Apresentação Do Powerpoint

UNIVERSIDADE FEDERAL DO RIO GRANDE DO NORTE CENTRO DE BIOCIÊNCIAS PROGRAMA DE PÓS-GRADUAÇÃO EM SISTEMÁTICA E EVOLUÇÃO

VARIABILIDADE FENOTÍPICA E GENOTÍPICA DO CAMARÃO Macrobrachium jelskii (MIERS, 1877) DAS BACIAS DO NORDESTE BRASILEIRO: UMA ABORDAGEM DE SISTEMÁTICA INTEGRATIVA

SÁVIO ARCANJO SANTOS NASCIMENTO DE MORAES ______Dissertação de Mestrado Natal/RN, fevereiro de 2017

SÁVIO ARCANJO SANTOS NASCIMENTO DE MORAES

Variabilidade fenotípica e genotípica do camarão Macrobrachium jelskii (Miers, 1877) das Bacias do Nordeste Brasileiro: uma abordagem de sistemática integrativa

Dissertação apresentada ao Programa de Pós- graduação em Sistemática e Evolução da Universidade Federal do Rio Grande do Norte como requisito parcial para obtenção do título de Mestre em Sistemática e Evolução.

Orientador: Fúlvio Aurélio Morais Freire. Coorientador: Sérgio Maia Queiroz Lima.

Natal, 2017

Universidade Federal do Rio Grande do Norte - UFRN Sistema de Bibliotecas - SISBI Catalogação de Publicação na Fonte. UFRN - Biblioteca Setorial do Centro de Biociências - CB

Moraes, Sávio Arcanjo Santos Nascimento de. Variabilidade fenotípica e genotípica do camarão Macrobrachium jelskii (Miers, 1877) das Bacias do Nordeste Brasileiro: uma abordagem de sistemática integrativa / Sávio Arcanjo Santos Nascimento de Moraes. - Natal, 2017. 96 f.: il.

Dissertação (Mestrado) - Universidade Federal do Rio Grande do Norte. Centro de Biociências. Programa de Pós-Graduação em Sistemática e Evolução. Orientador: Prof. Dr. Fúlvio Aurélio Morais Freire. Coorientador: Prof. Dr. Sérgio Maia Queiroz Lima.

1. Camarão-sossego - Dissertação. 2. Invasão - Dissertação. 3. Decapoda - Dissertação. 4. Plasticidade fenotípica - Dissertação. 5. Coamplificação - Dissertação. I. Freire, Fúlvio Aurélio Morais. II. Lima, Sérgio Maia Queiroz. III. Universidade Federal do Rio Grande do Norte. IV. Título.

RN/UF/BSE-CB CDU 595.371

SÁVIO ARCANJO SANTOS NASCIMENTO DE MORAES

Variabilidade fenotípica e genotípica do camarão Macrobrachium jelskii (Miers, 1877) das Bacias do Nordeste Brasileiro: uma abordagem de sistemática integrativa

Aprovada em 21 de fevereiro de 2017.

BANCA EXAMINADORA:

______Dr. Fúlvio Aurélio de Morais Freire Universidade Federal do Rio Grande do Norte (Orientador)

______Dra. Renata Akemi Shinozaki Mendes Universidade Federal Rural de Pernambuco

______Dra. Luciana Segura Andrade Universidade Federal do Triângulo Mineiro

Natal, 2017

AGRADECIMENTOS

Aos meus pais por acreditarem e apoiarem nesta caminhada acadêmica e me alimentarem mesmo comprometendo o orçamento da família. Aos professores Fúlvio Freire e Sérgio Lima (Prof. Xérxis) pela confiança, desempenho na orientação acadêmica e pela amizade. Ao meu amor Valéria Vale por acreditar, por vezes mais do que eu, na minha capacidade de continuar nesta empreitada e por não me abandonar nesta vida de muito trabalho e pouco dinheiro. À galera do Laboratório de Fauna Aquática pelo “conversadeiro de m...” diário, pelo apoio em laboratório e em campo. Em especial, a tia Anastacia (Roney), Walmir (Waldir), Lucianus marmoratus (Luciano), Jebis (Mateus Germano), Telton e Cadu Guedes (Carlos Eduardo, famoso Cadu) por arriscarem suas vidas, adquirirem dermatites incuráveis, viajando e coletando por esse Nordeste “velho de guerra”. Aos demais integrantes do Laboratório de Fauna Aquática, Espirito Inquieto (Matheus Arthur), Veiuda (Thaís), Demônio Daltônico (Bruna), Dr. Márcio, Carol Tupan (Carol Puppin), Carol Alimentos (Ana Carolina Xavier), Boy Ni Ni (Nielson), Flávia Peter Pan (Flávia Petean), Silvia Yasmin, Luquinhas, Boquinha de Hypostomus (Nathalia) e Aninha, por tornar o laboratório um ambiente alegre e descontraído, muitas vezes até de mais. À alguns colegas da pós-graduação e do laboratório que me ensinaram o que é uma atitude não profissional e o verdadeiro significado de ser otário. Obrigado por me ensinar não ser como vocês. Não quero citar nomes... rsrsrsrs... Às personalidades singulares “Índio Janduís”, “Minha mãe é uma pilantrinha” e ao Guia, autor das estórias de “Jú Cascata” e “Arara e Ipê” por propiciarem momentos de raiva e descontração durante nossas viagens de Kombi. À Empresa “PC Rent a Car” por fornecer uma Kombi confortável, arrejada, com sistema de direção remoto (o volante até sai), freios ABS e pintura temática (adesivagem tosca). Na verdade, aqui não é realmente um agradecimento, é puro sarcasmo. Ao Bar do Thomas e Bar do Pedrão por fornecer cerveja, às vezes gelada, kits (cachaça 51, Pepsi e limão) e um lugar “confortável” para promover discussões enriquecedoras sobre ecologia e biologia, arriação e alteração com direto a briga de bar e tudo mais. Em especial, à “Galega do Thomas” por transbordar toda sua doce ignorância ao servir nossas mesas.

Aos “cara”, Kavera (Igor), Sérgio (Sérgio), Pedrinho (Pedro), Beiço (Gabriel) e Robson (in memoriam), por estarem sempre por perto pra beber e falar sobre assuntos aleatórios da vida. Em especial, à Sergeta (Sérgio) pelo empenho no serviço de tradução. Aos colegas de graduação que nunca pederam os laços afetivos, agradeço o carinho e atenção em mandar mensagem no WhatsApp, mesmo eu demorando semanas para responder. Ao pior cachorro do mundo, Loki, e a melhor cadela do mundo, Mel, por zelarem pela segurança do seu dono e da casa nas madrugadas que seu dono pegava no sono escrevendo e a casa “dormia” de portas abertas. Aos crustáceos que habitam meu aquário, Eriphia gonagra, Clibanarius sclopetarius, Clibanarius antillensis, Calcinus tibicen, Alpheus buckupi, Hepatus gronovii e Palaemon spp., por segurar minha atenção por horas e ver o quão interessante é o mundo dos crustáceos. Ao álcool, às vezes o da bancada serve, por procipiar o “desestresse”. À cafeína e taurina por tentar me manter acordado nas “madrugas” de escrita de artigo e ‘deadlines’. À Deus por promover a estocasticidade durante minha vida.

OBRIGADO A TODOS!!!

SUMÁRIO 1. INTRODUÇÃO GERAL ...... 8 1.1.Nordeste ...... 8 1.2.Crustacea ...... 9 1.3.Região Neotropical e a Sistemática Integrativa ...... 11 REFERÊNCIAS ...... 13 2. CAPÍTULO I - INTRA- AND INTERSPECIFIC VARIATION RELATED TO SHAPE: ECO-EVOLUTIONARY ASPECTS OF FRESHWATER PRAWN Macrobrachium jelskii (MIERS, 1877) (PALAEMONIDAE: DECAPODA) IN DRAINAGES IN BRAZILIAN NORTHEAST ...... 21 2.1.INTRODUCTION ...... 22 2.2.MATERIAL AND METHODS...... 25 2.2.1. Sampling ...... 25 2.2.2. Geometric morphometric analysis ...... 26 2.3.RESULTS ...... 28 2.4.DISCUSSION ...... 30 REFERENCES ...... 35 TABLES ...... 47 FIGURES ...... 52 3. CAPÍTULO II - EVIDÊNCIA GENÉTICA DE INTRODUÇÃO DO CAMARÃO Macrobrachium jelskii (MIERS, 1877) (CARIDEA: PALAEMONIDAE) NAS BACIAS DO NORDESTE BRASILEIRO E A IMPLICAÇÃO DE PSEUDOGENES MITOCONDRIAIS EM ESTUDOS MOLECULARES DE CRUSTÁCEOS ...... 64 3.1.INTRODUÇÃO ...... 66 3.2.MATERIAL E MÉTODOS ...... 69 3.2.1. Coleta de dados ...... 69 3.2.2. Extração, amplificação e verificação das sequências de DNA ...... 69 3.2.3. Inferência filogenética e estruturação genética ...... 72 3.3.RESULTADOS ...... 72 3.4.DISCUSSIÃO ...... 74 REFERÊNCIAS ...... 78 TABELAS ...... 88 FIGURAS ...... 92

RESUMO

Macrobrachium jelskii é uma espécie de ampla distribuição no nordeste brasileiro, e ocorrendo em toda América do Sul. Contudo, nenhum estudo acerca a filogeografia, variações morfológicas locais e variabilidade genética das populações desta espécie foi efetuado. Esta espécie de camarão, pode revelar informações importantes sobre o padrão de dispersão e vicariantes correlatos à cenários de arranjos tectônicos pretéritos e outros eventos que possam ter influenciado a biogeografia dos taxa aquático. Portanto, o presente trabalho tem como objetivo investigar a diversidade fenotípica e molecular das populações do camarão Macrobrachium jelskii, nas ecorregiões Nordeste Médio Oriental, Maranhão Piauí e São Francisco, frente a influência de cenários pretéritos e respostas ambientais locais. Este trabalho utilizou uma abordagem de Sistemática integrativa, a morfometria geométrica multivariada, análises filogenéticas e de estruturação genética. A morfometria geométrica, revelou dimorfismo sexual evidente, em que fêmeas apresentaram cefalotórax e abdômen mais estirados horizontalmente. Isto, possivelmente, favorece o desenvolvimento gonadal, vitelogênese e armazenamento dos ovos. Abstração da forma dos três planos corporais não demostrou um consenso acerca da estruturação das populações entre de M. jelskii no Nordeste Brasileiro. Tal fato corrobora com a baixa diversidade nucleotídica e haplotípica, em que foi relatado apenas um haplótipo compartilhado entre as populações das bacias. Assim, ratificando a possibilidade de introdução da espécie nos corpos d’água do Nordeste pelo DNOCS. Em adição, os dados genéticos relataram a presença de ruídos e picos duplos no eletroferograma, que representa co-amplificação de pseudogenes mitocondriais da região Citocromo Oxidase I, pouco relatadas na literatura para o gênero Macrobrachium. Este fato abre um precedente de desconfiança para relações filogenéticas e filogeográficas publicadas, recentemente que não retratam isto. Sabendo que esta característica pode gerar uma superestimação de linhagens evolutivas e, assim, conclusões errôneas sobre eventos dispersivos, vicariantes ou de especiação, se faz de suma importância retratar os casos de pseudogenes e a utilização de iniciadores específicos para cada táxon.

Palavras-chave: camarão-sossego, invasão, Decapoda, plasticidade fenotípica, co- amplificação.

ABSTRACT

Macrobrachium jelskii is a widely distributed species in northeastern Brazil, occurring throughout South America. However, no studies on phylogeography, local morphological variations and genetic variability of the populations of this species were carried out. This prawn species can reveal important information on the dispersion pattern and related vicariates for scenarios of past tectonic arrangements and other events that have influenced the biogeography of the aquatic taxa. The aim of this manuscript is to investigate a phenotypic and molecular diversity of the prawn M. jelskii populations in the Mid-Northeast Caatinga, Maranho Piauí and São Francisco ecoregions, influenced by past scenarios and environmental local responses. This scientific article uses an approach of Integrative Systematics, a multivariate geometric morphometry, phylogenetic analyzes and genetic structuring. Geometric morphometry showed evident sexual dimorphism, in which females presented cephalothorax and abdomen more horizontally stretched. This possibly favors gonadal development, vitellogenesis and egg storage. Abstraction of the shape of the three body planes does not demonstrate a consensus on the structuring of the populations between M. jelskii in the Northeast of Brazil. This fact corroborates a low nucleotide and haplotype diversity, in which only one haplotype was shared among the populations of the basins. Thus, ratifying a possibility of introduction in the Northeast area by DNOCS. In addition, the genetic data reported a presence of noises and double peaks not electropherogram, which represents co-amplification of mitochondrial pseudogenes of the region Cytochrome Oxidase I, little reported in the literature for the genus Macrobrachium. This fact show a precedent of mistrust for published phylogenetic and phylogeographic relationships, which recently did not depict this. Knowing that this characteristic can generate an overestimation of evolutionary lineages and, thus, erroneous conclusions on dispersive, vicarious or speciation events, it is of importance to report the cases of pseudogenes and the use of specific molecular primers for each taxon.

Keywords: agar river prawn, invasion, Decapoda, phenotypic plasticity, co- amplification.

1. INTRODUÇÃO GERAL

1.1.Nordeste

Os ecossistemas aquáticos continentais estão entre os mais ameaçados do mundo por ações antrópicas (i. e. destruição de hábitats, sobreexplotação, modificações dos cursos d’água, introdução de espécies exóticas, poluição, etc) (LÉVÊQUE; BALIAN; MARTENS, 2005; LÉVÊQUE et al., 2008; NOGUEIRA et al., 2010). Embora os ecossistemas aquáticos continentais estejam em rápido declínio, estudos recentes demonstraram que a biodiversidade dulcícola vem sendo negligenciada pelas avaliações de conservação (NOGUEIRA et al., 2010) e apresentam baixa prioridade em iniciativas conservacionistas (LÉVÊQUE; BALIAN; MARTENS, 2005). O clima semi-árido e ao regime intermitente, foram os fatores reportados como dificuldade para a estimar a biodiversidade aquática do bioma Caatinga, sendo negligenciado até os dias hodiernos, mas estudos tem revelado uma riqueza moderadamente alta para diversos taxa, com uma grande proporção de endemismo (GIARETTA; AGUIAR, 1998; GOLDANI; CARVALHO; BICCA-MARQUES, 2006; HADDAD; ABE, 1999; MMA, 2007; NANIWADEKAR; VASUDEVAN, 2007; ROSA et al., 2004). Contudo, a diversidade biológica, estado de conservação e a biogeografia dos animais aquáticos da Caatinga ainda é incipiente (LÉVÊQUE; BALIAN; MARTENS 2005; LÉVÊQUE et al., 2008 ROSA et al., 2004). O Nordeste brasileiro é constituído pelas ecorregiões Marinhão-Piauí, Nordeste Médio-Oriental e São Franscisco, predominantemente (ALBERT; REIS, 2011). A ecorregião hidrográfica do Maranhão-Piauí, abrange o rio Parnaíba e bacias costeiras menores associadas, na zona de transição entre a Caatinga e o Cerrado (ROSA; GROTH, 2004). A ecorregião hidrográfica do Nordeste Médio Oriental, que compreende as bacias costeiras entre os rios Parnaíba e a bacia do rio São Francisco, abrangendo os rios Jaguaribe, Piranhas-Açú, Apodi-Mossoró, Mamanguape, Paraíba do Norte, Capibaribe e Beberibe (LANGEANI et al., 2009). A ecorregião hidrográfica do rio São Francisco, compreende toda a área de influência da bacia hidrográfica do São Franscisco, com maior parte de sua abrangência no Nordeste; e as bacias costeiras localizadas entre a desembocadura do rio São Francisco e o sul da Bahia (LANGEANI et al., 2009). As principais bacias que compreendem a região hidrográfica do Nordeste Médio Oriental são

as dos rios Jaguaribe, Piranhas-Assú, Mamanguape, Paraíba, Capibaribe e Beberibe (LANGEANI et al., 2009).

1.2.Crustacea

A precariedade de informação resulta em uma exclusão de espécies desta região em estudos filogeográficos das grandes bacias hidrográficas da América do Sul. Deste modo, há poucos estudos que possuem dados filogenéticos abrangendo representantes da ictiofauna continental do Nordeste, e não há nenhum trabalho filogeográfico com taxa aquáticos das bacias da região, quadro semelhante com outros táxons da caatinga (TURCHETTO-ZOLET et al., 2012). A resolução das relações filogenéticas das espécies endêmicas seria uma ferramenta crucial para o entendimento das relações biogeográficas da região (ROSA; GROTH, 2004). Escassez de estudos que abordem tais relações é notória para crustáceos no Nordeste brasileiro, principalmente para os membros mais representativos como a Infraordem Decapoda. Estes desempenham papeis importantes para processos ecológicos em ambientes aquáticos, atuando em diferentes níveis na cadeia (consumidores e decompositores), bem como as mais variadas funcionalidades ao meio ambiente (BEISSINGER; THOMAS; STRAHL, 1988; BENETTON; ROSA; COLARES, 1990; GOULDING; FERREIRA, 1984; MAGNUSSON; DA SILVA; LIMA, 1987; WALKER, 1987, 1990). Além do mais, estudos recentes demonstraram que decápodes de água doce são importantes modelos para estudos para retratar padrões biogeográficos e filogenéticos e, assim elucidar eventos geológicos influentes sobre a diversificação biológica (CUMBERLIDGE, 2008; CUMBERLIDGE; STERNBERG; DANIELS, 2008; CUMBERLIDGE; NG, 2009; DANIELS et al., 2006; YEO; TAN; NG, 2008). A ordem Decapoda é a maior entre os crustáceos, com aproximadamente 15.000 espécies sendo que apenas em torno de 20% são de água doce, sendo contabilizadas 767 espécies de camarõs, 634 espécies de lagostins, 1485 de caranguejos e 69 de aeglídeos (BOND-BUCKUP et al., 2008; BOWMAN; ABELE, 1982; CRANDALL; BUHAY, 2008; DE GRAVE; CAI; ANKER, 2008; DE GRAVE et al., 2009; DE GRAVE; FRANSEN, 2011; YEO; TAN; NG, 2008). Dentre estes os camarões os podemos citar a família Palaemonidae pela forte representatividade da transição do ambiente marinho ao ambiente dulcícola por crustáceos decápodes (VOGT, 2012), por sua distribuição

cosmopolita, exceto Antártida (DE GRAVE; CAI; ANKER, 2008), e por ser o segundo táxon mais especioso dos camarões Pleocyemata (DE GRAVE; FRANSEN, 2011). Os camarões palaemonídeos de água doce apresetam uma plasticidade no desenvolvimento larval, variando de um estágio prolongado dependente do ambiente marinho a um desenvolvimento abreviado parcialmente ou independente do ambiente marinho (JALIHAL; SANKOLLI; SHENOY, 1993; KNOWLTON; VARGO, 2004). Tal caráter tem sido bastante investigado, sendo um aparente modulador dos processos pretéritos de dispersão e vicariância das linhagens evolutivas (JALIHAL; SANKOLLI; SHENOY, 1993; MEJÍA; ALVAREZ; HARTNOLL, 2003; PEREIRA; GARCÍA, 1995). Dentre os palaemonídeos os gêneros mais especiosos são Macrobrachium Spence Bates, 1868 (243 espécies), Palaemon Weber, 1795 (41) e Palaemonetes Heller, 1869 (31) (DE GRAVE et al., 2009; DE GRAVE; FRANSEN, 2011). Assim, destaca-se o gênero Macrobrachium com maior número de eventos isolamento geográfico em sua distribuição pan-tropical, principalmente nas Américas (DE GRAVE et al., 2009). Sua distribuição abrange uma ampla gama de habitats, de ambiente costeiros a água doce, incluindo lagoas costeiras, estuários e nascentes de rios (JALIHAL; SANKOLLI; SHENOY, 1993, PEREIRA; GARCÍA, 1995). Isto revela uma impressionante característica de adaptabilidade a flutuações de salinidade e abreviação do estágio larval. Esta tendência é menos pronunciada em alguns representantes marinhos costeiros, como os gêneros Palaemon e Palaemonetes. A maioria das espécies de água doce destes géneros Desenvolver através de mais de cinco e três larvas Estágios, respectivamente (FALCIAI; PALMERINI, 2002; KNOWLTON; VARGO, 2004). Por exemplo, espécies de água salobra e de água doce possuem desenvolvimento larval em torno de 10 a 11 estágios larvais (CAVALLO; LAVENS; SORGELOOS, 2001), e espécies confinados a montantes de ambientes dulcícolas demostram desenvolvimento abreviado entre 1 a 5 estágios larvais (JALIHAL; SANKOLLI; SHENOY, 1993; KARGE; KLOTZ, 2008; PEREIRA; GARCÍA, 1995). Shokita et al. (1991) lista apenas 13 espécies de Macrobrachium com ciclo de desenvolvimento larval abreviado. Há evidências de que está característica tenha evoluído pelo menos nove vezes nas linhagens da América do Sul, Austrália e Ásia (MURPHY; AUSTIN, 2005; WOWOR et al., 2009). Dentre estas espécies, destaca-se a espécie Macrobrachium jelskii (Miers, 1877) com apenas 3 estágios larvais (GAMBA, 1980, 1984, 1997; MAGALHÃES, 2000; PAIVA; BARRETO, 1960).

A espécie Macrobrachium jelskii, vulgamente conhecida por camarão sossego, foi descrito inicialmente como Palaemon jelskii, coletado em expedição ao Rio Oyapock (Oiapoque) pelo naturalista Konstanty Jelski em 1965 na localidade-tipo no rio Oyapock/Saint-Georges (Oiapoque), Guiana Francesa (MIERS, 1877). Esta espécie tem distribuição sulamericana (COELHO; RAMOS-PORTO, 1985; MAGALHÃES et al., 2005; MELO, 2003; RODRÍGUEZ, 1981), mas questionável. Uma pequena miríade de trabalhos defende que a distribuição natural de M. jelskii para as bacias do rio Amazonas e Orinoco (BASTOS; PAIVA, 1959; COLLINS, 2000; HOLTHUIS, 1950, 1966). Contudo há evidências de introdução pelo Departamento de Obras Contra a Seca (DNOCS) (GURGEL; OLIVEIRA, 1987). Outros congêneres apresentam distribuições geográficas extensas na América do Sul, demostraram estruturação genética entre clados bacias costeiras e continentais, mas com baixas distâncias gênica entre grupos (CARVALHO; PILEGGI; MANTELATTO, 2013; VERGAMINI; PILEGGI; MANTELATTO, 2011).

