MOLECULAR AND IMMUNOLOGICAL SD0100025 CHARACTERIZATION OF MYCOBACTERIA ASSOCIATED WITH BOVINE FARCY.
Thesis submitted in accordance with requirements of the University of Khartoum for the Degree of Doctor of Philosophy (Ph.D).
By Victor Loku Kwajok B.V.Med. 1978, University of Cairo/Egypt. M.V.Sc.1992, University of Khartoum/Sudan.
Supervisor: Dr. Maowia M. Mukhtar. Institute of Endemic Diseases, University of Khartoum.
Department of Preventive Medicine and Veterinary Public Health. Faculty of Veterinary Science, University of Khartoum. 2000.
32/27 SOME PAGES ARE MISSING IN THE ORIGINAL DOCUMENT LIST OF CONTENTS
DEDICATION. * ii v ACKNOWLEDGEMENTS vi
ABBREVIATIONS viii
ABSTRACT. xi
CHAPTER ONE. REVIEW OF LITERATURE. 1.
General Introduction. 1. 1.1. Molecular Systematics of genus Mycobacterium. 2. 1.2. Molecular taxonomy of M. farcinogenese and M. senegalense 11. 1.3. Immunology of bovine farcy agents. 36. CHAPTER TWO. MATERIALS AND METHODOLOGY 41. Isolation, identification and characterization of M. farcinogenes.
2.1 Phenotypic characterization. 41. 2.1.1. Morphological and biochemical tests. 2.1.2. Degradation tests. 2.1.3. Rapid fluorogenic enzyme tests. 2.1.4. Nutritional tests. 2.1.5. Physiological tests.
2.2. Molecular characterization. 52. 2.2.1. DNA extraction and purification 2.2.2. PCR amplification and application. 2.2.3. DNA sequencing of 16SrDNA. 2.2.4. PCR-based restriction fragment length polymorphism.
2.3 Imrmmological analyses of bovine farcy agents. 71. 2.3.1 .EL1SA technique for sera diagnosis. 2.3.2 Animal pathogenicity Tests. 2.3.3 Protein antigen profiles determination using.
CHAPTER THREE: RESULTS. 78.
CHAPTER. FOUR: DISCUSSION. 124.
REFERENCES. 133.
APPENDIX 180.
iif LIST OF TABLES
Substrates used in Rapid fluorogenic enzyme tests. 48.
Oliginucleotide primers used in the PCR amplification and
sequence of 16SrDNA. 61.
The clinical isolates. 79.
Test Strains and their sources. 79.
Levels of nucleotide similarity based on 16S rDNA sequences of M. farcinogenese, M. Senegal ense and related taxa. 93.
ELISA results. 118.
Protein antigens profiles (molecular weights) 121.
IV LIST OF FIGURES.
Sources of taxonomic information used to characterize actinomycetes. 4.
Protocol for PCR amplification and 16SrDNA sequencing. 53.
Protocol for ribotyping experiments labeled rDNA probes. 68.
Sj and UPGMA. 82.
Ssm and UPGMA. • 83.
DNA bands of clinical isolates. 85.
PCR amplification of DNA of clinical isolates. 86.
Restriction fragment length polymorphism patterns. 88.
Dendrograms showing similarity values. 89.
DNA sequences of clinical isolates. 94.
Protein antigen bands. 122.
Protein antigen profiles. 123. ABBREVIATIONS.
AIDS Aquired immunodeficiecy syndrome. AMC Aminomefhyl coumarin (fluorogenic indicator). Apal Restriction enzyme isolated from Acetobacter pasieurianus. API Analytical profile Index. ASCII Accesibilily of sequence data in computer. ATCC American collection of type culture. ATPase Adenosinc triphosphate. Bp Base pair. BSA Bovine serum albumen. BstEIl Restrictiuon enzyme isolated from Baccilus stearolhermphilusE. DAB diaminobenzidine. DDBJ DNA databank of Japan. DMT Delayed hypersensitivity type. DM SO Dimethyl sulphoxide. DNA Deoxyribonucleic acid. DNTP Deoxynucleotide triphosphate. EBI European Bioinformatic Institute. EcoRI Restriction enzyme isolated from Escherichia coli IIY13. EDTA Ethylenditetra acetic acid. E1A Enzyme immunoassay. ELISA Enzyme linked immunosorbant assay. EMBL European Molecular Biology Laboratory. FAMES Fatty acid methyl esters. IIP File transfer protocol. G+C Guanine plus cytosine ratio of the DNA. GPL Glycopeptidolipids. GYEA Glucose yeast extract agar. HIV Human immunodeficiency virus. IIPLC High performance liquid chromatography. MSP I leal shocked protein.
VIII ICSB International Committee on Systematic Bacteriology. IS Insertion sequence (Insertion element). 1WGMT . International Working Group on Mycobacterial Taxonomy. Kb Kilobase (molecular size measure). LRF Large subunit fragment LSUrRNA Large subunit rllNA. MAMBS Mycolic acid methyl esters. Md Megadallon (DNA molecular size measure). MK Menac|iiinoneK with isoprene units. • MU Methylumbelliferone(fluorogenicindicator). NCTC National Collection of Type Cultures. Notl Restriction enzyme isolated from Nocardia otitidis-caviarum. NrampI Natural resistance associated macrophage Proteinl. OD Optimal density. 32P Probed labelled with a high-energy radio isotope. PAGE Polyacrylamide gel electrophoresis (ulse agar gel electrophoresis). PBS Phosphate buffer saline. PCR Polymerase chain reaction. PFGH Pulse field gel electrophoresis. PstI Restriction enzyme isolated from Providencia stuartii. PyMS Pyrolysis Mass spectrometry. RDP Ribosomal Database Project. RFLP Restriction fragment length polymorphism. JIN A Ribonucleic acid. SDS Sodium dodecyl sulphate. Sill Restriction enzyme isolated from Streptomyces fimbriatus. Sml Restriction enzyme isolated from Serratia marcescens SB. Sj/UPGMA Unweighted pair group method of arithmetic algorithm using Sj Ssm/UPG.MA. Unweighted pair group method of arithmetic algorithm using Ssm. TAIi Tris-acelate ethylditetra acetic. TBE Tris-borate EDTA. TBS Tris-buffer saline. TLC Thin layer chromatography. „
IX Tm Thermal denaturatuion method. TPE Tri-phosphate EDTA. UPGMA, Unweighted pair group method with arithmetic averages algorithm. UV Ultra-Violet transilluminator. WHO World Health Organization. WWW World wide web. ABSTRACT.
The ability to delineate taxo-species has had a profound influence in bacteriology, notably the identification and classification of pathogenic bacteria. However, improved methods and automated data acquisition system can be expected to facilitate the generation of high-quality databases for variety of purposes. The aim of the study was to: i, Isolate and identify Mycobaclerium jarcinogenese from the clinical samples (lymph nods and sreum), ii.characterization of these species including Mycobaclerium senegalense and the related taxa (Mycobaclerium chelonae, Mycobacleriuni forluitum, Mycobacierium peregrinum and Nocardia farcinica) using Molecular biology methods (DNA extraction, PCR amplification, restriction fi-agment length polymorphism determination using restriction enzymes and DNA sequencing) and Hi. Jinmunological analysis of the species (animal pathogenicily tests, ELISA using sera samples from the clinical cases, protein antigen bands determination using SDS-PAGE method, and antigen-antibodies immunoassay using Western blotting and iinnumodiniision tests).
Seventeen clinical isolates identified as Mycobaclerium farcinogenese were obtained fromfive hundred and seventy eight (578) lymph nodes and 36 positive sera samples of the two hundred and sixty nine (269) sera samples which were tested. Molecular characterization of the test strains was carried out using independent taxonomic criteria derived from the application of morphological, enzymatic and chemotaxonomic methods.
DNA extraction method gave clearly resolved bands on agarose gel electrophoresis with clear common bands of 1500 base pairs. The extracted DNA was used as template for PCR amplification with universal primer 27f (5' AGAGTTTGATCCGGCTCAG-3') and primer 1525r (5'AAGGAGGTGATCGAGCC-3') with appended restriction sites being ideal primers lor amplification. No significant difference in the DNA fingerprints was found, indicating that DNA fingerprints of the farcy agents were reproducible over successive generations and were in line with their placement in the genus A/ycobiu feriiiin.
XI PCR-DNA fingerprinting using BamHI restriction enzymes for restriction fragment length polymorphism analysis as a means for differentiating between Mycobaclerium farcinogemse and Mycobacterium senegalense. •.
The I6S1DNA sequencing of Mycobacterium farcinogense and Mycobacterium senegalense the farcy sole agents, gave data of variable signals wilh 1482 nucleotides with 65 corresponding almost complete nucleotide sequences in 1404 positions. Manual alignment of the sequenced DNA using computer, was clear and showed l6SrDNA similarity values of 99.8-99.9%, which corresponded, to 7 and 12 nucleotide differences.
Immunoassay of the protein antigens of the test strains of 'Mycobaclerium farcinogenese and the anti sera produced from the laboratory animals-guinea pigs gave positive results. Mycobacterium farcinogenese isolates produced approximately similar profiles of protein bands.
VII CHAPTER ONE: LITERATURE REVIEW
GENERAL INTRODUCTION.
Bovine farcy is a chronic disease of African bovines caused by Mycohacterium fare-hingenes and Mycohacterium senegaiense (Chamoseau. 1969. 1972). These species have a long and torlous history since the time of a French veterinarian lidward Nocard(1888). Bacterial systematics began as a largely intuitive science but has become increasingly objective due to the development and application of chemotaxonomic. molecular systematic and numerical phenetic methods. The new advances, especially in molecular systematics promoted to compare older and more recent approaches to bacterial classification (Wayne el. al. 1987. Murray et.al.. 1990). This exercise led to the view that bacterial classification at all levels in the taxonomic hicrachy should be based on the integrated use of genotypic and phenotypic data (O'Donnell et.al.. 1993). Polyphasic taxonomy, was introduced by Cohvell (1970) to signify successive or simultaneous studies on groups of organisms using a set of taxonomic procedures designed to yield good quality genotypic and phenotypic data (Goodfellow et.al.. 1997b).Genotypic .infemiation is derived from analyses of nucleic acids (DNA and RNA) and phenotypic data from studies on microbiological, chemotaxonomic. and other expressed features (Vandamme et.al., 1996). It is encouraging that most descriptions of new cultivable bacteria in current issues of the International Journal of Systematic Bacteriology are based on judicious selection of genolypic and phenotypic data (Goodfellow et al ..1997b).The subgeneric classification of several Actinomycete taxa, have been clarified using the polyphasic taxonomic approach (Kroppenstedt et.al., 1990,Wayne 1996; Kim cl.ai. 1996; Yassin et.al.. 1997). Similary. several new species have been described using a combination of genohpic and phenotypic data (De Boer et al., 1990; Good fellow et al., 1997a; Yassin etal.. 1995). The methods used in polyphatic taxonomic studies cannot be too prescriptive as those employed to some extent depend on the rank of the taxa under investigation (Mafio. 1995; Vandamme et al.. 1996). Nevertheless, it is clear that 16S rRNA sequencing is a powerful method for establishing suprageneric relationships between bacteria but less valuable for unraveling relationship below the genus level (Goodfellow e/ al., 1997b). In contrast, DNA.DNA hybridization, molecular fingerprinting and phenotypic procedures are of particular value in delineating groups at species and .-. infrasub specific levels (Stackebrandt & Goebel, 1994; Wayne et a!., 1996). It is the aim of this study to characterise the species of mycobacteria causing bovine farcy in Sudanese bovines using a genotypic and phenotypic studies.
1.1 The Molecular systematics of the genus Mycobacterium Mycobacterium is one of the most clinically important and intensively studied bacterial taxon. Leprosy and tuberculosis, the most serious diseases caused by mycobacteria have been recognized throughout recorded times (Lehmann & Neumann 1896, 1907). However the taxonomic history of the genus Mycobacterium is intricate and difficult to disentangle from those of related taxa, notably the genera Corynebacieium, Nocardia, and Rhodococcus (Bousfield & Goodfellow, 1976; Goodfellow & Minnikin 1984). Mycobacterium farcinogenes and Mycobacterium senegalense belong to the genus Mycobacterium which are the sole causative agents of bovine >arcy in tropical Africa (Chamoiseau, 1979). The good congruence found between phylogenies based on 16S rRNA and those derived from studies on alternative conserved molecules, lends substrates to this later point (Ludwig et al., 1993; Olsen & Woese, 1993; Goodfellow et al.. 1997b). It seems likely that lateral genes transfer between 16S rDNA genes will be rare as this gene is responsible for the maintenance of functional and tertiary structural consistency (Woese, 1987). Nevertheless, the possibility of horizontal gene transfer in 166 rDNA should not be overlooked (Sneath, 1993). The clinical interest in mycobacteria started with the work of Koch (1882). From thereon, there was an understandable, but nonetheless clinical bias, which promoted a tendency to see different taxonomic kinds of mycobacteria solely in terms of their relationships with M. tuberculosis. This taxonomic bias reflected in the common use of the term 'atypical mycobacteria' for strains which could not be identified as either M. bovis or M.tubercolusis e.g.Mycobacteria causing bovine farcy (Goodfellow & Magee, 1907). Circumscription of the genus. The circumscription of the genus Mycobacterium was proposed by Lehmann an Neumann (1896) to include leprosy and tubercle bacilli, organisms which have been classified as Bacterium leprae (Hansen, 1880) and Bacterium tuberculosis (Zopf, 1883) respectively. Subsequently, several hundred mycobacterial species were described but only fourty-one of those were included in the Approved List of Bacterial Names (Skerman et al. 1980). Lehmann and Neumann (1896) like many who followed, saw mycobacteria as aerobic, asporogenous rods, acid-alcohol-fast and produced a substrate mycelium that fragmented into irregular elements at some stage in the growth cycle. These "differential properties" held sway in the systematics of Corynebacteia, Mycobacteria and Nocardiae for many years (Goodfcllow Si. Minnikin, 1984). However, it eventually became apparent (hat the dependency placed on a few morphological and staining characters was such that elements of the genera Corymbacterium, Mycobacteria and Nocardia were virtually interchangeable (Bousfield & Goodfellow, 1976). It was evident by the early 1950s that better taxonomic criteria were needed for classification of Mycobacteria and related Actinomycetes. The introduction and application of chemotaxonomic techniques proved to be the spur for a reappraisal of actinomycetes systematics (Lachevalier & Lechevalier 1970a; Schleifer & Kandler, 1972) led to the assignment of actinomycetes to several wall group (Suzuki et al., 1993). Classification at genus and species levels. Current bacterial species concepts have tended to reflect the taxonomic methods used to classify individual strains (Goodfellow et al., 1997b) The dramatic impact made by the application of chemotaxonomic, molecular systematic and numerical phenetic procedures on bacterial classification is eloquent testimony to this point. It is, therefore, the overall pattern of properties shown by cultivatable bacteria not the processes, which gave rise to them which are currently seen to be paramount in bacterial classification. Views on how bacterial species should be delineated have been greatly influenced by the emergence of chemotaxonomy (Goodfellow & Minnikin, 1985), molecular systematics (Stackerbrandt & Goodfellow, 1991) and numerical taxonomy (Sokal & Sneath, 1963; Sneath & Sokal, 1973). ChemoiaAonoiny. Chemical data derived from the analysis of the cell components can be used to classify bacteria at genus and species levels according to the patterns of distribution of the different compounds within and between members of different taxa (Goodfellovv & O'Donnell, 1994a). Chemotaxonomic analyses of chemical (Figure
1:1) i.l. Sources of taxonomic mrormauoti .
