of any units/ml, respectively. additional promoter elements, could be a primary determinant of RNA polymerase specificity. Indeed, by utilizing a strong Abbreviations: Pol II, RNA polymerase II; Pol III, RNA polymerase III; TBP, TATA box-binding protein; SNF, soluble nuclear fraction; The publicatidn costs of this article were defrayed in part by page charge TFIID, transcription factor IID; TFIIIB, transcription factor IIIB; payaent. This article must therefore be hereby marked "advertisement" in snRNA, small nuclear RNA. accordance with 18 U.S.C. §1734 solely to indicate this fact. *To whom reprint requests should be addressed. 8606 Downloaded by guest on September 27, 2021 Biochemistry: Wang and Stumph Proc. Natl. Acad. Sci. USA 92 (1995) 8607 Purification of transcription products and analysis by primer affinity binding site for TBP (unpublished data). Moreover, extension were as described (16). The 32P-labeled primers previous studies indicated that this sequence is a strong [New England Biolabs catalog number 1233 or a primer promoter element that can function independently of other (1211z) similar to New England Biolabs catalog number 1211 promoter elements for the initiation of transcription (16). but longer by 7 nt at its 5' end] were complementary to pUC18 Finally, this TATA sequence is highly asymmetrical-i.e., DNA on opposite sides of the polylinker. Primer-extension dissimilar in sequence-in its 5' and 3' halves. Conceivably, products were separated by electrophoresis through 10% these properties should maximize the ability of TBP, as a denaturing polyacrylamide gels and subjected to autoradiog- component of either transcription factor IID (TFIID) or raphy at -70°C. The transcription initiation sites were mapped transcription factor IIIB (TFIIIB), to recognize the TATA box at high resolution by running the primer-extension products on with high specificity and directionality. similar gels together with sequencing ladders generated by The synthetic sequences inserted to the right of the TATA using the same 32P-labeled primers (data not shown). boxes contain no known promoter sequences but were de- signed to bear some resemblance to the Drosophila Ul and U6 RESULTS snRNA gene transcription start sites (11, 12) to potentially optimize the context for initiation of transcription by either Pol The relevant portions of the two constructs used as templates II or Pol III. However, these constructs contain no proximal for the initial experiment are shown at the top of Fig. 1. These sequence element which is essential for snRNA gene expres- two plasmids, D "Forward" TATA and D "Reverse" TATA, sion and is normally located -40-65 bp upstream of the are identical to each other except for the polarity of the 8 bp transcription start site of snRNA genes. The plasmid templates that make up the TATA box (boldface type). An 8-bp sequence were transcribed in vitro by using SNF prepared from Dro- was chosen because the TATA box-binding protein (TBP) sophila embryos (15, 17). contacts exactly 8 bp in its cocrystal structure with DNA (21, Identical sets of reactions were carried out, except that one 22). Also, 5'-TATAAAAA-3' represents a canonical TATA set contained the D "Forward" TATA template (Fig. 1, lanes sequence that, on the basis of footprinting assays, is a high- 1-5) and the complementary set contained the D "Reverse" 1233 primer 5. D 'Forward' TATA Template e Pol 3. -* TCACACAGGAAACAGCTA TGACA TGA TTACGAA TTCGAGCTCGGTA CCGCTATAAAGG T ATGGGA TCCT C AATAC TTCG GCATGC T TACC T GG C TGA TCTAGA AGTGTGTCCTTTGTCGATACTGTACTAATGCTTAAGCTCGAGCCA TGGCG&TAhTTSICCATACCCTAGGAGTTATGAAGCCGrACGAATGGACCGACTAGATCT -4- 3' Pol III ; 121 Iz primer 1233 primer 5 D 'Reverse TATA Template pol III 3' ,__tTCA CACAGGAAA CAGCTA TGACA TGATTSACGAA TTCGAGC TCGGTACC=C7777AS&GGTATG GGA SCCTCAATAC TTC GGCATGSCTT AC CTGGCTGA TCTAGA ASGTGTGTCCTTTGCGATA CTGTA CTAA TGCTTAAGCTCGAGCCA TGGCG AAXAAACCATAC CC SAGGAG T TATG AAG CCGTAC GAATG GACC GAC TAGATSCT -1 3' Pol 7: 5' 1211Iz primer 121 1z Primer 1233 Primer D Fo#ward TATA D Reverse' TATA : template: D Forward TATA D Reverse' TATA _ + -1 - + + - 4+ + - a-amanitin : _ + -II - +t + - +4 + - + + - _-_ : tagetitoxin: - transcription products *..:P ...@.