1.3.Região Neotropical (fonte de diversificação biológica) e a Sistemática Integrativa

A região Neotropical engloba a América do Sul comporta a maior biodiversidade da terra, e contém cinco dos hot spots de biodiversidade mundiais (MYERS et al., 2000). Tal diversidade pode explicado pelas características de relevo, em que 50% de sua área inferior a 250m de altitude (ALBERT; REIS, 2011). Isto pode ter favorecido, maior exposição da plataforma continental durante as incursões e regressões marinhas sucessivas em cenários (últimos 120 milhões de anos), sendo estes acontecimentos influentes na atual diversidade e distribuição das linhagens de organismo aquáticos continentais (ALBERT; REIS, 2011; VERA-SILVA; CARVALHO; MANTELATTO, 2016). Esta região apresenta, também, vários indícios de atividade geológica frequente, que, ao longo do tempo, promoveu permuta da fauna aquática entre bacias hidrográficas independentes por meio de eventos de capturas de cabeceiras. Assim, aumentam a riqueza de espécies aquáticas, permitem a mistura de linhagens isoladas, promovendo novas rotas de dispersão e colonização de populações (MENEZES et al., 2008). Estes dois eventos, flutuações do nível do mar e capturas de cabeceiras, atuaram na interface de eventos de vicariância e dispersão, e foram possivelmente os principais eventos responsáveis pela

diversificação de peixes neotropicais (ALBERT; CARVALHO, 2011), assim podem servir de modelo para outras taxa aquáticas como os crustáceos. Ressaltando a diversidade e a escala de processos históricos e ecológicos relacionados à sua formação, o entendimento das origens e atuais padrões de distribuição e diversificação dos organismos aquáticos neotropicais necessita de informações advindas das mais variadas áreas de concentração de estudo como ecologia, geomorfologia, geologia paleoclimática e paleoambiental, sistemática filogenética, entre outras, ou seja, uma abordagem de sistemática integrativa (ALBERT; REIS, 2011). Esta abordagem multidisciplinar, seguem uma tendência de estudos de biodiversidade e conservação, na tentativa de entender a história evolutiva e manutenção dos processos presentes responsáveis pela diversificação (BOWEN, 1999). Mudanças climáticas e glaciações, assim como eventos de oscilação no nível do mar têm afetado este continente, criando cenários de isolamento, refúgio, expansão e dispersão, influentes na diversificação das espécies (ANTONELLI; SANMARTIN, 2011; BEHLING, 2002). O conceito “sistemática integrativa”, tenta unir abordagens ecológicas, moleculares e morfológicas na determinação de linhagens evolutivas, e auxiliar a entendimento dos processos que favorecem a diversificação biológica (DAYRAT, 2005; PADIAL et al., 2010). Esta abordagem tem sido utilizada no estudo de áreas pouco conhecidas, na descoberta de espécies crípticas e na avaliação da plasticidade fenotípica (TAN et al., 2009). A variação fenotípica é resultado da interação de processos históricos (expressão gênica) e ecológicos (influencia ambiental) que podem regular a fixação de caracteres fenotípicos (MULLEN et al., 2009). Processos determinísticos mediados pela seleção natural e processos estocásticos (deriva gênica) podem favorecer a manutenção ou eliminar variações de traços fenotípicos (CLEGG; PHILIMORE, 2010). Contudo, esta relação também é influenciada pelo grau de conectividade entre as populações ou linhagens, isto é, o fluxo gênico é também modulador da plasticidade fenotípica (MULLEN et al., 2009). Entretanto, tal variação pode ser gerada por respostas morfológicas às condições ambientais contemporâneas, ontogenia e/ou dimorfismo sexual inerente ao táxon, que não necessariamente representa mudanças na frequência de alelos (PFENING et al., 2010). Uma das maneiras de verificar a variações fenotípicas, especialmente morfológicas, são por meio da abstração das variações na forma do corpo, úteis na avaliação de processos ecológicos e fatores ambientais influentes na diversificação inter

e intraespecífica de linhagens. Aspectos ecológicos como composição de dieta, (WAGNER et al., 2009), pressões de predação (LANGERHANS; DEWITT, 2004), composição de comunidades, fluxo de água (LANGEHANS, 2008; SAMPAIO; PAGOTTO; GOULART, 2013), temperatura (SIDLAUSKAS; CHERNOFF; MACHADO-ALLISON, 2006); oxigênio dissolvido na água (CRISPO; CHAPMAN, 2011), entre outros, já se mostraram influentes quanto a variação da forma. A distribuição geográfica de uma determinada espécie é regulada em função da sua ecologia, demografia histórica e padrões de dispersão, que podem ser muitas vezes elucidados através da biogeografia molecular (AVISE, 2000). Uma ferramenta para investigar os processos e padrões históricos que regularam a diversificação das linhagens é a filogeografia (AVISE, 2000). Esta abordagem parece ainda mais interessante quando utilizada com organismos nas quais as populações tem seu potencial dispersivo vinculadas ao meio que vivem, e este é o caso dos peixes de água doce (ALBERT; REIS, 2011) bem como crustáceos. Visto que estes organismos, quase que, obrigatoriamente necessitam da conexão entre as drenagens para que ocorra dispersão (JONES; JOHNSON, 2009), e assim a distribuição de linhagens, permite inferências sobre eventos pretéritos de uma determinada região. Através de uma abordagem sistemática integrativa será possível compreender os padrões de dispersão, relações filogeograficas dessa espécie no Nordeste do Brasil, frente as conexões pretéritas entre as bacias, e suas respectivas relações com o clima e geomorfologia da região, ou eventos antrópicos que promoveram a mistura entre espécies e linhagens filogenéticas, bem como investigar o plasticidade fenotípica e correlacionar com os fatores que podem ter influenciado variações na abstração das populações de M. jelskii.

REFERÊNCIAS

ALBERT, J. S.; REIS, R. E. Introduction to Neotropical freshwaters. Historical biogeography of neotropical freshwater fishes, p. 3-19, 2011. ANTONELLI, Alexandre; SANMARTÍN, Isabel. Why are there so many plant species in the Neotropics?. Taxon, v. 60, n. 2, p. 403-414, 2011. AVISE, John C. Phylogeography: the history and formation of species. Harvard university press, 2000.

BASTOS, J. A. M.; PAIVA, M. P. Notas sobre o consumo de oxigênio do camarão ‘sossêgo’, Macrobrachium jelskii (Miers, 1877) Chace & Holthuis, 1948. Revista Brasileira de Biologia, v. 19, n. 4, p. 413-419, 1959. BEHLING, Hermann. South and southeast Brazilian grasslands during Late Quaternary times: a synthesis. Palaeogeography, Palaeoclimatology, Palaeoecology, v. 177, n. 1, p. 19-27, 2002. BEISSINGER, Steven R.; THOMAS, Betsy Trent; STRAHL, Stuart D. Vocalizations, food habits, and nesting biology of the slender-billed kite with comparisons to the snail kite. The Wilson Bulletin, p. 604-616, 1988. BENETTON, M. L. F. M.; ROSAS, F. C. W.; COLARES, E. P. Aspectos do hábito alimentar da ariranha (Pteronura brasiliensis) na Amazônia brasileira. Programa y Resumenes, 4ª Reunión de Trabajo de Especialistas en Mamiferos Acuaticos de America del Sur, Valdivia, Chile, p. 12-15, 1990. BOND-BUCKUP, Georgina et al. Global diversity of crabs (Aeglidae: Anomura: Decapoda) in freshwater. Hydrobiologia, v. 595, n. 1, p. 267-273, 2008. BOWEN, Brian W. Preserving genes, species, or ecosystems? Healing the fractured foundations of conservation policy. Molecular ecology, v. 8, n. s1, 1999. BOWMAN, THOMAS E.; ABELE, LAWRENCE G. Classification of the recent Crustacea. The biology of Crustacea, v. 1, p. 1-27, 1982. CARVALHO, Fabrício L.; PILEGGI, Leonardo G.; MANTELATTO, Fernando L. Molecular data raise the possibility of cryptic species in the Brazilian endemic prawn Macrobrachium potiuna (Decapoda, Palaemonidae)/Datos moleculares sugieren la presencia de una especie críptica del camarón endémico brasileño Macrobrachium potiuna (Decapoda, Palaemonidae). Latin American Journal of Aquatic Research, v. 41, n. 4, p. 707, 2013. CAVALLO, Ronaldo O.; LAVENS, Patrick; SORGELOOS, Patrick. Reproductive performance of Macrobrachium rosenbergii females in captivity. Journal of the World Aquaculture Society, v. 32, n. 1, p. 60-67, 2001. CLEGG, Sonya M.; PHILLIMORE, Albert B. The influence of gene flow and drift on genetic and phenotypic divergence in two species of Zosterops in Vanuatu. Philosophical Transactions of the Royal Society of London B: Biological Sciences, v. 365, n. 1543, p. 1077-1092, 2010.

COELHO, Petrônio Alves; RAMOS-PORTO, Marilena. Camarões de água doce do Brasil: distribuição geográfica. Revista Brasileira de Zoologia, v. 2, n. 6, p. 405-410, 1985. COLLINS, Pablo A. Macrobrachium jelskii (Miers, 1877). Crustaceana, v. 73, n. 9, p. 1167-1169, 2000. CRANDALL, Keith A.; BUHAY, Jennifer E. Global diversity of crayfish (Astacidae, Cambaridae, and Parastacidae––Decapoda) in freshwater. Hydrobiologia, v. 595, n. 1, p. 295-301, 2008. CRISPO, Erika; CHAPMAN, Lauren J. Hypoxia drives plastic divergence in cichlid body shape. Evolutionary Ecology, v. 25, n. 4, p. 949-964, 2011. CUMBERLIDGE, Neil. Insular species of Afrotropical freshwater crabs (Crustacea Decapoda: Brachyura: Potamonautidae and Potamidae) with special reference to Madagascar and the Seychelles. Contributions to Zoology, v. 77, n. 2, 2008. CUMBERLIDGE, Neil; VON STERNBERG, Richard M.; DANIELS, Savel R. A revision of the higher taxonomy of the Afrotropical freshwater crabs (Decapoda: Brachyura) with a discussion of their biogeography. Biological Journal of the Linnean Society, v. 93, n. 2, p. 399-413, 2008. CUMBERLIDGE, Neil; NG, PETER KL. Systematics, evolution, and biogeography of freshwater crabs. In: Decapod crustacean phylogenetics. CRC Press, 2009. p. 491-508. DANIELS, Savel R. et al. Evolution of Afrotropical freshwater crab lineages obscured by morphological convergence. Molecular Phylogenetics and Evolution, v. 40, n. 1, p. 227-235, 2006. DAYRAT, Benoit. Towards integrative taxonomy. Biological journal of the Linnean society, v. 85, n. 3, p. 407-415, 2005. DE GRAVE, S.; CAI, Y.; ANKER, A. Global diversity of shrimps (Crustacea: Decapoda: Caridea) in freshwater. Hydrobiologia, v. 595, n. 1, p. 287-293, 2008. DE GRAVE, Sammy et al. A classification of living and fossil genera of decapod crustaceans. Raffles Bulletin of Zoology, p. 1-109, 2009. DE GRAVE, Sammy; FRANSEN, C. H. J. M. Carideorum catalogus: the recent species of the Dendrobranchiate, Stenopodidean, Procarididean and Caridean shrimps (Crustacea: Decapoda). Zoologische Mededelingen, v. 85, p. 195, 2011. FALCIAI, L.; PALMERINI, E. Larval development of the freshwater shrimp, Palaemonetes antennarius (H. Milne Edwards, 1837) (Decapoda, Palaemonidae) reared in the laboratory. Crustaceana, v. 74, n. 11, p. 1315-1333, 2002.

GIARETTA, Ariovaldo A.; AGUIAR JR, Odair. A new species of Megaelosia from the Mantiqueira Range, Southeastern Brazil. Journal of Herpetology, p. 80-83, 1998. GOLDANI, A.; CARVALHO, G. S.; BICCA-MARQUES, J. C. Distribution patterns of Neotropical primates (Platyrrhini) based on Parsimony Analysis of Endemicity. Brazilian Journal of Biology, v. 66, n. 1A, p. 61-74, 2006. GURGEL, J. J. S.; OLIVEIRA, A. B. Efeitos da introdução de peixes e crustáceos no semi-árido do nordeste brasileiro. ESAM, 1987. HADDAD, C. F. B.; ABE, A. S. Anfíbios e répteis. In: Workshop Mata Atlântica e Campos Sulinos. Conservation International do Brasil. Fundação Biodiversitas, Fundação SOS Mata Atlântica, Instituto de Pesquisas Ecológicas, Secretarias do Meio Ambiente de São Paulo e Minas Gerais. Disponível em:< http://www. conservation. org. br/ma/rp_anfib. htm>. Acesso em: 2 de janeiro de 2017. 1999. p. 2003. HOLTHUIS, Lipke Bijdeley. The Decapoda of the Siboga Expedition: Pt. 10: the Palaemonidae Collected by the Siboga and Snellius Expeditions with Remarks on Other Species: 1: Subfamily Palaemoninae. Brill, 1950. HOLTHUIS, L. B. A collection of freshwater prawns (Crustacea Decapoda, Palaemonidae) from Amazonia, Brazil, collected by Dr. G. Marlier. 1966. JALIHAL, D. R.; SANKOLLI, K. N.; SHENOY, Shakuntala. Evolution of larval developmental patterns and the process of freshwaterization in the prawn genus Macrobrachium Bate, 1868 (Decapoda, Palaemonidae). Crustaceana, v. 65, n. 3, p. 365- 376, 1993. JONES, Carissa P.; JOHNSON, Jerald B. Phylogeography of the livebearer Xenophallus umbratilis (Teleostei: Poeciliidae): glacial cycles and sea level change predict diversification of a freshwater tropical fish. Molecular Ecology, v. 18, n. 8, p. 1640- 1653, 2009. KARGE, Andreas; KLOTZ, Werner. Süßwassergarnelen aus aller Welt [Fresh water shrimps of the world]. 2. ed. Auflage, (Dähne Verlag) Ettlingen, 2008. 216 p. KNOWLTON, Robert E.; VARGO, Carol K. The larval morphology of Palaemon floridanus Chace, 1942 (Decapoda, Palaemonidae) compared with other species of Palaemon and Palaemonetes. Crustaceana, v. 77, n. 6, p. 683-715, 2004. LANGEANI, F. et al. Peixes de água doce. Rocha, RM, Boeger WAP. Estado da Arte e perspectivas para a Zoologia no Brasil. Curitiba, Paraná: Editora da UFPR, 2009.

LANGERHANS, R. Brian; DEWITT, Thomas J. Shared and unique features of evolutionary diversification. The American Naturalist, v. 164, n. 3, p. 335-349, 2004. LANGERHANS, R. Brian. Predictability of phenotypic differentiation across flow regimes in fishes. Integrative and Comparative Biology, v. 48, n. 6, p. 750-768, 2008. LÉVÊQUE, Christian; BALIAN, E. V.; MARTENS, K. An assessment of animal species diversity in continental waters. In: Aquatic Biodiversity II. Springer Netherlands, 2005. p. 39-67. LEVÊQUE, Christian et al. Global diversity of fish (Pisces) in freshwater. Hydrobiologia, v. 595, n. 1, p. 545-567, 2008. MAGALHÃES, Célio et al. Exotic species of freshwater decapod crustaceans in the state of São Paulo, Brazil: records and possible causes of their introduction. Biodiversity and Conservation, v. 14, n. 8, p. 1929-1945, 2005. MAGNUSSON, William E.; DA SILVA, Eduardo Vieira; LIMA, Albertina P. Diets of Amazonian crocodilians. Journal of Herpetology, p. 85-95, 1987. MEJÍA, Luis M.; ALVAREZ, Fernando; HARTNOLL, Richard G. A new species of freshwater prawn, Macrobrachium totonacum (Decapoda, Palaemonidae), with abbreviated development from Mexico. Crustaceana, v. 76, n. 1, p. 77-86, 2003. MELO, G. A. S. Famílias Atyidae, Palaemonidae e Sergestidae. Manual de identificação dos Crustacea Decapoda de água doce do Brasil, p. 289-415, 2003. MENEZES, Naercio A. et al. Biogeography of Glandulocaudinae (Teleostei: Characiformes: Characidae) revisited: phylogenetic patterns, historical geology and genetic connectivity. Zootaxa, n. 1726, p. 33-48, 2008. MIERS, Edward John. On a Collection of Crustacea, Decapoda and Isopoda, Chiefly from South America: With Descriptions of New Genera and Species.. 1877. MMA (MINISTÉRIO DO MEIO AMBIENTE). Áreas Prioritárias para Conservação, Uso Sustentável e Repartição de Benefícios da Biodiversidade Brasileira: Atualização Portaria MMA n° 9, 23 de Janeiro de 2007. MULLEN, Lynne M. et al. Adaptive basis of geographic variation: genetic, phenotypic and environmental differences among beach mouse populations. Proceedings of the Royal Society of London B: Biological Sciences, v. 276, n. 1674, p. 3809-3818, 2009. MURPHY, Nicholas P.; AUSTIN, Christopher M. Phylogenetic relationships of the globally distributed freshwater prawn genus Macrobrachium (Crustacea: Decapoda: Palaemonidae): biogeography, taxonomy and the convergent evolution of abbreviated larval development. Zoologica Scripta, v. 34, n. 2, p. 187-197, 2005.

MYERS, Norman et al. Biodiversity hotspots for conservation priorities. Nature, v. 403, n. 6772, p. 853-858, 2000. NANIWADEKAR, Rohit; VASUDEVAN, Karthikeyan. Patterns in diversity of anurans along an elevational gradient in the Western Ghats, South India. Journal of Biogeography, v. 34, n. 5, p. 842-853, 2007. NOGUEIRA, Cristiano et al. Restricted-range fishes and the conservation of Brazilian freshwaters. PloS one, v. 5, n. 6, p. e11390, 2010. PADIAL, José M. et al. The integrative future of taxonomy. Frontiers in zoology, v. 7, n. 1, p. 16, 2010. PEREIRA, Guido A. S.; GARCÍA, José V. D. Larval development of Macrobrachium reyesi Pereira (Decapoda: Palaemonidae), with a discussion on the origin of abbreviated development in palaemonids. Journal of Crustacean Biology, p. 117-133, 1995. PFENNIG, David W. et al. Phenotypic plasticity's impacts on diversification and speciation. Trends in ecology & evolution, v. 25, n. 8, p. 459-467, 2010. RODRÍGUEZ, G. Decapoda. Aquatic biota of tropical South America, part, v. 1, p. 41-51, 1981. ROSA, Ricardo S.; GROTH, Fernando. Ictiofauna dos ecossistemas de brejos de altitude de Pernambuco e Paraíba. Brejos de Altitude em Pernambuco e Paraíba: História Natural, Ecologia e Conservação. Série Biodiversidade, v. 9, p. 201-210, 2004. ROSA Ricardo S. et al. Biota aquática: áreas e ações prioritárias para a conservação da Caatinga. In: SILVA, J. M. C.; TABARELLI, M., et al (Ed.). Biodiversidade da caatinga: áreas e ações prioritárias para a conservação. Ministério do Meio Ambiente, Universidade Federal de Pernambuco, Brasil. p.163-171, 2004. SAMPAIO, Ana Lúcia A.; PAGOTTO, João Paulo A.; GOULART, Erivelto. Relationships between morphology, diet and spatial distribution: testing the effects of intra and interspecific morphological variations on the patterns of resource use in two Neotropical Cichlids. Neotropical Ichthyology, v. 11, n. 2, p. 351-360, 2013. SHOKITA, Shigemitsu et al. Abbreviated larval development of a fresh-water prawn, Macrobrachium niphanae Shokita and Takeda (Decapoda: Palaemonidae), from Thailand. Journal of Crustacean Biology, p. 90-102, 1991. SIDLAUSKAS, Brian; CHERNOFF, Barry; MACHADO-ALLISON, Antonio. Geographic and environmental variation in Bryconops sp. cf. melanurus (Ostariophysi: Characidae) from the Brazilian Pantanal. Ichthyological Research, v. 53, n. 1, p. 24-33, 2006.

TAN, Denise SH et al. From ‘cryptic species’ to integrative taxonomy: an iterative process involving DNA sequences, morphology, and behaviour leads to the resurrection of Sepsis pyrrhosoma (Sepsidae: Diptera). Zoologica Scripta, v. 39, n. 1, p. 51-61, 2009. TURCHETTO ZOLET, A. C. et al. Phylogeographical patterns shed light on evolutionary process in South America. Molecular Ecology, v. 22, n. 5, p. 1193-1213, ‐ 2012. VERA-SILVA, Ana Luiza; CARVALHO, Fabrício L.; MANTELATTO, Fernando L. Distribution and genetic differentiation of Macrobrachium jelskii (Miers, 1877) (Natantia: Palaemonidae) in Brazil reveal evidence of non-natural introduction and cryptic allopatric speciation. Journal of Crustacean Biology, v. 36, n. 3, p. 373-383, 2016 VERGAMINI, Fernanda G. et al. Genetic variability of the Amazon river prawn Macrobrachium amazonicum (Decapoda, Caridea, Palaemonidae). Contributions to Zoology, v. 80, n. 1, p. 67-83, 2011. VOGT, Guenter. Abbreviation of larval development and extension of brood care as key features of the evolution of freshwater Decapoda. Biological Reviews, v. 88, n. 1, p. 81- 116, 2012. WAGNER, Catherine E. et al. Diet predicts intestine length in Lake Tanganyika’s cichlid fishes. Functional Ecology, v. 23, n. 6, p. 1122-1131, 2009. WALKER, Ilse. The biology of streams as part of Amazonian forest ecology. Cellular and Molecular Life Sciences, v. 43, n. 3, p. 279-287, 1987. WALKER, Ilse. Ecologia e biologia dos igapós e igarapés. Ciência Hoje, v. 11, n. 64, p. 45-53, 1990. WOWOR, Daisy et al. Evolution of life history traits in Asian freshwater prawns of the genus Macrobrachium (Crustacea: Decapoda: Palaemonidae) based on multilocus molecular phylogenetic analysis. Molecular Phylogenetics and Evolution, v. 52, n. 2, p. 340-350, 2009. YEO, D. C. J.; TAN, S. H.; NG, P. K. L. Horseshoe crabs (Phylum Arthropoda: Subphylum Chelicerata: Class Merostomata), Decapod Crustaceans (Phylum Arthropoda: Subphylum Crustacea: Order Decapoda). The Singapore Red Data Book: Threatened Plants and Animals of Singapore. 2nd edition. Nature Society, Singapore, 2008.

2. CAPÍTULO I: INTRA- AND INTERSPECIFIC VARIATION RELATED TO SHAPE: ECO-EVOLUTIONARY ASPECTS OF FRESHWATER PRAWN Macrobrachium jelskii (MIERS, 1877) (PALAEMONIDAE: DECAPODA) IN DRAINAGES IN BRAZILIAN NORTHEAST

Sávio A. S. N. Moraes 1*; Carlos E. R. D. Alencar; Sergio M. Q. Lima 2; Fúlvio A. M. Freire 1

1 Grupo de Estudos em Ecologia e Fisiologia de Animais Aquáticos, Departamento de Zoologia e Botânica, Centro de Biociências, Universidade Federal do Rio Grande do Norte 2 Laboratório de Ictiologia Sistemática Evolutiva, Departamento de Zoologia e Botânica, Centro de Biociências, Universidade Federal do Rio Grande do Norte * Correspoding author: [email protected]

Status: submetido (Journal of Zoological Systematics and Evolutionary Research)

Intra- and interspecific variation related to shape: eco-evolutionary aspects of freshwater prawn Macrobrachium jelskii (Miers, 1877) (Palaemonidae: Decapoda) in drainages in Brazilian Northeast

Sávio A. S. N. Moraes 1*; Carlos E. R. D. Alencar; Sergio M. Q. Lima 2; Fúlvio A. M. Freire 1 1 Grupo de Estudos em Ecologia e Fisiologia de Animais Aquáticos, Departamento de Zoologia e Botânica, Centro de Biociências, Universidade Federal do Rio Grande do Norte 2 Laboratório de Ictiologia Sistemática Evolutiva, Departamento de Zoologia e Botânica, Centro de Biociências, Universidade Federal do Rio Grande do Norte * Correspoding author: [email protected]

Abstract The present study aims to infer intra- and inter-population shape variations of the freshwater prawn Macrobrachium jelskii in the basins of hydrographic ecoregions of Maranho Piauí, Mid-Northeast Caatinga and São Francisco, using geometric morphometry in three body plans (cephalothorax, abdomen and cheliped). It used principal component analysis, to verify trends; discriminant function analysis, to test the sexual dimorphism and hydrodynamics; and canonical analysis, for populational differences. In regards to sexual dimorphism, females showed cephalothorax and abdomen more stretched horizontally, which possibly favors gonadal development, vitellogenesis and egg attachment. For the hydrodynamics factor, no trends were observed in morphospace. In all of the three body struture plans, no consensus was shown in morphospace on the population structure of M. jelskii in Northeast Brazil, which corroborates with the possible introduction of the species in water bodies of the region by the National Department of Works Against Drought (Departamento Nacional de Obras Contra as Secas – DNOCS). However, the cluster with the highest cophenetic correlation coefficient was evidenced to abdomen, an indirect reflection of variations of vitellogenesis in eggs, modulated by environmental factors, such as salinity, temperature and rainfall. In spite of this, a past scenario of separation of lineages by sea level fluctuations cannot be discarded

Keywords: phenotypic plasticity, sexual dimorphism, hydrodynamics, agar river prawn, Palaemonidae.