component Analysis Taxonomic rank
Base composition (mol% G+C) ' —• Species and genus |ti|: il chromosomal DNA DNA:DNA hybridisation ! —• Species Restriction patterns (RFLP.PFG^) —* Infrasubspecific and subspecies
DNA probes DNA sequencing Infrasubspecific, subspecies ID) \ segments and species PCR based DNA fingerprinting (PCR-RFLP, RAPD) I
Ribotyping Ri osomal RNA Nucleotide sequences Subspecies, species, genus • and above DNArrRNA hybridisation
Amino acid sequences —»• Genus and above Serological comparisons —*• Inirasubspecific. species and genus P )teins Electrophoretic patterns —»• Subspecies and species Multilocus enzyme electrophorosis f Clones within species
Cell wall components Fatty acids Isoprenoid quinones Mycolic acids ( lemotaxonomic markers Species, genus and above Polar lipids Polyamines Polysaccharides Teichoic acids
iPyrolysis mass-spectrometry 1 hole organisms Inlrasubspecific, species and Rapid enzyme tests I Morphology xpressed features Species and genus Physiology macromoleeiiles, particularly amino acids and peptides, lipids (lipopolysaccharides), polysasachairdes related polymers, proteins (e.g.bacteriochlorophyl, whole-organism protein pa Herns), enzymes and other complex polymeric compounds, such as isoprenoid quinones and slerols. all provide valuable chemolaxonomic data. In addition, chemical fingerprints of taxonomic value can be obtained by using analylical techniques (Stead el a/., 1992; Vauterin el ai, 1996), whole-organism proteins (Vauterin el a/., 1993; Verissimo eta/., 1996) and the elucidation oi enzyme profiles based on chromogenic and fluorogenic substrates (Manafi eta/., 19°I) Numerical laxononiy. Karly bacterial systematic^, relied oil lesls lluii were based on bacterial morphology and other whole-organism properties. Strains weve assigned to groups on the bases of characteristics such as acid production, staining and morphological properties, motility, nutritional requirements, pigmentation and spore formation. In contrast, the primary objective of early numerical laxonomic studies was to assign individual bacterial strains to homogenous groups or cluster which could be equated with taxospecies, using large sets of phenotypic daia. The resultant quantitative data on numerically defined taxospecies were used to design improved idcntificaliun schemes (Priest & Williams, 1993). Minimal standards for assigning species to the genus Mycobaelci itiin. The currently recommended minimal standards are acid-alcohol fastness, the presence of mycolic acids, and the appropriate DNA G+C content (Levy-Frcbault & Portaels 1992). Acid-alcohol fastness. The most prominent feature of the genus Mylohacleriiim and the simplest test for discriminating mycobacteria from other prokaryotes is the Ziehl- Neelsen acid-fast stain (Barkdale & Kim, 1978). Mycohacierimn farcinogenes and Mycobacterium sefiegalen.se are acid alcohol-fast ((ioren <•/ 1.2. Molecular Taxonomy of Mycobactcrinmfarcinogenes and Mycobacterium senegalense. Mycobacterium farcinogene and Mycobacterium senegalense are aerobic to microaerophilic actinomycetes which usually form slightly curved or straight, non- motile rods (0.2-0.6 x 1.0-1- urn). Branching and mycelial-like growth may occur with fragmentation into rods or coccoid elements. Cells are acid-alcohol-fast at some stage of growth, and are usually considered Gram-positive though they are not readily stained by Gram's method. The bovine farcy agents do not form capsule, conidia or endospores. rarely exhibit visible aerial hyphae, catalase positive, and produce acid from sugars oxidatively. Form whitish to cream-coloured colonies but the presence of carotenoicl pigments in some strains, notably Mycobacterium senegalense leads to the formation of bright yellow or orange coloured colonies. In some cases the pigments are only produced in response to light (photochromogenic species) but most members of pigmented species also form these pigments in the dark (scotochromogenic species). Diffusible pigments are rarely found (Runyon etal.,\912). Epidemiology and pathology. Occurence. The early history of cattle farcy (Farcin du bouf) in France including Guadeloupe dates back to the first half of nineteeth centuary. Edmoiul Mocard (1888) a French veterinarian reported the isolation of acid-fast, branching filamentous organisms from pus specimens sent from Guadeloupe. The cultures were pathogenic for ox, sheep and guinea pigs, and retained virulence for several months. Experimenial intraperitoneal and intravenous inoculation killed the guinea pigs in 9 to 20 days with the formed lesions resembling those of miliary tuberculosis. Lesions were confined to the peritoneal coverings of the visceral organs, their parenchyma remaining mtact. Subcutaneous inoculation provoked local abscesses at the site of inoculation with involvement of adjacent lymph nodes. The Ac-,inomycetes were observed in the tissues of infected cows as tangled mass of branching threads after treatment with the Gram-Wright and Ziehl-Neelsen strains. The organism, which was slassified as a species of Streptothrix (Streptomyces), was grown aerobically in liquid and solid media. It was later, described as Nocardiafarcinica by TreVisan (1889). « Distribution. The early literature of cattle farcy was reviewed and pointed out that cattle with symptoms attributed to bovine farcy had been reported in Eriteria, France including Guadeloupe, India, Kenya Mali, Senegal, Somalia, Sri Lanka, Sudan, Sumatra and in South America (Mostafal 966). The disease, which was known as "Arboulet" in Anjou Province, appeared to have been fairly prevalent in France though it is now unknown in Europe. Mostafa (1966) noted thai the organisms considered to be responsible for the disease were known by various names (Skerman etal., 1980). Sheater (1920) concluded that there \Vere two distinct forms of bovine lymphandenitis, one caused by Strepthothrix (Nocardia) and the other by Bacillus strains. After the establishment of Nocardia farcinica as the type species of the genus (Opinion 13 Judicial Commission 1954), several reported cases of bovine farcy were reported from east and west Africa (Awad & Karib, 1958; El-Nasri, 1961; Mostafa 1962, 196 7). Histopathology of the disease. The aerobic, gram-positive, acid-fast, filamentous Actinomycetes mentioned in these reports were considered to conform to the organism described by Nocard (1888). The confusion over the nature of the organisms causing or associated with bovine farcy reflected difficulties in the clinical and diagnosis of the disease and the heavy weight given to a few morphological and staining properties. Cattle farcy is characterized mainly by appearance on the medial surface of the extremities, of firm, painless prevascular nodes which later suppurate. When incised, they discharge a whitish odourless mass resembling soft cheese (Report 13), and the regional lymph nodes become converted into firm tumours. Histopathological features showed that farcy lesions on the limbs, particularly the prescapula- suggests that the organisms entered superficial wounds contaminated with soil or other environmental factors (Salih el ah, 1978). Tick bites may also be a route of entry (Mostafa el ah, 1976a) followed by localized subcutaneous cellulitis that spreads along local lymphatic channels to regional lymph nodes. The lungs, testes and udders may also be involved. The disease occurs in chronic form, after which the animal, becomes emaciated and dies (Mostafa 1967a; Salih etal., I978;E1 Sa al., 1979; Blood el al., 1983) and can be confused with tuberculosis as farcy infected cattle have been shown to react variably to the tuberculin test (Awad, 1958; Mostafa 1967c). There has never been any considerable controversies that existed on the relative importance of farcy agents that cause human infections which is unlike Nocardia farcinica (Pulver and Schaal 1978; Sachaal & Lee 1992), nor are there any reported cases of farcy in wild animals or other domesticated animal stock. n Aetiology of bovine farcy. Nocard's (1888) isolates. Bovine farcy was originally described in the West Indies by Nocard (1888), is endemic and reported in many African countries (Awad & Karib 1958; El-Nasri 1961; Mostafa 1967a; ei al., 1979; Marchot el af.J979: Abdulle 1983).The strain originally isolated by Nocard (1888) from the case of bovine farcy mentioned above was designated as the type strain of the type species of the genus Nocardia by a ruling of the Judicial Commission of the International Committee on Systematic Bacteriology (ICSB) in 1954. However, it later became apparent that Nocard's isolate was represented by two supposedly by identical but by very different strains namely Nocardia farcinica ATCC 3318 and Nocardia NCTC 4524. These strains were shown to be markedly dissimilar on the basis of chemical (Laneelle el al., 1971; Lechevalier el al., 1971; Mordarski el a/., 1978), numerical phenetic (Tsukamura, 1969; Schaal & Reutersberg 1978), serological (Ridell &Norlin 1973; Ridell el a/., 1982) and phage sensitivity studies (Prauser, 1981). Gordon and Mihm (1962a) were unable to distinguish Nocardia farcinica ATCC 3318 from strains of Nocardia tisleroids and grouped them together. Bovine farcy from Nocardia farcinica to Mycobacterhim Lipid data, led several investigators to the view that Actinomyceies causing bovine farcy in eastern and western Africa belonged to the genus Mycobacteritim (Asselineau el al., 1969; Chamoiseau, 1969, 1973, 1979). Chamoiseau (1973) proposed I he name Mycohachrium farcinogenes for those bovine isolates and recognised two subspecies: tchadense and senegalense. It later became apparent that strains from Chad differed from thos. isolated from zebu cattle in Senegal. The latter were relatively rapid- growing, showed broader and more intense amidase and glucolytic activities, contained a characteristic mycoside 'C (Laneelle, 1971), but did not: show relatively a high degree of relatedness with strains from Chad. On the bases of these and other differences, Chamoiseau (1973) proposed that Mycobaclehum farchiogenes subspecies ichculeme be classified as Mycobacterhim farcinogenes and their more rapidly-growing counterparts as Mycobacierium senegalense. Members of each of these species differ from all other known mycobacteria as they are found in lesions of the lymphatic system or the parenchyma of the zebu cattle and present a stable mycelium, a positive malonamidase test and show a distinctive pathogenicity for guinea pigs (Chamoiseau, 1979). Taxonomy of bovine farcy agents and related tax. Good classification is a prerequisite for accurate identification, particularly between members of closely related taxa (Goodfellow & O'Donnell, 1993). Improved diagnostic methods are needed, particularly to separate clinical and veterinary important mycobacteria from all other mycolic acid-containing Actinomycetes. Rapid and reproducible methods are needed to distinguish between Mycobacterium farc'mogene from Mycobacierium senegaloise and between these actinomycetes and related taxa {Mycobacierium chelonae, Mycobacieriumfortuitum, Mycobacleriwn. peregrimim) and Nocardiafarcinica This later organism is still sometimes implicated as a causal agent of bovine farcy when diagnosis based on morphological observations, which failed to distinguish nocardiae from other mycolic acid- containini'' Actinomycetes is used (Awa«l & Karib, 1958; Memery eta/., 1958; El- Nasri, 1961; Mostafa, 1962, 1967b; Perpezat et al,, 1967; Awad El-Kareem & Mustafa, 1974; Shigidi et al, 1980;. Oyekunle& Ojo, 1988; Marchot eta/., 1989). Better diagnostic tests are also needed to distinguish Mycobacterium farcinogems and Mycobacierium senegaleme from Mycobacterium chelonae, Mycobacterium. fortuilum and Mycobacierium peregrinum\ these species form a distinct evolutionary branch within the adaptive radiation accommodated by the ger4usMycobacterium (Rogall eta/., 1990; Stahl & Urbance, 1990; Pitulle et al., 1992). Chemotaxonomy. Chemical data derived from the analysis of the cell component can be used io classify bacteria at genus and species levels according to the patterns of distribution of the different compounds will-in and between members of different taxa (Goodfellow & O'Donnell, 1994a) Chemotaxonomic analyses of chemical macromoiecules, particularly amino acids and proteins (e.g. whole-organism protein patterns) all provide valuable chemotaxono nic data (Vauterin el a!., 1993; Verissimo el a/.. 1996) and the elucidation of en: ynie profiles based on chromogenic and fluorogenic substrates (Manafi efa/., 199 ) Development in molecular systematics is perceived essential and complementary in > her methods. Phylogenefic data provide a hierarchic framework of relationships among bacteria but do not give reliable information for the delineation of taxa abo.i ihe species level. Chemical markers are unevenly distribute il across taxa but rarely give information on their hieraiohic rank. It is very encouraL' nj that good congruence exists between the distribution of chemical markers and ih relative positions of taxa in phylogenetic trees (Goodfellow & O'Donnell, 199 Chun et al, 1996). Chemical data are employed to evaluate existing phytogenies ;md can also be used to adjudicate between conflicting phylogenetic systematics (Goo. I follow elal, 1997b). Chemosyslematics or chemotaxonomy is ;i discipline where information derived from whole-organism or cell fractions is used u> classify and type bacteria (Goodfellow & O'Donnell, 1994). The introduction and application of analytical methods such as chromatography and electrophoresis sluwed that chemical methods become an integral part of the taxonomic repertoire ((.'.wdfellow & O'Donnell, 1993). Analyses of lipicls, amino acids and wall sugars promoted a reappraisal of Actinomycetes systematics (Minnikin & Guodfellow, 1980; Minnikin & O'Donnell, 1984; Goodfellow, 1989; Suzuki elal., 19<>1). Representative strains of Mycobactem in farcinogenes and Mycobaclerium setiega/eme were screened for menaquinones (Collins etal., 1977; Abdulle, 1983; * Hamid, 1994). All of these strains contained dihydrogenated menaquinones with nine isoprene units as the major components. Monaquinone analyses provided a convenient way of distinguishing the bovine farcy at'.e its from Nocardia farcinica, as the strains of the latter like all other nocardia except for nocardia amarae (Goodfellow, 1980b; Goodfellow etal., 1982b) contain major amounts of tetrahydrogenated menaquinones with eight isoprene units (Collins el a/., 19N1: Yamadaefa/., 1977). Thin-layer chromatographic analysis of wli ile-organism acid methanolysates provides a rapid, accurate and convenient way o;s distinguishing Nocardia farinicci from Mycobacierhim farcinogenes and Mycobaclerium senegalense strains as the latter gives a muliispot pattern of mycolates (Han.id etal., 1993). Mycobacierium fortuitum and Mycobaclerium peregrimim strains Ii.ul components corresponding to mycolates and non-hydroxylated fatty acid methyl esters in addition to polar mycolates (Minnikin ei a/., 1980, 1982b). Mycoboaemim farcinogenes and Mycobaclerium senegalen.se strains also have a generated j attern of long chain components similar to that of Mycobacteriiim fortuitum (Ridell ei tl., 1982; Hamid et al, 1993). Mycobacterium farcinogenes andMycoh,,t.erhtm senegalense contain mycolic acids that can be separated into a, d, and e; .. 20 DNA pairing data (Levy Frebault c'/#/., 1986). can be distinguished by a number of bacteriological and physiological properties (Stanford el al., 1972; Runyonefar/., 1974)), but not by the results of lipid analyses (Jenkins etal., 1971; Minnikin etal., 1982). The specific epithet chelonei was changed to chelonae for linguistic accuracy (von Graevnitz & Berger, 1980) and is the name used in the Bergey's Manual of Systematic Bacteriology (Wayne & Kubica, 1986). Mycobacterium chelonae subspecies abscessus ATCC 199997T has recently been shown to be markerdly different from Mycobaclerhtm chelonae subspecies chelonae NCTC 946T given results of DNA: DNA relatedness studies carried out under optimal conditions (Kusunoki&Ezaki, 1992). Nocardia farcinica. The long and turbulent taxonomic history of the genus Nocardia has been the subject of several comprehensive reviews (Lachevalier, 1976; Goodfellovv & Minnikin, 1977, 1984, Beaman & Beaman, 1994; McNeill & Brown, 1994). The taxon, which was originally described by Trevisan (1889), subsequently became a dumping ground for nocardioform bacteria. It was only with application of modern laxonomic methods, notably chemotaxonomic, molecular systematic and numerical phenetic procedures, mat relationships between members of this heterogeneous group have been clarified (Goodfellow, 1992, 1997). It is important that nocardiae are correctly classified if the biotechnological, clinical, and ecological roles of these organisms are to be ascertained. Little is known about the role of nocardiae in the natural habitats though they are usually considered to form an important part of the microbial community involved in the turnover of the organic matter in soil (Orchard, 1980). To date, nocardiae have received little attention from microbial technologists but have been the subject of a lot of interest from clinical bacteriologists. In the main time it became evideni that Nocardia farcinica is a serious agent of human nocardiosis (Berd, 1973; Tsukamura etal., 1988; Wallace el al., 1990, 1991; Schaal & Lee, 1992) and a wide range of animals infections (Beaman & Sugar, 1983; Beaman S: Beaman,1994; McNeil cV: Brown, 1994). In dairy animals, especially cows, mastitis is the clinical manifestation of major significance (Battig el al., 1990) Nocardia farcimca ATCC 4524 was found to have many properties; in common with mycobacti-ria (Chamoiseau & Asselmeau, 1970; Ridell &Norlin, 1973; Magnusson, 1976; Collins el al.. 1977; Orchard &• Goodfellow, 1980; Ridell el al., 1982; Ridell & 21 Goodfellow, 1983). This organism is now classified as Mycobacierium senegaleme (Chamoiseau, 1979). • Numerical taxonomic procedures have been applied to most groups of cultivatable bacteria ((ioodfellow ik Dickinson, 1985: Sackin & Jones, 1993) in order to revise existing classification and to classify the unknown strains isolated from diverse habitats (Sackin & Jones, 1993). It is evident from such studies that numerical taxonomic procedures are effective in delineating taxo species. The method has been less successful in the constniction of higher taxonomic ranks, but this almost certainly due to the types of data used rather than to fundamental flaws in numerical methods. Thus, representative strains from diverse genera may have different metabolisms and growth requirements which can make studies across generic boundaries difficult. Numerical taxonomic surveys have been used to circumscribe many taxospecies, including those encompassed in taxonomicallv complex taxa such as Mycobacterhim (Wayne el a/., 1985, 1996) and Snvplomyces (Williams etal., 1983, Kampfere/ al., 1991) Any tendency to see numerical taxonomy as a method with a long past and an uncertain fuliire should he resisted (Goodfellow etal., 1997b). Improved methods and automated data acquisition systems can be expected to facilitate the generation of high-quality phenotypic databases for a variety of purposes. It can for example, be anticipated that with the developing interest in bacterial species diversity of habitat, will be put to other more fundamental uses. Concurrent with these events, was the development of the technologies that allowed rapid characterisation of mycobactei ial isolates. Either through the application of highly specific DNA probes tailored to signature regions of 16S rRNA or through the amplification of I6S rRNA genes by reverse transcriptase-PCR and automated sequencing of the product. Then a computerised comparison to sequences of known species (Wayne, 1997). Another attractive feature of these techniques was that they could be applied to organisms that were hard to grow, or even, for a time, uncultivatabie. The new technology, based on the sequences of selected regions of 16S rRNA, was considered to be the key to the "true" taxonomy, just as had its predecessors, amidase tests, lipid chemistry, phage typing, phenetic numerical taxonomy, sinsitin testing, serology and virulence tests. Particularly striking in early phases of these studies was the confirmation by 16S rRNA sequence comparisons that the phenotypically defined division of the genus 22 Mycobacterium into 'slow" and "rapid" growers represented a genuine major genetically based branching within ihc genus Mycobacterium (Stahl & Urbance, 1990;Pitullee?