Load more

Recommended publications
  • Supplementary Materials
    DEPs in osteosarcoma cells comparing to osteoblastic cells Biological Process Protein Percentage of Hits metabolic process (GO:0008152) 29.3 29.3% cellular process (GO:0009987) 20.2 20.2% localization (GO:0051179) 9.4 9.4% biological regulation (GO:0065007) 8 8.0% developmental process (GO:0032502) 7.8 7.8% response to stimulus (GO:0050896) 5.6 5.6% cellular component organization (GO:0071840) 5.6 5.6% multicellular organismal process (GO:0032501) 4.4 4.4% immune system process (GO:0002376) 4.2 4.2% biological adhesion (GO:0022610) 2.7 2.7% apoptotic process (GO:0006915) 1.6 1.6% reproduction (GO:0000003) 0.8 0.8% locomotion (GO:0040011) 0.4 0.4% cell killing (GO:0001906) 0.1 0.1% 100.1% Genes 2179Hits 3870 biological adhesion apoptotic process … reproduction (GO:0000003) , 0.8% (GO:0022610) , 2.7% locomotion (GO:0040011) ,… immune system process cell killing (GO:0001906) , 0.1% (GO:0002376) , 4.2% multicellular organismal process (GO:0032501) , metabolic process 4.4% (GO:0008152) , 29.3% cellular component organization (GO:0071840) , 5.6% response to stimulus (GO:0050896), 5.6% developmental process (GO:0032502) , 7.8% biological regulation (GO:0065007) , 8.0% cellular process (GO:0009987) , 20.2% localization (GO:0051179) , 9.
    [Show full text]
  • The Conserved Structure of Plant Telomerase RNA Provides the Missing Link for an Evolutionary Pathway from Ciliates to Humans
    The conserved structure of plant telomerase RNA provides the missing link for an evolutionary pathway from ciliates to humans Jiarui Songa, Dhenugen Logeswaranb,1, Claudia Castillo-Gonzáleza,1, Yang Lib, Sreyashree Bosea, Behailu Birhanu Aklilua, Zeyang Mac,d, Alexander Polkhovskiya,e, Julian J.-L. Chenb,2, and Dorothy E. Shippena,2 aDepartment of Biochemistry and Biophysics, Texas A&M University, College Station, TX 77843; bSchool of Molecular Sciences, Arizona State University, Tempe, AZ 85287; cNational Maize Improvement Center of China, China Agricultural University, 100193 Beijing, China; dCollege of Agronomy and Biotechnology, China Agricultural University, 100193 Beijing, China; and eCenter of Life Sciences, Skolkovo Institute of Science and Technology, 121205 Moscow, Russian Federation Edited by Thomas R. Cech, University of Colorado Boulder, Boulder, CO, and approved October 24, 2019 (received for review September 4, 2019) Telomerase is essential for maintaining telomere integrity. Although transcribed by RNA polymerase III (Pol III) (6, 7). The La-related telomerase function is widely conserved, the integral telomerase protein P65 in Tetrahymena recognizes the 3′ poly-U tail of TR RNA (TR) that provides a template for telomeric DNA synthesis has and bends the RNA to facilitate telomerase RNP assembly (8, 9). diverged dramatically. Nevertheless, TR molecules retain 2 highly In contrast, fungi maintain much larger TR molecules (900 to conserved structural domains critical for catalysis: a template- 2,400 nt) that are transcribed by RNA polymerase II (Pol II) (3). proximal pseudoknot (PK) structure and a downstream stem-loop The 3′ end maturation of fungal TRs requires components of the structure. Here we introduce the authentic TR from the plant canonical snRNA biogenesis pathway and results in RNP assembly Arabidopsis thaliana, called AtTR, identified through next-generation sequencing of RNAs copurifying with Arabidopsis TERT.