2.1.INTRODUCTION

To understand nuances between ecology and evolution at various levels, or "eco- evolutionary dynamics", is to understand influential processes on diversity, communities and complexity of ecosystems (dynamics and their interactions) (POST; PALKOVACS, 2009). An approach that links the functionality of the species within the environment with the plasticity of its characters allows to infer adaptive radiations (CALSBEEK; SMITH; BARDELEBEN, 2007; GRANT, 1986; LOSOS, 1994; SCHLUTER, 2001). Some examples of this are "eco-evolutionary" indicators of short and/or long time scale, such as intra-population variations of sexual dimorphism and phenotypic adaptations to environmental conditions, and inter-population variations, reflecting vicarious and dispersive processes (HENDRY, 2013). Sexual dimorphism (SD) is an important pillar for variation in phenotypic expression in animals (BENÍTEZ et al., 2011; BERNS, 2013; BONDURIANSKY, 2007; SHINE, 1989), resulting from specific selective pressures of both sexes, reinforcing the pre-zygotic isolation between evolutionary lineages, and thus representing a great source of evolutionary diversification (ANDERSSON, 1994; DARWIN, 1871; SHINE, 1989; SLATKIN, 1984). SD is a common phenotypic variation among decapod crustaceans, usually expressed in larger body size and more robust chelipeds in males, which are used in most cases in agonistic encounters (DUFFY & THIEL, 2007; LEE, 1995; MARIAPPAN; BALASUNDARAM; SCHMITZ, 2000). Morphological plasticity related to adaptation to environmental conditions are intra-and inter-population sources of phenotypic variation in widely distributed species, considering that a wide range of habitats is available (SCHEINER, 1993; SPAARGAREN, 1999; WHITMAN; AGRAWAL, 2009; WINTERHALTER; MOUSSEAU, 2007). Thus, it creates a requirement for adjustments to the physicochemical parameters of the habitat mosaic within the limits of distribution of a species (MCDOWALL, 2007). It is possible to observe, in several taxa of crustaceans, variations in morphometric characters affected by different selective regimes (predators, different resources, rainfall, hydrodynamics, etc.) (DIMMOCK; WILLIAMSON; MATHER, 2004; SPAARGAREN, 1999; WINTERHALTER; MOUSSEAU, 2007),

which may be either a reflection of natural genetic organization (WALDMAN; GROSSFIELD; WRIGIN, 1988) and, therefore, more related to past events, or to modulation of gene expression due to external factors and, on the other hand, more related to contemporary factors (HOLLANDER et al., 2006). Phenotypic plasticity related to external morphology is common in crustaceans, and is related to sexual dimorphism (ACCIOLY et al., 2013; ALENCAR et al., 2014; GRANDJEAN et al., 1997; KAPIRIS; THESSALOU-LEGAKI, 2001; LEDESMA; DER MOLEN; BARON, 2010; SCALINI; GIBERTINI, 2009; STREISSL; HODL, 2002) and/or environmental factors and isolation of populations (DIMMOCK; WILLIAMSON; MATHER, 2004; HOPKINS; THURMAN, 2010; LEDESMA; DER MOLEN; BARON, 2010; NEUFELD; PALMER, 2008; ROSENBERG, 2002; RUFINO; ABELLÓ; YULE, 2006; SILVA et al., 2010; TORRES; COLLINS; GIRI, 2014; ZIMMERMANN et al., 2012). To evaluate the changes in phenotypic expression, emphasizing the variation and co-variation of the external morphology, we can mention a set of techniques with quantitative approach that abstracts the shape of morphological structures of interest and preserves its configuration (cartesian coordinates) in the analysis, called geometric morphometry (ADAMS; ROHLF; SLICE, 2004; MITTEROECKER; GUNZ, 2009). This set of techniques is characterized by its descriptive precision, recognition of intermediate shape and gradation of similarity/dissimilarity between the shape and an hypothetical and experimental extrapolation (ROTH; MERCER, 2000). Recently, the integration of techniques such as morphometric and/or molecular integrated analyses is being used to determine whether the differences occur due to past or present factors and also to evaluate genetic and phenotypic variations in populations and patterns of distribution (AHMADZADEH et al., 2013; BERBEL-FILHO et al., 2015; DAYRAT, 2005; JANSEN et al., 2011; McCORMACK; ZELLMER; KNOWLES, 2010; PADIAL; DE LA RIVA, 2009; WARREN; GLOR; TURELLI, 2010). As well, use only one technique to link ecological and evolutionary aspects of lineages, species or community (ROTH; MERCER, 2000). The genus Macrobrachium Spence Bate, 1868 has a pan-tropical distribution in freshwater environments (VALÊNCIA; CAMPOS, 2007), and its taxonomy is hampered by both by intra and interpopulational variations, such as strong sexual dimorphism and the isolation of the drainages they dwell, respectively (HOLTHUIS, 1952; KONAN et al., 2010; LEE, 1979; SHORT, 2004). Among the species of this genus, Macrobrachium jelskii (Miers, 1877) is widely distributed, being found in coastal basins in South America

(Venezuela to Brazil) and in most basins in Orinoco, Amazon, Mid-Northeastern Caatinga and Paraná-Paraguai (BASTOS; PAIVA, 1959; COELHO; RAMOS-PORTO, 1985; COLLINS, 2000; HOLTHUIS, 1950, 1966; MAGALHÃES et al., 2005; MELO, 2003). Moreover, there are indications of accidental introduction of specimens of this species, coming from the Amazon basin in 1939, to northeastern Brazil due to the works of the National Department of Works Against Drought (Departamento Nacional de Obras Contra as Secas – DNOCS) to promote fishing and aquaculture in the semiarid (details in GURGEL; OLIVEIRA, 1987). This species has an abbreviated larval development, which occurs entirely in freshwater (GAMBA, 1980, 1984, 1997; MAGALHÃES, 2000; PAIVA; BARRETO, 1960), a trait that also limits their dispersion compared to other species of the same genus. Taking that in consideration, this species may have had its eco-evolutionary dynamics modulated by preterit connection between the basins, either by the formation of paleo- channels that connected the basins that cover this region during the Pleistocene marine regressions (TURCHETTO-ZOLET et al., 2012), or by neotectonics adjustments that can result in the capture of springs, which possibly affected the distribution of the continental aquatic species and promoted mixing between populations, a pattern observed for fishes by Albert & Reis (2011). After these scattering events, the lineages may have experienced a long period of isolation, that can result in morphological and molecular differences between species. Natural populations often have their fitness tested for environmental variations (WINDIG; DE KOVEL; DE JONG, 2004). Anthropogenic effects alter the natural environment at an unprecedented rate (REED; SCHINDLER; WAPLES, 2011) and freshwater environments have been repressively most impacted (COLLEN et al., 2013), as with water transfer projects between basins (GRANT et al., 2012; MEADOR, 1992; PITTOCK; MENG; CHAPAGAIN, 2009). Despite its socio-economic relevance, those artificial links promote connectivity between geologically isolated basins and their communities, promoting homogenization of biodiversity, loss of species richness (BELLAFRONTE et al., 2010; GRANT et al., 2012), modifications of gene flow patterns (BLANCO et al., 2009; PERES et al., 2012), disruptions in water quality, alteration of habitats, and the introduction of invasive species (MEADOR, 1992). In the past, there were numerous efforts by the government to solve the problem of inadequate water supply in Central Northeast Caatinga, but without success (PITTOCK; MENG; CHAPAGAIN, 2009). An example of interbasin water transfer in evidence is the one on the São Francisco

River, from which water will be transferred to the basins of Jaguaribe, Piranhas-Açu, Apodi-Mossoró and Paraíba do Norte (PITTOCK; MENG; CHAPAGAIN, 2009). Understanding the eco-evolutionary dynamics of this species, knowing the scenario of the São Francisco river water transfer process, becomes important as a way to predict future impacts to populations of aquatic organisms. Thus, the aim of this study is to describe and infer whether the phenotypic variation (morphological) among populations of M. jelskii in northeastern Brazil are due to population structure and to phenotypic plasticity.

2.2.MATERIAL AND METHODS

2.2.1. Sampling

A total of 3,709 specimens of the Macrobachium jelskii prawn was collected. The samplings occurred between March/2012 and April/2013, performed using various fishing tackle: sieves, trawls (lenght: 10m, height: 1.5m, stretch mesh netting: 0.5mm), casting net, creels, following the RAP (Rapid Assesment Program) method, with evaluation of the tackle that can be used according to the characteristics of each collection site. Then, the collected animals were labeled and stored in 70% alcohol for subsequent morphometric analysis. The collections covered the basins of Parnaiba (PNB), Apodi- Mossoró (APO), Piranhas-Açu (PIR), Jaguaribe (JAG), Paraíba do Norte (PNORT) and São Francisco (SFR) (Figure 1). All specimens were identified according to the morphological and meristic characters of their descriptions in the literature (GARCÍA-DÁVILA; HOLTHUIS, 1959; MELO, 2003) and sexed, noticing the presence of the male appendage in the second pair of pleopods (VALENTI, 1998). For subsequent morphometric analyses, 965 specimens were used, at least 25 of each sex (male and female) from sampling points distributed in lentic and lotic environments in each basin (Table 1; Figure 1), to detect possible hydrodynamic adaptations. Complete morphological structures, free of injuries and occasional damage to the cephalothorax were used. In addition, only adult specimens were used in order to avoid allometric ontogenetic effects (COCK, 1966) according to the procedure proposed by Alencar et al. (2014).

2.2.2. Geometric morphometric analysis

The multivariate geometric morphometric set, in this study, creates the definition of shape and all of its geometrical configurations, except for size, position and orientation (KLINGENBERG et al., 2012), using anatomical landmarks to obtain shape information through Procrustes Superimposition (DRYDEN; MARDIA, 1998). Three plans of body structures were evaluated: lateral of cephalothorax (LC), lateral of second abdominal somite (LSAS) and external face of cheliped (EFC). The body plans were obtained by images captured using a Bel Eurekan digital camera (10.0 megapixels) with a Zoom Trinocular LAB-SZ25T stereomicroscope, using height and position of the body plan standardized from the size range specimens collected. For all image captures, the body structures were positioned in the central plane (vertical and horizontal) of the image frame and scaled in millimeters for future obtainment of the size information. Previous procedures were also carried out to standardize the distance and zooming on objects, avoiding the Parallax effect (peripheral distortion). In addition, tests to measure the accuracy of image capture and placement of landmarks were performed (data not published). For ordering of digitalized images of a same body structure plan in the same file in TPS format, the software tpsUtil (ROHLF, 2008) was used. To register the landmarks in each digitalized image, the software tpsDig2 (ROHLF, 2006) was used. In the LC body plan, 12 landmarks were positioned (Figura 2a). In LSAS 8 landmarks were positioned (Figure 2b). Finally, in each EFC 12 landmarks were positioned (Figura 2c). The descriptions of landmarks followed the anatomical descriptions defined in Williams (1984). The coordinates of landmarks for each body plan were subjected to a Generalized Procrustes analysis (GPA) (DRYDEN; MARDIA, 1998), a procedure that removes the information not related to variation due to position, size and rotation (ROHLF; SLICE, 1990) (Figure 2). Subsequently, a Multivariate Regression (grouped by sex and populations) of the Procrustes coordinates (shape component) in the centroid size (size component) were used to analyze the variation of shape in function of the allometric effect (DRAKE; KLINGENBERG, 2008). The percentage of allometric prediction in variation of shape was also calculated as a part of the percentage of the total variation of shape that the regression model recorded, which was computed using the Procrustes distance (GODALL, 1991; KLINGENBERG; MCINTYRE, 1998). The statistical significance of

allometric regressions was tested using a permutation test against the null hypothesis of allometric independence (GOOD, 2000). To make a comparison of the variations in shape of each body plan, between the genders without differences in body size composition of specimens, and also controlling the static and ontogenetic allometric effects (details in COCK, 1966), an allometric correction was necessary (ALENCAR et al., 2014; SIDLAUSKAS; MOL; VARI, 2011). Thus, the residues of multivariate regression of the shape under the centroid size were used for subsequent inferential statistical analyses and research of variation of morphospace for each body plan. Finally, Principal Component Analysis (PCA), Canonical Variables (CVA) and Discriminant Function (DFA) were used to evaluate the variation in shape and find differences between the sexes, lentic and lotic environment, and among populations. A PCA using a covariance matrix from the residues of the multivariate regression was performed to produce a morphospace of the main patterns of variation in the data and trends among groups of interest (JOLLIFFE, 2002). The CVA shows a general view of the variations between populations (corresponding to each basin) (ALBRECHT, 1980). The DFA was used to generate the final variations in shape between males and females and specimens of lentic and lotic environments, regardless of population. In hypothesis testing in CVA and DFA, the probability values from the permutation test (n = 10,000) for the Procrustes distance were computed. The Procrustes distance values were preferred rather than the Mahalanobis distance ones by the fact that the first is the measurement of absolute amount of shape variation, while the second is a relative measure of variation of shape (KLINGENBERG; MONTEIRO, 2005). In addition, the percentages of correct markings of the cross-validation matrix obtained in DFA were computed. For better visualization of clusters among populations, an analysis of clusters from the residual data coming from the multivariate regression was used. The representations of shape variation obtained from the PCA, DFA and CVA methods were observed by means of deformation grids and wireframe type graphics (alternative representation of the body structure under study, or consensus) (Figure 1) using landmarks coordinates. Generalized Procrustes analysis, multivariate regressions, multivariate analysis of PCA, CVA and DFA, transformation grids and wireframe graphics were conducted in MorphoJ 1.02b® software (KLINGENBERG, 2011). Cluster analysis was performed

using R software (R DEVELOPMENT CORE TEAM, 2008), using the Geomorph package (ADAMS; OTAROLA-CASTILLO, 2013).

2.3.RESULTS

The landmarks positioned for abstraction of shape in the analyzed body structures plans (LC, LSAS and ECF) showed significant differences that demonstrate sexual dimorphism, variations related to hydrodynamics and isolations by watersheds. Allometric independedence of shape was observed in each of the structures (LC – p < 0.0001, % allometric prediction = 1.38%; LSAS – p < 0.0001, % allometric prediction = 5.13%; ECF– p < 0.0001, % allometric prediction = 20.86%) (Figure 3). Primarily, by the relation between the procrustes coordinates and centroid size, it may be noticed sexual dimorphism based on size (centroid size), in which females in the three body plans are bigger than males (Figure 3). The PCA analysis showed similar results for each body structure plan, revealing variations in morphospace, mainly related to sexual dimorphism, less evident related to hydrodynamics, and no trend among populations of each river basin (Figures 4 – 6). According to the evaluation criteria of the PCA, the first five principal components were investigated for LC (cumulative variation = 73.13%; PC1 = 28.38%, PC2 = 23.46%; Figure 4). For LSAS the first three principal components were investigated (cumulative variation = 71.52%; PC1 = 36.94%, PC2 = 19.66%; Figure 5). Finally, for ECF, the first five principal components were investigated (cumulative variation = 76.42%; PC1 = 28.44%, PC2 = 15.73%; Figure 6). In the evaluation of shapes between the sexes, regardless of the locations, DFA indicated significant differences in the shapes for the three body structures (LC, LSAS and ECF). CL and LSAS more dissimilar (Procrustes distance = 0.0392, p < 0.0001; Procrustes distance = 0.0389, p < 0.0001; respectively), and ECF more similar (Procrustes distance = 0.0098, p < 0.0001). All percentages of correct markings in the cross-validation matrix were above 70% for observation of sexual dimorphism (Table 2). On the observed deformations for each sex: (1) in LC a vector displacement in landmarks in the dorsal- posterior and ventral-anterior regions was noticed, with females showing a lengthier cephalothorax (Figure 7a); (2) in LSAS, females showed a more stretched lower portion and a constricted upper portion, with the opposite being evidenced for males (Figure 7b);

and in ECF, changes in the morpho-space were more subtle, especially in the lower portion and in the hinge region of the fixed dactyl (Figure 7c). In DFA, to evaluate the variations of shape related to hydrodynamics, regardless of population and genders, an equitable similarity between each body plan was observed (Procrustes distance = LC – 0.0091, LSAS – 0.0083, ECF – 0.0112, p < 0.0001). All percentages of correct markings in the cross-validation matrix were above 60% (Table 3). Subtle deformations related to hydrodynamics were observed in lentic and lotic groups: (1) in LC a subtle vertical displacement of the rostral spine in the distal portion was observed, which was directed upwards in the lotic group and downwards in the lentic group (Figure 8a), (2) in LSAS, there were no clear differences in morpho-space (Figure 8b), and in ECF, there were varitions in the morpho-space at the top portion of the palm and the lower distal portion of the fixed dactyl, with lentic environment specimens showing slightly thinner ones and lotic environment specimens showing more drawn ones (Figure 8c). The CVA identified, for body structure plan, statistical differences between population groups in each basin. For the LC body plan, the first two CVs accounted for 72.35%, and the calculations of differences of Procustes distances showed significant differences among all groups (Table 4). The vector displacements of the landmarks in the regions of the antennal spine (landmark 10) (CV1) and the rostral spine (landmark 1, 2, 3, 11 and 12) (CV2) were the main responsible factors for the differentiation of each population group. Observing the CV1, the specimens of APO showed a displacement of landmark 10 directed to the lower direction (CV1+), while the specimens of PIR, PNB and SFR groups showed a slight displacement to the upper direction (CV1-). In CV2, the specimens of PNORT, JAG and SFR showed thinner rostral spines (CV2-), while the PIR, PNB e APO groups tended to show more robust ones (CV2+). For LSAS, the first three CVs accounted for 81.90%, and the calculations of differences of Procustes distances showed significant differences among all groups (Table 4). The vector displacements mainly in the landmarks 3 and 7 (CV1) and in the landmarks 4 and 5 (CV2) were the main responsible factors for the subtle variations that showed a groupment of populations near the consensus shape. However, it was noticed in CV1 that the specimens of APO, JAG, PNORT and PNB showed a displancement in landmark 3 pointed to the anterior direction, and in landmark 7 to the inferior direction (CV1-), while specimens of SFR and PIR showed deformations that were inverse to those noticed previously (CV1+). In CV2, the specimens PNB, PAR, APO and PIR showed

displacement of landmark 4 to the posterior region and landmark 5 to the anterior region (CV2-); JAG and SFR showed displacement of landmark 4 to the anterior region and landmark 5 to the posterior region (CV2+) (Figure 10). In ECF, the two CVs accounted for 74.59% and the calculations of differences of Procustes distances showed significant differences among all groups (Table 4). The vector displacements of the landmarks 1, 2 and 3, distal margin of the fixed dactyl, show subtle population differences of shape in the morpho-space. Observing CV1, the specimens of APO, JAG, PNORT and PNB showed a stretching in landmark 3 and almost an alignment between landmarks 1, 2 and 3 (CV1-), while specimens of groups SFR and PIR showed deformations that were inverse to those noticed previously (CV1+). In CV2, the specimens of PNB showed in the axis CV2- deformations similar to the ones observed in CV1-. As for the other populations, in the axis CV2+, variations similar to those of the axis CV1+ were noticed (Figure 11). Additionally, the cluster that best represented the groupings based in the procrustes distances was the dendrogram made for the body structure plan of LSAS (cophenetic correlation coefficient = 0.701) (Figure 12).

2.4.DISCUSSION

The three body plans of M. jelskii showed more evident instraspecific variations of shape (sexual dimorphism and hydrodynamics) and less evident interspecific variations of shape (populations). All the comparisons were statistically significant, as expected for the geometric morphometric tool, which is able to identify subtle differences (BERTIN et al., 2002). Knowing this, further discussions are based on Procrustes distance values and variations (vector displacement) of the morphospace. In LC, females showed larger cephalothorax (distant from the centroid) and tiny vector retraction of the rostral spine, while males showed more compressed cephalothoraxes and a subtle stretch of the rostral spine. Variations related to cephalothorax may be related to gonadal development and selection of defense strategies. In crustacean species that dwell strictly in freshwater, as M. jelskii, eggs contain lots of yolk, due to the abridgment of the development in the larval stage. That way, females reach larger sizes (cephalothorax length), providing a greater internal area for gonadal development (BECK; COWELL, 1976; PARKER, 1992), in which oocytes of some

species of Macrobrachium can grow to 60 times their volume during vitellogenesis, especially in cases of abbreviated of the larval stage (REVANTHI et al., 2012). The abbreviation of the larval stage is common in freshwater crustaceans which obtained independence from coastal environments (e. g. estuaries) by decreasing the number of larval stages, ecloding in advanced larval stages (zoea and decapodit) (BAUER, 2011a; CAVALLO; LAVENS; SORGELOOS, 2001; RODRÍGUEZ; CUESTA, 2011) and, that way, developing an increased production of lipoproteins composing the yolk (lecithotrophic egg) (MASHIKO, 1983; WILDER; SUBRAMONIAM; AIDA, 2002), that ends up occupying about ¾ of the total volume of the egg (MOSSOLIN et al., 2013), and also low fecundity (MASHIKO, 1983; VOGT, 2012). With regards to the subtle stretch of the rostral spine, this may be a consequence of selection of defensive characters, as males usually explore more the environment for resources (foraging and searching for susceptible females) and have higher mortality rates by predation (BAEZA; DÍAZ-VALDÉZ, 2011; NAKASHIMA, 1987). Nakagaki (1999) in experimental study on predation of Xiphopenaeus kroyeri Heller, 1862 (Sub-Order Dendrobranchiata), suggested that the shrimps with pronounced rostral spine (more angled and longer) are avoided and less preyed upon by potential predators. Werner and Peacor (2003) and Preisser, Bolnick and Benard (2005) add that predation rate is mediated by some characters of the prey, such as size, speed, cripticity and external morphology (e.g., defensive spines). In LSAS, for females there was a stretch of the lower portion of the abdomen and a constriction for males, and vice versa for the upper portion. This character is highlighted for the vast majority of prawns of Sub-Order Pleocyemata, in which most species incubate the eggs until hatching, zoea or decapodit (BURKENROAD, 1963). In Caridea Infra- Order, the character of incubating eggs is shown in the second abdominal segment, where the segment pleuron overlaps the pleura of the first and third segments (WILLIAMS, 1984). In caridean shrimp, this characteristic favors sexual dimorphism, where females tend to have a positive allometric relation between cephalothorax length and width of the abdomen (AHAMED; OHTOMI, 2014; BAEZA; HEMPHILL; RITSON-WILLIAMS, 2015; MANTEL; DUDGEON, 2005; PASCHOAL; GUIMARÃES; COUTO, 2013; PRALON; NEGREIROS-FRANSOZO, 2006), and in multivariate morphometric studies, a discriminatory variable to show sexual dimorphism (DE GRAVE; DIAZ, 2001). In ECF, specimens showed little variation in morphospace and greater similarity between the sexes, perhaps a possible evidence of absence or few events of agonistic

encounters, corroborating the high densities of specimens collected from both sexes, forming large groups. Another important fact is that for this species there is no record of hierarchical groups of dominance among males, together with proof of females reaching bigger sizes (centroid size) than males. According to Moore (2007) and Bauer (2011b), species with the standard mentioned above are characterized as "aggregated species" in which there are high population densities and the copula happens by "pure search" (active search for receptive females), with no reports of pre or post-copulatory behavior (guarding of females, fights for partners and cohort behavior). With regards to hydrodynamics comparison, specimens in both lentic and lotic environments were more similar in the three body planes, based on little variation in morpho-space, low values of procrustes distances and of correct markings. This result may reflect the micro-habitat occupied by the species, always housed in marginal aquatic vegetation and in association with roots of submerged phanerogams (MELO, 2003). This habit possibly allows the species to avoid the abiotic hydrodynamics factor, avoiding the current and unnecessary energy expenditure with swimming. Another fact that should be emphasized are the seasonal cycles of drought and rain that can provide drastic changes in the speed of the river currents, where lentic environments can become lotic in periods of high rainfall, with exceptions for the rivers São Francisco and Parnaíba, both of perennial regime (AB’SÁBER, 1974; ROSA et al., 2003). Moreover, Gurgel and Oliveira (1987) provide a hypothetical scenario of introduction of this species in 1939 along with M. amazonicum (Heller, 1862), M. acanthurus (Wiegmann, 1836) and other 39 species of fish in the weirs, rivers and brooks in Brazilian Northeast by DNOCS, with the objective of encouraging subsistence fishing among the settlements located near weirs. However, the same authors state that the species M. jelskii was already native to the Brazilian Northeast basins, and the matrices introduced were coming from the Amazon basin. Phylogenetic studies of this kind covering populations of Brazilian continental and coastal basins show low genetic variability (VERA-SILVA; CARVALHO; MANTELATTO, 2016). In the present study, this can be evidenced in the low procustes distance related to lentic and lontic environments, which is likely an indication of a possible founder effect caused by human action, that can be a scenario of introduction of a small portion of the population (matrix), resulting in low genetic differentiation and, consecutively, few fenotypical characters abstracted by morphometric geometry technique.