*tf/., 1992). It is becoming increasingly accepted that nomenclature should reflect genomic relationships (Goodfellow et al., ] 9(;7b) and that all preconceived notions need to be examined within this context (Murray ei al.. , 990). Consequently in the remaining part of this section, taxoiiomic pen-pictures are given to the mycobactreia associated with bovine farcy and the related taxa examined in this study. 1.3 DNA fingerprints. It has already been pointed out that the driving force in bacterial systematic owes much to developments in molecular biology, notably, nucleic acid sequencing studies. However, several other molecular systematic methods provide valuable data for the classification of bacterial species, notably, the estimation of the mean overall base composition of DNA, and indirect comparisons nucleotide sequences by DNA:DNA hybridization and PCR - based RFLP. Extraction of genomic ON A is a key way step to the application of molecular biology techniques. Gram-negative bacteria are easily lysed by detergents such as SDS (Marmur, 1961; Brenner e/ al.,]9S.:) or by sodium hydroxide (Beji e about 50 kilobase (kb) in length and lmg/ml in concentration. NucleoSpin Extract 2 in I is a working procedure using a kit for the DNA extraction from agarose gels and for the direct purification of PCR products, Recovery rates of 75-90% are obtained for DNA fragments about 100-10,000 base pairs. Large fragments over 10 kilobas.es can also be processed by using a prewarmed elufion buffer (5mM Tris/HCI, pH 3 5 at 70aC). DNA base composition is usually considered to be one of the characteristics required to characterise the genome and should also form part of the minimal descriptions of species and genera (Levy-Frebaui: & I'ortaels, 1992). It provides additional information for assigning and/or oo.ifirming the placement of bacterial strains to broad taxonomic groups (Sackin & Jones, 1993; Goodfellowc/a/., 1997b). Such studies may also be used to distinguish between members of taxa that have a similar morphology but are genetically different e.g. members of the genera Micrococcus and Staphylococcus (Colwell & Mandel 1964; Silvestri & Hill, 1965). The number of species and unknown strains neeii o be compared for identification purposes given that microorganisms with marked DNA base composition differences have different chromosomal DNA and hence beloi.u to distinct taxa (Colwell & Mandel, 1964). DNA base composition values a v expressed as the mole percent of guanosine plus cytosine (mole % G+C) They rai w.-from-25 to 80 mole GC in bacteria (Tamaoka, 1994). Well-circumscribed taxospo.-. .s usually do not differ by more than 3 mole % GC whereas members of species within yenus should usually not differ from one another by more than DNA base eomposiiions that can be encompassed at these taxonomic ranks. Simple methods are currently use:! u> determine DNA base composition, namely, direct chromatographic separation ol' enzymatically hydrolysed nucleoticle using HPLC (Tamaoka & Komagata, ll>M; Mesbah et al., 1989; Tamaoka, 1994) and indirect estimation of mole % Cv( comes it from thermal denaturation curves using spectrophotometry (Marmur& Doty. 962; Taniaoka, 1994). The HPLC method, which is more accurate, should be adapted when DNA base composition data are to be used to determine hybridization conditions for DNA:DNA relatedness studies (Kusonoki & Ez ik;. 1992). DNA:DNA hybridization. A un\:\< e property of DNA and RNA is their ability for reassociat.on or hybridization (S:al. branca & Goebel, 1994). The complementary strands of DNA, once denatured, v.in un.ie.r appropriate experimental conditions, reassociat' to reform native duplo; •Wueii.res. The specific pairings are between the base pairs, adenine with thymine and guaniiie whh cytosine, and the overall pairing of the nucleic acid fragments is depeiicient oiv^iniiiar linear arrangements of these bases along the DNA. When comparing nucleic ;K idsifrom different organisms, the amount of molecular hybrid formed and its thermal stability provide an average measurement ofnucleotide sequence similarity (Krbg, I9i;8). A formal molecular definition of bacterial species has been proposed, namely, that a species should generally include strains 'with approximately 70 % or greater DNA:DNA relatedness with 5 C o. less divergence values (Wayne eifa/., 1987). Values from 30 % to 70 % reflect a moderate degree of relationship, but values become increasingly unreliable once they tali below 30 % level as they can be attributed to experimental artifacts. These guidelines have been used to clarify species relationships in diverse bacterial ui-nera (S:ackebrandt & Goebel, 1994; Goodfellow eta/., 1997b). :: Experimental procedures for estimating ! >NA relatedness are based on two key properties of DNA molecules, namely, spcilicity of base pairing and denaturation- renaturation kinetics at specific \:mpcr;.;ures (Marmur & Doty, 1961). Double stranded DNA dissociates into siiur;--sir.-in; vd I >NA either at its melting temperature (Tm) or under highly alkaline coiKii ions ;: d leassociates at temperatures 15 to 30°C below the Tm value at neutral pH. Singlo-s: randed (ss) DNA from one organism will hybridise with ssDNA from another ;: uanism under appropriate experimental conditions to form heterologous mokcules <• duplexes. The procedure currently used .to m asurc DNA sequence similarity values either involves "immobilised DNA" or :• solution reassociation" assays (Stackebrandt & Goebel, 1994). Most methods, apart i'« n optical determinations of hybridized formation, use radioactively labelled refer--nces DNA but nonradio active labelling with either biotin or digoxigenin is a afer an-.i increasingly popular alternative. The ratiotiale for using DNA reassi ciation of numerous studies where a high degree of correlation was found between !>NA imilarity and chemotaxonomic, genomic, serologicaK and numerical phenetic data t; ackebrandt & Goebel, 1994; Goodfellow et al., 1907b). These studies were based * > the original finding that single-stranded DNA from two different strains re ssocia:. to a measurable extent and form a DNA hybrid if the strands contain less 15 (. base : ispairing (Ullmann & McCarthy, 1973). In genera! organisms which have "0 % o jreater DNA similarity also show at least 96 % DNA sequence identity (Stack*.inaikit Goebel,,1994). DNA-rRNA hybridization involves (he us« i oflabelled rRNA as a probe determining relationships between strains at t;xononii( levels and above the generic level (De Smedt & De Ley, 1977). This method v\7i.:i .Hihly used as an alternative to I6S rRNA cataloguing prior to the advent of KNA sec|ui\nciiigand the polyniQrase chain reaction (PCR). Hie DNA-rRNA hybridist ion nic;fib;df has fallen Out offavdurduetothe developments in molecular systematic jough it is. occasionally used (Witt & Stackebrandt, 1990; Park etaL, 1993). H;' The amount of rRNA probe bound and the .lability of the resultant duplexes measure relatedness between strains. J-lomology del-rminations may be strongly biased by the number of rRNA operons in test strains and • y self-renaturation of probe rRNA due to the stable secondary structure of rRNA (Kil| ier-Balz, 1991). Electrophoresis: (Kozolic, 1995 & MiddciulorTetaL, 1992). , Analysis and evaluation of DNA fingerprint ing data. Nucleic acid-based subtyping methods yield DNA fragments of different sizes. Each lane in a gel, membrane, or autbrculiogram : presents the fingerprint of one strain and consists of a few (plasmid profiles, probe-based typing, PFGE PCR-RFLP, and RAPD) to several hundred fragments of different sizes (genomic DNA fingerprints). Methods of analysis and interpretation of tin. e data depend on the aims of the study. Simple visual examination of the data may b •.: suiFicient if the objective is merely to compare a limited number of strains in order to determine whether a particular organism is different or similar to oilier strains e.g. Mycobacterium farcinogense and Mycobacierium Senegal ens. which cause the same disease of bovine farcy but differ in the rate of growth and lipi component (Laneele et a/., 1971). Genomic DNA fingerprinting data may be acquired in several ways. Agarosegels stained with ethidium bromide are usually photographed with negative or positive print (Elder & Southern, 1983). Autoradiograms and filters on which DNA fragments have been visualised by colorimetric methods can be used directly for data acquisition. The first in visual analyses i to determine the refative sizes of each fragment in a lane by comparing them against molecular size standards run on the same gel. The molecular size standard should be chosen carefully to cover all of the fragments in the same lanes. The relationshi.) between the size and the electrophoretic mobility of a DNA fragment is not linear.. everal curve fitting algorithms have been developed to determine DNA fragment sues, of these, the local reciprocal (Elder & Southern, 1983) and the cubic spline inte polation methods are I he most accurate (Press et a/., 1986, Kussel el a/., 19 ) I).Genomic DNA fingerprinting data may also be acquired by using a digitizer or a flatbed scanner connected to a computer and by running appropriate software programs. In this study, a method involved the use of BioRad Image System, which consisted of a 'charge coupled device' camera connected to a computer (BioRaJ, Version 1.2, USA) equipped with Molecular Analyst/P 27 primers with gcnomic template, primers with product, or product with product, are under continuous flux during IV R cycling (Ruano et al., 1991). PCR mechanis.ni is a process with two primary phases, a screening phase during the first few cycles when desire.I DNA fragment is selected by specific primer binding, and an amplification phase dm ny the subsequent cycles when the copy nuiAber of the desired DNA fragment increases exponentially (Saiki etal, 1988). Each cycle of PCR onsists of three phases; i. thermal denaturation (melting) at a temperature that causes dissociation of duplex DNA at 94°C; ii. annealing at a temperature that determines the stridency of primer hybridization; and Hi. elongation at an optimal temperature for polymen.se activity (72°C for Taq DNA polymerase). All cycles begin by denaturing both the template and any previously synthesised product. As the temperature is 1 nvered, primers anneal to the template DNA and are extended indefinetely during the I rst cycle. The annealing step of the early cycles requires pi'imers to scan the genomic temp.ate for their correct target (Mullis and Faloona, 1987). Following primer annealing, the DNA polymerase anchors itself to the primer-template complex, abstracts free dNTPs ;rom the medium, and extends along the template strand. In subsequent cycles, proc; KIS of discrete length arc formed exponentially. The result can be million-fold amplificatk n of the targeted region (Saiki et al., 1988). These products are visible by ethidium biv.nide staining on agarose gels. Finally, in the late cycles, amplified products in high concentration self-hybridise, thereby blocking the primers from their complementary sites. Primers (Rychlik & R.ioads, 1989). The 16S rRNA genes of the strains were amplified by the ,polymerase chain reaction (PCR) using conserved primers (Lane, 1991), and sequenced using the automated Dyo-Deoxy terminator Taq cycle sequencing procedure (Applied Biosystems, 1995). PCk amplification primers are simply pairs of hybridization probes that must act in concert (Ryc.ilik and Rhoads, 1989). Each probe must be specific for its binding site. Usually PCR primers are synthetic DNA molecules 20-30 bases in length. It is necessary to control caa fully the factors that determine hybridization stringency in order to obtain the potential spe.ificity inherent in primer hybridization. This is because DNA oligomers will hybridise to sites containing mismatches, particularly when the mismatches involve G-T base pairs, which contribute almost as to the stability of hybrids as do G-C base pairs (Sanger, 1984). Jenetic mapping has sex oral advantages over other molecular typing melhods. A universal 2t of oligonucleoiide pri;. TS can be used for genomic analysis of member? of a wide variety 28 if species (Bassam el .,/.. 1992). The oligomer primers can readily be synthesised in ihlimited amounts. PCR primers are designed by reference to sequence databases and can Jso be designed to spe/lically amplify phylogetically related class of a gene, referred to as jrfiylogenetic group-speciu primers (Ha.un and Goebel, 1987; Giovannoni etal., 1988a; fiMetal., 1988;Woese. 1987). [Taq DNA polymera.. (Chen el a/., 1976). Thermus aquaticus is a thermophilic (eubacterium thai can i uiiinely be isolated from hot springs and household waters (Chen et i j ifl/., 1976). DNA poly is .-rase exhibits an unusually high optimal processing activity (8000 ! bases per minute at 75°C), and significant extension rates at 75°C at much lower j temperatures (90 bases |cr minute at 22°C). It is a truncated Thermus aquaticus DNA polymerase missing the N-terminal portion of the full-length enzyme (Tunis etal., 1988). This deletion leaves a :. :ihly active and even more heat-stable DNA polymerase. Repeated 'expossure to 98°C in wiction buffer does not seem to diminish the enzyme activity (Tech.Com. USA). Reaction buffers. Mas.: lesium ion concentration is one of the key variables in PCR (Oste, 1989). It is relevant to both the specificity and yield. The Mg (concentration affects the reaction differently at I. ii and low concentrations). Higher concentration stablizes double- stranded DNA and piv nits complete denaturation of the product at each cycle, reducing yield. Excess Mg2! cc ..il also stabilize spurious annealing of the primer to incorrect template sites, resulting i iarger amounts of undesired products and lower specificity (Oste, 1987). On the other h; us, very low Mg2" concentrations (less than 0.5(M) impair the extension reaction, as ; \y.2+ is a required co-factor for enzymatic activity of most DNA polymerases. (Hohmei .., 1987). Potasium chloride bufUl 5 are adequate for majority of PCR assays. PCR of GC-rich loci shows increased specii ;iy when amplified in sodium-based buffers, probably because of more complete denatui. iion (Holm el 29 joligonucleotide primers are required, this means that knowledge of the DNA sequence of |the test organism is essential. • Restriction fragment length polymorphism. PCR-based RFLP method involves the use of (the PCR technique to amplify a particular region of the genome coupled with restriction iendonuclease analyses of PCR products from different strains on agarose or polyacrylamide gels. This method has significant advantages over conventional DNA restriction analyses as it requires only a small amount of chromosomal DNA for digestion and is comparatively much shorter due to the elimination of the Southern blotting and hybridization steps (Lungu et ah, 1994). Another significant advantage of PCR-RFLP over genomic DNA restriction is that problems of poor restriction of genomic DNA due to the DNA base modifications (methylation) are not encountered. The PCR-RFLP technique has been used to separate Mycobacteria from Nocardiae (Lungu 1994) and for delineating actinomycetes below the Ipecies level (Telenti et ah, 1993; Hirsch & Sigmund, 1995; Laurent et ah, 1996; Wayne, |1996; Steingrube e/a/., 1997). IjfCR-based ribotyping method is an alternative to traditional ribotyping, which involves gpie use of PCR to detect polymorphisms in genes or intergenric spacer regions associated |With rRNA or t'RNA synthesis (Klijn et ah, 1991). This procedure has been succesfully used C; ftp type several bacterial species, notably, Mycobacterhim (Stemgrube et ah, 1995) and ^ocardiae species (Lungu, 1994). It has also been shown that PCR-RFLP analysis of the 16S-23S ribosomal intergenic spacer region is a good method for differentiating strains of several bacterial taxa, including actinomycetes (Frothingham & Wilson, 1993, 1994; Abed et ah, 1995; Main et a/., 1997). However, it is unlikely that this method will be of a great value in differentiating between mycobacteria as these organisms only have one or two rRNA operons per genome (Gotler & Stanisich, 1996). Analysis of randomly amplified polymorphic DNA fingerprints (RAPD) also known as arbitrarily primed PCR (AP-PCR), removes this requirement by using a primer(s) chosen without regard to the sequence of the genome that is to be fingerprinted (Welsh & McClelland, 1990; Williams et ah, 1990). RAPD procedure involves enzymatic amplification of the template DNA directed by one or more arbitrary oligonucleotide primers to produce a characteristic spectrum of polymorphic products (Wel:-h and McLelland 1990). That is a single arbitrarily chosen primer combined with two cycles of PCR at low stringency and many cycles at high stringency generated discrete and reproducible set of amplification products characteristic oJ* particular genomes (Williams et ah, 1990). 