    [Show full text]
  • Preinitiation Complex
    Science Highlight – June 2011 Transcription Starts Here: Structural Models of a “Minimal” Preinitiation Complex RNA polymerase II (pol II) plays a central role in the regulation of gene expression. Pol II is the enzyme responsible for synthesizing all the messenger RNA (mRNA) and most of the small nuclear RNA (snRNA) in eukaryotes. One of the key questions for transcription is how pol II decides where to start on the genomic DNA to specifically and precisely turn on a gene. This is achieved during transcription initiation by concerted actions of the core enzyme pol II and a myriad of transcription factors including five general transcription factors, known as TFIIB, -D, -E, -F, -H, which together form a giant transcription preinitiation complex on a promoter prior to transcription. One of the most prominent core promoter DNA elements is the TATA box, usually directing transcription of tissue-specific genes. TATA-box binding protein (TBP), a key component of TFIID, recognizes the TATA DNA sequence. Based on the previous crystallographic studies, the TATA box DNA is bent by nearly 90 degree through the binding of TBP (1). This striking structural feature is thought to serve as a physical landmark for the location of active genes on the genome. In addition, the location of the TATA box at least in part determines the transcription start site (TSS) in most eukaryotes, including humans. The distance between the TATA box and the TSS is conserved at around 30 base pairs. TBP does not contact pol II directly and the TATA-containing promoter must be directed to the core enzyme through another essential transcription factor TFIIB.
    [Show full text]
  • Identification of Promoter Regions in the Human Genome by Using a Retroviral Plasmid Library-Based Functional Reporter Gene Assa
    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Methods Identification of Promoter Regions in the Human Genome by Using a Retroviral Plasmid Library-Based Functional Reporter Gene Assay Shirin Khambata-Ford,1,5 Yueyi Liu,2 Christopher Gleason,1 Mark Dickson,3 Russ B. Altman,2 Serafim Batzoglou,4 and Richard M. Myers1,3,6 1Department of Genetics, 2Stanford Medical Informatics, 3Stanford Human Genome Center, Stanford University School of Medicine, Stanford, California 94305, USA; 4Department of Computer Science, Stanford University, Stanford, California 94305, USA Attempts to identify regulatory sequences in the human genome have involved experimental and computational methods such as cross-species sequence comparisons and the detection of transcription factor binding-site motifs in coexpressed genes. Although these strategies provide information on which genomic regions are likely to be involved in gene regulation, they do not give information on their functions. We have developed a functional selection for promoter regions in the human genome that uses a retroviral plasmid library-based system. This approach enriches for and detects promoter function of isolated DNA fragments in an in vitro cell culture assay. By using this method, we have discovered likely promoters of known and predicted genes, as well as many other putative promoter regions based on the presence of features such as CpG islands. Comparison of sequences of 858 plasmid clones selected by this assay with the human genome draft sequence indicates that a significantly higher percentage of sequences align to the 500-bp segment upstream of the transcription start sites of known genes than would be expected from random genomic sequences.
    [Show full text]
  • Molecular Biology and Applied Genetics
    MOLECULAR BIOLOGY AND APPLIED GENETICS FOR Medical Laboratory Technology Students Upgraded Lecture Note Series Mohammed Awole Adem Jimma University MOLECULAR BIOLOGY AND APPLIED GENETICS For Medical Laboratory Technician Students Lecture Note Series Mohammed Awole Adem Upgraded - 2006 In collaboration with The Carter Center (EPHTI) and The Federal Democratic Republic of Ethiopia Ministry of Education and Ministry of Health Jimma University PREFACE The problem faced today in the learning and teaching of Applied Genetics and Molecular Biology for laboratory technologists in universities, colleges andhealth institutions primarily from the unavailability of textbooks that focus on the needs of Ethiopian students. This lecture note has been prepared with the primary aim of alleviating the problems encountered in the teaching of Medical Applied Genetics and Molecular Biology course and in minimizing discrepancies prevailing among the different teaching and training health institutions. It can also be used in teaching any introductory course on medical Applied Genetics and Molecular Biology and as a reference material. This lecture note is specifically designed for medical laboratory technologists, and includes only those areas of molecular cell biology and Applied Genetics relevant to degree-level understanding of modern laboratory technology. Since genetics is prerequisite course to molecular biology, the lecture note starts with Genetics i followed by Molecular Biology. It provides students with molecular background to enable them to understand and critically analyze recent advances in laboratory sciences. Finally, it contains a glossary, which summarizes important terminologies used in the text. Each chapter begins by specific learning objectives and at the end of each chapter review questions are also included.