Among the watersheds, there was not a clear consensus between the patterns of similarities and dissimilarities among the populations among the planes of body structure, but in the LSAS plan, were viewed comparisons peer-to-peer that obtained the highest procrustes distance values and highest cophenetic correlation coefficient in the cluster analysis. Such a structure, based on the quantification of shape, may reflect characteristics related to the plasticity of the larval stage abbreviation modulated by environmental factors such as salinity, temperature and rainfall, as evidenced for gender (JALIHAL; SANKOLLI; SHENOY, 1993; MAGALHÃES; WALKER, 1988 – varying between 1 to 11 larval stages) and for species (GAMBA, 1980; 1984; 1997; MAGALHÃES, 2000; PAIVA; BARRETO, 1960– larval period length, 8 to 15 days). Vogt points out that such plasticity of the larval stage abbreviation, concomitantly to changes in vitellogenesis, in larval development and parental in care, are responsible for the conquest of freshwater and terrestrial environment, with independence of coastal (estuaries and coastal lagoons) and marine environments. The shape settings can indirectly represent egg size or amount of yolk in the populations studied, in which basins with lower river and rainwater input (PNORT, PIR and APO), would show females producing more effective eggs (more yolk and greater total volume - females with wider abdominal pleuron, stretched horizontally), and most river and rainwater input (PNB e SFR) or prerennial passages (JAG) would present less effective eggs (less yolk and less total volume, females with a narrow abdominal pleuron, horizontally compressed) also highlighting the condition of perennial regime of the rivers Parnaíba and São Francisco, which can provide an environment without large seasonal variations in environmental factors. Variations in egg size are reported for the species M. nipponense (De Haan, 1849) in different populations, but having salinity as a modulator (MASHIKO; NUMACHI, 2000). Despite the evidences of unnatural introduction of this species in northeastern Brazil, the structure of the populations, based on the quantification of the shape, can also be a reflection of neotectonic arrangements (TURCHETTO-ZOLET et al., 2012). The first scenario is the arrangement of spring captures of the basins of rivers Orinoco (type locality of M. jelskii) and Amazonas, dated 30-40 million years ago (LUNDBERG et al., 1998). The second scenario depicts the possible connectivity between the basins and is related to episodes of marine ingression that provide connectivity of the basins of rivers Amazonas, Parnaíba, de la Plata and São Francisco, dated 12-20 million years ago (BLOOM; LOVEJOY, 2011; LIMA; RIBEIRO, 2011; LOVEJOY; BERMINGHAM;

MARTIN, 1998; RAMOS; ALEMAN, 2000), which may be a reason for the greater similarity of shape and the shortest procrustes distance among populations of the basins of Parnaíba and São Francisco. Finally, there is evidence, in northeastern Brazil, that can confirm the existence of paleo-channels such as valleys or failures in sedimentological deposits that portray a Pleistocene link between the waterways of Baturité-Urauçuba compartments (Parnaíba Basin - PNB) and especially Jaguaribe-Potiguar (Basins of Jaguaribe - JAG, Apodi-Mossoró - APO, Piranhas-Açu - PIR) (BRITO NEVES; DOS SANTOS; VAN SCHMUS, 2000; CABY; ARTHAUD; ARCHANJO, 1995; CARNEIRO; HAMZA; ALMEIDA, 1989; PEULVAST et al., 2008). The latter scenario may indirectly explain the grouping by similarity of shape in most basins composing the Mid-Northeast Caatinga Ecoregion. This information can provide products of these plastic phenotypes and provide possible signs of past events of increase in sea level and of marine regression. Aspects of eco-evolutionary dynamics on the morphology (shape) provide evidence about sexual dimorphism, origin of natural distribution of species and population variations. These aspects have not been investigated for all taxa of crustaceans and its wide range of eco- evolutionary indicators of short and long time-scale, especially in the tropical region of semiarid regime. Thus, interpretation of the direction and of the phenotypic plasticity degree can give erroneous results, in which differences in body shape are generally not assigned to a single natural selective force (natural and sexual selection), but to artificial processes involved (anthropic introduction). This study exemplifies how the investigation of body variations can be correlated to the knowledge of the biology of the species and also give subsidies to formulate new questions about evolutionary aspects and speculation about future impacts of the interbasin transfer of the São Francisco River on the biological heritage of the semiarid region. The Ministry of National Integration reports that the environmental impact of the transfer of water between basins will be inexpressible (PITTOCK; MENG; CHAPAGAIN, 2009), promoting a great exchange between aquatic fauna and evolutionary lineages that diversified independently by dispersive and vicariant processes. This possibly means an unpredictable and unrecoverable loss of intraspecific diversity, evolutionary potential and information about the history of shrimp lineages in the Mid-Northeast Further investigations about populational, ecological, behavioral, physiological (tolerance to salinity, correlating with marine incursion events) and genetical (use of more

sensitive markers for population differences) aspects can contribute to a deeper evaluation of the overall status of the species to along its geographic distribution.

Acknowledgements The authors thank the Conselho Nacional de Desenvolvimento Cientifico e Tecnológico (National Scientific Development Council, CNPq #552086/2011-8) for the financing of the research project and for the scholarships granted (Sávio ASN Moraes - CAPES), and the LISE and GEEFAA members for the field and lab support. All fieldwork was conducted in accordance with state and federal environmental laws (License collection SISBIO-IBAMA #28314-1). The authors declare no conflicts of interest.

REFERENCES

AB’SÁBER, A. N. O domínio morfoclimático semi-árido das caatingas brasileiras Geomorfológia. São Paulo, JGEOG, USP, v. 43, 1974. ACCIOLY, INGRID V. et al. Sexual dimorphism in Litopenaeus vannamei (Decapoda) identified by geometric morphometrics. Pan-American Journal of Aquatic Sciences, v. 8, n. 4, p. 276-281, 2013. ADAMS, Dean C.; OTÁROLA CASTILLO, Erik. geomorph: an R package for the collection and analysis of geometric morphometric shape data. Methods in Ecology and ‐ Evolution, v. 4, n. 4, p. 393-399, 2013. ADAMS, Dean C.; ROHLF, F. James; SLICE, Dennis E. Geometric morphometrics: ten years of progress following the ‘revolution’. Italian Journal of Zoology, v. 71, n. 1, p. 5-16, 2004. AHAMED, F.; OHTOMI, J. Relative growth and sexual maturity of the pandalid shrimp Plesionika izumiae (Decapoda, Caridea) in Kagoshima Bay, southern Japan. Crustaceana, v. 87, n. 13, p. 1567-1577, 2014. AHMADZADEH, Faraham et al. Cryptic speciation patterns in Iranian rock lizards uncovered by integrative taxonomy. PloS one, v. 8, n. 12, p. e80563, 2013. ALBERT, J. S.; REIS, R. E. Introduction to Neotropical freshwaters. Historical biogeography of neotropical freshwater fishes, p. 3-19, 2011. ALBRECHT, Gene H. Multivariate analysis and the study of form, with special reference to canonical variate analysis. American Zoologist, p. 679-693, 1980.

ALENCAR, C. E. R. D. et al. Sexual shape dimorphism of the mangrove crab Ucides cordatus (Linnaeus, 1763) (Decapoda, Ucididae) accessed through geometric morphometric. The Scientific World Journal, v. 2014, 2014. ANDERSSON, Malte B. Sexual selection. Princeton University Press, 1994. BAEZA, J. Antonio; DÍAZ VALDÉS, Marta. The symbiotic shrimp Ascidonia flavomaculata lives solitarily in the tunicate Ascidia mentula: implications for its mating ‐ system. Invertebrate Biology, v. 130, n. 4, p. 351-361, 2011. BAEZA, J. Antonio; HEMPHILL, Carrie A.; RITSON-WILLIAMS, Raphael. The sexual and mating system of the shrimp Odontonia katoi (Palaemonidae, Pontoniinae), a symbiotic guest of the ascidian Polycarpa aurata in the coral triangle. PloS one, v. 10, n. 3, p. e0121120, 2015. BASTOS, J. A. M.; PAIVA, M. P. Notas sobre o consumo de oxigênio do camarão ‘sossêgo’, Macrobrachium jelskii (Miers, 1877) Chace & Holthuis, 1948. Revista Brasileira de Biologia, v. 19, n. 4, p. 413-419, 1959. BAUER R. T. Amphidromy and migrations of freshwater shrimps. II. Delivery of hatching larvae to the sea, return juvenile upstream migration, and human impacts. In: Asakura A. (Ed.). New Frontiers in Crustacean Biology, Crustaceana Monographs, Brill, Leiden, 2011a. p.157–168. BAUER R. T. Chemical communication in decapods shrimps: the influence ofmating and social systems on the relative importance of olfactory and contact pheromones. In: BREITHAUPT, T.; THIEL, M. (Eds.). Chemical Communication in Crustaceans, Springer Science Business Media LCC, New York, 2011b. p.277-295. BECK, J. Thomas; COWELL, Bruce C. Life history and ecology of the freshwater caridean shrimp, Palaemonetes paludosus (Gibbes). American Midland Naturalist, p. 52-65, 1976. BELLAFRONTE, Elisangela et al. Cytogenetic identification of invasive fish species following connections between hydrographic basins. Hydrobiologia, v. 649, n. 1, p. 347- 354, 2010. BENÍTEZ, Hugo A. et al. Geometric perspectives of sexual dimorphism in the wing shape of Lepidoptera: the case of Synneuria sp.(Lepidoptera: Geometridae). J. Entomol. Res. Soc, v. 13, n. 1, p. 53-60, 2011. BERBEL-FILHO, Waldir M. et al. Inter-and intra-basin phenotypic variation in two riverine cichlids from northeastern Brazil: potential eco-evolutionary damages of São Francisco interbasin water transfer. Hydrobiologia, v. 766, n. 1, p. 43-56, 2015.

BERNS, Chelsea M. The evolution of sexual dimorphism: understanding mechanisms of sexual shape differences. Sexual Dimorphism, p. 1-16, 2013. BERTIN, Angeline et al. Quantification of sexual dimorphism in Asellus aquaticus (Crustacea: Isopoda) using outline approaches. Biological Journal of the Linnean Society, v. 77, n. 4, p. 523-533, 2002. BLANCO, Daniel Rodrigues et al. Characterization of invasive fish species in a river transposition region: evolutionary chromosome studies in the genus Hoplias (Characiformes, Erythrinidae). Reviews in Fish Biology and Fisheries, v. 20, n. 1, p. 1- 8, 2009. BLOOM, Devin. D.; LOVEJOY, Nathan R. The biogeography of marine incursions in South America. In: Albert, J.S.; Reis, R.E. (Eds.). Historical Biogeography of Neotropical Freshwater Fishes. University of California Press, Berkeley, 2011 p.137- 144. BONDURIANSKY, Russell. The evolution of condition-dependent sexual dimorphism. The American Naturalist, v. 169, n. 1, p. 9-19, 2007. BRITO NEVES, Benjamin B.; DOS SANTOS, Edilton J.; VAN SCHMUS, William R. Tectonic history of Borborema Province, Northeastern Brazil. In: Cordani, U.G, Thomaz Filho, A.; Campos, D.A. (Eds.). Tectonic Evolution of South America. 31st International Geological Congress, Rio de Janeiro, 2000. p.151-182 BURKENROAD, Martin D. The evolution of the Eucarida, (Crustacea, Eumalacostraca), in relation to the fossil record. Tulane Studies in Geology and Paleontology, v. 2, n. 1, 1963. CABY, Renaud; ARTHAUD, Michel H.; ARCHANJO, Carlos J. Lithostratigraphy and petrostructural characterization of supracrustal units in the Brasiliano Belt of Northeast Brazil: geodynamic implications. Journal of South American Earth Sciences, v. 8, n. 3-4, p. 235-246, 1995. CALSBEEK, Ryan; SMITH, Thomas B.; BARDELEBEN, Carolyne. Intraspecific variation in Anolis sagrei mirrors the adaptive radiation of Greater Antillean anoles. Biological Journal of the Linnean Society, v. 90, n. 2, p. 189-199, 2007. CARNEIRO, Celso D. R.; HAMZA, Valiya M.; DE ALMEIDA, Fernando F. M. Ativação tectônica, fluxo geotérmico e sismicidade no Nordeste Oriental brasileiro. Revista Brasileira de Geociências, v. 19, n. 3, p. 310-322, 1989.

CAVALLO, Ronaldo O.; LAVENS, Patrick; SORGELOOS, Patrick. Reproductive performance of Macrobrachium rosenbergii females in captivity. Journal of the World Aquaculture Society, v. 32, n. 1, p. 60-67, 2001. COCK, A. G. Genetical aspects of metrical growth and form in animals. The Quarterly Review of Biology, v. 41, n. 2, p. 131-190, 1966. COELHO, Petrônio A.; RAMOS-PORTO, Marilena. Camarões de água doce do Brasil: distribuição geográfica. Revista Brasileira de Zoologia, v. 2, n. 6, p. 405-410, 1985. COLLEN, Ben et al. Global patterns of freshwater species diversity, threat and endemism. Global Ecology and Biogeography, v. 23, n. 1, p. 40-51, 2013. COLLINS, Pablo A. Macrobrachium jelskii (Miers, 1877). Crustaceana, v. 73, n. 9, p. 1167-1169, 2000. DARWIN, Charles. The descent of man, and selection in relation to sex, v. 2, 1871. DAYRAT, Benoit. Towards integrative taxonomy. Biological journal of the Linnean society, v. 85, n. 3, p. 407-415, 2005. DE GRAVE, S.; DIAZ, D. Morphometric comparison between Mediterranean and Atlantic populations of Pontophilus norvegicus (Decapoda, Crangonidae). Hydrobiologia, p. 179-186, 2001. DIMMOCK, Amanda; WILLIAMSON, I.; MATHER, P. B. The influence of environment on the morphology of Macrobrachium australiense (Decapoda: Palaemonidae). Aquaculture International, v. 12, n. 4, p. 435-456, 2004. DRAKE, Abby G.; KLINGENBERG, Christian P. The pace of morphological change: historical transformation of skull shape in St Bernard dogs. Proceedings of the Royal Society of London B: Biological Sciences, v. 275, n. 1630, p. 71-76, 2008. DRYDEN, Ian L.; MARDIA, Kanti V. Statistical analysis of shape. Wiley, 1998. DUFF, J. E.; THIEL, M. Evolutionary ecology of social and sexual systems: crustaceans as model organisms. Oxford University Press on Demand, 2007. GAMBA, A. L. Desarrollo larval abreviado del camarón de agua dulce Macrobrachium jelskii (Miers, 1877). Primeras Jornadas Científicas, Universidad Simón Bolívar. Caracas, Venezuela, p. 169-190, 1980. GAMBA, A. L. Different egg-associated and larval development characteristics of Macrobrachium jelskii and Macrobrachium amazonicum (Arthropoda: Crustacea) in a Venezuelan continental lagoon. International Journal of Invertebrate Reproduction and Development, v. 7, n. 3, p. 135-142, 1984.

GAMBA, A. L. Biología reproductiva de Macrobrachium jelskii (Miers, 1877) y Macrobrachium amazonicum (Heller, 1862) en Venezuela (Crustacea, Decapoda, Palaemonidae). Acta Cientifica Venezolana, v. 48, n. 1, p. 19-26, 1997. GARCÍA-DÁVILA, Carmen R.; MAGALHÃES, Célio. Revisão taxonômica dos camarões de água doce (Crustacea: Decapoda: Palaemonidae, Sergestidae) da Amazônia Peruana. Acta Amazonica, v. 33, n. 4, p. 663-686, 2003. GOOD, Phillip. Permutation tests: a practical guide to resampling methods for testing hypotheses. Springer Science & Business Media, 2000. GOODALL, Colin. Procrustes methods in the statistical analysis of shape. Journal of the Royal Statistical Society. Series B (Methodological), p. 285-339, 1991. GRANDJEAN, F. et al. Morphometry, sexual dimorphism and size at maturity of the white-clawed crayfish Austropotamobius pallipes pallipes (Lereboullet) from a wild French population at Deux-Sèvres (Decapoda, Astacidea), Crustaceana, v. 70, n. 1, p. 31-44, 1997. GRANT, Evan H. C. et al. Interbasin water transfer, riverine connectivity, and spatial controls on fish biodiversity. PLoS One, v. 7, n. 3, p. e34170, 2012. GRANT, Peter R. Ecology and evolution of Darwin's finches. Princeton University Press, 1986. GURGEL, J. J. S.; OLIVEIRA, A. B. Efeitos da introdução de peixes e crustáceos no semi-árido do nordeste brasileiro. ESAM, 1987. HENDRY, A. P. Key questions in the genetics and genomics of eco-evolutionary dynamics. Heredity, v. 111, n. 6, p. 456-466, 2013. HOLTHUIS, Lipke Bijdeley. The Decapoda of the Siboga Expedition: Pt. 10: the Palaemonidae Collected by the Siboga and Snellius Expeditions with Remarks on Other Species: 1: Subfamily Palaemoninae. Brill, 1950. HOLTHUIS, Lipke Bijdeley. A general revision of the Palaemonidae (crustacea Decapod Natantia) of the Americas. II. The subfamily Palaemonidae. 1952. HOLTHUIS, Lipke B. The Crustacea Decapoda of Suriname (Dutch Guiana). EJ Brill, 1959. HOLTHUIS, L. B. A collection of freshwater prawns (Crustacea Decapoda, Palaemonidae) from Amazonia, Brazil, collected by Dr. G. Marlier. 1966. HOPKINS, Melanie J.; THURMAN, Carl L. The geographic structure of morphological variation in eight species of fiddler crabs (Ocypodidae: genus Uca) from the eastern

United States and Mexico. Biological Journal of the Linnean Society, v. 100, n. 1, p. 248-270, 2010. HOLLANDER, Johan et al. Phenotypic plasticity in two marine snails: constraints superseding life history. Journal of evolutionary biology, v. 19, n. 6, p. 1861-1872, 2006. JALIHAL, D. R.; SANKOLLI, K. N.; SHENOY, Shakuntala. Evolution of larval developmental patterns and the process of freshwaterization in the prawn genus Macrobrachium Bate, 1868 (Decapoda, Palaemonidae). Crustaceana, v. 65, n. 3, p. 365- 376, 1993. JANSEN, Martin et al. Integrative inventory of Bolivia’s lowland anurans reveals hidden diversity. Zoologica Scripta, v. 40, n. 6, p. 567-583, 2011. JOLLIFFE, Ian. Principal component analysis. John Wiley & Sons, Ltd, 2002. KAPIRIS, Kostas; THESSALOU-LEGAKI, Maria. Sex-related variability of rostrum morphometry of Aristeus antennatus (Decapoda: Aristeidae) from the Ionian Sea (Eastern Mediterranean, Greece). Hydrobiologia, v. 449, p.123–130, 2001. Klingenberg C. P., Duttke S., Whelan S. & Kim M. (2012) Developmental plasticity, morphological variation and evolvability: a multilevel analysis of morphometric integration in the shape of compound leaves. Journal of Evolutionary Biology, 25, 115- 129. KLINGENBERG, Christian Peter; MCINTYRE, Grant S. Geometric morphometrics of developmental instability: analyzing patterns of fluctuating asymmetry with Procrustes methods. Evolution, p. 1363-1375, 1998. KLINGENBERG, Christian Peter; MONTEIRO, Leandro R. Distances and directions in multidimensional shape spaces: implications for morphometric applications. Systematic Biology, v. 54, n. 4, p. 678-688, 2005. KLINGENBERG, Christian Peter. MorphoJ: an integrated software package for geometric morphometrics. Molecular ecology resources, v. 11, n. 2, p. 353-357, 2011. KONAN, Koffi Mexmin et al. Morphometric variation among male populations of freshwater shrimp Macrobrachium vollenhovenii Herklots, 1851 from Côte d’Ivoire Rivers. Fisheries Research, v. 103, n. 1, p. 1-8, 2010. LEDESMA, Federico M.; VAN DER MOLEN, Silvina; BARÓN, Pedro J. Sex identification of Carcinus maenas by analysis of carapace geometrical morphometry. Journal of Sea Research, v. 63, n. 3, p. 213-216, 2010.

LEE, C. L.; FIELDER, D. R. A mass migration of the freshwater prawn, Macrobrachium australiense Holthuis, 1950 (Decapoda, Palaemonidae). Crustaceana, v. 37, n. 2, p. 219- 222, 1979. LEE, S. Yl. Cheliped size and structure: the evolution of a multi-functional decapod organ. Journal of Experimental Marine Biology and Ecology, v. 193, n. 1-2, p. 161- 176, 1995. LIMA, Flávio C. T.; RIBEIRO, Alexandre C. (2011) Continental–scale tectonic controls of biogeography and ecology. In: ALBERT J.S.; REIS R.E. (Eds.). Historical Biogeography of Neotropical Freshwater Fishes, University of California Press, Berkeley, 2011. p.145-164. LOSOS, Jonathan B. Integrative approaches to evolutionary ecology: Anolis lizards as model systems. Annual Review of Ecology and Systematics, v. 25, n. 1, p. 467-493, 1994. LOVEJOY, Nathan R.; BERMINGHAM, Eldredge; MARTIN, Andrew P. Marine incursion into South America. Nature, v. 396, n. 6710, p. 421-422, 1998. LUNDBERG, G. J. et al. Phylogeny and Classification of Neotropical Fishes. In: MALABARBA, L. R. et al. (Eds.). The stage for Neotropical fish diversification: a history of tropical South America river, Edipuers, Porto Alegre, 1998. p.13-48. MAGALHÃES, Célio et al. Exotic species of freshwater decapod crustaceans in the state of São Paulo, Brazil: records and possible causes of their introduction. Biodiversity and Conservation, v. 14, n. 8, p. 1929-1945, 2005. MAGALHÃES, Célio; WALKER, Ilse. Larval development and ecological distribution of central Amazonian palaemonid shrimps (Decapoda, Caridea). Crustaceana, v. 55, n. 3, p. 279-292, 1988. MAGALHÃES, Célio. Abbreviated larval development of Macrobrachium jelskii (Miers, 1877) (Crustacea: Decapoda: Palaemonidae) from the Rio Solimões floodplain, Brazil, reared in the laboratory. Nauplius, v.8, n.1, p. 1-14, 2000. MANTEL, Sukhmani Kaur; DUDGEON, David. Reproduction and sexual dimorphism of the palaemonid shrimp Macrobrachium hainanense in Hong Kong streams. Journal of Crustacean Biology, v. 25, n. 3, p. 450-459, 2005. MARIAPPAN, Pitchaimuthu; BALASUNDARAM, Chellam; SCHMITZ, Barbara. Decapod crustacean chelipeds: an overview. Journal of biosciences, v. 25, n. 3, p. 301- 313, 2000.