30 |DNA fingerprint. The amplification parameters must be kept within an optimal range to |obtain reproducible results. The number, reproducibility and intensity of bands in a fingerprint are a function of several parameters, notably, the concentration of salts, and the ; primer annealing temperature, the template concentration and the primer length and sequence (Welt;h & McClelland, 1990). The primer concentration is particularly important for optimal amplification since it dictates the number of possible annealing sites. The required primer concentrations are higher than those normally used in the: polymerase chain reaction (Bassam et ai, 1992). Preliminary work, such as isolation of cloned DNA probes, preparation of filters for hybridization, and nucleotide sequencing, is not required. The possibility of using whole cells circumvents the critical, expensive afld time-consuming steps of DNA extraction and purification. The technique produces a rapid (less than a few hours), sensitive, reproducible, and widely applicable means for inter-strain comparison. The resulting polymorphisms provide a simple means of constructing genetic maps and performing DNA fingerprinting. Nucleotide polymorphisms are easier to identify with random amplified polymorphic DNA markers than the RFLP markers (Williams et al, 1990). Analysis of randomly amplified polymorphic DNA fingerprints is fast and independent of prior biochemical and genetic knowledge of the target organism (Welsh & McClelland, 1990; Williams et al., 1990; Bassam et al, 1992). This means thai the method can be applied to all species from which DNA can be extracted. The existence of polymorphisms among the amplification products can be detected and used as genetic markers for the fast and accurate identification of bacterial isolates in ecological, epidemiological and taxonomic studies (Bassam et al., 1992; BroUsseau et al, 1993). The method has been used to determine inter-strain relationships between diverse bacteria, including Actinomycetes such as Mycobacteria (Abed et al., 1995; Matsiota-Bernard et al., 1997), Nocardiae (Exmelin et al, 1996) and Streptomycetes (Anzia et al., 1994). Nucleic acid sequencing. The most specific and informative methods for classifying microorganisms are based on the determination of precise nucleotide sequences of specific regions of the chromosome (Woese, 1987: Kurtzman, 1992). Sequencing methods have developed rapidly in recent years so that comparative sequencing of homologous genes is now a standard procedure in molecular systematic studies. Conserved genes have been sequenced to establish the position of organisms in an overall taxonomic scheme (Woese, 1987; Kurtzman, 1992) and 31 • conserved genes have been used to distinguish between closely related organisms itit & Tompkins, 1991; Aim & Manning, 1990). able taxonomic information is also obtained by sequencing 16S-23S spacer regions.To representatives of 44 species belonging to 27 bacterial genera have been studied :ler & Stanjsich, 1996). Systematic studies of spacer region variation require PCR plification and hence knowledge of the sequences of conserved regions in the flanking lini of the 16s and 23 S rRNA genes to serve in preimer recognition (Mullis & Faloona, 87; Gotler & Stanisich, 1996). Such regions are known for the 16S rRNA gene but not for :23S rRNA gene. Rlie location of nucleotide sequences within the conserved regions at each end ofthe 16S IrRNA gene that are suitable for amplification ofthe adjacent DNAs. The analysis ofthe p iiiill-length 23 S rRNA sequences has revealed six conserved regions in the first 520 base f pairs but region 10 (position 456-474) is the most highly conserved of these regions (Gutler |r& Stanisich, 1996). |0'Donnel et al, (1993) also pointed out that potential in interpreting nucleotide sequence •data include alignment artifacts, non-independence of sites, inequalities in base substitution ; frequencies between sequences and lineage-dependent inequalities in rates of change. It has already been pointed out that bacterial rRNA genes are organised into operons the composition of which has already been considered (Stull et al., 1988). The 16S subunit is composed of approximately 1500 nucleotides; at the 5' end, and it is separated by an intergenic-spacer region from the 23S subunit. The spacer regions usually encode for several tRNAs. The 23S subunit consists of about 3000 nucleotides and the adjoining 5S subunit of about 120 nucleotides. A second smaller spacer region separates these subunits. Analysis of sequence data. Comparative sequence analyses of coding and non-coding DNA and other macromolecules, notably, proteins, have a central role in biology, particularly in molecular systematics. Nucleic acid and protein sequence similarities often indicate structural and functional similarities and thereby help in the interpretation of complex biological structures and processes. Comparative sequencing in molecular systematics is used to derive phylogenies, these may include details con novel organisms isolated from clinical and environmental samples (Woese, 1987; Embley & Stackebrandt, 1997). The identification of structural genes and control regions in DNA helps to predict the physiological potential and properties of members of microbial communities in natural habitats (Ludwig, 1995) It is now well known that rRNA genes are essential for the survival of all organisms. These 32 Igenes are highly conserved in eukaryotes and prokaryotes and hence can be used to §••* Establish a universal tree of life. Two premises underlie this approach, namely: that lateral f gene transfer has not occurred between 16S rDNA genes and that the degree of dissimilarity I of 16S rRNA sequences between a given pair of organisms in representative of the variation i shown by corresponding whole genomes. "Ribosomal RNA operons are transcribed into single pre-RNA transcripts which contain Sseveral components in the following order (5' to 3'): 16S rRNA, spacer region, tRNA, spacer region, 23 rRNA, spacer region and 5S rRNA (Watson et a!., 1978; Gurtler& Stanisich, 1996). The 16S rRNA genes are similar in length (about 1.5 kilobases) throughout the bacterial domain and contain both highly conserved and variable regions. However, it is essential that the characterization of the bovine farcy agents should show the similarity of the reduced DN A bands. The location of rare changes in the variable regions are specific to group or species in which they occur (Stackebrandt & Woese, 1981; Woese, 1987; Dams et al., 1988). The advantages of using 16S rRNA sequencing for the delineation of species far outweight its deficiencies (Goodfellow et al.. 1997b) due to rapid and inexpensive sequence analysis, provision of high-quality databases, more objective definition of species, species presented within a suprageneric framework and nucleic acid probes for identification (Goodfellow et al, 1997b). In addition the ability to sequence rRNA from difficult to uncultivatable bacteria is helping to unravel the diversity of prokaryotic species (Embley & Stackebrandt, 1997). Nucleic acid sequence data can also be used to design probes for hybridization (Schleifer et al., 1993) and thereby facilitate the development of appropriate selective isolation strategies by showing whether environmental samples contain members of target taxa. Southern hybridization studies between 16S rDNA sequences and genomic DN A digested with restriction enzymes that cut relatively infrequently (e.g., Eco RI or Hind III) have shown that several bands may be hybridised to the probe (Southern et al., 1975). The number of bands often correspond to the number of rRNA operons in the genome (Loughney et a/., 1982; Gamier et al., 1991; Srivastava&Schlessinger, 1990; Toonetal., 1996) e.g. one or two in genus Mycobacterium (Bercovier et al., 1986). Sequence databases. The ongoing development and world wide application of rapid techniques for automated sample processing and sequence determination is leading to a daily out of new sequence data. To analyse putative new sequences, first find out whether the sequencef, are already known, whether similar sequences exist, and whether any additional information related to similar sequences is available in centres involved with the 33 [acguisition of the nucleic acid and protein sequences specially databases on ribosomal ribonucleic acid sequences (RDP) were established. (Maidak et al.., 1997; Dayhoff et al., 1965). Alignment of sequence data. Once the complete or partial sequence of 16S rDNA has been attained, the identity of the fragment has to be determined. The first step in the process of sequence identification is the alignment of sequence data to a set of sequences of i representatives of the main lines of descent within the bacterial domain. Complete alignment may not allow to be possible due to factors such as differences in terminal length (i.e., some sequences are longer than others), internal length variation (i.e.., the presence of jbase deletions or insertions), recombination and high mutation rates associated with hvpervariable regions (Chun 1995). Computerised alogrithms for sequence alignment, such as pairwise and multiple alignments are based on minimising mismatches. However, such optimal alignment may not be historically correct since base changes in regions of 16SrRNA associated with secondary structural features of the molecule, such as hairpins and pairing between distant regions, cannot be assumed to have the same effect or importance as changes in loops and hypervariable regions that are not associated with the preservation of secondary structure. (Chun 1995). ' In this research study, alignment of sequences "by hand" takes into account secondary structural features, namely: base signatures, pairing between distant regions, conserved mismatches, hairpins, gaps and loops and thereby provides more accurate data than those generated by automated computerised algorithms. During manual alignment, some idea about the identity of the sequence can be gained by considering the main line of descent to which it best aligns. Sequence alignment comparisons should always be considered as working hyphotjieses due to the degree of uncertainty about the 'historical correctness' of the data. Uaalignable regions should ultimately be omitted from phylogenetic analyses. Chun (1995) incorporated base pairing features of 16S rRNA sequence data thereby enabling alignment of user- generated sequences. Once sequences have been aligned, similarity matrices can be constructed. In most cases the main phylogenetic group to which an unidentified sequence shows its similarity is determined. Then, the sequence can be compared to those available for all members of that group. Such a comparison can lead to placement of the sequence at one of the various taxonomic levels from family down to species. It is at this stage that a detailed laxonomic 34 knowledge of the group into which the sequence falls is necessary since failure to include .nucleotide sequences of all representatives can lead to the erroneous assumption that the sequence represents an unknown or uhsequenced taxon. In most of these cases the nucleotide sequences of the different operons in the same strain have been found to be either identical or to show a low level of heterogeneity (Maden et al., 1987; Dryden & Kaplan, 1990; Heinonen et al., 1990; Ji etal., 1994b; CMiaetal., 1996). However, there are some instances where heterogeneity has been found between different rRNA operons in the same strain. Partial sequences should not be used to unravel intrageneric phylogeny and that the phylogenetic positions of bacterial taxa should be based on the analysis of complete nucleotide sequences. However, the 3' terminal 900 nucleotides, or {he first 450 (5'-3') nucleotides can be used for the rapid allocation of isolates and clone sequences to higher taxa (Stackebrandt & Rainey, 1995). Sequencing of the first 500 bases of an environmental 16SrDNA clone for example can be used to assign the clone to a main line of bacterial descent. This approach can be used to determine the degree of diversity in a particular clone library and to design oligonucleotide probes for screening clone libraries for the abundance of probe-positive clones (Stackebrandt & Rainey, 1995). Analysis of 16S rRNA sequence data show that mycolic acid-containing Actinomycetes form a suprageneric relationships well defined branch within the evolutionary, radiation occupied by actinomycetes (Embley & Stackebrandt, 1994; Chun & Goodfellow, 1995; Pascual et al.1995; Rainey etal, 1995a; Ruimy et al., 1995; Goodfellow &Magee, 1997). Mycobacteria form a distinct phyletic line within this clade and have a phylogenetic depth comparable to ihat of mycolic acid-containing taxa. The renewal of interest in the so-called opportunistic mycobacteria and similar acceleration in the naming of new species ofrapidly-growingmycobacteria occurred in the 1980s with the arrival of the AIDS epidemic on the clinical scene and the unique ability of non- pathogenic and rapidly-growing mycobacteria to effect bioremediation of environmental contamination with various petroleum products or toxic halogenated hydrocarbons (Haggblom et a/., 1994; Kleepies et al., 1996). Stackebrandt ;ind Goebel (1994) noted that species having 70% or more DNA similarity usually have more 97% sequence identity. The 3% or 45-nucleotide differences are not evenly scattered along the primary structure of the 16S rRNA molecule but are concentrated in these hypervariable regions. It is therefore, important that complete sequences of 16S rRNA databases (Goodfellow et al., 1997b). 35 -Several authors have described a highly variable region between positions 175 and 23 8 (£ icoli numbering system) which contains possible species-specific regions (Stahl & Urbance, 1990; Pitulle et al., 1992; Kirschner et al., 1993). Unique sequence stretches are found for [all species although some of these sequences differ by only a single nucleotide. Within the [genus Mycobacterium all of the slow-growing species are highly related (similarity values greater than 94.8%) and form a shallow, heterogenous group that is separated from the clade ^composed of the rapidly-growing mycobacteria. Partial sequencing of 16S rRNA shows a close relationship between Mycobacterium chelonae, Mycobacterium.farcinogenes, Mycobacterium fortuitum and Mycobacterium senegalense (Pitulle et al., 1992). (Numerical taxonomic (Ridell & Goodfellow 1983), serological (Ridell, 1981,1993) and I- Hipid studies (Ridell et al., 1982; Hall & Ratledge, 1985), confirmed the distinction between Mycobacterium farcinogense and Mycobacterium senegalense and also highlighted the relationships between these taxa to Mycobacterium chelonae and Mycobacterium fortuitum complex (Hamid, et al., 1993). 1:4. IMMUNOLOGY OF BOVINE FARCY AGENTS Pathogenic mycobacteria are important cause of both human and animal diseases world wide (Young, 1988; Rott et al., 1994). During infection, mycobacteria live within phagocytic cells of the immune system and protective immunity involves recognition of mycobacterial antigens by T-lymhpocytes. Infection also results in generation of antibody response to the pathogen and monitoring of antibody levels is of use in the diagnosis of mycobacterial diseases. Purified antigen preparations from these organisms can be applied for use in the immuno- blotting techniques for analysis of individual components present in the complex antigen mixtures. This plays an important role in the study of mycobacterial diseases (Young, 1988). Immuno blotting can be applied to diagnosis by antibody antigen detection, and also to analysis oftheT-cell response (Janssene/al 1996). Most individual develop antibodies to common non-pathogenic ref Poulet & Cole 1995 environmental mycobacteria. in order to develop specific serological tests for mycobacterial diseases, it is therefore necessary to identify antigens which are unique to the pathogenic strain because mycobactreia produce a surface capsule consisting mainly of complex lipid components, some of which are species-specific antigen (Brennan, 1984). Several molecular and immunological typing systems have been found to be helpful in 36 iineating Mycobacterium farcinogene and Mycocobacterium senegalense below the cies level and in clarifying the epidemiology of mycobacterial infections (Grimont& Srimont 1986; Levy- Frebault et al., 1989; Welsh & McClelland, 1990; Klijn et al., 1991; Frothingham & Wilson, 1993; Poulet & Cole, 1995; Gurtler & Stanisich, 1996; Janssene/ 1996). mmunological studies depend mainly on typical immune responses to infectious agents followed by a state of long-lived memory during which subsequent contact with antigen leads to a more effective response and rapid rejection of the pathogen concerned (Gray, 993; MacKay, 1993; Sprent, 1994; Zinkernagel; 1996; Ahmed & Gray, 1996). Memory is I- •* {.carried out by both T and B-Cells which reflect the combination of an increased precursor ^Frequency of specially reactive lymphocytes and heightened sensitivity to the antigens •concerned. Primary responses to pathogens are often intense and cause small numbers of specific T- and B-cells undergo marked clonal expansion followed by differentiation of various homing molecules ( eg B integrin families). Activated cells aquire the capacity to penetrate i •;the walls of small blood vessels and can thus disseminate throughout the body to seek land destroy ihe pathogen concerned (Rott et al 1996. Andrew etal, 1996, Tsuzukie/ Ik 1996, Butcher & Picker, 1996). Effector cells have a relatively short life span and most of these cells are eliminated at the end of the primary response (Sprent, 1994, Sprent & Webb, 1995). At this stage effector cells are no longer useful, and elimination of these cells can be viewed as a device to preserve the primary repertoire thus maintaining responsiveness to new pathogens. Eliminating all of the cells participating in the primary response, however would obviously be counter productive and lead to tolerance rather than immunity. Memory cell generation thus appears to reflect a trickle-through process whereby a small fraction of the cells stimulated in ihe primary response somehow evade death (apoptosis) and survive for prolonged periods. Genes control innate susceptibility to several mycobacterial species as well as other intracellular pathogens including Salmonella typi murium and L. donovani (McLeod et al., 1995; Blackwtll et al., 1994). A candidate for this gene was identified and designated as NramPl (Natural resistance associated macrophage proteinl;Vidale/ a/., 1993). 'Sequence analysis of Nrampl revealed that susceptibility to infection is associated with a single non conservative protein substitution at aminoacid position 169 within (he fourth predicted transmenbrane domain of the Nrampl protein (MBXO et al.,\99A) 37 jfanulomatous inflammation plays a major role in the pathogenesis of a wide variety of eases caused by infectious agents including Mycobacteria ( Present et #/.,1966; Cuttino, 49; Epstein, 1967). Although it has long been suspected that the granuloma may be a lifestation of delayed hypersensitivity (DHT), significant data supporting this concept i agents have not been gathered (Crowle 1962). antigenic glycolipids located on mycobacterial cell surface are probably important gvirulent factors which affect the interaction between mycobacteria, phagocytic and >immunogenic cells which resulted into DHT Crowle 1962. However; Present et al. (1966) : revealed similar study. It is of interest to note that lipids are similar in certain strains of ^ mycobacteria which can be pathogenic (Hamid, 1993,1994). From the high rate of cross- reactivity, these related taxa of mycobacteria interact with host immune system in a similar manner. Within the frame work of a single antigen, or multiple antigens from a single strain, the approach is relatively simple and straight forward, however, the complexity increases considerably when antigens from different species are compared, because shared determinants may be found on molecules with different physiochemical properties ( Chaparas et al.. 1978; Janicki et al., 1976). Cytokine-producing T-cells help macrophages to kill intracellular parasites and mycobacteria only survive inside mnycrophages through their ability to subvert the innate killing mechanisms of these cells (Rott el al., 1996). The need to identify antigens at molecular and submolecular level has been a major impeteus for what is now an enormous amount of literature on the application of immunoassay technology to the analysis of host-microbe responses (KoUetaL, 1996). The search for organism-specific antigens which may be diagnostically useful for monitoring infection and treatment of chronic diseases which continues to be a major challenge. In addition, with the growing limitations and costs of antibiotics, the need for more effective immunization programs and the development of therapeutic schedules using specific antibodies demand a greater understanding of the nature of the immune response to infective organisms. Serotaxonomic studies of Mycobacterium farcinogenes and Mycobacterium senegalenses, the farcy sole agents (Ridell, 1983) interestingly revealed antigens which demonstrated in one species but not in another, i.e antigens which might be species specific e.g one different antigen each in Mycobacterium farcinogenese and Mycobacterium senegalense. Ridell found one precipitinogene in Mycobacterium farcinogense strains and another was only revealed among the Mycobacterium senegalese strains. The presence of these antigens does, therefore indicate differences between Mycobacterium farcinogense and 38 Mycobacterium.senegalenses. These specific antigens appeared, however, only a limited number of strains and their value for classification and differentiation should not be [exaggerated. •i | While antibodies have the ability to bind directly to antigen molecules, the specific antigen [receptor on T-lymphocytes recognises antigens after they have been 'processed'and are | exposed on the surface of an antigen-presenting cell in combination with a component of •the major histocompatibility complex or HLA molecule (Rott etal., 1996). Since, protective ? immunity to mycobacterial infection involves antigen-recognition by T-cells, it is of interest I to apply immunoblotting in this context be used in multiple proliferation assays (Towbin et \ah, 1979; Abou-Zeid 1987). Enzyme linked immunosorbant assay (EL1SA) technique is a useful diagnostic tool ( Kawaza et aL, 1990). The technique? can be used in epidemiological studies against a wide variety of microorganisms (Choretah, 1991). It is one of the aims of this study to apply ELIS A technique to test serum samples from field cases of bovine farcy to detect infection in chronic cases of the disease and subsequently be used for diagnosis. Separation of antigens permits better resolution of mixtures, identification and quantitation of either antigens or antibodies ( Chaparas,1981. et ah, 1987). Rationale It is evident that the ability to delineate taxospecies has had a profound influence in bacteriology, notably, for the identification of pathogenic bacteria. Indeed, the strengths of numerical taxonomic procedure far outweigh its limitations (Goodfellow et al., 1997b. Improved methods and automated data acquisition systems can be expected to facilitate the generation of high-quality phenotypic databases for a variety of purposes. It can for example, be anticipated that with the developing interest in bacterial species diversity of habitat, will be put to other more fundamental uses. The genetic variability observed among these pathogenes, may be the result of the transfer of pathogenicity genes between strains. However further studies of the relationships among genome structure, taxonomic and functional groupings of these strains is required. Objectives of % he study: In light of these, it is therefore, essential to evaluate the taxonomic integrity of taxospecies by examining ihe clinical isolates and representative strains. 