Proc. Natl. Acad. Sci. USA Vol. 92, pp. 8606-8610, September 1995 Biochemistry RNA polymerase II/III transcription specificity determined by TATA box orientation (in vitro transcription/basal transcription machinery/TATA box-binding protein/transcription factor IID/transcription factor IIIB) YAN WANG AND WILLLAM E. STUMPH* Department of Chemistry and Molecular Biology Institute, San Diego State University, San Diego, CA 92182-1030 Communicated by E. Peter Geiduschek University of California, San Diego, CA, June 13, 1995 (received for review May 31, 1995) ABSTRACT The TATA box sequence in eukaryotes is canonical TATA box sequence and a nuclear extract with located about 25 bp upstream of many genes transcribed by similar amounts of Pol II and Pol III activity, we find that a RNA polymerase II (Pol II) and some genes transcribed by "forward" TATA box specifically directs Pol II transcription, RNA polymerase III (Pol III). The TATA box is recognized in whereas a "reverse" TATA box specifically directs Pol III a sequence-specific manner by the TATA box-binding protein transcription. (TBP), an essential factor involved in the initiation of tran- scription by all three eukaryotic RNA polymerases. We have investigated the recognition of the TATA box by the Pol II and MATERIAL AND METHODS Pot III basal transcription machinery and its role in estab- Construction of Templates. The D "Forward" TATA and D lishing the RNA polymerase specificity of the promoter. "Reverse" TATA templates (shown in Fig. 1) were con- Artificial templates were constructed that contained a canon- structed in two steps. First, synthetic DNA sequences that ical TATA box as the sole promoter element but differed in the represent a hybrid of the Drosophila Ul and U6 snRNA gene orientation of the 8-bp TATA box sequence. As expected, Pol transcription start sites (11, 12) were inserted between the II initiated transcription in unfractionated nuclear extracts BamHI and Xba I restriction sites of the polylinker of pUC18. downstream of-the "forward" TATA box. In distinct contrast, After isolation of this recombinant plasmid, synthetic oligo- transcription that initiated downstream of the "reverse" nucleotides that contained the TATA sequence in either the TATA box was carried out specifically by Pol III. Importantly, forward or reverse orientation were inserted between the Kpn this effect was observed regardless of the source of the DNA I and BamHI restriction sites of the polylinker. either upstream or downstream of the TATA sequence. These To construct the H/D "Forward" TATA and H/D "Re- findings suggest that TBP may bind in opposite orientations verse" TATA templates (shown in Fig. 2), synthetic oligonu- on Pol II and Pol III promoters and that opposite, yet cleotides containing a combination of DNA sequences near homologous, surfaces ofTBP may be utilized by the Pol II and the transcription start sites of human Ul, U2, and U6 snRNA Pol III basal machinery for the initiation of transcription. genes (8, 13, 14) were inserted between the EcoRI and Kpn I restriction sites of the D "Forward" TATA and D "Reverse" The TATA box was originally identified as a regulatory signal TATA templates. This placed the human sequences in the upstream of many protein-coding genes transcribed by RNA opposite orientation and in an upstream position relative to the polymerase II (Pol II). However, some tRNA and 5S RNA Drosophila sequences. genes and most RNA polymerase III (Pol III)-transcribed To construct the pUC18 "Forward" TATA and pUC18 genes with external promoters also possess TATA boxes "Reverse" TATA templates (shown in Fig. 3), the Drosophila- -25-30 bp upstream of the transcription start site. When like sequences were deleted from the D "Forward" TATA and present in Pol III promoters, the TATA box can have a D "Reverse" TATA templates by digestion with BamHI and significant effect on the efficiency and accuracy of transcrip- Sal I. After filling in the overhanging ends with the Klenow tion of these genes by Pol III (1-6). Interestingly, a better fragment of DNA polymerase, the plasmids were recircular- match to a canonical TATA sequence often becomes apparent ized. Plasmids were grown in Escherichia coli TOP10 cells if the TATA sequences in Pol III promoters are read in the (Invitrogen), purified by using Qiagen (Chatsworth, CA) Plas- qpposite orientation. As one example, transcription of plant mid Midi kits, and used as templates for in vitro transcription. small nuclear RNA (snRNA) genes by either Pol II (Ul, U2, In Vitro Transcription Assays. Transcription reactions (25 ,ul U4, and U5) or Pol III (U3 and U6) requires a TATA box (7). final volume) were carried out for 1 h at 25°C with 10 ,ul of However, the 8-nt consensus sequence for plant Pol II- soluble nuclear fraction (SNF) prepared from Drosophila transcribed genes is 5'-TATAAAAN-3' (a canonical TATA embryos (15-17), 5.5 ,ul HEMG buffer [25 mM Hepes, pH sequence), whereas the consensus sequence for plant Pol 7.6/12.5 mM MgCl2/0.1 mM EDTA/10% (vol/vol) glycerol/ III-transcribed snRNA genes is 5'-TTTATATA-3' (7). (The 1.5 mM