MCCORMACK, John E.; ZELLMER, Amanda J.; KNOWLES, L. Lacey. Does niche divergence accompany allopatric divergence in Aphelocoma jays as predicted under ecological speciation?: insights from tests with niche models. Evolution, v. 64, n. 5, p. 1231-1244, 2010. MCDOWALL, R. M. On amphidromy, a distinct form of diadromy in aquatic organisms. Fish and fisheries, v. 8, n. 1, p. 1-13, 2007. MEADOR, Michael R. Inter-basin water transfer: ecological concerns. Fisheries, v. 17, n. 2, p. 17-22, 1992. MELO, G. A. S. Famílias Atyidae, Palaemonidae e Sergestidae. Manual de identificação dos Crustacea Decapoda de água doce do Brasil, p. 289-415, 2003. MITTEROECKER, Philipp; GUNZ, Philipp. Advances in geometric morphometrics. Evolutionary Biology, v. 36, n. 2, p. 235-247, 2009. MOORE, P. A. Agonistic behavior in freshwater crayfish – the influence of intrinsic and extrinsic factors on aggressive encounters and dominance. In: DUFFY, E.J.; THIEL, M. (Eds.). Evolutionary ecology of social and sexual systems – crustaceans as model organisms, Harvard University Press, New York, 2007. p.90-114. MOSSOLIN, Emerson Contreira et al. Population and reproductive features of the freshwater shrimp Macrobrachium jelskii (Miers, 1877) from São Paulo State, Brazil. Acta Scientiarum. Biological Sciences, v. 35, n. 3, p. 429-436, 2013. NAKAGAKI J. M. Estudo da predação sobre camarões peneídeos (Crustacea, Decapoda). PhD Thesis, Universidade Estadual Paulista, Botucatu, 1999. NAKASHIMA, Yasuhiro. Reproductive strategies in a partially protandrous shrimp, Athanas kominatoensis (Decapoda: Alpheidae): sex change as the best of a bad situation for subordinates. Journal of Ethology, v. 5, n. 2, p. 145-159, 1987. NEUFELD, Christopher J.; PALMER, A. Richard. Precisely proportioned: intertidal barnacles alter penis form to suit coastal wave action. Proceedings of the Royal Society of London B: Biological Sciences, v. 275, n. 1638, p. 1081-1087, 2008. PADIAL, José M.; DE LA RIVA, Ignacio. Integrative taxonomy reveals cryptic Amazonian species of Pristimantis (Anura: Strabomantidae). Zoological Journal of the Linnean Society, v. 155, n. 1, p. 97-122, 2009. PAIVA M. P.; BARRETO V. A. Notas sobre a biologia do camarão ‘sossego’, Macrobrachium jelskii (Miers, 1877) numa pequena bacia potamográfica do nordeste brasileiro. Revista Brasileira de Biologia, v. 20, n. 2, p. 121-129, 1960.

PALKOVACS, Eric P.; POST, David M. Experimental evidence that phenotypic divergence in predators drives community divergence in prey. Ecology, v. 90, n. 2, p. 300-305, 2009. PARKER, G. A. The evolution of sexual size dimorphism in fish. Journal of Fish Biology, v. 41, n. sB, p. 1-20, 1992. PASCHOAL, Lucas RP; GUIMARÃES, Fernanda J.; COUTO, Erminda CG. Relative growth and sexual maturity of the freshwater shrimp Palaemon pandaliformis (Crustacea, Palaemonidae) in northeastern of Brazil (Canavieiras, Bahia). Iheringia. Série Zoologia, v. 103, n. 1, p. 31-36, 2013. PELLETIER, Fanie; GARANT, Dany; HENDRY, A. P. Eco-evolutionary dynamics. Philosophical Transactions of the Royal Society B: Biological Sciences, v. 364, p. 1483-1489, 2009. PERES, Wellington Adriano Moreira et al. Invasion, dispersion and hybridization of fish associated to river transposition: karyotypic evidence in Astyanax “bimaculatus group”(Characiformes: Characidae). Reviews in Fish Biology and Fisheries, v. 22, n. 2, p. 519-526, 2012. PEULVAST, Jean-Pierre et al. Low post-Cenomanian denudation depths across the Brazilian Northeast: implications for long-term landscape evolution at a transform continental margin. Global and Planetary Change, v. 62, n. 1, p. 39-60, 2008. PITTOCK, J.; MENG, J.; CHAPAGAIN, A. K. Interbasin Water Transfers and Water Scarcity in a Changing World — A Solution or a Pipedream? A Discussion Paper in a Burning Issue. WWF Germany, Frankfurt, 2009. PRALON, B. G. N.; NEGREIROS-FRANSOZO, M. L. Population biology of Palaemon (Palaeander) northropi Rankin, 1898 (Crustacea, Decapoda, Palaemonidae) in a tropical South American estuary. Acta Limnologica Brasiliensia, v. 18, n. 1, p. 77-87, 2006. PREISSER, Evan L.; BOLNICK, Daniel I.; BENARD, Michael F. Scared to death? The effects of intimidation and consumption in predator–prey interactions. Ecology, v. 86, n. 2, p. 501-509, 2005. R DEVELOPMENT CORE TEAM. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, 2008. RAMOS, V. A.; ALEMAN, A. Tectonic Evolution of the Andes. In: Cordani, U. et al. (Eds.). Tectonic Evolution of South America, 31st International Geological Congress, Rio de Janeiro, 2000. p.635-685.

REED, Thomas E.; SCHINDLER, Daniel E.; WAPLES, Robin S. Interacting effects of phenotypic plasticity and evolution on population persistence in a changing climate. Conservation Biology, v. 25, n. 1, p. 56-63, 2011. REVANTHI, Peranandam et al. Vitellogenesis during the ovarian development in freshwater female prawn Macrobrachium rosenbergii (De Man). International Journal of Aquatic Science, v. 3, n. 2, p. 13-27, 2012. RODRÍGUEZ, Antonio; CUESTA, José A. Morphology of larval and first juvenile stages of the kangaroo shrimp Dugastella valentina (Crustacea, Decapoda, Caridea), a freshwater atyid with abbreviated development and parental care. Zootaxa, v. 2867, p. 43-58, 2011. ROHLF, F. James; SLICE, Dennis. Extensions of the Procrustes method for the optimal superimposition of landmarks. Systematic Biology, v. 39, n. 1, p. 40-59, 1990. ROHLF, F. James. tpsDig, software program. version 2.10. Department of Ecology and Evolution, State University of New York at Stony Brook, 2006. ROHLF, F. James. tpsUtil, file utility program. version 1.40. Department of Ecology and Evolution, State University of New York at Stony Brook, 2008. ROSA, RICARDO S. et al. Diversidade, padrões de distribuição e conservação dos peixes da Caatinga. In: LEAL, I.R.; TABARELLI, M.; SILVA, J.M.C. (Eds.). Ecologia e conservação da Caatinga, Editora Universitária, Recife, 2003. p. 135-180. ROSENBERG, Michael S. Fiddler crab claw shape variation: a geometric morphometric analysis across the genus Uca (Crustacea: Brachyura: Ocypodidae). Biological Journal of the Linnean Society, v. 75, n. 2, p. 147-162, 2002. RUFINO, Marta M.; ABELLÓ, Pere; YULE, Andrew B. Geographic and gender shape differences in the carapace of Liocarcinus depurator (Brachyura: Portunidae) using geometric morphometrics and the influence of a digitizing method. Journal of Zoology, v. 269, n. 4, p. 458-465, 2006. SCALICI, M.; GIBERTINI, G. Sexual dimorphism and ontogenetic variation in the carapace of A. pallipes (Lereboullet, 1858). Italian Journal of Zoology, v. 76, n. 2, p. 179-188, 2009. SCHEINER, Samuel M. Genetics and evolution of phenotypic plasticity. Annual review of ecology and systematics, v. 24, n. 1, p. 35-68, 1993. SCHLUTER, Dolph. Ecology and the origin of species. Trends in ecology & evolution, v. 16, n. 7, p. 372-380, 2001.

SHINE, Richard. Ecological causes for the evolution of sexual dimorphism: a review of the evidence. The Quarterly Review of Biology, v. 64, n. 4, p. 419-461, 1989. SHORT, J. W. A revision of Australian river prawns, Macrobrachium (Crustacea: Decapoda: Palaemonidae). Hydrobiologia, v. 525, n. 1-3, p. 1-100, 2004. SIDLAUSKAS, Brian L.; MOL, Jan H.; VARI, Richard P. Dealing with allometry in linear and geometric morphometrics: a taxonomic case study in the Leporinus cylindriformis group (Characiformes: Anostomidae) with description of a new species from Suriname. Zoological Journal of the Linnean Society, v. 162, n. 1, p. 103-130, 2011. SILVA, Inês C. et al. Population differentiation of the shore crab Carcinus maenas (Brachyura: Portunidae) on the southwest English coast based on genetic and morphometric analyses. Scientia Marina, v. 74, n. 3, p. 435-444, 2010. SLATKIN, Montgomery. Ecological causes of sexual dimorphism. Evolution, p. 622- 630, 1984. SPAARGAREN, D. H. Shape and hydrodynamic properties in relation to size in marine macro-Crustacea. Crustaceana, v. 72, n. 2, p. 203-214, 1999. STREISSL, Franz; HÖDL, Walter. Growth, morphometrics, size at maturity, sexual dimorphism and condition index of Austropotamobius torrentium Schrank. Hydrobiologia, v. 477, n. 1, p. 201-208, 2002. TORRES, María Victoria; COLLINS, Pablo Agustín; GIRI, Federico. Morphological variation of freshwater crabs Zilchiopsis collastinensis and Trichodactylus borellianus (Decapoda, Trichodactylidae) among localities from the middle Paraná River basin during different hydrological periods. ZooKeys, n. 457, p. 171, 2014. TURCHETTO ZOLET, A. C. et al. Phylogeographical patterns shed light on evolutionary process in South America. Molecular Ecology, v. 22, n. 5, p. 1193- ‐ 1213, 2012. VALENCIA, Diego M.; CAMPOS, Martha R. Freshwater prawns of the genus Macrobrachium Bate, 1868 (Crustacea: Decapoda: palaemonidae) of Colombia. Zootaxa, v. 1456, p. 1-44, 2007. VERA-SILVA, Ana Luiza; CARVALHO, Fabrício L.; MANTELATTO, Fernando L. Distribution and genetic differentiation of Macrobrachium jelskii (Miers, 1877) (Natantia: Palaemonidae) in Brazil reveal evidence of non-natural introduction and cryptic allopatric speciation. Journal of Crustacean Biology, v. 36, n. 3, p. 373-383, 2016.

VOGT, Guenter. Abbreviation of larval development and extension of brood care as key features of the evolution of freshwater Decapoda. Biological Reviews, v. 88, n. 1, p. 81- 116, 2012. WALDMAN, John R.; GROSSFIELD, Joseph; WIRGIN, Isaac. Review of stock discrimination techniques for striped bass. North American Journal of Fisheries Management, v. 8, n. 4, p. 410-425, 1988. WARREN, Dan L.; GLOR, Richard E.; TURELLI, Michael. ENMTools: a toolbox for comparative studies of environmental niche models. Ecography, v. 33, n. 3, p. 607-611, 2010. WERNER, Earl E.; PEACOR, Scott D. A review of trait mediated indirect interactions in ecological communities. Ecology, v. 84, n. 5, p. 1083-1100, 2003. ‐ WHITMAN, D. W.; AGRAWAL, A. A. What is phenotypic plasticity and why is it important? In: WHITMAN, D.W.; ANANTHAKRISHNAN, T.N. (Eds.) Phenotypic Plasticity of Insects: Mechanisms and Consequences, Scientific Publishers, Enfield, 2009. p. 1-63. WILDERM. N., SUBRAMONIAM, T.; AIDA K. Yolk proteins of Crustacea. In: RAIKHEL, A. S.; SAPPINGTON, T. W. (Eds.). Reproductive Biology of Invertebrates Vol XIIA Progress in Vitellogenesis, Science Publishers, Enfield, 2002. p. 131-174. Williams, A. B. Shrimps, lobsters and crabs of the Atlantic coast of the eastern United States, Maine to Florida. Smithsonian Institution Press, Washington, 1984. WINDIG, JACK. J., DE KOVEL, C. G. F.; DE JONG, G. Genetics and mechanics of plasticity. In: DEWITT, T.J.; SCHEINER, S.M. (Eds.). Phenotypic Plasticity: Functional and Conceptual Approaches, Oxford University Press, Oxford, 2004. p. 31- 49 WINTERHALTER, Wade E.; MOUSSEAU, Timothy A. Patterns of phenotypic and genetic variation for the plasticity of diapause incidence. Evolution, v. 61, n. 7, p. 1520- 1531, 2007. ZIMMERMANN, Gabrielle et al. Geometric morphometrics of carapace of Macrobrachium australe (Crustacea: Palaemonidae) from Reunion Island. Acta Zoologica, v. 93, n. 4, p. 492-500, 2012.

TABLES Table 1 Selected locations in ecoregions Maranho Piauí, Mid-Northeast Caatinga and São Francisco to assess the abstraction of form prawn Macrobrachium jelskii (Miers, 1877) with description about the river/stream, basin and hydrodynamics. Long - Longitude; Lat - Latitude; N - abundance (males - M and females - F); n – number corresponding to the voucher deposited in the carcinological collection (GEEFAA-UFRN). Description of sample area Basin Ambient Long Lat n N Apodi river downstream of the barrage of Santa Cruz, RN. Apodi-Mossoró Lotic -37.772 -5.6582 114 F(30) M(29) Rio do Carmo downstream of Upanema, RN. Apodi-Mossoró Lotic -37.291 -5.5411 115 F(28) M(28) Reservoir on the river Umbuzeiro, CE. Jaguaribe Lentic -40.125 -6.6019 118 F(29) M(29) Umbunzeiro river downstream of the barragem of São Nicolau, CE. Jaguaribe Lotic -40.08 -6.6802 120 F(28) M(30) Jaguaribe river, CE. Jaguaribe Lotic -39.91 -6.542 122 F(30) M(30) Orós reservoir, CE. Jaguaribe Lentic -38.913 -6.2386 124 F(30) M(30) Jucá stream, CE. Jaguaribe Lotic -40.134 -6.3486 131 F(30) M(29) Paraíba river, PB. Paraíba do Norte Lotic -35.999 -7.5292 133 M(22) Epitácio Pessoa reservoir, PB. Paraíba do Norte Lentic -36.123 -7.4866 135 F(30) M(18) Piranhas river, RN. Piranhas-Açu Lotic -37.355 -6.3779 139 F(26) M(30) Downstream of Carnaúba barrage, RN. Piranhas-Açu Lentic -37.149 -6.6291 140 F(29) M(27) Mel stream, PE. São Francisco Lentic -37.371 -8.4173 150 F(30) M(28) Pajeú river downstream of the Jazido barrage, PE. São Francisco Lotic -38.245 -8.0005 151 F(29) M(13) São Francisco river, PE. São Francisco Lotic -40.578 -9.4533 155 F(30) M(28) Varzinha reservoir, PE. São Francisco Lentic -38.12 -8.033 186 F(30) M(30) Piauí river, PI. Parnaíba Lotic -42.236 -8.3668 880 F(31) M(17) Piauí river on the Jenipapo reservoir, PI Parnaíba Lotic -42.165 -8.4538 881 F(29) M(29) Canindé river downstream of barrage of Pedra Rodada, PI. Parnaíba Lotic -41.991 -7.975 882 F(29) M(28) States: RN – Rio Grande do Norte, CE – Ceará, PB – Paraíba, PE – Pernambuco, PI – Piauí.

Table 2 Morphological descriptions of the landmarks of specimens of Macrobrachium jelskii (Miers, 1877) to the body plans: lateral cephalothorax (LC), lateral of second abdominal somite (LSAS) and external face of cheliped (EFC).

Landmark Descriptions LC 1 Distal margin of rostral spine 2 Distal margin of adrostral carena 3 Proximal margin of adrostral carena 4 Intersection between dorsal margin and posterior margin 5 Maximum curvature of posterior margin 6 Intersection posterior margin and ventral margin 7 Maximum curvature of the transverse plane of the brachial region 8 Intersection between ventral margin and anterior margin 9 Depression below the antennal spine in the coronal plane 10 Rostral spine apex 11 Orbital curvature 12 Distal margin of the last inferior rostral tooth LSAS 1 Intersection of anterior margin and dorsal margin 2 Intersection between dorsal margin and posterior margin 3 Depression in the anterior coronal plane constriction 4 Depression in the posterior coronal plane constriction 5 Maximum anterior curvature in the inferior margin of the pleura 6 Intersection of anterior margin and ventral margin 7 Intersection between ventral margin and posterior margin 8 Maximum posterior curvature in the inferior margin of the pleura EFC 1 Fixed finger apex 2 Posterior depression to fixed finger apex 3 Maximum curvature in the ventral margin of the distal portion of fixed finger 4 Maximum medial curvature between dorsal margin of fixed dactyl and anterior margin of palm 5 Intersection of anterior margin and dorsal margin 6 Dorsal point in the transversal plane of the palm 7 Maximum curvature between the dorsal margin and posterior margin 8 Point at the posterior margin in the medial line 9 Maximum curvature between the posterior margin and ventral margin 10 Central point in the transversal plane of the palm 11 Ventral point in the sagittal plane to the articulation of fixed dactyl 12 Ventral point in the transversal plane of fixed dactyl

Table 3 Statistical results of the discriminant function analysis and cross-validation matrix for the hypothesis of sexual differences (M - male, F - female) in the species Macrobrachium jelskii (Miers, 1877) to the body plans: lateral carapace (LC), lateral of second abdominal somite (LSAS) and external face of cheliped (EFC). Pcr – Procrustes distance, %AC – percentual assimilation correct of cross-validation matrix. Values in bold indicate statistical significance (p <0.05).

LC Statistic Cross-validation Matrix Pcr 0.0392 F M Total %CA Pcr (p-value) <0.0001 F 459 57 516 88.95 T-square 1534.090 M 52 397 449 88.42 T-square (p-value) <0.0001 LSAS Pcr 0.0389 F M Total %CA Pcr (p-value) <0.0001 F 387 104 491 78.82 T-square 763.2458 M 69 401 470 85.32 T-square (p-value) <0.0001 EFC Pcr 0.0098 F M Total %CA Pcr (p-value) <0.0001 F 364 97 461 78.96 T-square 522.1589 M 119 324 443 73.14 T-square (p-value) <0.0001

Table 4 Statistical results of the discriminant function analysis and cross-validation matrix for the hypothesis of hydrodynamic differences (LENT - lentic, LOT - lotic) in the species Macrobrachium jelskii (Miers, 1877) to the body plans: lateral carapace (LC), lateral of second abdominal somite (LSAS) and external face of cheliped (EFC). Pcr – Procrustes distance, %AC – percentual assimilation correct of cross-validation matrix. Values in bold indicate statistical significance (p <0.05).

LC Statistic Cross-validation Matrix Pcr 0.0091 LENT LOT Total %CA Pcr (p-value) 0.0001 LENT 227 113 340 66.76 T-square 195.0673 LOT 223 402 625 64.32 T-square (p-value) <0.0001 LSAS Pcr 0.0083 LENT LOT Total %CA Pcr (p-value) 0.0115 LENT 209 103 339 61.65 T-square 101.6071 LOT 244 378 622 60.77 T-square (p-value) <0.0001 EFC Pcr 0.0112 LENT LOT Total %CA Pcr (p-value) <0.0001 LENT 215 111 326 65.95 T-square 356.6289 LOT 138 440 578 76.12 T-square (p-value) <0.0001

Table 5 Statistical results of the canonical variate analysis to the body plans (lateral carapace - LC, lateral of second abdominal somite - LSAS and external face of cheliped - EFC) between populations of prawn Macrobrachium jelskii (Miers, 1877) (APO - Apodi-Mossoró, JAG - Jaguaribe, RIP - Piranhas-Açu, GNP - Parnaíba, PNORT - North Paraiba, SFR - San Francisco). CVs - axis of CVA, Eigenvalues CumVar (%) - Cumulative Variance Percentage of CVs, Pcr – Procrustes distance. Values in bold indicate statistical significance (p <0.05).

LC % p- CVs Eig % Var APO JAG PIR PNB PNORT SFR CumVar value/Pcr 1 0.554 46.95 46.95 APO 0.019 0.0234 0.0174 0.0191 0.0158 2 0.300 25.40 72.35 JAG <0.0001 0.0293 0.0211 0.0194 0.0124 3 0.159 13.46 85.81 PIR <0.0001 <0.0001 0.0175 0.0259 0.0213 4 0.121 10.23 96.04 PNB <0.0001 <0.0001 <0.0001 0.0221 0.0111 5 0.047 3.96 100.00 PNORT <0.0001 <0.0001 <0.0001 <0.0001 0.0164 SFR <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 LSAS APO JAG PIR PNB PNORT SFR 1 0.142 36.57 36.57 APO 0.0165 0.0218 0.0176 0.0272 0.0179 2 0.103 26.61 63.19 JAG 0.0024 0.0229 0.0112 0.0201 0.0098 3 0.073 18.71 81.90 PIR 0.0002 <0.0001 0.0213 0.0276 0.0196 4 0.041 10.68 92.58 PNB 0.0026 0.0265 <0.0001 0.0213 0.0116 5 0.029 7.42 100.00 PNORT <0.0001 0.0014 <0.0001 0.0006 0.0207 SFR 0.0012 0.0455 0.0003 0.0327 0.0011 EFC APO JAG PIR PNB PNORT SFR 1 0.465 44.59 44.59 APO 0.0089 0.0216 0.0093 0.0085 0.0145 2 0.313 30.00 74.59 JAG <0.0001 0.0158 0.0099 0.0096 0.0082 3 0.136 13.02 87.61 PIR <0.0001 <0.0001 0.0192 0.022 0.0103 4 0.083 7.95 95.56 PNB <0.0001 <0.0001 <0.0001 0.0099 0.0117 5 0.046 4.44 100.00 PNORT <0.0001 <0.0001 <0.0001 <0.0001 0.0135 SFR <0.0001 <0.0001 <0.0001 <0.0001 <0.0001

FIGURES

Fig. 1 Sample locations of the prawn Macrobrachium jelskii (Miers, 1877) with representations of the basins, ecoregions (Proposed by Albert & Reis 2011) and hydrodynamic regimes. Symbol "X" inside circle represent the locations selected for abstraction of form.

Fig. 2 Macrobrachium jelskii (Miers, 1877). Representation of landmarks in each body structure plan, adjusting Procrustes and graphics like 'wireframe' from landmarks coordinates. (a) lateral of the cephalotorax - LC, (b) the lateral of the second abdominal somite - LSAS, (c) the external face of cheliped - EFC.