1. Phenotypic characterization of Mycobacterium farcinogenes and A -i.senegalense using morphological, biochemical tests and rapid fluorogenic tests. 39 '{L. Molecular characterization: DNA extraction and purification, PCR amplification, DNA sequencing of 16SrDNA and PCR-based restriction fragment length polymorphism. 3. Iriimunological analyses by animal pathogenicity test, application of FXISA technique for diagnosis of Mycobacterium farcinogenes from clinical serum samples and protein antigen profijes determination of molecular weight using SDS-PAGE method. 40 CHAPTER TWO: MATERIALS AND METHODS. | Bacterial isolation, identification and characterization. |2.1. Phenotypic Characterisation Survey and sources of the test isolates; v Survey of the disease was conducted in Omdurman, El Obeid and Dillinj slaughtering f houses. Field visits were also conducted in different farms in Khartoum area and in El s Obeid and Dillinj. Lymph nodes and serum samples were collected from animals in all the endemic areas of the disease. : Reference strains: Mycobacterium farcinogenes and Mycobactehum senegalense and related taxa (Mycobacterium chelonae, Mycobacterium fortuitum, Mycobacterium peregrinwn and Nocardia farcinica strains were obtained from Molecular Microbiology Laboratory/Department of Agricultural and Environmental Sciences - University of Newcastle upon Tyne, UK. 2.1.1 Morphological and biochemical tests. Sampling and isolation Serum sample is preferred to plasma for immunoassay due to the tendency of the clotting factors in plasma. Sera samples were obtained from clinical cases (Omdurman, El Obeid, and DilUnj slaughtering houses). Blood was collected in sterile glass containers without anticoagulant and allowed to clot at room temperature for one hour. Once the clot had formed, it was loosened from the walls of the containers to aid retraction and then left overnight. Sera samples were centrifuged at 150g for 5 minutes to sediment erythrocytes and then at 350g for 15 minutes. The straw-coloured solution sera were transferred to sterile eppendorf tubes for long-term storage and heat at 56°C for 30 min. to destroy the heat -labile components of the complement. Lymph nodes were examined and asporates were collected into sterile plastic containers before and after the antemortem and postmortem inspections respectively. The swollen and pus containing lymph nodes were carefully removed and kept in clean sterile containers at lower temperature or kept in thermofla.sk. All samples (sera and lymph nodes) were kept at low temperature (4° C). 41 2.2. Phentitypic characterization. 2.1.1 Morphological test. Purulent materials (lg) from positive and negative specimens, were ground using a pestle and mortar, 7ml of IN hydrochloric acid was added and the resultant preparation was allowed to stand for 10 minutes. Preparations were then neutralised with 2N sodium hydroxide (4ml), centrifuged at 3000 (rpm) for 30 minutes and the supernatant was discarded. The deposits were again examined microscopically for the characteristic branched hyphae prior to inoculation onto to slopes of Lowenstein-Jensen medium (Cowan and Steel 1974). Microscopical examination of smears using Ziehl-Neelsen method (Cowan and Steel, 1974). Fixed smears on slides from lymph nodes materials and grown cultures were flooded with strong carbol-fuchsin and heated until steam was produced. The preparations were then cooled for 2-3 minutes prior to heating as before. Smears were then washed thoroughly under running water. Decolourization in acid-alcohol was carried out until traces of red strong carbol-fuchsin had disappeared. Washed again in water and then flooded with 0.5%(w/v) malachite green (or methylene blue) for one minute. The preparation was then washed thoroughly under running water and allowed to dry. Cultures were incubated at 37° C and examined for bacterial growth for over 21 days. Raised yellowish-white irregular colonies tentatively were identified as Mycobacierhim farcinogenes by microscopical examination. Seventeen isolates from different cultures of lymph nodes were selected for further analysis. All the seventeen isolates were selected from cases of bovine farcy based on colonial and morphological studies. The isolates were maintained on glucose yeast extract agar (Gordon and Mihm (1962) at room temperature and as suspensions in glycerol (20%, w/v) at 20°C (Wellington and Williams, 1978). The glycerol suspensions were prepared by scraping growth from heavy inoculated plates or tubes of GYEA, incubated at 37°C for 14 days and making heavy suspensions in 3ml glycerol in Bijou bottles (1.5 ml in plastic microfiige tubes). Frozen glycerol suspensions were used • both as a means of long term preservation of bacteial strains and also provide a ready source of inoculum for variety of purposes. Inocula were obtained by thawing suspensions at room temperature for about 15 min.and they were then treated in a similar way to conventional broth cultures. 42 The isolates were characterized based on a wide range of characters including biochemical, degradation, enzymatic, nutritional and physiological tests. All of the tests were incubated at 37° C and read after 7,14,21, and 28 days. Tests on nutritional, physiological and antibiotic features were carried out in replidishes (Sterilin Teddington, U K) used in conjunction with a multi-loop inoculation procedure (Williams et ah, 1983a). Replidishes have 25 separate compartments and filled with 3 ml of sterile medium. The muki loop inoculator consisted of a square template of perspex supporting 25 loops (Medical Wire and Equip.Co.UK) which were used to pick up about 1/400 ml of glucose yeast extract agar broth from wells containing inocula. One ml of each of the G YEA broth were pippeted into separate compartments of the replidishes. The advantages of replidishes over conventional petri-dishes that they allow an economic use of media and provide a way of maximising the incubation space. Biochemical tests (MacFaddin, 1980) Arylsulphate activity test (Tsukamura, 1975). Test medium containing tripotassium phenolphthalein sulphate were dispensed in test tubes seeded with single drops of glycerol inocula and incubated at 37°C for 3 days. After incubation lml of a 10% (WYV) solution of sodium carbonate was added to each of the tubes and a pink colour indicating the release, of phenolphthalein, was scored as a positive result Semi -quantitative test for catalase activity (Kubica, et.al.,1966), The test was carried out using the method of Kubica et ah (1966). Lowenstein-Jensen media (5 ml) was added to test tubes (16 by 150 mm) which were kept in vertical position and sterilised at 75°C for 60 minutes on two consecutive days The sterilised were inoculated with one drop of glycerol suspension and the inoculated tubes incubated at 37° C for 14 days. After incubation, lml of freshly prepared hydrogen peroxide (0.5ml of substrate stock, i.e.30% (v/v) hydrogen peroxide) was mixed with 0.5ml of foam base stock 10%, (v/v) Tween 80 in water and added to each tube. The tubes were then examined for foam of oxygen bubbles derived from the action of catalase on hydrogen peroxide. A positive result was recorded when the height of the foam in tl :e test tubes was 45mm or greater. 43 Niacin accumulation (Runyon, et al.,1959 ). Strains grown on Lowenstein-Jensen media were tested for the accumulation of nicotinic acid. Cultures were flooded with 0.5ml of sterile distilled water and after 60 minutes the aqueous extract was pippeted into a screw-capped test tubes. Aniline- ethanol (0.5ml) and cynogen bromide (0.5ml) were added to aqueous extracts. The development of a yellow colour indicated the presence of niacin which was positive result. Nitrate reduction and hydrogen sulphide production (Skerman, 1967). Nitrate reduction was detected using a semisolid nitrate medium. Inoculated tubes were incubated for 21 days when a few drops of reagent A (0.8ml) of sulphanilic acid in 100ml of 5N acetic acid) and reagent B (0.6ml of dimethyl-alpha-naphthylamine in 100ml of 5N acetic acid) were added. The development of a rose colour on addition ofreagentB was scored as a positive result. If no such colour developed after a short period of time, a small amount of zinc dust was added to the tubes. Zinc ions are known to catalyse the reactions of the enzyme nitrate reductase Thus, if, any nitrate is still present in the medium, the addition of the zinc powder will promote the reduction of nitrite which can be detected by the late development of the characteristic rose-red colour. Such cases indicate the continuing presence of nitrate was recorded as negative. The continued absence of any colour in the medium, even after the addition of zinc, indicated that nitrate has been reduced to nitrogen and such cases were scored as positive. Hydrogen sulphide production was detected by inserting lead acetate paper strips (Kuster and Williams, 1964) into the neck of the tube containing the inoculated semi solid nitrate medium examining for blackening after 21 days. Blackening in the lead acetate strips due to the formation of lead sulphide was scored as a positive result. Phosphatase production test. A 1% (v/v) aqueous solution of sodium phenolphthalein di phosphate (B.D.H. Chemicals Ltd.), was sterilised by filtration (0.22um pore diameter-Millipore filter) and added to cooled sterile nutrient agar to give a final concentration of 0.0001% (w/v). After incubation for 10 days at 30° C, 0.1ml of concentrated ammonium solution (BDH..Chemicals Ltd.), was then pippeted into the lid of each petri dish and the inverted petri-dishes allowed to stand for 10 minutes. A positive reaction was indicated, by the appearance of a pink coloration in and around the bacterial growth. Phenolphlhalein diphosphate forms a substrate for alkaline phophatase and upon 44 hydrolysis releases the indicator-free phenolphthalein, which reacts with alkali to give a pink coloration indicating a positive result. 2.1.2 Degradative tests. These tests were carried out to detect the presence of a number of extra-cellular enzymes known to be discontinuously distributed amongst the actinomycetes (Goodfellow,1979, Goodfellow and Andreson, 1977a; Williams etal. 1983b). Adenine degradation. Adenine (0.5% w/v), elastin (0.3% w/v), guanine (0.5% w/v), hypoxaqnthine (0.4 % w/v), testosterone (0.1% w/v), L-tyrosine (0.4% w/v)and xanthine (0.4% w/v).These compounds at appropriate copcentration, were incorporated into glucose yeast extract agar (GYEA), care being taken to ensure that the insoluble compounds were eventually distributed throughout the medium. Clearing of the insoluble compounds from under and around the area of the test strain growth was taken to denote a positive result. Plates were examined at 7,14,21, and 28 days incubation. Aesculin hydrolysis. The hydrolysis of aesculin was detected using the method of Williams et al.{ 1983a). Aesculin (0.1%, w/v) was added to a soft agar containing yeast extract a,nd ferric ammonium citrate. The basal medium minus the aesculin formed the negative control. Tubes were inoculated with one drop of glycerol suspension and examined after 7, 14, and 21 days incubation. Blackening of the test medium indicated a positive result. The degradation of theaesculin,a glycoside (C5-H16 O9) from Aescus hippocastanum (Linnaeus), is catalysed by a hydrolase enzyme to give an aglycone 6:7- dihydrocoumarin) which complexes with the ferric ions in the medium to give a black-brown melanin-like-pigment since non of the test strains produced brown- diffusible pigments all of the negative controls were colourless. AHantoin and urea test. Allantoin (0.33%, w/v) and urea (1.5%, w/v) degradation were detected in the liquid medium of Gordon (1967). In each case broth s were inoculated with a drop of the glycerol suspension and results read after 7,14, 21, and 28 days incubation. For broth substrates active enzyme production causes an alkaline reaction which is detected by the indicator, phenol red which changes colour from yellow /orange-red/purple. A positive allantoin result indicated the presence of two hydrolase emzymes, one of which breaks allanton to allantoic acid while the second enzyme results in the formation of urea and glyoxylate. In the hydrolysis of urea, 45 ammonia and carbon dioxide are formed. The resultant change in pH, from neutral to alkaline is detected using the phenol red indicator. Arbutin hydrolysis test. The hydrolysis of arbutin (0.1%, w/v), hydroquinone-beta- glycopyranoside, was detected using the method of Williams, etal. (1983a). The basal medium minus the arbutin acted as a negative control. All tubes were inoculated with a drop of glycerol suspension and were examined after 7, 14, 21, and 21 days incubation. Once again blackening of the test medium indicated a positive result. The degradation of arbutin is also catalysed by a hydrolase enzyme. The hydroquinone produced complexes with the iron in the medium to form a black-brown melanin-like polymer. Brown pigments were not produced in the negative controls so positive results were easy to read. Casein hydrolysis test. The production of casein hydrolysing proteolytic enzymes was detected after incorporating skimmed milk powder (1%, w/v) into GYEA. Inoculated plates were read at 7,14,2, and 21 days. A positive result was indicated by a zone of clearing around and under the area of growth of the test strains. DNA and RNA degradation test. The degradation of DNA was defected using Bacto Dnase Test Agar (Difco) which contains (0.2% w/v) with ribonuciic acid breakdown was observed after incorporating RNA (0.3%, w/v) into the base medium of Goodfellow et al., (1979). The inoculated plates were incubated for 14 days and then flooded v/ith IN hydrochloric choleric acid. The tests depend on the ability of the deoxyrinonucleases and ribonucleases to reduce the viscosity of solutions of semi- purified nucleic acid extracts. The addition of IN hydrochloric acid causes the nucleic acid to be precipitated as a fibrous mass, so that a positive reaction is indicated by a zone of clearing under and around the growth of test strains. Gelatin hydrolysis. The production of proteases which hydrolyses gelatin was detected in GYEA plates supplemented with gelatin (0.4% w/v). Inoculated plates were incubated for 14 days and then flooded with an acidic mercuric solution (Frazier 1926). A positive result was indicated by the presence of a clear zone under and around the area of growth. In this test mercuric chloride, a heavy metal salt, complexes with sulphdryl and other electron negative groups in the gelatin, causing an irreversible denaturing of proteins which result s in a heavy precipitation in the medium. Hence zones of clearing are taken as an indication of positive result. Starch degradation test (Cowan and Steel, 1974). Amylase production was detected in GYHA supplemented with potato starch (1% w/v). Inoculated pkues were 46 • incubated for 14 days the flooded with iodine solution. Since iodine complexes with the unchanged starch, zones of clearing around colonies were taken as a positive result. In the cleared areas the starch has been broken down into low molecular weight dextrins and/or disaccharides by the amylase. Tributrin test. The production of esterases able to break down glycerol tributyrate was detected in Tributyrin agar (Oxoid). Inoculated plates were read weekly for 28 days and zone of clearing around the area of test strain growth was taken as a positive result. The opacity of tributyrin agar is due to the presence of a stable emulsion of micro-droplets of tributyrin in the basal medium. Strains able to break down these droplets produced water-soluble butyric acid, hence the clearing of the medium. Tweens 20 40, 60, and 80 degradation test (Sierra, 1957). Tweens are water soluble fatty acid esters of polyoxyalkylene derivatives of sorbitan (Sierra, 1957). Different Tweens differ only in the particular fatty acid component. Tweens 20, 40, 60, and 80 contain lauric, palmitic, stearic, and oleic acid esters respectively Lipolysis of Tweens liberates the calcium salt of the particular fatty acid, and the crystals formed are characteristic for the different Tweens. The degradation of Tweens was detected using the basal medium of Sierra (1957). In each case the basal medium was supplemented with the Tween (1%, v/v) and inoculated plates read after 7, 14, 21 and 28 days for the presence of crystals of insoluble calcium salts which form an opaque halo around the colonies and indicate a positive result. « 2.1.3 Rapid enzyme tests Biochemical survey of Mycobacteria using fluorogenic enzymes and substrates. Substrates (Table 2:1 Muftic, 1967) and tested Mycobacteria strains (Table 3:2). Materials. Glucose lOg, Yeast Extract lOg, agar 15g and sterile distilled water 1 litre, autoclaved at 121° C for 15 minutes. Phosphate buffer (pH 7.4), Dimethyl sulphoxide; Fluorescence microtitre plate reader (Labtech Int.Ltd.UK.) and Densitometer (Bio Merieux). Procedure. 1-adi .strain was subcultuerd onto glucoseyeast extract agar (Sigma) and incubated at 37° C iihtil good growth was obtained. Strains were harvested and emulsified in sterile phosphate buffer (pH 7.4) to an equivalent to McFarland 3.0 using densitometer (Bio Merieux). 47 Table:2:l Substrates used in Fluorogenic Enzyme Tests. M.W Mg/5ml 6ml/bottle 4-MU-B-D galactopyranosid 338.32 5 6 4-MU-B-D glucopyranoside 338.32 5 6 • 4-MU-N-acetyI - B -D- glucoronide 379.4 5 6.7 • 4-MU-B-D- glucoronide 406.35 5.6 6.7 MU-L-D-xyloside 308.31 6 7.2 MU-L-D-glucoside 338.32 4.6 5.5 • MU-L-D- galactoside 338.32 5 6 4 MU-B-D- fucoside 322.30 5 6 • 4-MU-L-D-mannoside 338.32 4.8 5.8 4-MU-B-D-mannoside 338.30 5 6 • 4-MU-phosphate 300.10 5 5 4-MU- sulfate 294.30 4.4 5.3. • 4-MU-acetate 218.20 3.6 3.9 4-MU-butyrate 246.30 3.2 4.3 4-MU-nonanoate 316.40 3.4 5.8 4-MU-propionate 312.30 4.4 4.6 L-alamyl-7-amido-4- methylcumarin 360.30 5.3 6.4 • L-leucyl-AMC 293.80 • 4.3 5.2 L-lVolyl-7-AMC 272.3 4 4.8 Pyroglutamyl 7- AMC 286.29 4.2 5 • PhcnyIanalyl-7-AMC 322.40 4.8 5.8 Glutamyl-AMC 304.30 4.5 5.4 • Lysyl-AMC 304.40 4.5 5.4 • Asperginyl - AMC 410.9 4.6 7.3 L-L-arabinose 308 3 4.6 4-inethyl-7-nitro Coumarin 205 3.5 3.6 Methyl - MU - B - ribofuranoside 308.3 3.2 4.6 • N-acetyl -7- AMC 217 3.2 3.8 • 8-acetyl-4-MU 218 3.2 .3.8 H-Orn-AMC. 2HC1. 289.9 5.2 5.8 14.8 umoi of each substrate was dissolved in phosphate buffer (pH 7.4) and filter sterilised. 4-methyl-7-nitrocoumarin, 7-methoxycoumarin, 8-ac:etyl-7-hydroxy-4- methylcoumarin, anthranilonitrile, ethoxycarbonyl-7-AMC, N-acetyl-7- aminocoumarin required dissolution in 100-500ul dimethyl sulphoxide. 50 ul of each organism suspension was added to 50 ul of each substrate and incubated at 30° C for exactly 18 hours. Immediately before and after incubation, all tests were read for fluorescence using a fluorescence microtitre plate reader at 365nm excitation and 440 nm emission wavelengths. All tests were performed in duplicate and the results averaged. Organism-free and substrate-free controls were included. 