    [Show full text]
  • 1589622468 115 19.Pdf
    Journal of Global Antimicrobial Resistance 18 (2019) 168–176 Contents lists available at ScienceDirect Journal of Global Antimicrobial Resistance journal homepage: www.elsevier.com/locate/jgar Characterisation of drug resistance-associated mutations among clinical multidrug-resistant Mycobacterium tuberculosis isolates from Hebei Province, China a b b b b a,1, Qianlin Li , Yuling Wang , Yanan Li , Huixia Gao , Zhi Zhang , Fumin Feng *, b,1, Erhei Dai * a Department of Epidemiology and Statistics, North China University of Science and Technology, Tangshan 063210, Hebei, China b Department of Laboratory Medicine, The Fifth Affiliated Hospital of Shijiazhuang, North China University of Science and Technology, Shijiazhuang 050021, Hebei, China A R T I C L E I N F O A B S T R A C T Article history: Objectives: Multidrug-resistant tuberculosis (MDR-TB) is a major public-health problem in China. Received 15 November 2018 However, there is little information on the molecular characterisation of clinical MDR-TB isolates in Hebei Received in revised form 9 March 2019 Province. Accepted 14 March 2019 Methods: In this study, 123 MDR-TB isolates were identified in sputum cultures using traditional drug Available online 27 March 2019 susceptibility testing. The isolates were analysed for mutations in seven genes associated with resistance to antituberculous four drugs: katG and inhA promoter for isoniazid (INH); rpoB for rifampicin (RIF); gyrA Keywords: and gyrB for ofloxacin (OFLX); and rrs and eis promoter for kanamycin (KAN). All strains were genotyped Multidrug-resistant tuberculosis by spoligotyping and 15-loci MIRU-VNTR analysis. MDR-TB Results: A total of 39 distinct mutations were found at the seven loci in 114/123 (92.7%) MDR-TB isolates.
    [Show full text]
  • Supplementary Material Computational Prediction of SARS
    Supplementary_Material Computational prediction of SARS-CoV-2 encoded miRNAs and their putative host targets Sheet_1 List of potential stem-loop structures in SARS-CoV-2 genome as predicted by VMir. Rank Name Start Apex Size Score Window Count (Absolute) Direct Orientation 1 MD13 2801 2864 125 243.8 61 2 MD62 11234 11286 101 211.4 49 4 MD136 27666 27721 104 205.6 119 5 MD108 21131 21184 110 204.7 210 9 MD132 26743 26801 119 188.9 252 19 MD56 9797 9858 128 179.1 59 26 MD139 28196 28233 72 170.4 133 28 MD16 2934 2974 76 169.9 71 43 MD103 20002 20042 80 159.3 403 46 MD6 1489 1531 86 156.7 171 51 MD17 2981 3047 131 152.8 38 87 MD4 651 692 75 140.3 46 95 MD7 1810 1872 121 137.4 58 116 MD140 28217 28252 72 133.8 62 122 MD55 9712 9758 96 132.5 49 135 MD70 13171 13219 93 130.2 131 164 MD95 18782 18820 79 124.7 184 173 MD121 24086 24135 99 123.1 45 176 MD96 19046 19086 75 123.1 179 196 MD19 3197 3236 76 120.4 49 200 MD86 17048 17083 73 119.8 428 223 MD75 14534 14600 137 117 51 228 MD50 8824 8870 94 115.8 79 234 MD129 25598 25642 89 115.6 354 Reverse Orientation 6 MR61 19088 19132 88 197.8 271 10 MR72 23563 23636 148 188.8 286 11 MR11 3775 3844 136 185.1 116 12 MR94 29532 29582 94 184.6 271 15 MR43 14973 15028 109 183.9 226 27 MR14 4160 4206 89 170 241 34 MR35 11734 11792 111 164.2 37 52 MR5 1603 1652 89 152.7 118 53 MR57 18089 18132 101 152.7 139 94 MR8 2804 2864 122 137.4 38 107 MR58 18474 18508 72 134.9 237 117 MR16 4506 4540 72 133.8 311 120 MR34 10010 10048 82 132.7 245 133 MR7 2534 2578 90 130.4 75 146 MR79 24766 24808 75 127.9 59 150 MR65 21528 21576 99 127.4 83 180 MR60 19016 19049 70 122.5 72 187 MR51 16450 16482 75 121 363 190 MR80 25687 25734 96 120.6 75 198 MR64 21507 21544 70 120.3 35 206 MR41 14500 14542 84 119.2 94 218 MR84 26840 26894 108 117.6 94 Sheet_2 List of stable stem-loop structures based on MFE.