dithiothreitol] containing 0.1 M KCl, 7.5 ,ul of complementary strand sequence, in this case 5'-TATATAAA- ribonucleoside triphosphate (rNTP) mix (1.7 mM each rNTP 3', represents the better match to a canonical TATA se- in 67 mM Hepes, pH 7.6), and 2 pul of plasmid DNA (0.2 mg/ml quence.) Other examples of genes with TATA sequences that in 10 mM Tris-HCl, pH 8.0/1 mM EDTA). The drugs a-aman- can be better interpreted as inverted TATA boxes range itin (a specific inhibitor of Pol II but not insect Pol III) and evolutionarily from the human U6 and 7SK genes to several tagetitoxin [Tagetin, Epicentre Technologies, Madison, WI; a yeast tRNA genes (5, 8-10). specific Pol III inhibitor (18)] were added to the indicated These and other observations prompted us to investigate reactions at final concentrations of 2 or 200 ,ug/ml and 400 whether the orientation ofthe TATA box, in the absence of any units/ml, respectively. additional promoter elements, could be a primary determinant of RNA polymerase specificity. Indeed, by utilizing a strong Abbreviations: Pol II, RNA polymerase II; Pol III, RNA polymerase III; TBP, TATA box-binding protein; SNF, soluble nuclear fraction; The publicatidn costs of this article were defrayed in part by page charge TFIID, transcription factor IID; TFIIIB, transcription factor IIIB; payaent. This article must therefore be hereby marked "advertisement" in snRNA, small nuclear RNA. accordance with 18 U.S.C. §1734 solely to indicate this fact. *To whom reprint requests should be addressed. 8606 Downloaded by guest on September 27, 2021 Biochemistry: Wang and Stumph Proc. Natl. Acad. Sci. USA 92 (1995) 8607 Purification of transcription products and analysis by primer affinity binding site for TBP (unpublished data). Moreover, extension were as described (16). The 32P-labeled primers previous studies indicated that this sequence is a strong [New England Biolabs catalog number 1233 or a primer promoter element that can function independently of other (1211z) similar to New England Biolabs catalog number 1211 promoter elements for the initiation of transcription (16). but longer by 7 nt at its 5' end] were complementary to pUC18 Finally, this TATA sequence is highly asymmetrical-i.e., DNA on opposite sides of the polylinker. Primer-extension dissimilar in sequence-in its 5' and 3' halves. Conceivably, products were separated by electrophoresis through 10% these properties should maximize the ability of TBP, as a denaturing polyacrylamide gels and subjected to autoradiog- component of either transcription factor IID (TFIID) or raphy at -70°C. The transcription initiation sites were mapped transcription factor IIIB (TFIIIB), to recognize the TATA box at high resolution by running the primer-extension products on with high specificity and directionality. similar gels together with sequencing ladders generated by The synthetic sequences inserted to the right of the TATA using the same 32P-labeled primers (data not shown). boxes contain no known promoter sequences but were de- signed to bear some resemblance to the Drosophila Ul and U6 RESULTS snRNA gene transcription start sites (11, 12) to potentially optimize the context for initiation of transcription by either Pol The relevant portions of the two constructs used as templates II or Pol III. However, these constructs contain no proximal for the initial experiment are shown at the top of Fig. 1. These sequence element which is essential for snRNA gene expres- two plasmids, D "Forward" TATA and D "Reverse" TATA, sion and is normally located -40-65 bp upstream of the are identical to each other except for the polarity of the 8 bp transcription start site of snRNA genes. The plasmid templates that make up the TATA box (boldface type). An 8-bp sequence were transcribed in vitro by using SNF prepared from Dro- was chosen because the TATA box-binding protein (TBP) sophila embryos (15, 17). contacts exactly 8 bp in its cocrystal structure with DNA (21, Identical sets of reactions were carried out, except that one 22). Also, 5'-TATAAAAA-3' represents a canonical TATA set contained the D "Forward" TATA template (Fig. 1, lanes sequence that, on the basis of footprinting assays, is a high- 1-5) and the complementary set contained the D "Reverse" 1233 primer 5. D 'Forward' TATA Template e Pol 3. -* TCACACAGGAAACAGCTA TGACA TGA TTACGAA TTCGAGCTCGGTA CCGCTATAAAGG T ATGGGA TCCT C AATAC TTCG GCATGC T TACC T GG C TGA TCTAGA AGTGTGTCCTTTGTCGATACTGTACTAATGCTTAAGCTCGAGCCA TGGCG&TAhTTSICCATACCCTAGGAGTTATGAAGCCGrACGAATGGACCGACTAGATCT -4- 3' Pol III ; 121 Iz primer 1233 primer 5 D 'Reverse TATA Template pol III 3' ,__tTCA CACAGGAAA CAGCTA TGACA TGATTSACGAA TTCGAGC TCGGTACC=C7777AS&GGTATG GGA SCCTCAATAC TTC GGCATGSCTT AC CTGGCTGA TCTAGA ASGTGTGTCCTTTGCGATA CTGTA CTAA TGCTTAAGCTCGAGCCA TGGCG AAXAAACCATAC CC SAGGAG T TATG AAG CCGTAC GAATG GACC GAC TAGATSCT -1 3' Pol 7: 5' 1211Iz primer 121 1z Primer 1233 Primer D Fo#ward TATA D Reverse' TATA : template: D Forward TATA D Reverse' TATA _ + -1 - + + - 4+ + - a-amanitin : _ + -II - +t + - +4 + - + + - _-_ : tagetitoxin: - transcription products *..:P ...@.