Fig. 3 Multivariate regression of the form (scores regression in procrustes coordenate) by size (centroid size) highlighting the shape variation in centroid sizes. (a) lateral of the cephalotorax - LC, (b) the lateral of the second abdominal somite - LSAS, (c) the external face of cheliped - EFC.

Fig. 4 Principal components analysis of the shape to the lateral plane lateral of the cephalotorax (LC) of prawn Macrobrachium jelskii (Miers, 1877), (a) sexual dimorphism (b) hydrodynamics, (c) population variations and (d) deforming grids for each principal component.

Fig. 5 Principal components analysis of the shape to the lateral of the second abdominal somite (LSAS) of prawn Macrobrachium jelskii (Miers, 1877) (a) sexual dimorphism (b) hydrodynamics, (c) population variations and (d) deforming grids for each principal component.

Fig. 6 Principal component analysis of the variation in shape to the external face of cheliped (FEQ) of prawn Macrobrachium jelskii (Miers, 1877) (a) sexually dimorphic (b) hydrodynamic (c) population variations and (d) deforming grids for each principal component.

Fig. 7 Comparison of body shape and frequencies from discriminant function analysis for the hypothesis of sexual diferences (males and females) in the morphological struture of (a) lateral of the cephalotorax - LC, (b) the lateral of the second abdominal somite - LSAS, (c) the external face of cheliped - EFC.

Fig. 8 Comparison of body shape and frequencies from discriminant function analysis for the hypothesis of hydrodinamic diferences (lentic and lotic) in the morphological struture of (a) lateral of the cephalotorax - LC, (b) the lateral of the second abdominal somite - LSAS, (c) the external face of cheliped - EFC.

Fig. 9 Scatterplot of shape canonical variables analysis and deforming grids for each axis of canonical variable (CV) of the lateral of the cephalotorax (LC) between populations (APO - Apodi-Mossoró, JAG - Jaguaribe, PIR - Piranhas-Açu, PNB- Parnaíba, PNORT – Paraíba do Norte, SFR - São Francisco) of prawn Macrobrachium jelskii (Miers, 1877). Consensus - Moderate form from Procrustes adjustment.

Fig. 10 Scatterplot of shape canonical variables analysis and deforming grids for each axis of canonical variable (CV) of the lateral of the second abdominal somite (LSAS) between populations (APO - Apodi-Mossoró, JAG - Jaguaribe, PIR - Piranhas-Açu, PNB- Parnaíba, PNORT – Paraíba do Norte, SFR - São Francisco) of prawn Macrobrachium jelskii (Miers, 1877). Consensus - Moderate form from Procrustes adjustment.

Fig. 11 Scatterplot of shape canonical variables analysis and deforming grids for each axis of canonical variable (CV) of the external face of cheliped (EFC) between populations (APO - Apodi-Mossoró, JAG - Jaguaribe, PIR - Piranhas-Açu, PNB- Parnaíba, PNORT – Paraíba do Norte, SFR - São Francisco) of prawn Macrobrachium jelskii (Miers, 1877). Consensus - Moderate form from Procrustes adjustment.

Fig. 12 Dendogram resulting from cluster analysis with procrustes distance values between populations (APO - Apodi-Mossoró, JAG - Jaguaribe, PIR - Piranhas-Açu, PNB - Parnaíba, PNORT – Paraíba do Norte, SFR - São Francisco) showing of shape struture of populations for (a) lateral of the cephalotorax - LC, (b) the lateral of the second abdominal somite - LSAS, (c) the external face of cheliped - EFC. CCC - cophenetic correlation coefficient.

3. CAPÍTULO II: Evidência genética de introdução do camarão Macrobrachium jelskii (Miers, 1877) (Caridea: Palaemonidae) nas bacias do Nordeste brasileiro e a implicação de pseudogenes mitocondriais em estudos moleculares de crustáceos

Sávio A. S. N. Moraes1*; Ghennie T. R. Rey2,3; Sergio M. Q. Lima4; Fúlvio A. M. Freire1

1Grupo de Estudos em Ecologia e Fisiologia de Animais Aquáticos, Departamento de Zoologia e Botânica, Centro de Biociências, Universidade Federal do Rio Grande do Norte, Rio Grande do Norte, Brasil 2Laboratório de Biodiversidade Molecular, Departamento de Genética, Instituto de Biologia, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brasil 3Departamento de Ciencias Biológicas, Universidad de Caldas, Manizales, Colombia 4Laboratório de Ictiologia Sistemática Evolutiva, Departamento de Zoologia e Botânica, Centro de Biociências, Universidade Federal do Rio Grande do Norte, Rio Grande do Norte, Brasil Autor correspondente: [email protected]

Evidência genética de introdução do camarão Macrobrachium jelskii (Miers, 1877) (Caridea: Palaemonidae) nas bacias do Nordeste brasileiro e a implicação de pseudogenes mitocondriais em estudos moleculares de crustáceos

Sávio A. S. N. Moraes1*; Ghennie T. R. Rey2,3; Sergio M. Q. Lima4; Fúlvio A. M. Freire1

Resumo Macrobrachium jelskii é uma espécie de ampla distribuição na América do Sul, contudo há evidências de introdução desta espécie em corpos d’água, principalmente no Nordeste do Brasil. O presente visou sanar os questionamentos sobre a naturalidade das ocorrências do M. jelskii no Nordeste brasileiro. Foram extraídas, amplificadas e sequenciadas amostras das bacias de Apodi-Mossoró, Jaguaribe, Piranhas-Açú, Paraíba do Norte, São Francisco e Parnaíba, pertencentes a três ecorregiões distintas. A inferência filogenética bayesiana revelou monofiletismo entre as linhagens da espécie M. jelskii, com baixa divergência genética. As estimativas de estruturação populacional indicam uma baixa diversidade haplotípica e diversidade nucleotídica média, corroborando a hipótese de introdução não-natural por ações do Departamento de Obras Contra a Seca. Nos eletroferogramas obtidos com os iniciadores universais para o gene COI foram observados alguns picos duplos e muito ruído, provavelmente resultado da co- amplificação de pseudogenes mitocondriais. Ressalta-se a importância de iniciadores

66 específicos e cuidado em analisar dados de crustáceos, que já apresentam casos de co- amplificação documentado.

Palavras-chaves: camarão-sossego, Decapoda, NuMts, distribuição geográfica, Caatinga semiárida.

3.1.INTRODUÇÃO

Os camarões de água doce do gênero Macrobrachium Spence Bate, 1868 tem distribuição espacial pan-tropical (DE GRAVE; CAI; ANKER, 2008; VALÊNCIA; CAMPOS, 2007). Das espécies que possuem ampla distribuição geográfica, podemos citar a espécie Macrobrachium jelskii. Aespécie foi descrita, inicialmente, como Palaemon jelskii por Miers (1877), coletado pelo naturalista Konstanty Jelski em 1965 na localidade-tipo no rio Oyapock (Oiapoque), Guiana Francesa e, encontrado em simpatria com M. amazonicum. Uma ampla gama da literatura defende a distribuição natural de M. jelskii, nas bacias do rio Amazonas e Orinoco (BASTOS; PAIVA, 1959; COLLINS, 2000; HOLTHUIS, 1950, 1966). Porém, algumas literaturas são muito abrangentes quanto à distribuição citando a América do Sul como distribuição natural (COELHO; RAMOS-PORTO, 1985; MAGALHÃES et al., 2005; MELO, 2003; RODRÍGUEZ, 1981). Muitas espécies congêneres, que apresentam distribuições geográficas extensas na América do Sul, como M. jelskii, demostraram estruturação genética entre clados bacias costeiras e continentais, mas com baixas distâncias gênica entre grupos (CARVALHO; PILEGGI; MANTELATTO, 2013; VERGAMINI; PILEGGI; MANTELATTO, 2011). Todavia, algumas espécies com ampla distribuição geográfica levam ao questionamento sobre a ocorrência natural em algumas áreas, como a espécie M. amazonicum (Heller, 1862), devido as ações governamentais de transferência de espécimes de peixes e crustáceos. Gurgel e Oliveira (1987) afirmam que entre 1933 e 1985 o Departamento de Obras Contra a Seca (DNOCS) introduziu M. amazonicum (Heller, 1862), M. acanthurus (Wiegmann, 1836), M. jelskii e outras 39 espécies de peixes nos açudes, rios e riachos do nordeste brasileiro, para incentivar a atividade de pesca comercial e de subsistência das comunidades do semiárido. Relatam ainda, que ao capturarem as matrizes de M. amazonicum perceberam que foram ineficientes em triar os espécimes de M. jelskii que

67 co-habitavam o mesmo habitat, sendo estes introduzidos juntamente com o camarão- canela. No entanto, os mesmos autores afirmaram que os camarões M. jelskii já era nativa das bacias do Nordeste brasileiro. Mas, nenhum estudo prévio ou material referencial é citado, e, portanto, sua ocorrência prévia inconclusiva. Excetuando-se os indícios de introdução não-natural, as relações evolutivas de organismos de água doce podem ser reflexo de conexões pretéritas entre bacias, por paleo-canais nas regressões do nível do mar durante o Pleistoceno (TURCHETTO- ZOLET et al., 2012), ou aos ajustes neotectônicos (e. g. captura de cabeceiras) (ALBERT; REIS, 2011). Estudos dos crustáceos continentais, no Nordeste brasileiro, podem elucidar se a ocorrência de algumas espécies é natural ou resultado da intervenção antrópica. Com isso, pode-se validar o estado da arte da diversidade das bacias do nordeste brasileiro que representam um vale no conhecimento biológicos e eco-evolutivo. Deste modo, é possível entender os processos que possam ter influenciado a diversidade biológica em uma escala de tempo recente (e. i. composição de comunidades), como uma escala de tempo geológica (i. e. linhagens evolutivas), devido a eminente transposição de águas da bacia do rio São Francisco para as bacias do Nordeste Médio-Oriental: dos rios Jaguaribe, Piranhas-Açu, Apodi-Mossoró e Paraíba do Norte (GRANT et al., 2012; MEADOR, 1992; PITTOCK; MENG; CHAPAGAIN, 2009). Com isso, linhagens isoladas podem ter seu fluxo gênico reestabelecido, (BLANCO et al., 2009; PERES et al., 2012), o que pode resultar na perda de adaptações locais, e, consequente, a perda da diversidade (BELLAFRONTE et al., 2010; GRANT et al., 2012). Abordagens utilizando dados moleculares tem progredido consideravelmente, e contribuído para a compreensão de processos de dispersão, vicariância e especiação inerentes a diversificação de linhagens evolutivas, possibilitando o desenvolvimento de métodos e técnicas para caracterizar geneticamente os taxa (FREELAND, 2005; TENEVA, 2009). Como marcador molecular mitocondrial (mtDNA), podemos destacar o gene Citocromo Oxidase I (COI), caracterizado pelo amplo polimorfismo intraespecífico, elevada taxa de mutação e herança uniparental, utilizado em diversos estudos, incluindo filogeografia, reconstrução de história demográfica e diversificação (LEITE, 2012). Apesar da utilização do versátil do gene mitocondrial COI em uma miríade de resoluções filogenéticas e filogeográficas, dados genéticos devem ser manuseados e inspecionados com cuidado, ressaltando presença de pseudogenes no processo de

68 amplificação e sequenciamento. Também conhecidos como DNA mitocondrial nuclear (NuMts), estes caracterizam-se por serem cópias não funcionais de sequências mitocondriais incorporadas ao genoma nuclear (BALDO et al., 2011; BENSASSON et al., 2001; KIM; LEE; JU, 2013; LEITE, 2012; LOPEZ et al., 1994). Esta transferência de genes mitocondriais ao DNA nuclear, em procariontes, pode ocorrer através de transferência direta ou mediada por RNAs (viral) (D'ERRICO; GADALETA; SACCONE, 2004; FRÉZAL; LEBLOIS, 2008; SONG et al., 2008; WILLIAMS; KNOWLTON, 2001). No caso de eucariontes, pode ocorrer durante a reprodução, em que pode haver uma falha na eliminação das mitocôndrias paternas durante a fecundação (i. e. introgressão), havendo a formação do zigoto com mitocôndrias maternas e paternas (HAZKANI-COVO; ZELLER; MARTIN, 2010). Quando transferidos para o núcleo, o gene mitocondrial perde sua função original, e torna-se um pseudogene, passando a acumular mutações (GAZIEV; SHAIKHAEV, 2010; STRUGNELL; LINDGREN, 2007). Os pseudogenes são difíceis de serem identificados pelas semelhanças estruturais com o gene original, mas podem não ter códon de terminação, íntros ou regiões controle, e assim não traduzem proteínas funcionais (D'ERRICO; GADALETA; SACCONE, 2004; GERSTEIN; ZHENG, 2006). Estes ocorrem em maior frequência em procariotos, originados por erros no processo de transcrição, mas podem ser detectados em vários grupos de eucariotos (ARTHOFER et al., 2010; BENSASSON et al., 2001; DEN TEX et al., 2010; RICHLY; LEISTER, 2004; SUNNUCKS; HALES, 1996; TIMMIS et al., 2004). A integração de uma cópia de um gene mitocondrial ao genoma nuclear é evidente em mais de 70 espécies de crustáceos, dentre eles decápodes dos gêneros Austinograea Hessler & Martin, 1989 (KIM; LEE; JU, 2013), Cardisoma Latreille in Latreille, Le Peletier, Serville & Guérin, 1828 e Geryon Krøyer, 1837 (SCHUBART, 2009), Cherax Erichson, 1846 (NGUYEN; MURPHY; AUSTIN, 2002), Orconectes Cope, 1872 (SONG et al., 2008), Alpheus Fabricius, 1798 (WILLIAMS; KNOWLTON 2001; WILLIAMS et al., 2001), Lysmata Risso, 1816 (BAEZA; FUENTES, 2013) e Macrobrachium (LIU; CAI; TZENG, 2007). Apesar de apenas um trabalho reportar tal fenômeno, existe uma gama expressiva de estudos filogenéticos e filogeográficos com camarões do gênero Macrobrachium (GUERRA et al., 2014; MACIEL et al., 2011; PILEGGI; MANTELATTO, 2010; ROSSI; MANTELATTO, 2013; VERGAMINI; PILEGGI;

MANTELATTO, 2011) que possivelmente tenham se deparado com isto ou não tenham atentado para esta singularidade. Deste modo, o presente estudo visou entender a estruturação genética, verficou a distribuição geográfica do M. jelskii no Nordeste brasileiro é natural ou foi um evento de introdução por ação antrópica. Além disso, reportou a presença de NuMts e suas implicações aos estudos que utilizem dados moleculares.

3.2.MATERIAL E MÉTODOS

3.2.1. Coleta de dados

Foram amostrados exemplares de M. jelskii entre os meses de março de 2012 e abril de 2013, realizadas com o uso de vários apetrechos de pesca: peneiras, redes de arrasto (10m de comprimento; 1,5m de altura; 0,5 distância entre nós), tarrafa, covos, seguindo o método RAP (Rapid Assesment Program), com avaliação dos apetrechos que podem ser empregados de acordo com as características de cada local de coleta. Para as análises moleculares foram utilizados tecidos (músculo) fixados em álcool 96%, de preferencialmente dez (10) exemplares de cada bacia. As coletas abrangeram as bacias do rio Parnaíba (PNB) da ecorregião do Maranhão-Piauí, do rio Apodi-Mossoró (APO), Piranhas-Açú (PIR), Jaguaribe (JAG), Paraíba do Norte (PNORT), da ecorregião do Nordeste Médio-Oriental; e São Francisco (SFR) da ecorregião homônima (Figura 1). Todos os espécimes foram identificados de acordo com os caracteres morfológicos e merísticos de suas descrições na literatura (GARCÍA-DÁVILA; MAGALHÃES, 2003; HOLTHUIS, 1959; MELO, 2003).

3.2.2. Extração, amplificação e verificação das sequências de DNA

A sequência mitocondrial do gene Citocromo Oxidase Sub-unidade I (COI) foi obtida através do protocolo de extração com cloreto de sódio (modificado de MILLER; DYKES; POLESKY, 1988). Um fragmento de tecido muscular de aproximadamente 20 mg foi homogeneizado em 500μL de tampão de lise (Tris HC 50mM, EDTA 50mM, SDS 1%, NaCl 50mM, pH 8,0) com 60μg de proteinase K e incubado a 55°C, durante no mínimo três horas até a digestão completa do tecido. Após isso, os restos celulares foram

70 estratificados pela centrifugação a 14.000rpm (12.000g) por 15min. Para a precipitação das proteínas, pela menor solubilidade em altas concentrações salinas, foi adicionado ao sobrenadante 300μL de NaCl (5M) seguido de centrifugação a 14.000rpm durante 15min. O material extraído, 500μL do sobrenadante, foi transferido a um novo tubo, adicionando 500μL isopropanol absoluto gelado e, armazenado durante duas horas a - 20°C para a otimização do processo de precipitação. Após isso, foi homogeneizado foi centrifugado a 14.000rpm por 15min completando a precipitação do material. Em seguida, para diminuição da salinidade, o pellet de DNA formado foi lavado duas vezes com 750μL de etanol 70% (v/v) gelado e centrifugado a 14.000rpm por 5min. Subsequentemente, o pellet foi seco a 15°C por 15min a vácuo (Concentrator plus, Eppendorf) e ressuspendido em 50μL de água destilada. O material genético foi quantificado em nanofotômetro (Implen®) e todas as amostras foram normalizadas para uma concentração aproximada de 30ng/μL e armazenados a -20°C. A amplificação e identificação das sequências dos marcadores mitocondriais podem ser prejudicadas pela co-amplificação ou amplificação preferencial de cópias de regiões mitocondriais dentro do genoma nuclear (NuMts  Nuclear Mitochondrial DNA sequence), fenômeno comum em crustáceos (BUHAY, 2009; SCHUBART, 2009; WILLIAMS; KNOWLTON, 2001). Assim, foi realizada uma análise preliminar para avaliar a qualidade das sequências obtidas com dois pares de iniciadores para o fragmento do extremo 3ˈ do gene mitocondrial da citocromo oxidase I (COI). Para esta avaliação, foram usados os iniciadores universais COIf e COIa desenvolvidos por Palumbi e Benzie (1991) e os iniciadores COL8 e COH1b desenvolvidos por Schubart (2009) especificamente para decápodes (Tabela 1). Para às análises foram empregados nove indivíduos de localidades diferentes (CRT2329, CRT2343, CRT2365, CRT2402, CRT2410, CRT2431, CRT2438, CRT2465 e CRT2517). As reações de amplificação continham aproximadamente 30 ng de gDNA, 1 U de enzima GoTaq Flexi DNA polimerase, 3 μL de tampão Green GoTaq Flexi (5X),

0,2 mM de cada dNTP, 2,5 mM de MgCl2 para as amplificações com COL8/COH1b ou

2,0 mM de MgCl2 para as amplificações com COIf/COIa, e 0,3 μM de cada iniciador em um volume final de 15 μL. Os parâmetros de termociclagem para as amplificações foram: um ciclo inicial de desnaturação a 95 °C por 5 minutos, seguido por 35 ciclos de 1 minuto de desnaturação a 95 °C, anelamento de 40 segundos a 48 °C para COL8/COH1b ou 64 °C para COIf/COIa, e extensão durante 45 segundos a 72 °C, seguidos de uma extensão

71 final de 5 minutos a 72 °C. Os produtos de PCR que continham mais de 40 ng/μL de DNA foram purificados através do uso de esferas magnéticas com o kit de purificação de produtos de PCR Agencourt® AMPure® na plataforma epMotion® 5075 (Eppendorf). Os sequenciamentos foram realizados no sequenciador automático ABI3500 (Applied Biosystems), do Laboratório de Biodiversidade Molecular da Universidade Federal do Rio de Janeiro (LBDM/UFRJ) e a edição dos eletroferogramas foi feita no programa SeqMan II 4.0. Adicionalmente, uma análise do número de nucleotídeos diferentes entre as sequências obtidas com os dois pares de iniciadores de cada indivíduo, realizada com o programa Mega 7 (TAMURA et al., 2007). Com o intuito de determinar se estavam sendo co-amplificados NuMts com os iniciadores universais e se a sequência obtida com os iniciadores específicos para decápodes representava a sequência de origem mitocondrial, foi desenhado um iniciador específico (COI_MA_R) para os camarões do género Macrobrachium (Tabela 1). O iniciador foi desenvolvido a partir do alinhamento dos genomas mitocondriais de três espécies do género disponíveis no GenBank (M. nipponense - NC015073, M. lanchesteri - NC012217 e M. rosenbergii - NC006880), e encontra-se ancorado no extremo 3ˈ conservado do gene. As reações de amplificação para os iniciadores COIf / COI_MA_R foram feitas da maneira descrita anteriormente, porém, empregando 2.5 mM de MgCl2 nas reações, uma temperatura de anelamento de 55 °C por 40 segundos, e uma extensão de 1 minuto a 72 °C nos 35 ciclos. Posteriormente, as sequências obtidas com COI_MA_R foram semelhantes a aquelas obtidas com os iniciadores COL8/COH1b, indicando que estas representam mais provavelmente as sequências de origem mitocondrial e que as sequências recuperadas com os iniciadores universais podem ser consideradas como de origem nuclear. Para a visualização da superestimação de linhagens filogenéticas propiciadas pelo uso de NuMts em reconstruções filogenéticas, foi utilizado o método de filogenia Neighbor-Joining utilizando o modelo de substituição de caracteres “Hasegama-Kishino- Yano” (HKY), indicado pelos os valores dos critérios de AIC (Critério Akaike) e BIC (Critério Bayesiano), e com 1000 ‘bootstrap’ permutações. Os prováveis dados com NuMts foram retirados do manuscrito (VERA-SILVA; CARVALHO; MANTELATTO, 2016). Os ‘outgroup’ utilizados estão detalhados na Tabela 2.

3.2.3. Inferência filogenética e estruturação genética

Após a edição, as sequências foram alinhadas utilizando o algoritmo Clustal W presente no programa Mega 7 e inspecionados visualmente e editados, quando necessário. O Modelo de Verossimilhança da corrida foi ajustado utilizando o programa jModeltest 0.1.1 (POSADA, 2008) os valores dos critérios de AIC e BIC para cada modelo de substituição de caracteres “Hasegama-Kishino-Yano” (HKY). E para determinação da burn-in de 10% foi utilizado o Tracer 1.6 (RAMBAUT et al., 2013). Para representação das relações filogenéticas (genealogia) dos grupos populacionais e congêneres foi utilizado inferência Bayesiana (mcmc = 10000000) Análise filogenética por Inferência Bayesiana foi realizada usando o programa BEAST v. 1.7 (DRUMMOND et al., 2012) com os seguintes parâmetros: sítios = modelo de substituição de nucleotídeos; relógio molecular = relógio relaxado com distribuição log- normal; taxa de mutação = 0,014% por MA (KNOWLTON; WEIGHT, 1998). As sequências de ‘outgroup’ e de M. jelskii (localidade Pereira Barreto, São Paulo, Brasil) de Citocromo Oxidase subunidade I foram obtidas no GenBank (National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov). Os ‘outgroup’ utilizados estão detalhados na Tabela 2. Para estimar a variabilidade intraespecífica, os índices de diversidade haplotípica (h) e nucleotídica (p), com sua variância e desvio padrão, foram obtidos usando o programa DnaSP 5.1 I (LIBRADO; ROZAS, 2009). E para verificar diferenças entre as populações/haplótipo foi uma utilizada uma AMOVA (Análise Molecular de Variância) (Arlequin software v. 3.5; EXCOFFIER; LISCHER, 2010).