    [Show full text]
  • Long-Range Repression in the Drosophila Embryo HAINI N
    Proc. Natl. Acad. Sci. USA Vol. 93, pp. 9309-9314, September 1996 Colloquium Paper This paper was presented at a colloquium entitled "Biology of Developmental Transcription Control, " organized by Eric H. Davidson, Roy J. Britten, and Gary Felsenfeld, held October 26-28, 1995, at the National Academy of Sciences in Irvine, CA. Long-range repression in the Drosophila embryo HAINI N. CAI, DAVID N. ARNOSTI, AND MICHAEL LEVINE* Department of Biology, Center for Molecular Genetics, Pacific Hall, University of California at San Diego, La Jolla, CA 92093-0347 ABSTRACT Transcriptional repressors can be character- Short-range transcriptional repression appears to account ized by their range of action on promoters and enhancers. for enhancer autonomy in a modular promoter. Repressors Short-range repressors interact over distances of50-150 bp to bound to a given enhancer do not interfere with the activators inhibit, or quench, either upstream activators or the basal contained within neighboring enhancers. For example, the transcription complex. In contrast, long-range repressors act posterior border of eve stripe 3 is established by the gap over several kilobases to silence basal promoters. We describe repressor knirps (kni; ref. 7), which is a member of the nuclear recent progress in characterizing the functional properties of receptor superfamily, and is expressed in the presumptive one such long-range element in the Drosophila embryo and abdomen in early embryos (8). There are at least five kni- discuss the contrasting types of gene regulation that are made binding sites in the stripe 3 enhancer, two of which map within possible by short- and long-range repressors.
    [Show full text]
  • Termination of RNA Polymerase II Transcription by the 5’-3’ Exonuclease Xrn2
    TERMINATION OF RNA POLYMERASE II TRANSCRIPTION BY THE 5’-3’ EXONUCLEASE XRN2 by MICHAEL ANDRES CORTAZAR OSORIO B.S., Universidad del Valle – Colombia, 2011 A thesis submitted to the Faculty of the Graduate School of the University of Colorado in partial fulfillment of the requirements for the degree of Doctor of Philosophy Molecular Biology Program 2018 This thesis for the Doctor of Philosophy degree by Michael Andrés Cortázar Osorio has been approved for the Molecular Biology Program by Mair Churchill, Chair Richard Davis Jay Hesselberth Thomas Blumenthal James Goodrich David Bentley, Advisor Date: Aug 17, 2018 ii Cortázar Osorio, Michael Andrés (Ph.D., Molecular Biology) Termination of RNA polymerase II transcription by the 5’-3’ exonuclease Xrn2 Thesis directed by Professor David L. Bentley ABSTRACT Termination of transcription occurs when RNA polymerase (pol) II dissociates from the DNA template and releases a newly-made mRNA molecule. Interestingly, an active debate fueled by conflicting reports over the last three decades is still open on which of the two main models of termination of RNA polymerase II transcription does in fact operate at 3’ ends of genes. The torpedo model indicates that the 5’-3’ exonuclease Xrn2 targets the nascent transcript for degradation after cleavage at the polyA site and chases pol II for termination. In contrast, the allosteric model asserts that transcription through the polyA signal induces a conformational change of the elongation complex and converts it into a termination-competent complex. In this thesis, I propose a unified allosteric-torpedo mechanism. Consistent with a polyA site-dependent conformational change of the elongation complex, I found that pol II transitions at the polyA site into a mode of slow transcription elongation that is accompanied by loss of Spt5 phosphorylation in the elongation complex.
    [Show full text]
  • RNA Polymerase III Interferes with Ty3 Integration
    FEBS 18345 FEBS Letters 405 (1997) 305-311 RNA polymerase III interferes with Ty3 integration Charles M. Connolly1, Suzanne B. Sandmeyer* Department of Microbiology and Molecular Genetics, College of Medicine, University of California, Irvine, CA 92697-4025, USA Received 8 January 1997; revised version received 12 February 1997 verse transcription of Ty3 RNA in association with the VLP, Abstract Ty3, a gypsylike retrotransposon of budding yeast, integrates at the transcription initiation site of genes transcribed the DNA copy is integrated into the host genome in a process by RNA polymerase III (pol III). It was previously shown that mediated by Ty3 integrase (IN) [12]. Ty3 IN is a homologue integration in vitro requires intact promoter elements and the pol of retroviral IN. Recombinant retroviral IN has been demon- III transcription factors TFIIIB and TFIIIC. In order to test the strated to have in vitro 3'-end processing and strand-transfer effect of pol III on integration, increasing amounts of a pol Ill- activities (reviewed in [13]). Although Ty3 IN has been dem- containing fraction were added to Ty3 in vitro integration onstrated to be required in vivo for 3'-end processing and reactions. The pol Ill-containing fraction was inhibitory to integration of Ty3 DNA, integration activity has only been integration. These results are consistent with a model where the observed in vitro in association with a VLP fraction [14]. Ty3 integration complex and pol III recognize similar features of the stable transcription complex and compete with each other for Despite the many similarities between retroviruses and Ty3 access to the transcription initiation site.