2.1.4 Nutritional tests. Utilisation of sole carbon sources. Organisms were examined for the ability to utilise carbon compounds as the sole source of carbon for energy and growth using the basal medium of Stevenson (1967). This medium is carbon free and contains vitamin free Bacto Yeast Nitrogen Base (Difco, 0.54%, w/v) a trace of vitamin free casamino acids (Difco 0.0008 %, w/v) and Lab M agar (1.5% w/v). The thermolabile yeast nitrogen base was sterilised bySeitz filtration.The medium was neutralised ( pH 7.0 ) with sterile dipotassium hydrogen phosphate( 1%, w/v) prior to dispensing.The 33 carbon compounds were sterilised as 20 and w/v or v/v solutions by tyndallising for 30 minutes on 3 consecutive days at 100° C. The sterilised carbon compounds were added aseptically to the basal medium to give a final concentration of 1 % w/v or v/v. The media were dispensed into replidishes, inoculated, and then incubated. The test read weekly up to 28 days. In all cases reading was made by comparing the growth of strains on test media with two controls. The negative control was a replidish containing the basal medium with no added cafbon source and the positive control a replidish containing the basal medium supplemented with D- glucose (1%, w/v). Comparison of the controls with the corresponding lest Petridishes made it possible to detect false positive results and non viable or poorly growing cultures. Positive results were recorded when the growth of the test strains in the Petridishes was greater than in the negative control. A negative result was recorded when the growth in the test replidish was equal to or than in the negative controls. Doubtful results were provincially scored +/- and then repeated. ^ 50 Utilisation of nitrogen compounds as simultaneous nitrogen and carbon sources. The test strains were examined for their ability to use nitrogen compound as sole sources of carbon and nitrogen for energy and growth. The basal medium of Tsukamura (1967c) was supplemented with the nitrogen compounds (added to give a final concentration of 0.02M,) and the medium adjusted to pH 7.0 with 10% potassium hydroxide except in the case of mono ethanol which was adjusted to pH 7.0 with 10 % hydrochloric acid. All but one of the media was sterilised at 100°C for 30 minutes daily for 2 consecutive days. The test were read weekly up to 28 days .As with the sole carbon sources test readings were made by comparing the growth of strains on test media with two controls. The negative control was a replidish containing the basal medium with no added carbon and nitrogen source, and the positive controls with the corresponding test replidishs allowed the detection of false positive results and non viable or poorly growing cultures. Positive results were recorded when the growth of the test strains in the replidishes was greater than in the negative control. A negative result was scored when growth in the test Replidish was equal to or less than in the negative control. Doubtful results were provisionally scored +/- and repeated. 2.1.5 Physiological tests. (Cowan & Steel, 1974): Temperature range. The test strains were examined for their ability to grow on O GYEA media at 5°C, 15°C,25 C;37°C, 42°C, and 52°C. Inoculated replidishes were incubated at 5°C andl5°C for 6 weeks at 25 °C, and 37°C for 4 v/eeks, at 42°C for 2 weeks and at 45°C and 52°C for one week. Visible growth was scored as positive result. pH. The ability of the test strains to grow at range of pH regimes was tested in appropriately buffered GYEA. Details of the buffering system used are given in the appendix The results were read after 7 and 14 days. Visible growth was scored as positive result. Growth on MacConkey agar (Cowan and Steel. 1974). t Clinical strains were tested for their growth on MacConkey agar. The results were read weekly up to 28 days. Growth was scored as a positive result. Chemical inhibitors. The test strains were examined for their ability to grow in GYEA supplemented with bismuth citrate, manganese and zinc (Hopkin and Williams Ltd.UK). Candium, cobalt, copper crystal violet, lead, phenol, phenyi ethanol, potassium, tellurite, pyronineG, sodium azide, sodium chloride, sodium deoxychalate, 51 sodium nitrate, tetrazolium and thallous acetate (B.D.H. Chemical Ltd.) at the concentrations shown in Appendix. Replidishes were read weekly up to 28 days. Growth was scored as a positive result. Resistance to antibiotics. The organisms were examined for their resistance to 13 different antibiotics representing a range of structural types and modes of action. The clinical isolates of Mycobacterium farcinogense and Mycobacterium senkgalense were inoculated onto GYEA containing cephaloridine hydrochloride (64ul/gm; Sigma), chlorotetracycline hydrochloride (2, 64ul/gm Sigma), dapsone (2, 64ng/ml Sigma), gentamicin (2, 64ug/ml Sigma), isoniazid (2, 64|ig/ml Sigma), lincomycin hydrochloride (2, 64ug/ml Upjohn Chem. UK.), methacycline hydrochloride (2, 64|Ag/ml Sigma), neomycin sulphate (2,64ug/ml Sigma), oleandomycin phosphate (2, 64ug/ml Sigma), rifampicin (2,64|Ag/ml Sigma), streptomycin sulphate (2,64(ig/ml Sigma), iobramycin sulphate (2, 64jig/ml, Sigma), vancomycin hydrochloride (2,64ug/ml Sigma). The antibiotics were prepared as Seitz filter sterilised aqueous solutions except for rifampicin and dapsone which were dissolved in dimethyl sulphoxide (DMSO) and a solution containing equal volumes of ethanol and water respectively. The sterilised antibiotics were added to molten, cooled GYEA to give the appropriate concentrations. The media were dispensed into Replidishes and inoculated immediately after setting. Fourteen days old GYEA broth cultures were used as a source of inoculum. Incubated repli-dishes were examined after 1, 3, 7, and 14 days as were the positive control dishes containing GYEA. A positive result, i.e., resistance, was recorded when growth was similar to or greater than on the positive control. The first readable result was scored for computation. 2.2. Molecular Characterization methods. All solutions used in the molecular systematic studies were prepared from dilutions of the main reagents. Unless otherwise specified Molecular biology grade reagents and enzymes including antibiotics, enzyme-inducers and substrates, lytic, modifying and restriction enzymes were obtained from commercial suppliers (Boehringer Mannheim Biochem. UK). Stock solutions were prepared according to Sambrook e////. (1989). All buffers and solutions were prepared using autoclaved distilled and deionised Milli-Q reagent gradewater (Millipore Watford, UK) and stored in autoclaved glass 52 Fig.2.1. Protocol for PCR amplification and sequencing of 16S rDNA Genomic DNA (50-100 ng) i 27fand 1525r primers Vortex and collect -PCR mix (100 ul) (0.4 urn each) Reaction mixture dNTPs: 200 mM each By centrifugation Taq buffer IX i Denaturation -94°C, 2 minutes I -Ice, 5 minutes Addition of Taq - 2 U Taq polymerase (0.5 u 1) DNA polymerase - 2 dropSginineral oil - vortexing and short pulse I centrifugation (5 seconds) PCR - Denaturing: 94 C, 2 minutes (30 cycles) - annealing: 55°C, 1 minute - extension: 72°C, 2 minutes y r - final extension: 72°C, 10 minutes EcoR I/Hind III Check the size of amplified - electrophoresis: agarose 1% Or BstE II fragments (w/v) ethidium bromide (0.5 DNA MW markers (5 nl of PCR product) ug ml"') 100 V, 1 hour, 1 x TEB i - photography (optional) If product i.~4kb Gel purification of 16SrRNA - preparative electrophoresis fragment - centrifugation thorough Millipore filter units 16S rDNA reverse Automated sequencing - Taq dye-deoxy cycle and forward primers sequei icin g (Applied Biosystems) bottles. Disposable plasticware and glassware were either autoclaved or oven-baked to eliminate possible contamination with nucleases (Sambrook et al, 1989). DNA extraction and purification. Protocol. Preparation of genomic DNA( Kirby, 1957, 1965). The guanidine thiocynate DNA extraction procedure of Pitcher e/a/(1989) was used with the specific modifications to optimise the isolation of the DNA of the test strains. Treatment of cells with proteinase K (100 ug/ml) and sodium dedocyl sulphate (SDS, final concentration 1% w/v) was found to greatly facilitate the susceptibility of cells to the standard digestion and extraction procedure of Pitcher et al. (1989). Solutions: Guanidine thiocynate solution. (5 M guanidine thiocynate; lOOmM EDTA; 0.5% v/v sarkosyl): Guanidine 60g, Milli-Q water 20ml (autoclaved), 0.5 M EDTA, (pH 8.0), 20ml. The guanidine thiocynate was dissolved with constant stirring at 60°C and the resultant solution cooled to room temperature before adding 5ml N-lauryl sarcosine 10% (v/v autoclaved). The final volume was made up to 100ml with Milli-Qwater and the solution filtered through a 0.45 urn membrane. The guanidine thiocynate solution was stored at room temperature in a dark bottle. 7.5M Ammonium acetate: 57.81g-ammonium acetate, Milli-Qwaterl 00ml. Final volume completed to 100ml. Autoclave at 121°C for 15 minutes and stored at 40°C. Chloroform-iso-amyl. Chloroform 24ml : iso-amyl alcohol 1 ml, stored at 4°C in sealed bottle. Phenol-Chloroform-iso-amyalcohol. This reagent was purchased as a pre-mixed formulation (Sigma) of molecular biology grade. Phenol-chloroform-iso-amyl alcohol (25:24: L v/v) saturated with lOmM Tris (pH 8.0) and lmM EDTA (pH 8.0). The reagent was stored at 4°C in sealed dark bottle. T.E buffer (pH 8.0). 0.5 M EDTA, (pH 8.0) 2ml. 1M Tris, (pH 8.0) 10ml. Milli-Q water to) litre. RNase A stock solution : Dissolve pancreatic RNase (RNase A Sigma) at the concentration of lOmg/ml in lOmM Tris-HCl, 15 mM NaCl or sterile distilled water. Meat to 100°C for 15 minutes then cool to room temperature. Store d at -20°C. Proteinar.e K stock solution : Dissolve powder of proteinase type I (Sigma) at a concentration of lOmg/ml in lOmM Tris-HCl, lOmM NaCl and self digest by incubating for 2 hours at 37°C. Stored at -20°C. 54 If necessary, the pH of the solution was adjusted to 8.0 before making up to 1 litre. The buffer was sterilised by autoclaving at 121 °C for 15 minutes and stored at room temperature*. » Procedure. Approximately 100 mg wet weight biomass of test strain growth from the basal medium was transferred to Eppendorfmicrofuge tubes was resuspended in 100 ul of TE buffer (pH 8.0) containing 50 mg ml-1 dissolved lysozyme (Sigma) and incubated at 37°C overnight. Proteinase K (2-mg ml-1) and SDS (final concentration 2%, w/v) were added to a preparation, which was left at 37°C for 4 hours. Lysis was accomplished by adding 500 ul of guanidine thionynate solution to the preparation followed by briefmixing and incubation at room temperature for 5 to 10 minutes. The lysate was cooled oniceand250ulof 7.5M-ammonium acetate was added and mixed gently inverting the tubes several times. The lysate was incubated on ice for a further 10 minutes prior to the addition of 500 ul of chloroibrm-iso-amyl alcohol (24:1, v/v). The phases were emulsified by shaking by hand (do not vortex) and separated by centrifugation at 13,000 rpm for 10 minutes. The aqueous supernatant phase was transferred to a clean microfuge tube using a disposable plastic pipette tips and the DNA precipitated by the addition of 0.54 volumes of cold iso-propanol. The tubes were inverted several times to mix the solutions or until a visible white fibrous precipitate was seen. DNA was pelleted by centrifugation at 6,000 rpm for 20 seconds. The DNA pellet was washed 3 times with 70% ethanol (v/v) and dried under vacuum. Short centrifugation pulses (30 to 60seconds) were applied in case the pellet detached from the bottom of the tube during the washes. it DNA peliets were re dissolved in 200 ul of TE buffer (pH 8.0); RNA was removed by the addition of 10 ul RNAase A (10 mg ml-1 stock; Sigma) and the preparation incubated for more than 1 hour at 37°C. Proteins were removed from the preparation by the addition of 1 volume of phenol- choloroform-iso-amyl alcohol after the addition of 20 ul of 8 M lithium chloride and mixing of the phases by hand (do not vortex). 55 The two phases were separated by centrifugation as described earlier and DNA precipitated by addition of 2 volumes of cold ethanol, mixing by inversion and centrifugation, as described. Pellets were washed once with chloroform-iso-amyl- alcohol (24:l,v/v) and 3 times with 70% ethanol (v/v) prior to dry under vacuum. DNA was resuspended in ,50 to 100 ul(l of Milli-Q water and stored at 4°C until needed. DNA Purification. Purificaion of DNA was carried out using NucleoSpin Extract 2 in 1 Method which is a Working procedure for DNA extracted from agarose gels designed for the purification of DNA from TAE/TBE agarose gels. Reagents for elution of DNA : Elution buffer NE (5mM Tris.IICl, pH, 8.5), TE- buffer, ptf, 8.5, sterile distilled water, pH 8.5. The pH should be checked before use, lower pi 1 of the buffer leads to lower recoveries. Yield of larger fragments (>5-10kb) can be increased by using prewarmed elution buffer (70°C). Prewarmed elution buffer was added and then incubated for lhour. Recovery rates 75-90% was obtained for DNA fragments about 100-10000 base pairs. Large fragments can also be processed by using a prewamed elution buffer as above. Procedure. Take a clean scalpel to excise the DNA fragment. Excise the fragment gently in order to minimise excessive volume of gel. Determine the weight of the gel slice and transfer to a clean centrifuge tube. To each JOOg agarose gel add 300ml buffer NT1. For higher concentrated agarose gels (2%) add the double volume of buffer NT1. Incubate the sample for 10 minutes at 55°C. Vortex the sample every 2-3 minutes briefly. Samples were loaded on a NucleoSpin tube and placed it into a 2-ml centrifuge tube and then centrifuged for 60 seconds at 10000 rpm. The flo\ 56 Purity and quantitation of DNA samples. The purity and quantitation of the DNA samples was determined by taking spectrophotometric readings of diluted samples at 230, 260 and 280 v«n. The measurement at 260 wm gave an estimate of the DNA content, the corresponding reading at 280 nm gave an indication of protein contamination, and the reading at 230 nm measured any contamination with small molecules, e.g., EDTA, guanidine or polysaccharide. Procedure A 100 dilution of DNA in 0.1 x SSc Sodium citrate buffer was made by adding 5 ul of each DNA sample to 495 \A of 0.1 x SSC in an eppendorf tube. The DNA concentration was estimated as follows: Reading x Dilution x Index = DNA ug/ml. [(a reading of 1 at 260 nm is equivalent to 50ug ml*1 of double stranded DNA) (index); Sambrook et al (1989)]. * . The ratio between the readings at 260 nm and 280 nm (OD260/OD280), provides an estimate of the purity of the nucleic acid. Pure preparation of DNA has OD260 /OD280 value of 1.8 (Sambrook et al, 1989) Electropkoresis and visualization of the DNA bands. Materials.. Horizontal electrophoresis apparatus is a submarine or submerged system in which the whole gel is submerged in buffer during electrophoresis (GNA100 Sweden). This includes a casting plate, combs, tank and comply indicator tape. v Power supply : The experiments described in this study were run at 100V with about 60mA. Electrophoresis buffer: Convenient preparation of concentrated (lOx) stock solutions buffer (TBE) containing 108gTris base, 55g Boric acid, and 7.44g EDTA in a final volume of 1000 ml sterile distilled water, pH 8.0. Dilute stock solution 1.20 with sterile distilled water to make a working solution of 0.5X TBE. About 500ml of working solution is needed per run. Agarose must have a low coefficient where lg agarose was used to make 100ml (1%). Loading buffer (concentration 6x) and the DNA loading solution contained 60% (v/v) glycerol. 0.2% xylene cynol FF. 0.2% Bromophenol blue in TE, buffer 1 OmMTris- 57 hydrochloride, lmM and 60mM EDTA in sterile distilled water, or TBE buffer, pH 8.0. Stored at 4°C for a very long time. Ethidium bromide stock solution : Add O.lg-ethidium bromide to 10ml sterile distilled water to make concentrated solution (lOOOOx). Mixed well and stored in the dark at 4°C up to several weeks (always wear gloves when handling ethidium bromide • powder or solution ethidium bromide is strongly carcinogenic). DNA molecular weight size marker to interpolate the size of DNA fragment. In this study, "GeneRuler DNA Ladder Plus"was used among the samples loaded on to the gel, to have one or several lanes of DNA fragments of known sizes,, UV transilluminator with an emission peak of 312nm (Mask and goggles should be available to protect face and eyes of operator). Instant camera (Polaroid MP4) was fitted with an orange filter (type 667) used to produce both negative and prints. Procedure. Amplification was carried out by an appropriate amount of I g agarose for each 100ml of electrophoresis buffer and dissolved by boiling in a microwave oven (a bottle with a loose cap and not filled more than half full). When completely dissolved, agarose was allowed to cool to about 60° C and 5ul of ethidium bromide stock solution per 100ml of agarose added. Mixed by swirling (wear protective latex gloves when handling ethidium bromide or gels containing it. then allowed to set at room temperature (for about 30 minutes) Casting plate was washed then sealed with the Comply Indicator tape. Allow any bubbles to disperse, and poured in the melted agarose then insert the comb. The gel thickness should be about 4mm. Carefully remove the comb and the tape (and autoclaveed). Placed the casting tray carrying the gel in the electrophoresis tank, the side with the wells being near the cathode (indicated by a '-'sign and black electric cable and plug, as opposed to the anode indicated by a '+' sign and red electric cable and plug). Pour the electrophoresis buffer (working solution) into the tank to cover the gel to a depth of about 5nsm. To each genomic DNA sample (4iil) add 2ul loading buffer (6x). Carefully DNA samples were loaded into the wells through the electrophoresis buffer using a micropipste. Few wells for DNA size marker and control were reserved. 58 The lid of the electrophoresis apparatus was closed and then connected to the power supply which was run atlOOV and 60mA until the blue tracking dye has migrated about 30-45 min. » The power supply was turned off, disconnected and then the gel was transferred to UV transilluminator (Model UVGL 58 CA.91778 USA). The gel was photographed. In this study Fluor-S Multilmager was used for viewing the gel and the bands were printed and saved in the computer.Genomic DNA bands were determined and compared using BioRad Multi-Analyst™/PC Version 1.1 DNA amplification The amplification of DNA begins with the isolation of small quantities of pure DNA, while a few nanograms of DNA is sufficient, it is often more practical to begin with 10- 50 ug, since this will permit accurate measurement of DNA concentration by spectrophotometry. Procedure. The procedure is based on the DNA Thermal Cycler 480 (Perkin iilmer Corporation USA) and The Rapid Cycler (Idaho Technology Inc). The concentrations of reagents in the amplifying solution for standard PCR have the optimum concentrations to give a total volume of 50uI. Materials: . PCR 10X buffer (N1I4) 5ul; 12.5dNTPs lul; Primer Col (2.5ul) and primer Co2 (2.5ul). 3u mM MgC12, 1.5ul; 5u mM Taq DNA polymerase, 0.25ul. Sterile distilled water 37.25ul.PCR master mix is 49.5ul and genomic DNA sample is 0.5ul. 49.5ul of master mix was dispensed into each PCR tube and 0.5ul of DNA sample was added, spined down briefly for 5seconds and one drop of mineral oil added. Samples were placed including positive and negative controls into Ihe Thermal Cycler. ii PCR running was optimised as follows for 30 cycles. Denaturation 94°C, 5 sec; 55°C, lsec; 72°C, lsec. Anneaiing 94°C, 1 sec; 55°C, 1 sec; 72°C, 1 sec. Extension 94°C, 1 sec; 55°C, 1 sec; 72°C, 5 sec. 59 Visualization of PCR amplified product was achieved by running the product on I%agarosegel. PCR amplified product can be used for DNA sequencing, and restriction fragment length polymorphisms (PCR-RFLP). 60 fTable 2-3. Oligonucleotide primers used in the PCR amplification and sequencing of |6S rDNA. ?Primer Sequence (5' to Size Binding site** Usage0 Source name 5' 3' PCR Seq •27f AGAGTTTGATCMTGGCTCAG 220 8 27 Lane(1991) MG2f GAACGGGTGAGTAACACGT 19 107 125 Chun (1995) Mttlf CTACGGGRSGCAGCAC 16 342 357 Chun (1995) MG4f AATTCCTGGTGTAGCGGT 18 675 692 Chun (1995) 782r ACCAGGGTATCTAATCCTGT 220 801 782 Chun (1995) MG5f AAACTCAAAGGAATTGACGG 20 907 926 Chun (1995) MG6f GACGTCAAGTCATCATGCC 19 1190 1208 Chun (1995) '1525r AAGGAGGTGWTCCARCC 17 1544 1525 Lane(1991) M13 f GTTTTCCCAGTCACGAC 17 _d - V Promega(l993) MI3r CAGGAAACAGCTATGAC 17 _e Protnega(1993) "Degeneracies according to Lane (1991): K= G.T; M- A:C; Y = C:T; R= A:O; S.