3.3.RESULTADOS

Foram extraídos sequencias de 9 exemplares da bacia hidrográfica do Apodi- Mossoró (Santa Cruz - RN), 10 da bacia Jaguaribe (Orós – CE e Saboeiro – CE), 10 da bacia Piranhas-Açú (Bonito de Santa Fé – PB e Aparecida – RN), 9 da bacia Paraíba do Norte (Barra de Santana – PB e Boqueirão – PB), 10 da bacia São Francisco (Buíque – PE e Ouricuri – PE), e 9 exemplares da bacia do Parnaíba (São João do Piauí – PI) (Tabela 2).

Nos eletroferogramas obtidos com os iniciadores universais para o gene (COIf e COIa) foram observados alguns picos duplos (sobreposição do sinal de fluorescência de dois nucleotídeos no mesmo sítio) e muito ruído (background) (Figura 2). Já os eletroferogramas obtidos com os iniciadores específicos para decápodes (COL8/COH1b) exibiram picos bem definidos com pouco background e não apresentaram sinais de picos duplos. Os eletroferogramas obtidos com o iniciador COI_MA_R apresentaram pouco background e não exibiram sinais de picos duplos, enquanto que os eletroferogramas obtidos com o iniciador COIf apresentaram uma qualidade moderada. Em adição, a análise do número de nucleotídeos diferentes entre as sequências obtidas com os dois pares de iniciadores de cada indivíduo revelou que as sequências apresentavam entre 20 e 35 nucleotídeos diferentes, porém nenhuma das sequências exibia códons de parada ou indels. A inferência filogenética bayesiana revelou basicamente três clados. O clado I demostra um grupo polifilético agrupando linhagens de Macrobrachium carcinus (Linnaeus, 1758) com uma linhagem do M. americanum Spence Bate, 1868, uma relação monofilética entre as linhagens de M. crenulatum Holthuis, 1950 e M. olfersii (Wiegmann, 1836), e por fim, um agrupamento monofilético entre as linhagens de M. heterochirus (Wiegmann, 1836), M. brasiliense (Heller, 1862), M. acanthurus (Wiegmann, 1836) e Cryphiops caementarius. O clado II mostrou um parafiletismo entre as linhagens M. jelskii e linhagens de M. ferreirai Kensley & Walker, 1982 e M. borellii (Nobili, 1896). O clado III mostrou monofiletismo entre as linhagens M. amazonicum (Figura 2). Sendo possível ratificar também que os exemplares amostrados da espécie Macrobrachium jelskii representam um clado monofilético suportando as linhagens como realmente uma única espécie (Figura 3). As estimativas de estruturação populacional indicam uma baixa diversidade haplotípica (H = 0,095 ± 0,050) e uma baixa diversidade nucleotídica média (π = 0,0044 ± 0,0019) (Tabela 3). Evidenciando diferenças estatísticas apenas nas comparações par- a-par com as linhagens de bacia do Paraná (Barreto - SP) (p < 0,05). Há um haplótipo compartilhado entre todas as localidades de cada bacia do Nordeste brasileiro, contudo apenas um haplótipo exclusivo referente a bacia do rio Paraná-Paraguai.

3.4.DISCUSSÃO

Marginalmente ao foco do presente estudo, a inclusão de uma linhagem da espécie Cryphiops caementarius a um clado de representantes do gênero Macrobrachium ressalta a questão do parafiletismo do gênero Macrobrachium, representado no clado I, já relatado por outras abordagens metodológicas e outros marcadores moleculares (CARVALHO; PILEGGI; MANTELATTO, 2013; MURPHY; AUSTIN, 2005; PEREIRA, 1997; PILEGGI; MANTELATTO, 2010; PILLEGGI et al., 2014; ROSSI; MANTELATTO, 2013). O cenário de baixa diversidade haplotípica e baixa diversidade nucleotídica possivelmente representa o reflexo de um recente episódio de gargalo populacional frente a uma pressão seletiva ou um cenário de efeito fundador (HARTL, 2008). Casos de variação genética reduzida podem significar que a população passou por um vale adaptativo, onde ocorreu a redução drástica do tamanho efetivo populacional. Isto pode ser causado por diversos fatores, como desastre natural, descontrole no equilíbrio “bottom-up”, sobreexplotação, perda de habitat e diminuição nas taxas de migração devido a uma barreira geográfica (RIDLEY, 2006). Isto também pode ser observado em populações que migraram para um novo habitat (ABDELKRIM et al. 2005) ou em espécies que foram introduzidas por atividade antrópica (DLUGOSCH; PARKER, 2008; NOVAK; MACK, 2005; SHIRK et al., 2014; WARES; HUGHES; GROSBERG, 2005). Geralmente, em espécies que tiveram apenas um evento de introdução não-natural é observado uma baixa diversidade gênica, em que ocorre o transporte de exemplares de apenas uma localidade fonte, levando apenas uma pequena parcela do patrimônio genético da espécie, e introduzido em uma nova área que não possui interligação com o local de origem (HANDLEY et al., 2011). O presente estudo sugere uma forte evidência genética de introdução por atividade antrópica devido à baixa diversidade genética apresentada. O fato citado por Gurgel e Oliveira (1987) de que a espécie já era encontrada no Nordeste brasileiro, pode ser resultado de erro taxonômico, e/ou, em um cenário especulativo, a espécie que era nativa foi extinta por exclusão competitiva (BØHN; AMUNDSEN; SPARROW, 2008) e/ou pela adição de predadores como peixes da espécie do gênero Cichla Bloch & Schneider, 1801. O compartilhamento de haplótipo com linhagens de M. jelskii da Bacia do Paraná- Paraguai pode ser reflexo do transporte da corvina Plagioscion squamosissimus (Heckel,

1840) entre os anos 1966 e 1973 (TORLONI et al., 1993), oriundos de reservatórios do Nordeste do Brasil, uma das espécies que foram introduzidas pelo DNOCS. O segundo haplótipo, pode representar um evento de introdução acidental não documentado proveniente da bacia Amazônica ou Orinoco, baseado nos históricos de introdução ocorridos em reservatórios brasileiros (COLLEN et al., 2003; GURGEL & OLIVEIRA, 1987; TORLONI et al., 1993). Tais evidências apresentadas anteriormente somadas ao fato de que M. jelskii é uma das poucas espécies que não dependem de águas salobras ou estuários para completar seu ciclo de vida, em que as larvas necessitam da salinidade para completar seu crescimento e metamorfose (HOLTHUIS, 1952). Esses atributos da espécie provavelmente, contribuíram para a aclimatação de M. jelskii ao clima semiárido da região, onde a grande maioria dos rios é intermitente e passam por extensos períodos empoçados e sem continuidade com suas respectivas desembocaduras e estuários (ROSA et al., 2003). A característica que pode ter reforçado isto, é a abreviação do estágio larval da espécie, em que, evolutivamente, foi fixado um encurtamento do número de estágio larvais, resultando em três estágios larvais (2 zoea e 1 pos-zoea), com menor número de prole, ovos maiores (1,59 – 2,39mm de diâmetro) e grande quantidade de vitelo (GAMBA, 1980, 1984, 1997; MAGALHÃES, 2000; PAIVA; BARRETO, 1960; SOARES; OSHIRO; TOLEDO, 2015). Fato contrastante frente às demais espécies de Macrobrachium, que tem em média de dez estágios larvais, prole grande, ovos pequenos (0,40 – 1,20mm de diâmetro) e menor quantidade de vitelo (JALIHAL; SANKOLLI; SHENOY, 1993). Contudo, um estudo molecular recente, utilizando a região mitocondrial COI, para entender o padrão de distribuição geográfica de M. jelskii, relatou dois clados, um representado por uma linhagem Amazônica (Bacias Amazônica, Parnaíba, Piranhas-Açú, São Francisco, Atlântico Leste e Paraná-Paraguai), e outro clado, representada por uma linhagem Costeira (somente as bacias do Atlântico Leste), considerando a bacia Amazônica como fonte (VERA-SILVA; CARVALHO; MANTELATTO, 2016). Baseado no tempo de divergência e na provável distribuição natural da espécie, os autores sugerem alguns cenários biogeográficos para explicar a origem dos clados Costeiro e Amazônico. O primeiro cenário considera a capacidade limitada de M. jelskii de tolerar ambientes salinos (HOLTHUIS, 1980), sendo o clado Costeiro formado pela dispersão larval, sugerindo uma provável colonização do tipo ‘stepping-stone’, padrão evidenciado

76 geralmente para espécies estuarinas (HASTINGS; HARRISON, 1994). Todavia, não há nenhum estudo sobre respostas fisiológicas desta espécie a um gradiente de salinidade. O segundo cenário é baseado em mudanças climáticas datadas do Plioceno (2-5 Ma) que teriam causado a confluência dos rios costeiros formando a partir da regressão do nível do mar por flutuações da temperatura (DWYER; CHANDLER, 2008; PELLEGRINO et al., 2005). Para o clado Amazônico, devido as estimativas de relógio molecular demostrando baixa divergência genética, não foi descartada a introdução por atividade humana, já relatada anteriormente. As sequências utilizadas por Vera-Silva, Carvalho e Mantelatto (2016) não puderam ser utilizadas para o presente trabalho, devido a inconsistências nas etapas de alinhamento e construção da árvore filogenética. Em análise preliminar as linhagens encontradas neste estudo não se agruparam com as linhagens encontradas no presente estudo (Figura 3). No presente estudo, a presença de picos duplos no eletroferogramas, quando são usados os iniciadores universais, sugere a amplificação de diferentes sequências e, por conseguinte, a co-amplificação, provavelmente, de NuMts (BUHAY, 2009). Por isso, ressaltamos a importância que uma das formas de evitar a co- amplificação de NuMts é a otimização de iniciadores táxon específicos, já afirmado por Schubart (2009). Os iniciadores universais COIf/COIa já foram usados em diversos estudos populacionais e filogenéticos de espécies de camarões do gênero Macrobrachium (GUERRA et al., 2014; LIU; CAI; TZENG, 2007; MACIEL et al., 2011; PILEGGI; MANTELATTO, 2010; ROSSI; MANTELATTO, 2013; VERGAMINI; PILEGGI; MANTELATTO, 2011). Porém, somente um trabalho reportou dificuldades nas amplificações com esses iniciadores (LIU; CAI; TZENG, 2007). O fato de que as sequências apresentaram entre 20 e 35 nucleotídeos diferentes, mas, nenhuma das sequências exibia códons de parada ou indels, sugere um caso de introgressão. Isto ocorre durante a reprodução, em que pode haver uma falha na eliminação das mitocôndrias paternas durante a fecundação, havendo a formação do zigoto com mitocôndrias maternas e paternas (HAZKANI-COVO; ZELLER; MARTIN, 2010). E assim, especula-se que este fenômeno pode ser mais recorrente em crustáceos, pela característica atípica (não possuem flagelo e imóveis) (MEDINA; RODRÍGUEZ, 1992; TALBOT; SUMMER, 1978) do gameta masculino, tem mitocôndrias localizadas na zona central próximo à cromatina (DUPRÉ; BARROS, 2011). Provavelmente, no

77 momento da fecundação ocorre alguma anomalia e as mitocôndrias paternas são transferidas, passando a ser não-funcionais e, portanto, acabam por acumular mutações. Sabendo que o grau de similaridade entre NuMts e suas contrapartes mitocondriais varia amplamente, a presença inadvertida de NuMts, em estudos relacionados à evolução de populações e espécies, pode levar a inferências e reconstruções filogenéticas e filogeográficas incorretas (SONG et al., 2008). Por exemplo, os NuMts podem superestimar ou superestimar o número de espécies (SONG et al., 2008) e podem inclusive incrementar, artificialmente, o nível de diferenciação inferido entre populações (HLAING et al., 2009). Um exemplo disto, é demostrado em uma compilação de dados com presença de NuMts, que mostra um viés no número de linhagens filogenéticas evidenciadas, com dados de gafanhoto dos gêneros Schistocerca Stål, 1873, Calliptamus Serville, 1831 e Acrida Linnaeus, 1758 relataram uma superestimação de 17 espécies, sugerindo evidências de 13 espécies crípticas, e com dados de lagostim Orconectes, relatados 25 espécies, sugerindo mais de 21 espécies crípticas (SONG et al., 2008). O que foi, possivelmene, evidenciado na reconstrução filogenética utilizando o método de Neighbor-Joining (Figura 3). Os indícios, baseados em dados genéticos e dados secundários de ocorrência, apontam para a introdução não-natural desta espécie no Nordeste brasileiro, mas assumindo um posicionamento conservador, deve-se investir em marcadores mais variáveis, ou até uma abordagem multilocus. Eventos geológicos e climáticos pretéritos aparentam ser menos explicativos evolutivamente sobre a estruturação genética desta espécie, excetuando assim, eventos como arranjos neotectônicos (TURCHETTO-ZOLET et al., 2012), captura de cabeceiras entre 30-40 Ma (LUNDBERG et al., 1998), incursões marinha (confluência das bacias dos rios Amazonas, Parnaíba, da Plata e São Francisco, datado de 12-20 Ma) (BLOOM; LOVEJOY, 2011; LIMA; RIBEIRO, 2011; LOVEJOY; BERMINGHAM; MARTIN, 1998; RAMOS; ALEMAN, 2000) e paleo-canais ligação Pleistocênica entre os cursos d’água dos compartimentos Baturité-Urauçuba (Bacia do Parnaíba) e Jaguaribe-Potiguar (Bacias Jaguaribe, Apodi-Mossoró e Piranhas-Açú) (BRITO NEVES; DOS SANTOS; VAN SCHMUS, 2000; CABY; ARTHAUD; ARCHANJO, 1995; CARNEIRO; HAMZA; ALMEIDA, 1989; PEULVAST et al., 2008). E juntamente com a baixa diversidade haplotípica e nucleotídica, corroborando com os dados de variação de forma (abstração da forma de estruturas morfológicas) em que as variações interpopulacionais

(diferenças relativas entre bacias hidrográficas) eram menos evidentes que as variações intrapopulacionais (dimorfismo sexual e variações relacionadas ao hidrodinamismo) (MORAES et al., submetido). Além disso, Berbel-Filho et al. (2015) para duas espécies de Ciclidae Bonaparte, 1835 evidenciou uma rede de haplótipos que representa um cenário de diferenciação incipiente (moderada divergência genética), com algumas linhagens únicas para as bacias do Apodi- Mossoró, Jaguaribe e Piranhas-Açú. Considerando a amostragem similar (mesmas bacias hidrográficas) e um panorama geral de eventos dispersivos e vicariantes influentes em taxa aquáticos, era esperado um padrão de estruturação genética semelhante ao encontrado por Berbel-Filho et al. (2015).

Agradecimentos Os autores agradecem ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq # 552086 / 2011-8) pelo financiamento do projeto de pesquisa e pelas bolsas concedidas (Sávio ASN Moraes - CAPES). Aos membros do GEEFAA e LISE no suporte de atividade de campo e de laboratório. Todo o trabalho de campo foi conduzido de acordo com as leis ambientais estaduais e federais (Licença de coleta SISBIO-IBAMA # 28314-1). Ao Prof. Antônio M. Solé-Cava e ao Laboratório de Biodiversidade Molecular (LBDM  UFRJ) pelos procedimentos de extração e sequenciamento. Os autores declaram não haver conflitos de interesse.

REFERÊNCIAS

ABDELKRIM, Jawad et al. Importance of assessing population genetic structure before eradication of invasive species: examples from insular Norway rat populations. Conservation Biology, v. 19, n. 5, p. 1509-1518, 2005. ALBERT, J. S.; REIS, R. E. Introduction to Neotropical freshwaters. Historical biogeography of neotropical freshwater fishes, p. 3-19, 2011. ARTHOFER, Wolfgang et al. Mitochondrial phylogenies in the light of pseudogenes and Wolbachia: re-assessment of a bark beetle dataset. ZooKeys, v. 56, p. 269, 2010. BAEZA, J. Antonio; FUENTES, M. Soledad. Exploring phylogenetic informativeness and nuclear copies of mitochondrial DNA (numts) in three commonly used mitochondrial genes: mitochondrial phylogeny of peppermint, cleaner, and semi terrestrial shrimps

‐

(Caridea: Lysmata, Exhippolysmata, and Merguia). Zoological Journal of the Linnean Society, v. 168, n. 4, p. 699-722, 2013. BALDO, Laura et al. Nuclear–Mitochondrial sequences as witnesses of past interbreeding and population diversity in the jumping bristletail Mesomachilis. Molecular biology and evolution, v. 28, n. 1, p. 195-210, 2011. BASTOS, J. A. M.; PAIVA, M. P. Notas sobre o consumo de oxigênio do camarão ‘sossêgo’, Macrobrachium jelskii (Miers, 1877) Chace & Holthuis, 1948. Revista Brasileira de Biologia, v. 19, n. 4, p. 413-419, 1959. BELLAFRONTE, Elisangela et al. Cytogenetic identification of invasive fish species following connections between hydrographic basins. Hydrobiologia, v. 649, n. 1, p. 347- 354, 2010. BENSASSON, Douda et al. Mitochondrial pseudogenes: evolution's misplaced witnesses. Trends in ecology & evolution, v. 16, n. 6, p. 314-321, 2001. BERBEL-FILHO, Waldir M. et al. Inter-and intra-basin phenotypic variation in two riverine cichlids from northeastern Brazil: potential eco-evolutionary damages of São Francisco interbasin water transfer. Hydrobiologia, v. 766, n. 1, p. 43-56, 2015. BLANCO, Daniel Rodrigues et al. Characterization of invasive fish species in a river transposition region: evolutionary chromosome studies in the genus Hoplias (Characiformes, Erythrinidae). Reviews in Fish Biology and Fisheries, v. 20, n. 1, p. 1- 8, 2009. BLOOM, Devin. D.; LOVEJOY, Nathan R. The biogeography of marine incursions in South America. In: Albert, J.S.; Reis, R.E. (Eds.). Historical Biogeography of Neotropical Freshwater Fishes. University of California Press, Berkeley, 2011 p.137- 144. BØHN, Thomas; AMUNDSEN, Per-Arne; SPARROW, Ashley. Competitive exclusion after invasion?. Biological Invasions, v. 10, n. 3, p. 359-368, 2008. BRITO NEVES, Benjamin B.; DOS SANTOS, Edilton J.; VAN SCHMUS, William R. Tectonic history of Borborema Province, Northeastern Brazil. In: Cordani, U.G, Thomaz Filho, A.; Campos, D.A. (Eds.). Tectonic Evolution of South America. 31st International Geological Congress, Rio de Janeiro, 2000. p.151-182 BUHAY, Jennifer E. “COI-like” sequences are becoming problematic in molecular systematic and DNA barcoding studies. Journal of Crustacean Biology, v. 29, n. 1, p. 96-110, 2009.

CABY, Renaud; ARTHAUD, Michel H.; ARCHANJO, Carlos J. Lithostratigraphy and petrostructural characterization of supracrustal units in the Brasiliano Belt of Northeast Brazil: geodynamic implications. Journal of South American Earth Sciences, v. 8, n. 3-4, p. 235-246, 1995. CARNEIRO, Celso D. R.; HAMZA, Valiya M.; DE ALMEIDA, Fernando F. M. Ativação tectônica, fluxo geotérmico e sismicidade no Nordeste Oriental brasileiro. Revista Brasileira de Geociências, v. 19, n. 3, p. 310-322, 1989. DE CARVALHO, Fabrício L.; PILEGGI, Leonardo G.; MANTELATTO, Fernando L. Molecular data raise the possibility of cryptic species in the Brazilian endemic prawn Macrobrachium potiuna (Decapoda, Palaemonidae)/Datos moleculares sugieren la presencia de una especie críptica del camarón endémico brasileño Macrobrachium potiuna (Decapoda, Palaemonidae). Latin American Journal of Aquatic Research, v. 41, n. 4, p. 707, 2013. COELHO, Petrônio A.; RAMOS-PORTO, Marilena. Camarões de água doce do Brasil: distribuição geográfica. Revista Brasileira de Zoologia, v. 2, n. 6, p. 405-410, 1985. COLLINS, Pablo A. Macrobrachium jelskii (Miers, 1877). Crustaceana, v. 73, n. 9, p. 1167-1169, 2000. D'ERRICO, Ilenia; GADALETA, Gemma; SACCONE, Cecilia. Pseudogenes in metazoa: origin and features. Briefings in functional genomics & proteomics, v. 3, n. 2, p. 157-167, 2004. DE GRAVE, S.; CAI, Y.; ANKER, A. Global diversity of shrimps (Crustacea: Decapoda: Caridea) in freshwater. Hydrobiologia, v. 595, n. 1, p. 287-293, 2008. DEN TEX, Robert-Jan et al. Nuclear copies of mitochondrial genes: another problem for ancient DNA. Genetica, v. 138, n. 9-10, p. 979-984, 2010. DLUGOSCH, K. M.; PARKER, I. M. Founding events in species invasions: genetic variation, adaptive evolution, and the role of multiple introductions. Molecular ecology, v. 17, n. 1, p. 431-449, 2008. DUPRÉ, Enrique M.; BARROS, Claudio. In vitro fertilization of the rock shrimp, Rhynchocinetes typus (Decapoda, Caridea): a review. Biological research, v. 44, n. 2, p. 125-133, 2011. DRUMMOND, Alexei J. et al. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular biology and evolution, v. 29, n. 8, p. 1969-1973, 2012.

DWYER, Gary S.; CHANDLER, Mark A. Mid-Pliocene sea level and continental ice volume based on coupled benthic Mg/Ca palaeotemperatures and oxygen isotopes. Philosophical Transactions of the Royal Society of London A: Mathematical, Physical and Engineering Sciences, v. 367, n. 1886, p. 157-168, 2008. EXCOFFIER, Laurent; LISCHER, Heidi EL. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Molecular ecology resources, v. 10, n. 3, p. 564-567, 2010. FREELAND, J. R. Molecular Ecology. Chichester: John Wiley & Sons, Ltd, 2005. FRÉZAL, Lise; LEBLOIS, Raphael. Four years of DNA barcoding: current advances and prospects. Infection, Genetics and Evolution, v. 8, n. 5, p. 727-736, 2009. GAMBA, A. L. Desarrollo larval abreviado del camarón de agua dulce Macrobrachium jelskii (Miers, 1877). Primeras Jornadas Científicas, Universidad Simón Bolívar. Caracas, Venezuela, p. 169-190, 1980. GAMBA, A. L. Different egg-associated and larval development characteristics of Macrobrachium jelskii and Macrobrachium amazonicum (Arthropoda: Crustacea) in a Venezuelan continental lagoon. International Journal of Invertebrate Reproduction and Development, v. 7, n. 3, p. 135-142, 1984. GAMBA, A. L. Biología reproductiva de Macrobrachium jelskii (Miers, 1877) y Macrobrachium amazonicum (Heller, 1862) en Venezuela (Crustacea, Decapoda, Palaemonidae). Acta Cientifica Venezolana, v. 48, n. 1, p. 19-26, 1997. GAZIEV, A. I.; SHAIKHAEV, G. O. Nuclear mitochondrial pseudogenes. Molecular Biology, v. 44, n. 3, p. 358-368, 2010. GERSTEIN, M.; ZHENG, D. The real life of pseudogenes. Scientific American, v. 295, n. 2, p. 48-55, 2006. GRANT, Evan H. C. et al. Interbasin water transfer, riverine connectivity, and spatial controls on fish biodiversity. PLoS One, v. 7, n. 3, p. e34170, 2012. GUERRA, A. L. et al. Genetic variability and phylogenetic aspects in species of the genus Macrobrachium. Genetics and Molecular Research, p. 3646-3655, 2014. GURGEL, J. J. S.; OLIVEIRA, A. B. Efeitos da introdução de peixes e crustáceos no semi-árido do nordeste brasileiro. ESAM, 1987. HANDLEY, L.-J. Lawson et al. Ecological genetics of invasive alien species. BioControl, v. 56, n. 4, p. 409, 2011.