    [Show full text]
  • Ncrna Synthesis Ny RNA Polymerase
    “The functional characterization of mammalian non-coding Y RNAs” Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften (Dr. rer. nat.) der Naturwissenschaftlichen Fakultät I – Biowissenschaften – der Martin-Luther-Universität Halle-Wittenberg, vorgelegt von Herrn Marcel Köhn geb. am 04.01.1983 in Wolgast Öffentlich verteidigt am 30.10.2015 Gutachter: Prof. Dr. Stefan Hüttelmaier (Halle, Deutschland) Prof. Dr. Elmar Wahle (Halle, Deutschland) Prof. Dr. Daniel Zenklusen (Montreal, Kanada) Contents Abstract 1. Non-coding RNAs (ncRNAs) 2. NcRNA synthesis by RNA polymerase III 2.1. NcRNAs transcribed from type I and II POLIII-genes 2.2. NcRNAs transcribed from type III POLIII-genes 3. The non-coding Y RNAs 3.1. Evolution of Y RNAs 3.2. Y RNA genes and expression patterns 3.3. Processing of Y RNAs 3.4. Subcellular localization of Y RNAs 3.5. Y RNA-associated proteins 3.6. The Y RNA core proteins – La and Ro60 3.7. A paradigm of accessory Y RNA-binding proteins – IGF2BPs 3.8. The characterization of Y RNPs 3.9. The association of Y3/Y3** with mRNA 3’-end processing factors 4. Y RNA functions 4.1. The role of Y RNAs in DNA replication and cell growth 4.2. Y RNAs as modulators of Ro60 function and cellular stress 5. The role of Y3/Y3** in the 3’-end processing of histone mRNAs 5.1. The depletion of Y RNAs and their impact on pre-mRNA processing 5.2. The evolutionary conservation of Y3’s role in histone mRNA processing 5.3. Y3** ncRNA is essential for histone mRNA processing 5.4.
    [Show full text]
  • Polymerase II Into the Preinitiation Complex OSVALDO FLORES*, HUA Lu*, MARIE Killeentt, JACK Greenblattt, ZACHARY F
    Proc. NatI. Acad. Sci. USA Vol. 88, pp. 9999-10003, November 1991 Biochemistry The small subunit of transcription factor IIF recruits RNA polymerase II into the preinitiation complex OSVALDO FLORES*, HUA Lu*, MARIE KILLEENtt, JACK GREENBLATTt, ZACHARY F. BURTON§, AND DANNY REINBERG*¶ *Department of Biochemistry, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, Piscataway, NJ 08854; tBanting and Best Department of Medical Research, and tDepartment of Molecular and Medical Genetics, University of Toronto, Toronto, ON M5S lA1, Canada; and §Department of Biochemistry, Michigan State University, East Lansing, MI 48823 Communicated by Nicholas R. Cozzarelli, August 16, 1991 ABSTRACT We found that transcription factor IIF me- experiments also suggested that RNA polymerase II bound diates the association of RNA polymerase H with promoter directly to the DA complex followed by association offactors sequences containing transcription factors HD, BB, and HA IIB and IIE (14, 26). However, direct association of RNA (DAB complex). The resulting DNA-protein complex con- polymerase II with a IID/IIA DNA-protein complex (DA tained RNA polymerase H and the two subunits oftranscription complex) has not been confirmed (27, 28). Gel shift assays factor HF (RAP 30 and RAP 74). Cloned human RAP 30 was have been successfully used to resolve complexes formed by sufficient for the recruitment ofRNA polymerase H to the DAB the general factors and RNA polymerase II at specific complex. This ability of RAP 30 to recruit RNA polymerase to promoter regions (28, 29). Using this method, Buratowski et a promoter is also a characteristic of a factors in prokaryotes.
    [Show full text]