=C:O; W,=A:T. "Binding site on (In: I6.S rRNA molecule: numbering according to the Escherichia coli numbering system (Brosiiis et til.. 1978). CPCR, printer-; (isoi in ilic PCR aniplincation of I6S rDNA: Seq, primers used in (he dye-dcoxy cycle sequencing of ctoned I65> rDNA Binding at positions 2944 to 2960 (5' lo 3) of the pGEM-T plasmid vector (Proincga Corporation. 1993). approximately 23 base pairs upstream frotn die cloning site. 'Binding at positions 177 lo 161 (V to 3) of the pORM-T plasmid vector (Proinega Corporation. 1993). approximately 80base pairs dmvmtro.im from iiie cloning site. 61 Purification of PCR amplified products. Purification of amplified PCR product was carried out using NucleoSpin Extract 2 in 1 Method. The volume of reaction mix was adjusted with 100 ul ofTE buffer (pH 8.0). 400 ul buffer NT2 was added to the sample and mixed. Sample was loaded on a NucleoSpin tube and placed into a 2-ml centrifuge tube and then centrifuged for 60 seconds at 10000 rpm. The flow through was discarded and placed the NucleoSpin tube again into the centrifuge tube and put 700 ul buffer NT3. Centrifuged for 60 seconds at maximum speed. The washing step wasrepeated with bufferNT3.Discard the ilowthrough, place the NucleoSpin tube again into the centrifuge tube and then centrifuged for 60 seconds at maximum speed in order to remove buffer NT3 quantitatively. Residual ethanol inhibits subsequent reactions. Place the NucleoSpin tube in a clean 1.5ml centrifuge tube, add 50-ul elution buffer NE and centrifuge for 60 seconds at maximum speed. PCR amplification of 16S rDNA. PCR amplification of 16S rDNA was carried out in a HybAid Omnigene automated thermocycler (HybAid, Teddington, UK) using 0.8 ml PCR microfuge tubes. Taq DNA polymerase and reaction buffer were from Hoeffer (Bio Taq; Hoeffer Scientific Instruments. Newcastle-Upon Tyne, UK) Deoxynucleotides (dATP, dCTP, dGTP and dTTP, lithium salts; Boehringer Mannheim Biocemica, 1995) were mixed in a master * stock in equimolar ratios; the final concentration of individual deoxynuclotides was 25 mM. The following procedure was used for PCR amplification of 16SrDNA fragments. Stock solutions of primers, dNTPs and 10 x Taq buffer were defrosted and kept on ice. Taq DNA polymerase was kept at -20°C until required. The necessary volume of reaction mix was prepared in a 0.8-ml PCR tube (or 1.5-ml eppendorf tube), kept on ice and dispensed into individual PCR tubes. Usually 100 ul PCR reactions were preformed but the protocol also works for 50 ul reactions * The reagents for the PCR reaction were mixed in the following order/ one reaction). 27f Primer (20 uM) 2ul. 1525r Primer (20 uM) 2 ul. DNTP mix (25 mM each dNTP) 0.8 ul. 64 10 X Taq polymerase buffer (Bioline) 10 ul. Milli-Q water to 95 ul. The reagents were mixed by vortexing and collected at the bottom of the tube by short pulse centrifugation (5 seconds). The tubes were kept in ice and 95 ul of the PCR mix dispensed into each of the PCR reaction tubes. Procedure Approximately 50 to 500 ng of genomic DNA was added to each 100 ul reaction mix in a 5 ul volume dissolved in either Milli-Q water or TBE buffer. The tubes were heated at 98c for 3 minutes on the PCR block and immediately cooled in ice for 5minutes. The Taq DNA polymerase was removed from storage at —20°C and put on ice prior to being dispensed; 25 U of enzyme (0.4 ul) and one drop of mineral oil (Sigma) v/as added to each reaction tube kept on ice. „ The contents'of the tubes were thoroughly mixed by vortexing and collected at the bottom of the tube by short pulse centrifugation (5 seconds). Tubes were kept on ice until ready for PCR amplification. The PCR reaction was performed according to the following conditions: Denaturation: 94°C, 5 sec; 55°C, 1 sec; 72°C, 1 sec. Annealing : 94°C, 1 sec; 55°C, 1 sec; 72°C, 1 sec. Extention: 94°C , 1 sec; 55°C, 1 sec; 72°C,, 5 sec. The PCR reactions were kept at —20 C and the amplification product checked by electrophoresis on agarose gels (1%, w/v) on 1 x Tris-borate buffer (TBE; 89 mM Tris- borate and 2.5 mM EDTA, pH 8.0 containing 0.5 ug ml-1 ethidium bromide. Approximately 4ul were used. Gels were run at 100 V for 1 hour and the size of the amplified fragments estimated by comparison with GeneRuler molecular size marker (Sigma). Purification of PCR-amplified 16$ rDNA PCR amplified 16S rDNA was purified by preparative agarose gel electrophoresis (Sambrook c.t al., 1989) followed by elution of the DNA fragments by centrifugation through Ultrafree-MC microfiltration units (Millipore Ltd., Wartford, UK). Procedure. 65 . The complete volume of the PdR reaction (ca. 100 ul) was mixed with 10 ul of gel loading buffer (Sigma) and loaded into the preparative agarose mini-gel (1%, w/v) containing ethidium bromide (0.5 ug ml-1). The mini-gel was run in 1 x TBE buffer for 1 hour at 100 v. DNA molecular size markers GeneRuler (Sigma) were used as standards for the determination of DNA fragments sizes. After electrophoresis, the gel was visualized using UV transilluminator. The rDNA fragment was located by its molecular weight size (approx 1.5 kb) and a gel slice containing the rDNA was cut using a clean glass coverslip Exposure to UV light was kept to a minimum avoid photo-nicking of the DNA fragments. The agarose slice containing the rDNA fragment was transferred to a Millipore microfiltration unit. The gel slice (held inside the tubes) were frozen at -70° C for 30 minutes and allowed to defrost at room temperature. Then the tubes were centrifuged at 6,000 rpm for 20 minutes at room temperature. The presence of DNA in the extracted solution collected in the lower tube was verified by an orange glowing the solution from the flourescence of the ethidium bromide-DNA complex under UV light. The DNA fragments were extracted once with one volume of phenol-chloroform-iso- amyl alcohol (25:24:l.v/v) and once with 1 volume of chloroform-iso-amyl alcohol (24:1, v/v). as described previously (plasmid mini preps). A 0.1 volume of 8 M LiCi2 was added and mixed well prior to the addition of 2 volumes of cold ethanol. The solutions were mixed thoroughly by inversion of the tubes and kept at -20°C for 2 hours or at -70°C for 30 minutes. DNA was pelleted by centrifugation at 13,000 rpm for 10 minutes. The pellet was rinsed once with cold 70% ethanol (v/v) and dried under vacuum. The rDNA pellet was redissolved in 20 ul of Milli-Q water and stored at 4°c until needed. DNA samples (1 ul) were checked by agarose gel electrophoresis to estimate the DNA concentration by comparison with the DNA standard so unknown concentration (Sambrooku-/ al., 1989) Restriction fragment length polymorphism (RFLP). PCR-based IIFLP technique involves amplifying a known sequence (16SrDNA), cutting it with endonuclease restriction enzymes and comparing the restriction fragments of the amplified DNA of the test strains. The 16SrDNA genes of the test strains were amplified by PCR and purified as below. Procedure. 66 The endonuclase digestion of isolates DNA was carried out by the analysis of the restriction polymorphisms of the ribosomal genes which was performed as outlined in Figure 3:3. Purified genomic DNA (4ug) was digested with BamHi restriction endonuclease (G GATCC) using 10 units of enzyme per ug of DNA in a volume reaction as recommended by the manufacturer (Boering Man. Biochem. 1996). DNA fragments were separated in 0.8% agarose gels. Electrophoresis was carried out at 50V for 4 hours at room temperature in lxTEB buffer (Tris-borate-EDTA; Sambrook et ah, 1989). 67 Fig.2.3 Protocol for ribotyping experiments using digoxigenin labelled rDNA probes Genomic DNA 2 to fig of purified DNA Bam H I or Apa I £10 fig-1 Endonuclease digestion DNA), -overnight digestion in 25ul reaction volume Agarose gel electrophoresis -agarose 1% (w/v, 1 x TEB, 50 V, 4 hours -ethidium bromide staiing I UV photogrpahy (optional) 5 + 16 + 23S rDNA (p64 Southern blotting -Denaturation: 0.S M NaOH, I.S plasmid) M NaCI 2x 15 minutes with gentle shaking Random-primer labelling )DIG -Neutralisation: 0.5 Mtris pH Labelling Kit, Boehringer 8.0, 1.5 M Nad, 0.001 M EDTA Mannheim) 2 x 15 minutes with gentle shaking -Capillary transfer:Hybond-N+ membrane, 20 x SSC - Fixation: 80°C, 1 hour . rDNA-DIG probe hybridization8 -Pre-hbridization: hybridization buffer. 63°C, 1 hour Denaturing of probe (100°Crn 10 minutes and Hybridiza(ion:hybridizatio ice, 10 minutes) *" n buffer, probe (26 ng ml" '), 63°C, overnight Solution stored at -20°C, Removal of hybridization reusable solution Washing* -2 x SSC (t). 1 % w/v) room temperature (twice, 15 minutes each): -0.1 x SSC, SDS (0.1% w/v) 63°C (twice, 15 minutes each): DIG detection8 - Blocking - Binding of anti-DIG- AP Fab antibody - Washing - Developing: NBT and BCIP - Stop: TEpH 8.0 buffer Photography 'Hybridization and detection were performed according to the recommendations of the DIG system manufacturer (Boehringer Mannheim Biochemica, 1995). The hybridization buffer consisted of 5 x SSC, N-laurylsarcosine (0.1%, vv/v), SDS (0.02%, w/v) and blocking reagent (1%, w/v, Boeliringer Mannheim Biochemica, 1995). AP, alkaline phosphatase; BCIP, 5-bromo-4-chloro-3-indolyl phosphate; NBT, nitro bluelelra/olium. 68 DNA sequencing of 16S rDNA. Two methods for DNA sequencing were carried out using Automatic Dye-Deoxy™ terminator Taq cycle sequencing of 16S rDNA. Sequencing of 16S rDNA fragments was performed using the Dye-Deoxy™ terminator Taq cycle sequencing protocol (Applied Biosystems, 1994) and oligonucleotide primers were specifically designed for hybridizing to conserved sites in the 16S rRNA molecule (Lane, 1991). Several forward and reversed sequencing primers were used (Table2.3). Sequencing reactions were prepared and run as recommended by the TaqDyeDeoxy™ Terminator Cycle Sequencing Kit protocols (Applied Biosystems, 1994). A reaction premix containing the components ofthe sequencing reaction, except the DNA sample and the primers, was made as follows: 5 x TACS buffer 4 ul DNTPmix 1 ul DyeDeoxy A terminator 1 ul DyeDeoxy T terminator 1 ul DyeDeoxy G terminator 1 ul DyeDeoxy C terminator 1 ul Ampli Taq DNA polymerase 0.5 ul. Reagents were mixed thoroughly by gentle vortexing and collected at the bottom of the tube by short pulse centrifugation (5 seconds). The mixture was dispensed into PCR eppendorf tube (9.5 ul per tube). The premix was stored at 4°C until required. Approximately 1 lo 2 ug of purified 16S rDNA (dissolved in Milli-Q water) and 3.2 pmol of primer (2 ul of the sequencing primer stock) were added to 9.5 ul of sequencing premix ina PCR tube kept on ice. The final volume was brought up to 20 ul with Milli-Qwater and the reaction mixture overlaid with a drop of mineral oil. The contents were mixed thoroughly by gentle vortexing and collected at the bottom ofthe tube by short pulse centrifugation (5 minutes). The thermal cycling was performed in a HybAid Omnigene automated therrnocycler (HybAid. Teddington UK). The PCR program was initiated immediately after placing the last PCR eppendorf tube in the thermal cycler preheated to 96°C. The cycling 69 consisted of 96°C for 30 seconds, 50°C for 15 seconds, 60°C for 4 minutes, in a total of 25 cycles. The extension products were purified using Centri-Step spin columns to remove the excess DyeDeoxy terminators according to the recommended protocols (Applied Systems, 1994). Clean samples were dried under vacuum and resuspended in 4 ul of sequencing loading buffer (5 ul deionised formamide and 1 ul 50 mM EDTA, pH 8.0) by vigorous vortexing. The suspensions were collected at the bottom of the tubes by short pulse centrifugation (5 seconds) and denatured by heating at 90°C for 2 minutes (i followed ,by incubation in ice for a few minutes. Samples were loaded onto an Applied Biosystems 373A DNA sequencer and electrophoresed according to the manufacturers instructions (Applied Bio. Inc., Warrington, UK) using a 6% (w/v) polyacrylamide-urea gel. 70 2.4. IMMUNOLOGICAL ANALYSES ELISA Test (Enzyme linked immunosorbant assay). Diagnosis, of Mycobacterium farcinogenes using ELISA test with sera samples collected from clinical cases of bovine farcy. Materials: Sera samples were obtained from clinical cases. Omdurman, El Obeid, and Dillinj slaughtering-houses. Blood was collected in sterile glass containers without anticoagulant and allowed to clot at room temperature for one hour. Once the clot has formed, u was loosened from the walls of the containers to aid retraction and then left overnight. Sera samples were centrifuged at 150g for 5min. to sediment erythrocytes and then at 350g for 15 minutes. The straw-coloured solution sera were transferred to sterile eppendorf tubes for long-term storage and heated at 56°C for 15min. to destroy the heat -labile components of the complement. During antemortem and postmortem inspections, lymph nodes were examined and collected. The swollen and pus containing lymph nodes were carefully removed and kept in clean sterile containers at lower temperature or kept in thermoflask. All samples (sera and lymph nodes) were kept at low temperature. Reference strains of Mycobacterium farcinogenes and Mycobacterium senegalense and related taxa were obtained from Department of Agriculture and Environmental Sciences Molecular Microbiology Laboratory- University of Newcastle upon Tyne, UK. Antigen production : Antigen was made from 1-3 week's growth culture of Mycobacterium farcinogenes and Mycobacterium senegalense. Bacterial cultures were suspended into 7 ml of sterile phosphate buffer saline (PBS) and bacteria were harvested by centrifugation at 300 rpm for 20 minutes, Washed three times with sterile phosphate buffer saline and finally suspended in 10 ml sterile PBS. The suspension was sonicated at 6,000,000-beat/ minute for 30 seconds, intervals for 10 min. The supernatant was clarified in a centrifuge at 3000 rpm for 15 minutes and the supernatant was obtained as the antigen. Procedure: ELISA (Enzyme linked immosorbant assay) analysis was carried out using the methods of Nakamura et al. (1988). Each antigen solution was added to each well (100 id per well) of polystyrene microtitre pates (NUNC2 - 69620. Roskilde, Denmark) which were then covered with a plastic cover and left over night (this and 71 subsequent procedures were carried out at room temperature). All of the plates were washed three times (at an interval of 3 minutes) with sterile PBS containing 0.05% (v/v) Tween -20. Concentration of sera samples (100 ul) at 1/100,1/200,1/400,1/800, 1/600,1/3200, 1/6400 and 1/1280 dilutions were added to each well and the preparation mcubated for 4-5 hours in a humid chamber at room temperature. Plates were then washed three times with PBS -Tween solution, 100 ul anti-rabbit IgG alkaline phosphate conjugate (diluted 1/1000 in PBS; Sigma No. A-8025) was added to each well and the resultant preparations incubated as above for 1 hour. Plates were then washed with PBS as before. Disodium p-nitrophenyl phosphate (Sigma) was dissolved in diethanalamine buffer (pH 9.8 at concentrations / mg/nil) and 100 ul were added to each well. Plates were read at absorbance filter 405 nm after 20 and 60 minutes in a Computer - assisted device (Multiskan Plus Version 2.01). Animal pathogeniciry experiment. Materials: Inocula were prepared from strains of Mycobacterium farcinogenes and Mycohaclvriiini .senagale.se grown on GYIiA medium (Gordon & Milmi, 1962) al 37°C until good growth was obtained between 1-3 weeks. Each culture was suspended into sterile PBS and examined for purity. Laboratory animals. Immune sera were obtained from 8- weeks old male guinea pigs (National Research Centre Khartoum / Sudan), those animals were used for production of immune sera. Blood for serum samples was collected before inoculating the 8 week-old healthy male guinea pigs. Animals were shaved using razor blades and the area of flank region sterilized. Subcutaneous inoculation of the test strains (0.01ml) of culture suspension was carried out carefully and the animals kepi in clean cages. Control animals were inoculated using sterile PBS. Physical examination including inspection of the sites of inoculation were recorded. Direct cultures and smears were prepared from purulent materials obtained from lesions developed and those at inoculation sites. After day 7 of inoculation, blood was collected for serum samples. Collected blood was kept at room temperature for 15 minutes and then kept overnight at 4°C where serum was collected into sterile eppertdorf tubes using pipetman (Gibson R68663N, France) labeled and kept at -20°C until required. 72 Inoculation of immune serum to new guinea pigs: This was carried out by adding suspensions of live culture of the test strains into the collected immune serum, incubated for 1 hour at 37°C then 0.1 ml of the mix was used for inoculating subcutaneously new 8-week old healthy guinea pigs (2 each) and then left under observation for 10 days. These animals were boosted by suspnsion of the same strains at day 10 challenge new guinea pigs and then kept under observation for seven days and the same sera sampled as above are labeled and kept at -20° until required. The animals were exquaniated and examined. Gross pathological lesions recorded and granulomas sampled. Morphological, cultural and biochemical characteristics of the test strains were determined . Blood samples were left overnight at 4°C and serum samples collected into sterile eppendorf tubes using pippetman labeled and preserved at - 20°C. Protein antigen analysis. (Lind etal., 1980) Antigen preparation from the bacterial isolates was carried out by centrifugation at 3000 rpm for 20 min, washed three times with sterile PBS and suspended in 10 ml sterile PBL. The suspension was solicited (6,000,000 beat / min at 30 sec) at intervals for 10 minutes. The supernatant was clarified in a refrigerated centrifuge at 3000 rpm. Procedure (Lind et ah, 1980). 2% agarose in 0.06 M Tris-barbital buffer (pH 8.8) containing 1% sodium azide (Sigma) was prepared and poured into small flat bottomed petridish to given perfectly even surface. Wells were cut in the solidified agar with a cork-boarer, a central well surrounded by 6 peripheral wells. Five microlitre of each antigen prepared above was pipetted into the central well and 5ul of each anlisera into the 5 peripheral wells normal saline was added into the remaining 6th peripheral well and used as control. Plates were incubated in a moist chamber at room temperature and read after 24 hours. Positive result was indicated by perception line between the antigen and the antisera wells. Negative plates were further incubated and examined. Protein antigen preparation: (Lind et al, 1980) Grown culture of M. farcinogenes from GYEA medium (Gordon & Mihm, 1962) harvested and washed three times with 73 sterile PBS then transferred to lml PBS in microcntrifuge tubes and pelleted at 16000g for 10 min (Mikro 20, Hettich-Germany). Bacteria were killed by pasteurization of the suspension in a water bath (Inventum- Holland) at 75°C for 5 min. The suspension was centrifiiged at 13000g for 10 min at room temperature and the supernatant poured off gently. Bacteria in the pellet were ground and then lOOul PBS added to the prepared antigen and kept at-20°C until required. SD'S-PAGE electrophoresis (Sodium dedocyl sulphate- Polyacrylamide gel electrophoresis according to Lamellae, 1970 & Ochi and Miyadoh 1992). 