HARTL, D. L. Princípios de Genética de População. 3ª ed. Ribeirão Preto: FUNPEC Editora, 2008, 217 p. HASTINGS, Alan; HARRISON, Susan. Metapopulation dynamics and genetics. Annual review of Ecology and Systematics, v. 25, n. 1, p. 167-188, 1994. HAZKANI-COVO, Einat; ZELLER, Raymond M.; MARTIN, William. Molecular poltergeists: mitochondrial DNA copies (numts) in sequenced nuclear genomes. PLoS Genet, v. 6, n. 2, p. e1000834, 2010. HEBERT, Paul DN; RATNASINGHAM, Sujeevan; DE WAARD, Jeremy R. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society of London B: Biological Sciences, v. 270, n. Suppl 1, p. S96-S99, 2003. HLAING, Thaung et al. Mitochondrial pseudogenes in the nuclear genome of Aedes aegypti mosquitoes: implications for past and future population genetic studies. Bmc Genetics, v. 10, n. 1, p. 11, 2009. HOLTHUIS, Lipke Bijdeley. The Decapoda of the Siboga Expedition: Pt. 10: the Palaemonidae Collected by the Siboga and Snellius Expeditions with Remarks on Other Species: 1: Subfamily Palaemoninae. Brill, 1950. HOLTHUIS, Lipke Bijdeley. A general revision of the Palaemonidae (crustacea Decapod Natantia) of the Americas. II. The subfamily Palaemonidae. 1952. HOLTHUIS, L. B. A collection of freshwater prawns (Crustacea Decapoda, Palaemonidae) from Amazonia, Brazil, collected by Dr. G. Marlier. 1966. HOLTHUIS, Lipke Bijdeley et al. FAO species catalogue. Volume 1-Shrimps and prawns of the world. An annotated catalogue of species of interest to fisheries. 1980. JALIHAL, D. R.; SANKOLLI, K. N.; SHENOY, Shakuntala. Evolution of larval developmental patterns and the process of freshwaterization in the prawn genus Macrobrachium Bate, 1868 (Decapoda, Palaemonidae). Crustaceana, v. 65, n. 3, p. 365- 376, 1993. KIM, Se Joo; LEE, Kyeong Yong; JU, Se Jong. Nuclear mitochondrial pseudogenes in Austinograea alayseae hydrothermal vent crabs (Crustacea: Bythograeidae): effects on ‐ ‐ DNA barcoding. Molecular ecology resources, v. 13, n. 5, p. 781-787, 2013. KNOWLTON, Nancy; WEIGT, Lee A. New dates and new rates for divergence across the Isthmus of Panama. Proceedings of the Royal Society of London B: Biological Sciences, v. 265, n. 1412, p. 2257-2263, 1998.

LEITE, Luis Anderson Ribeiro. Mitochondrial pseudogenes in insect DNA barcoding: differing points of view on the same issue. Biota Neotropica, v. 12, n. 3, p. 301-308, 2012. LIMA, Flávio C. T.; RIBEIRO, Alexandre C. (2011) Continental–scale tectonic controls of biogeography and ecology. In: ALBERT J.S.; REIS R.E. (Eds.). Historical Biogeography of Neotropical Freshwater Fishes, University of California Press, Berkeley, 2011. p.145-164. LIU, Min-Yun; CAI, Yi-Xiong; TZENG, Chyng-Shyan. Molecular systematics of the freshwater prawn genus Macrobrachium Bate, 1868 (Crustacea: Decapoda: Palaemonidae) inferred from mtDNA sequences, with emphasis on East Asian species. Zoological Studies-Taipei-, v. 46, n. 3, p. 272, 2007. LOPEZ, Jose V. et al. Numt, a recent transfer and tandem amplification of mitochondrial DNA to the nuclear genome of the domestic cat. Journal of Molecular evolution, v. 39, n. 2, p. 174-190, 1994. LIBRADO, Pablo; ROZAS, Julio. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics, v. 25, n. 11, p. 1451-1452, 2009. LOVEJOY, Nathan R.; BERMINGHAM, Eldredge; MARTIN, Andrew P. Marine incursion into South America. Nature, v. 396, n. 6710, p. 421-422, 1998. LUNDBERG, G. J. et al. Phylogeny and Classification of Neotropical Fishes. In: MALABARBA, L. R. et al. (Eds.). The stage for Neotropical fish diversification: a history of tropical South America river, Edipuers, Porto Alegre, 1998. p.13-48. MACIEL, Cristiana R. et al. Occurrence of the Indo-Pacific freshwater prawn Macrobrachium equidens Dana 1852 (Decapoda, Palaemonidae) on the coast of Brazilian Amazonia, with notes on its reproductive biology. Anais da Academia Brasileira de Ciências, v. 83, n. 2, p. 533-544, 2011. MAGALHÃES, Célio. Abbreviated larval development of Macrobrachium jelskii (Miers, 1877) (Crustacea: Decapoda: Palaemonidae) from the Rio Solimões floodplain, Brazil, reared in the laboratory. Nauplius, v.8, n.1, p. 1-14, 2000. MAGALHÃES, Célio et al. Exotic species of freshwater decapod crustaceans in the state of São Paulo, Brazil: records and possible causes of their introduction. Biodiversity and Conservation, v. 14, n. 8, p. 1929-1945, 2005. MEADOR, Michael R. Inter-basin water transfer: ecological concerns. Fisheries, v. 17, n. 2, p. 17-22, 1992.

MEDINA, Antonio; RODRIGUEZ, Antonio. Structural changes in sperm from the fiddler crab, Uca tangeri (Crustacea, Brachyura), during the acrosome reaction. Molecular reproduction and development, v. 33, n. 2, p. 195-201, 1992. MELO, G. A. S. Famílias Atyidae, Palaemonidae e Sergestidae. Manual de identificação dos Crustacea Decapoda de água doce do Brasil, p. 289-415, 2003. MIERS, E. J. On a Collection of Crustacea, Decapoda and Isopoda, Chiefly from South America: With Descriptions of New Genera and Species..., 1877. MILLER, S. A.; DYKES, D. D.; POLESKY, H. F. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic acids res, v. 16, p. 1215, 1988. MURPHY, Nicholas P.; AUSTIN, Christopher M. Phylogenetic relationships of the globally distributed freshwater prawn genus Macrobrachium (Crustacea: Decapoda: Palaemonidae): biogeography, taxonomy and the convergent evolution of abbreviated larval development. Zoologica Scripta, v. 34, n. 2, p. 187-197, 2005. NGUYEN, Thuy TT; MURPHY, Nicholas Paul; AUSTIN, Christopher M. Amplification of multiple copies of mitochondrial Cytochrome b gene fragments in the Australian freshwater crayfish, Cherax destructor Clark (Parastacidae: Decapoda). Animal genetics, v. 33, n. 4, p. 304-308, 2002. NOVAK, S. J.; MACK, R. N. Genetic bottlenecks in alien plant species: influence of mating systems and introduction dynamics. In: SAX, D. F., STACHOWICZ, J. J, GAINES, S. D. (Eds.). Species Invasions: Insights into Ecology, Evolution, and Biogeography. Sinauer Associates: Sunderland, MA, 2005. p. 201–228. PAIVA M. P.; BARRETO V. A. Notas sobre a biologia do camarão ‘sossego’, Macrobrachium jelskii (Miers, 1877) numa pequena bacia potamográfica do nordeste brasileiro. Revista Brasileira de Biologia, v. 20, n. 2, p. 121-129, 1960. PELLEGRINO, Katia et al. Phylogeography and species limits in the Gymnodactylus darwinii complex (Gekkonidae, Squamata): genetic structure coincides with river systems in the Brazilian Atlantic Forest. Biological Journal of the Linnean Society, v. 85, n. 1, p. 13-26, 2005. PELLEGRINO, Katia CM et al. Molecular phylogeny, biogeography and insights into the origin of parthenogenesis in the Neotropical genus Leposoma (Squamata: Gymnophthalmidae): Ancient links between the Atlantic Forest and Amazonia. Molecular Phylogenetics and Evolution, v. 61, n. 2, p. 446-459, 2011.

PEREIRA, G. A cladistic analysis of the freshwater shrimps of the family Palaemonidae (Crustacea, Decapoda, Caridea). Acta Biologica Venezuelica, v. 17, n. 1, p. 1-69, 1997. PERES, Wellington Adriano Moreira et al. Invasion, dispersion and hybridization of fish associated to river transposition: karyotypic evidence in Astyanax “bimaculatus group” (Characiformes: Characidae). Reviews in Fish Biology and Fisheries, v. 22, n. 2, p. 519- 526, 2012. PEULVAST, Jean-Pierre et al. Low post-Cenomanian denudation depths across the Brazilian Northeast: implications for long-term landscape evolution at a transform continental margin. Global and Planetary Change, v. 62, n. 1, p. 39-60, 2008. PILEGGI, Leonardo G.; MANTELATTO, Fernando L. Molecular phylogeny of the freshwater prawn genus Macrobrachium (Decapoda, Palaemonidae), with emphasis on the relationships among selected American species. Invertebrate Systematics, v. 24, n. 2, p. 194-208, 2010. PILEGGI, Leonardo et al. Molecular perspective on the American transisthmian species of Macrobrachium (Caridea, Palaemonidae). Zookeys, v. 457, p. 109, 2014. PITTOCK, J.; MENG, J.; CHAPAGAIN, A. K. Interbasin Water Transfers and Water Scarcity in a Changing World — A Solution or a Pipedream? A Discussion Paper in a Burning Issue. WWF Germany, Frankfurt, 2009. POSADA, David; CRANDALL, Keith A.. . Modeltest: testing the model of DNA substitution. Bioinformatics, v. 14, n. 9, p. 817-818, 1998. RAMBAUT, A. et al. Tracer v. 1.6. Institute of Evolutionary Biology, University of Edinburgh. 2014. RAMOS, V. A.; ALEMAN, A. Tectonic Evolution of the Andes. In: Cordani, U. et al. (Eds.). Tectonic Evolution of South America, 31st International Geological Congress, Rio de Janeiro, 2000. p.635-685. RIDLEY, M. Evolução. Artmed, Porto Alegre, RS, 2006, 752p. RICHLY, Erik; LEISTER, Dario. NUMTs in sequenced eukaryotic genomes. Molecular biology and evolution, v. 21, n. 6, p. 1081-1084, 2004. ROBERTSON, Charles. Heterotropic bees. Ecology, v. 6, n. 4, p. 412-436, 1925. RODRÍGUEZ, G. Decapoda. Aquatic biota of tropical South America, v. 1, p. 41-51, 1981.

ROSSI, Natalia; MANTELATTO, Fernando Luis. Molecular analysis of the freshwater prawn Macrobrachium olfersii (Decapoda, Palaemonidae) supports the existence of a single species throughout its distribution. PLoS One, v. 8, n. 1, p. e54698, 2013. SCHUBART, C. D. Mitochondrial DNA and Decapod phylogenies: the importance of pseudogenes and primer optimization. In: MARTIN, J. W. et al (Ed.). Decapod crustacean phylogenetics: Crustacean Issue 18, 2009. SHIRK, R. Y. et al. Patterns of genetic diversity reveal multiple introductions and recurrent founder effects during range expansion in invasive populations of Geranium carolinianum (Geraniaceae). Heredity, v. 112, n. 5, p. 497-507, 2014. SOARES, Marcelo R. da S.; OSHIRO, Lídia MY; TOLEDO, Júlio C. Reproductive biology of the shrimp Macrobrachium jelskii (Crustacea, Decapoda, Palaemonidae) in São Francisco River, Minas Gerais, Brazil. Iheringia. Série Zoologia, v. 105, n. 3, p. 307-315, 2015. SONG, Hojun et al. Many species in one: DNA barcoding overestimates the number of species when nuclear mitochondrial pseudogenes are coamplified. Proceedings of the National Academy of Sciences, v. 105, n. 36, p. 13486-13491, 2008. STRUGNELL, Jan M.; LINDGREN, Annie R. A barcode of life database for the Cephalopoda? Considerations and concerns. Reviews in Fish Biology and Fisheries, v. 17, n. 2-3, p. 337-344, 2007. SUNNUCKS, Paul; HALES, Dinah F. Numerous transposed sequences of mitochondrial cytochrome oxidase I-II in aphids of the genus Sitobion (Hemiptera: Aphididae). Molecular Biology and Evolution, v. 13, n. 3, p. 510-524, 1996. TALBOT, Prudence; SUMMERS, R. G. The structure of sperm from Panulirus, the spiny lobster, with special regard to the acrosome. Journal of ultrastructure research, v. 64, n. 3, p. 341-351, 1978. TAMURA, Koichiro et al. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 7.0. Molecular biology and evolution, v. 24, n. 8, p. 1596-1599, 2007. TENEVA, A. Molecular markers in animal genome analysis. Biotechnology in animal husbandry, v. 25, n. 5-6-2, p. 1267-1284, 2009. TIMMIS, Jeremy N. et al. Endosymbiotic gene transfer: organelle genomes forge eukaryotic chromosomes. Nature Reviews Genetics, v. 5, n. 2, p. 123-135, 2004.

TORLONI, C. E. C. et al. Produção pesqueira e composição das capturas em reservatórios sob concessão da CESP nos rios Tietê, Paraná e Grande, no período de 1986 a 1991. CESP, São Paulo, 1993. TURCHETTO ZOLET, A. C. et al. Phylogeographical patterns shed light on evolutionary process in South America. Molecular Ecology, v. 22, n. 5, p. 1193- ‐ 1213, 2012. VALENCIA, Diego M.; CAMPOS, Martha R. Freshwater prawns of the genus Macrobrachium Bate, 1868 (Crustacea: Decapoda: palaemonidae) of Colombia. Zootaxa, v. 1456, p. 1-44, 2007. VERA-SILVA, Ana Luiza; CARVALHO, Fabrício L.; MANTELATTO, Fernando L. Distribution and genetic differentiation of Macrobrachium jelskii (Miers, 1877) (Natantia: Palaemonidae) in Brazil reveal evidence of non-natural introduction and cryptic allopatric speciation. Journal of Crustacean Biology, v. 36, n. 3, p. 373-383, 2016. VERGAMINI, Fernanda G. et al. Genetic variability of the Amazon river prawn Macrobrachium amazonicum (Decapoda, Caridea, Palaemonidae). Contributions to Zoology, v. 80, n. 1, p. 67-83, 2011. VILLALOBOS-HIRIART, JOSE LUIS; CANTÚ, A.; LIRA-FERNÁNDEZ, ENRIQUE. Los crustáceos de agua dulce de México. Revista de la Sociedad Mexicana de Historia Natural, v. 44, p. 267-290, 1993. WARES, J. P., HUGHES, A. R.; GROSBERG, R. K. Mechanisms that drive evolutionary change: insights from species introductions and invasions. In: SAX, D.F., STACHOWICZ, J.J., GAINES, S.D. (Eds.). Species invasions: insights into ecology, evolution, and biogeography. Sinauer, Sunderland, 2005, p. 229–257. WILLIAMS, S. T.; KNOWLTON, N. Mitochondrial pseudogenes are pervasive and often insidious in the snapping shrimp genus Alpheus. Molecular Biology and Evolution, v. 18, n. 8, p. 1484-1493, 2001. WILLIAMS, S. T. et al. Evidence for three major clades within the snapping shrimp genus Alpheus inferred from nuclear and mitochondrial gene sequence data. Molecular phylogenetics and evolution, v. 20, n. 3, p. 375-389, 2001. WILLIAMS, S. T. et al. The Marine Indo-West Pacific Break: Contrasting the Resolving Power of Mitochondrial and Nuclear Genes1. Integrative and Comparative Biology, v. 42, n. 5, p. 941-952, 2002.

TABELAS

Tabela 1 Iniciadores utilizados para extração e verificação de co-amplificação.

Iniciador Sequência (5ˈ3ˈ) Ta Referência COL8 GAYCAAATACCTTTATTTGT 48 Schubart, 2009 COH1b TGTATARGCRTCTGGRTARTC COIf CCTGCAGGAGGAGGAGACCC 64 Palumbi & Benzie, COIa AGTATAAGCGTCTGGGTAGTC 1991 COI_MA_R RTTAGCTGTTAGGGGGATTTCT 55 Presente estudo

Tabela 2 Descrição das espécies utilizadas com seus respectivos, ID/NºGenBank (identificação no presente estudo ou número de identificação no banco de dados de Nucleotídeos do NLM/NCBI - National Center for Biotechnology Information), Localidade (Munícipio, Estado, País), Coord Geo (coordenadas geográficas, somente para as localidades do presente estudo) e Referência (literatura na qual a sequência foi obtida e utilizada em inferências filogenéticas). RN – Rio Grande do Norte, CE – Ceará, PB – Paraíba, PE – Pernambuco, PI – Piauí. Espécie ID/N°GenBank Localidade Coord Geo Referência M. jelskii CRT2312-CRT2340 Santa Cruz, RN, Brasil 05°39'29,5''S / 37°46'17,5''O Presente estudo M. jelskii CRT2343-CRT2348 Orós, CE, Brasil 06°14'18,8''S / 38°54'45,3''O Presente estudo M. jelskii CRT2361-CRT2365 Saboeiro, CE, Brasil 06°32'31,1''S / 39°54'37,5''O Presente estudo M. jelskii CRT2401-CRT2405 Bonito de Santa Fé, PB, Brasil 07°16'12,7''S / 38°30'34,1''O Presente estudo M. jelskii CRT2406-CRT2410 Aparecida, RN, Brasil 06°47'07,0''S / 38°05'09,6''O Presente estudo M. jelskii CRT2468-CRT2472 Barra de Santana, PB, Brasil 07°31'45"S / 35°59'55,3"O Presente estudo M. jelskii CRT2461-CRT2465 Boqueirão, PB, Brasil 07°29'11,9''S / 36°07'24,5"O Presente estudo M. jelskii CRT2431-CRT2435 Buíque, PE, Brasil 08°25' / 2,4''S / 37°22'14,6''O Presente estudo M. jelskii CRT2436-CRT2440 Ouricuri, PE, Brasil 08°13'48,3"S / 39°53'47,4"O Presente estudo M. jelskii CRT2517-CRT2521 São João de Piauí, PI, Brasil 08°22'00,3"S / 42°14'10,1"O Presente estudo M. jelskii CRT2522-CRT2526 São João de Piauí, PI, Brasil 08°27'13,8"S / 42°09'53,2"O Presente estudo M. jelskii CRT2527-CRT2531 Conceição do Canindé, PI, Brasil 07°58'30,1"S / 41°59'26,5"O Presente estudo M. jelskii GU929469 Pereira Barreto, SP, Brasil --- Vergamini et al. (2011) M. jelskii HM352484 Pereira Barreto, SP, Brasil --- Pileggi & Mantelatto (2010) M. jelskii HAP1 Pereira Barreto, SP, Brasil --- LBDM - UFRJ M. amazonicum GU929542 Itacoatiara, Brasil --- Vergamini et al. (2011) M. amazonicum GU929500 Santana, Brasil --- Vergamini et al. (2011) M. amazonicum GU929471 Abaetetuba, Brasil --- Vergamini et al. (2011) M. amazonicum GU929489 Belém, Brasil --- Vergamini et al. (2011) M. amazonicum GU929492 Santa Bárbara, Brasil --- Vergamini et al. (2011)

M. amazonicum GU929479 Aquiraz, Brasil --- Vergamini et al. (2011) M. amazonicum GU929538 Miguelópolis, Brasil --- Vergamini et al. (2011) M. amazonicum GU929505 Sertãozinho, Brasil --- Vergamini et al. (2011) M. amazonicum GU929532 Avaré, Brasil --- Vergamini et al. (2011) M. amazonicum GU929515 Aquidauana, Brasil --- Vergamini et al. (2011) M. amazonicum GU929524 Miranda, Brasil --- Vergamini et al. (2011) M. ferreirai HM352483 Manaus, Brasil --- Pileggi & Mantelatto (2010) M. borelli GU929467 Buenos Aires, Argentina --- Vergamini et al. (2011) M. heterochirus HM352494 Ilha de São Sebastião, Brasil --- Pileggi & Mantelatto (2010) M. brasiliense GU929468 Serra Azul, Brasil --- Vergamini et al. (2011) M. brasiliense HM352482 Serra Azul, Brasil --- Pileggi & Mantelatto (2010) M. acanthurus GU929470 Ilha de São Sebastião, Brasil --- Vergamini et al. (2011) M. carcinus GU929553 Santana, Brasil --- Vergamini et al. (2011) M. carcinus HM352491 Isla Margarita, Venezuela --- Pileggi & Mantelatto (2010) M. carcinus HM352492 Rio São Francisco, Brasil --- Pileggi & Mantelatto (2010) M. carcinus HM352493 Ilha do Careiro, Brasil --- Pileggi & Mantelatto (2010) M. americanum GU929552 Pacifico Sul, Costa Rica --- Vergamini et al. (2011) M. crenulatum GU929555 Isla Margarita, Venezuela --- Vergamini et al. (2011) M. olfersii GU929554 Ilha de São Sebastião, Brasil --- Vergamini et al. (2011) M. olfersii HM352496 Ilha de São Sebastião, Brasil --- Pileggi & Mantelatto (2010) C. caementarius HM352495 4ª região, Chile --- Pileggi & Mantelatto (2010)

Tabela 3 Diversidade genética da sequência Citocromo Oxidase Sub-unidade I. N (número de indíviduos); NH (número de haplótipos observados); H (diversidade haplotípica); π (diversidade nucleotídica média); SD (desvio padrão). Estados: RN – Rio Grande do Norte, CE – Ceará, PB – Paraíba, PE – Pernambuco, PI – Piauí.

Região Hidrográfica Bacia Hidrográfica Localidade N NH H (SD) π (SD) Nordeste Médio-Oriental Apodi-Mossoró Santa Cruz – RN 9 1 - - Jaguaribe Orós – CE 5 1 - - Saboeiro – CE 5 1 - - Piranhas Açu Bonito de Santa Fé – PB 5 1 - - Aparecida – RN 5 1 - - Paraíba do Norte Barra de Santana – PB 4 1 - - Boqueirão – PB 5 1 - - São Francisco São Francisco Buíque – PE 5 1 - - Ouricuri – PE 5 1 - - Maranhão-Piauí Parnaíba São João de Piauí – PI 9 1 - - Paraná Paraná-Paraguai Perreira Barreto – SP 2 2 - - Total 58 2 0.095(0.050) 0.0044(0.0019)

FIGURAS

Fig. 1 Representação da amostragem no Nordeste brasileiro (a); e destaque nas bacias, distribuídas nas ecorregiões sugeridas por (Albert & Reis 2011) (b).

Fig. 2 Electroferogramas do indivíduo CRT2329 obtidos com os iniciadores universais (COIa/COIf), os iniciadores específicos para decápodes (COL8/COH1b) e o iniciador específico para Macrobrachium (COIMAR). As caixas ressaltam alguns dos sítios onde foram observados picos duplos nos eletroferogramas obtidos com os iniciadores universais.

Fig. 3 Árvore filogenética proveniente do método de reconstrução Neighbor-Joining gerada a partir das sequências de citocromo b. Números próximos aos nós indicam a probabilidade a posteriori de suporte de veracidade do clado. Nesta árvore foram utilizadas sequências provenientes do manuscrito Vera-Silva et al. (2016), com possíveis evidências de NuMts para Macrobrachium jelskii (Miers, 1877).

Fig. 4 Árvore filogenética proveniente da inferência Bayesiana gerada a partir das sequências de citocromo b. Números próximos aos nós indicam a probabilidade a posteriori de suporte de veracidade do clado. Barras em azul claro indicam tempo de divergência. Caixa sombreada representa a linhagem correspondente a espécie Macrobrachium jelskii (Miers, 1877).