30% acrylamide/bis solution was prepared by dissolving 29.2g acrylamide and 0.8g methylene/bis acrylamide in 100ml distilled water. Resolving gel buffer (1.5MTris-OH, pH 8.80) was prepared by dissolving 18.15g Tris/base in 80ml distilled water, pH 8.8 adjusted using N-NaOH and the volume brought io 100 ml. This was performed using Mini-8-10 Vertical slope gel electrophoresis. BRL MD 20877 USA. Two glass plates sandwich assemblies (7.5x 7.5 sq cm) were handled using globes to prevent contamination by the skin proteins and to provide good gel adhesion to the glass. One glass plate was laid flat on the bench and two spacer bars were positioned in place along the slides. The other glass plate was laid in position resting on the spacer bars. The sandwich assembly was then clamped tightly on both sides and placed on stand and tightened in position by clamps. Casting of the gel. The resolving gel mixture was prepared and immediately casted slowly from one of the sandwich end until the cavity was about 4/5 full and left for 30 minutes to be polymerized then. 2ml sterile distilled water was layered on its surface. The water and the unpolymerized gel was stored overnight at 4°C. Immediately after preparing the stacking gel, it was poured into the glass sandwich over the polymerized resolving gel to completely fill the sandwich. Comb was placed and adjusted to the stacking gel and the latter was left for 15 min to polymerize. Then comb was removed carefully and the formed wells were filled with electrophoretic buffer to prevent diying. Preparation and loading of sample. About 10 ml of culture of each strain was concentrated by centrifugation to about 1.5 ml amount, and then sonicated at 6,000,000 beat/ min at 30 seconds intervals for 10 min and ?e00 ul volume was 74 transferred into eppendorf tubes. Equal volume of 2 x SDS- electrophoresis loading buffer was added to the bacterial sample and the mixture was heated at 100°C for three minutes. Samples were then loaded into the wells in the stacking gel using pippetman including 15ul of low molecular weight protein standard-used to determine the size bf the separated proteins as marker with sizes of 66.6 kD and 45 kD (Pharmacia, Sweden). Electrophoresis (Middendorf et ai, 1992) was carried out, by the lower chamber of the electrophoresis apparatus filled with electrophoretic buffer to immerse the anode terminals and the lower part of the gel. The upper chamber was placed on top of the gel plates and then tightened carefully with clamps to prevent leakage. The gel plates carrying the upper chamber were unfastened from the stand and placed in the lower chamber. The upper chamber was then filled with electrophretic buffer. The lid was placed in position and cooling device (Multitemp- LKB Biochem. USA) was connected to the power source (BioRAD, Model 200/2.0 USA) and electrophoresis was run at a constant current of 50 mA per gel throughout the stacking and 40mA per gel throughout the resolving gel. Turning off the power source ended the run when the dye reached the bottom of the gel at about one and half-hours. The upper chamber and gel planters were then removed from the lower chamber. The buffer was poured off and the gel plates were separated. Staining the slab gel. The gel was carefully freed from the glass plates and the resolving gel was transferred with great care to a suitable container after separation from the stacking gel. Coomassia brilliant blue (CBB) stain was added till it covered the gel completely. Staining was carried on a shaker (Titertek-Flow Laboratories USA) for 2 hours, the stain poured off, then washed and covered with destaining solution with continuous shaking for 4hours. The destaining solution was examined over a light box and protein bands checked. The gel was preserved in 10% acetic acid solution until photographed. Electrotrasisfer of proteins. The procedure involves the transfer of the proteins from the gel to nitrocellulose sheet (use gloves, Towbin et al, 1979). Strain extracts were electrophoretically separated on 10% SDS-PAGE. (Kozolic 1995 Ochi &Miyadoh, 1992) 15ul of low molecular weight protein standard (Pharmacia, Sweden) were used to determine the size of the separated proteins as marker with sizes of 66.6 kD and 45 kD. The standard solution 75 was prepared by mixing 5 mg from each of ribonuclease A, Chymotrypsingen A, ovalbumin and albumin, in 300 ul of the loading buffer in eppendorf tube, and the mixture was heated (65°C boiling water) for 3 min. After electrophoresis, the strip of resolving gel, which contained the standard, was cut and stained with Commasia brilliant blue. A sheet of Whiteman paper (3 mm) was soaked in 20-mm sodium phosphate buffer and laid on the surface of Scotch Brita pad placed on»the inner surface of an open gel holder. The remaining gel was transferred from the glass sandwish and laid on the wet Whitman paper. A sheet of nitrocellulose (B A, 85,0. 45mM. Schleicher and Schuell GmbH, Germany), having equal dimension to those of the gel was soaked in the phosphate buffer saline and placed with its rough surface adhered to the gel. Another sheet of Whitman paper presoaked in phosphate buffer was laid on the nitrocellulose sheet and any trapped air bubbles were removed. Finally another scotch brite pad was placed on the second Whitman paper and the whole layer was tightened between the gel holders and placed in the transfer chamber with the gel situated on the cathode side. The transfer chamber was filled with phosphate buffer until it covered the electrodes and the lid placed in position. Electrodes were connected to power source and current of 0.8Amp was maintained for one hour. After the transfer was completed, the power was disconnected and the gel holders were removed and Whitman paper were dispensed. The nitrocellulose paper was placed in a suitable trough. Quenching solution (25ml PBS, 751 Tween-20, 1.25gm milk powder) was added to the nitrocellulose paper and shaken for one hour. Papers were then washed 3 times with PBS for lOminutes. The nitrocellulose papers were then covered with diluted hyper immune serum (reference hyperinmune serum and guinea pig anti-Mycobacterium farcinogenes and Mycobacterntm senegalense was diluted 1:5 with PBS containing 0.005% Tween-20, PBS-Tweea) for 1 hour with continuos shaking at room temperature. The diluted hyper-immlined serum was poured off and the paper washed 3 times with PBS-Tween solution for 10 min each time. The conjugate (goat rabbit immune globulin conjugated to the horse radish peroxides was diluted 1:2000 in PBS-Tween, added to the washed nitrocellulose paper and left for 1 hour at room temperature with continuous shaking. The diluted conjugate was decanted and the papers washed with PBS- Tween. The substrate 25mg DAB (3.3 diamino benzidine terahydroo chloride) dissolved in 50ml PBS and 10 ml of 30%hydrogen peroxidase was added to this mixture and the 76 nitrocellulose's paper incubated with the development of room temperature and observed for the development of brown colored bands. Washing paper-distilled water 4 times stopped reaction. The blotted papers were drilled and subjected to molecular weight analysis. Molecular weight curve Molecular weight curve was drawn by measuring the distance of migration of the standard protein in the gel and by determining the ratio ® of the distance from the top of the gel to the middle of the protein band divided by the distance from the top of the gel to the dye front. A curve was drawn relating ® of each marker protein to its molecular.weight analysis of proteins separated following electrophoresis and blotting of the selected isolates. The rates (R) was determined for the unknown proteins in the same way. The logarithms of their molecular weights were obtained directly from the standard curve (Lambin & Fine 1979). 77 CHAPTER THREE RESULTS Of the five hundred and seventy eight (578) lymph nodes and two hundred sixty nine (269) sera sampled, seventeen (17) isolates of Mycobacterium farcinogenes were identified from the three areas of the Sudan (Table 3:1). The isolates grew well on the Lowensteen Jensen media, glucose yeast extract agar media (GYEA) and DST agar medium (Table 3:1). Most of the Mycobacterium farcinogene and Mycobacterium senegalense strains produced relatively stable branched filaments that were evident Vjhen Ziehl Neelsen stained smears were examined using light microscope. The seventeen clinical isolates of Mycobacterium farcinogenes and representative reference strains of Mycobacterium farcinogenes, Mycobacterium senegalenses and related taxa (Mycobacierium chelonae, Mycobacterium fortuitum, and Mycobacterium peregrimtm) were used in this research study. Morpholoigcal and staining properties showed characteristics which formed short or long branched filaments which do not fragment into bacilary forms and are strongly Gram positive and acid alcohol fast. i Cultural properties showed good growth in Glucose Yeast Extract Agar aerobically in 11 to 28 days for Mycobacterium farcinogenes but up to four days for Mycobacterium senegalenses. Colonies raised* rough and yellowish-white. Both strains grew well in Lowensteen Jensen media, in tryptose broth with serum and on modified Sauntons1 medium. Effect of temperature and pH were indicative that their optimal growth requirements lie between 25°C and 37°C and between pH 6.0 to 8.0 but do not grow at 5°C, 15°C 42°C, 45°C or 52°C. Biochemical characteristics showed that some organisms produced aryl sulfate in 3 days, catalase foam>45mm, hydrogen sulphide and nitrate but neither niacinnor phosphatase were produced. Mycobacterium farcinogenes and Mycobacterium senegalemes produce /--arabinose (pH 5.4), jft-D-cellobiosidase (pH 5.4), acetamido- deoxy-galactopyranosidase (pH5.4). p-guanidinosidase (pH 7.4), sulphatase (pH 5.4) and fi D-xylosidase but not B-D-fucosidase (pH 5.4) or acetamido-doxy- 78 glucopyranosidase but some strains of Mycobacterium senegalense produce D- mannosidase. Table 3:1 Samples (lymph nodes) and isolated Mycobacterium farcinogenes. Area/sample Lymph nodes Isolates Dillinj (South Kordofan) 103 7 El Obeid (North Kordofan) 196 4 Khartoum (Omdurman abattoirs) 299 6 Total 578 17 Table 3:2. Test and references strains used in the study of various taxonomic studies obtained from Molecular Microbiology Laboratory/University of Newcastle upon Tyne UK. Species Num Reference strains ber Mycobacterium chelonae 3 M35O Mycobacterium farcinogenes 29 M.262 &M191 Mycobaderium for tut turn 14 M204, M205 & M390 Mycobacterium peregrinum 15 M6 Mycobacterium senegalenses 6 263 Nocardia farcinica 15 N258, N671 & N669 79 The clinical strains and the representative strains of Mycobacterium senegalenses the causative agents of bovine farcy agents degraded aesculin, arbutin, testosterone, Tweens 20, 40, 60, and 80, but not adenine, allantoin, casein, estastrun, guanine hyphoxanthine, RNA, starch, L-tyrosine, urea or xanthine. Inhibition in the presence of chemical compounds showed that most of the strains are inhibited by bismuth citrate (0.1% w/v), cadminum (50, lOOug/ml), Cobalt (50, lOOug/ml, copper (50, lOOug/ml), crystal violet (0.02%, w/v), picric acid (0.1% w/v), phenol (0.1%, w/v), phenyl ethanol (0.2%, w/v), potasium telluride(0.1% w/v), pyronineG (0.1% w/v), sodium chloride (7% w/v), sodium deoxychalate (3% w/v), sodium salicylate (0.9% w/v), tetrazolium (0.1% w/v), thallous acetate (0.01% w/v) and zinc (lOOug). Mycobacterium senegalenses used dulcitol and glycerol as sole carbon sources but not amyl alcohol, L+ arabinose, ethanol, erythritol, galactose, inulin, meterbiose, 1- octanol, raffinose, salicin, sucrose and xylose. Do not use benzamide as a sole source of carbon and nitrogen. Mycobacterium farcinogenses were sensitive to cephaloridine (64ug/ml), chlorotetracycline (64ug/ml Sigma), dapsone (64ug/ml), gentamicine sulfate (64ug/ml Sigma), isoniazide (64ug/ml), lincomycin), methacyline (64ug/ml), neomycin sulphate (64ug/ml), oleandomycine phosphate (64ug/ml), rifampicin (64ug/ml), streptomycin sulphate (64ug/ml), tobramycine sulphate 64ug/ml) and vancomycin (64ug/ml). Mycobacterium senegalenses were sensitive to gentamicine sulphate (64ug/ml), neomycin sulphate (64ug/ml) and tobramycine sulphate (64ug/ml). D Rapid enzyme test gave better results of relationship and differences between bovine farcy agents and the related taxa of M. chelonae, M, fortuitum and M. peregrinum including N. farcinica. However, these positive virtues were underlined where reproducible and taxonomically valuables were obtained from incubated 96 well microtiter plates with seventy two (72) strains (Table 3:1) using thirty (30) enzyme substrates (Table 2:1 ) providing in this study valuable information of the tested strains (Figures 3: 1& 3:2). The critical cut-off point was achieved in the present investigation as the cophenetic correlation values for the Sj UPGMA and Ssm UPGMA analyses showed the numerical taxonomic data were suitably hierachical and that the denodrograms 80 generated using the UPGMA clustering algorithm were good representations of the taxonomic structure inherent in the respective similarity matrices (Manafi et al, 1991 Figure 3:1 and 3:2). The composition of both the clusters and subclusters recovered in the Sj UPGMA analysis was identical to that found in the Ssm/UPGMA analysis and the arrangement of clusters was, however, influenced by the resemblance coefficient used (Austin & Colwell, 1977). In the Sj /UPGMA analysis Mycobacteria and Nocardia strains were separated into aggregate phena but the homogeneous and distinct Mycobacterium farcinogenes shared a marginally higher affirmity with Mycobacterium chelonae, Mycobacterium fortuitum, Mycobacterium senegalense and Mycobacterium peregrinum (Fig 3:2). However, in the Ssm/UPGMA analysis, the Nocardiafarcinica strains formed a recognized aggregate phenon which splits the Mycobacterium clusters (Fig3:l ). The Mycobacterium farcinogene cluster was again marginally closer to Mycobacterium senegalense, Mycobacterium chelonae and Mycobacterium fortuitum group than to Mycobacterium peregrinum. There is good evidence in this study that rapid fluorogenic enzymes' results of relatively closely related species have taxonomically meaningful aggregate groups high lighted. The recovery of strains in clusters Sj, UPGMA and Ssm UPGMA that can be equated with taxo species is in agreement with the current trends in the taxonomy of these organisms (Wayne & Kubica, 1986. The substrates that showed no significant reactivity with any of the tested strains are 4 MU- fi • glucuronide, 4-MU- phosphate, 4 MU - acetate - butyrate, L-alamyl-7-amido - 4- methyl coumarin and H-Orn - AMC.2 Hcl. The following substrates were reactive with all strains tested: 4-MU-alpha-D-glucoside, L-alamyl-7- AMC, L- Leucyl -7-AMC, L-prolyl-7-AMC, asperingly-7-AMC, Lysyl-7-AMC, L- phenylahmyl-7-AMC, L-glutanmyl -7-AMC, L-alamyl-7-amido -4-methyl coumarin and 8-acetyl-4-MU. The characteristics of Nocardia farcinica strains and the Mycobactcria species defined (in the Sj/UPGMA and especially Ssm/UPGMA analyses, showed characters potential) y useful for differentiating the bovine farcy strains from one another and from the related taxa figures 3:1 and 3:2 All the phenotypic tests gave biochemical characteristics with great resolving power for differentiating Mycobacterium forcinogenes & Mycobacterium senegalense and from the related taxa . 81 00 IO X X iPiii; m%l¥^m Figure 3:1 A simplified dendrogram showing relationships between clusters and subclusters for fluorogenic enzyme tests on Mycobacterium farcinogenes, Mycobacterium senegalense, related taxa (Mycobacterium chelonae, Mycobacterium fortuitum and Mycpbacterium peregrinum) and Nocardia farcinica based on the Sj Coefficient and Unweighted pair group method of arithmetic algorithm (UPGMA). £ 6M e •si 3 m i -g"^** 13 £8B algorithm (UPGMA). The success of PCR amplification (Saiki et al., 1985; Vosberg, 1989) as a sensitive procedure for identification of DNA sequences and for detection of changes within genes is tightly coupled to the success of the more general concept of reverse genetics. Genetic analysis which begins at the level of DNA extraction and proceeds from there to phenotype are rapidly gaining ground (Ehrenpreis, 1991). However, the DNA extraction methods of (Marmur, 1961) have revealed good results of genomic DNAs bands from the seventeen clinically isolated strains of Mycobacterium farcinogenes (Fig.3.3). Electrophoresis and the imaging of the DNA bands (Figures 3:3-3:7) using Biorad Multi-analystrM PC:3 Version 1:1 revealed 1500 base pairs molecular weight of strains. 84 Bio-Rad Multi-Analyst™/PC Version i.l MW 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 00 Figure 3:3 DNA bands of Mycobacterium farcinogenese (clinical isolates). Molecular weight marker "GeneRuler™", C (control) and Lanes 1-17 clinical isolates which revealed 1500 basepairs the molecular weight sizes. Lanes 1-7, 8-11, and 12-17 are clinical isolates from Billing, E! Obeid and Omdurman central abattoirs respectively. Figure 3:4 Polymerase chain reaction amplification of the clinical isolates of Mycobacterium farcinogenese. MW (marker) and C (control). Amplification was carried out using universal primer 27f (5'-AGAGTTTGATCCTGGCTCAG-3') and 1525r (5'- AAGGAGGTGATCCAGCC-3'). The results of restriction fragment length polymorphism (RFLP) gave clear bands (Figures 3:5 3:6). DNA of Mycobacterium farcinogenes and Mycohacterium senegalemes were first checked to ensure that extensive shearing and degradation had not taken place prior to digestion with restriction enzyme (Bam HI and Hind III to cleave molecular weight marker-lambda DNA). Strains have chromosomal DNA that was sufficiently pure for ribotyping. BamHI enzyme gave clear hybridization fragments which developed over a'wide size range. The digoxigenin-labelled rDNA probe which contained fragments of the 5S, 16S and 23S rRNA genes of the strains hybridized with 2 to 4 fragments of BamHI-cleaved fragments of chromosomal DNA of the test strains. The hybridized fragments range from one to nine (1 -9-kilobase pairs) molecular weight in size. The hybridized bands were well resolved and reproducible patterns were found in t he repeated experiments All seven strains of Mycobacterium senegalenses gave identical ribotype patterns consisted of 3 fragments ranging from 2.5 to 9 kilo base in size. Similarly two out of seven Mycobacterium farcinogenes gave species-specific ribotype patterns which consisted of four fragments ranging from 3 to 9 kilo bases in size. Mycobacterium farcinogenes showed an additional small fragment of 3 kilo base (Figure 3:5). The comparative results of the dendrogram relationships between the representative strains of the related taxa showed that Mycobacterium peregrinum, Mycobaclerium fortuitum and Mycobacterium chelonae strains showed relationships between them with similarity values derived from electrophorectic DNA profiles The automated sequencing analyses (electrograms) have all been obtained with the applied Biosystems Model 377 DNA sequencing (ABI 100). The results of genomic DNA sequencing analyses using primers showed efficent results (Figures 3:7-11). 87 23KB • 9.4 • 6.5 > 4.3 2.3 •7 00 00 Figure 3:5 Ribofype patterns of she bovine farcy asenis: A, Mycobacterium senegalense. The patterns were all obtained by electrophoretic separation of Bam HI digests of genoniic DNA and hybridization with the digoxigenin-labelled rDNA probe (calorimetric detection). Molecular weight marker (23, 9.4, 6.5,4.3, 2.3, and 3 kilobases), lambda DNA was cleaved with Hind 111. Lane 1 (9, 5 & 3 kiiobases), lane 2 (9 and 5 kilobases), lane 3 (9,5, and 3 kilobases), lanes 4 and 5 (9, and 5 kilobases), lanes 6 and 7 each 5 kilobases. B, Mycobacterium farcinogenese gave in Lanes 1-7 (9,5, and 3 kilobases), with additionaibands of 2.4 kiiobases in lanes 5 and 7. Similarity values 20 40 60 80 . . 100 11U1U1U1U1 Ellllil iinimlmiiiiitinitillimiillUlll i imiiii IIIIIHUIHIIII I M. peregrinum M6T I i M.fortuitum M204T I" M. cheloiiae M35OT M M. farcinogenes M9 H M.farcinogenes M39 i I M. farcinogenes M191 il M.farcinogenes M63 Figure 3:6a. Dendrogram showing relationships between representative strains of, Mycobacterium chclonae, Mycobacterium farcinogenese, Mycobacterium fortuitum and Mycobacterium peregrinum based on ribotyping data. The similarity value was calculated by examining the spectral traces derived from the electrophoretic DNA profiles using Pearson's product moment correlation coefficient with clustering achieved using the Unweighted pair group method with arithmetic averages algorithm (Sncath & Sokal, I97J). Similarity values 90 100 II i i i i 1 i I I I I I I M. farcinogenes M9 o M. farcinogenes M191 M. fortuitum M204T M. senegalense M263T M. peregrinum M6T M. peregrinum M418 "M. chelonae M350T Figure 3:6b. Dendrogram showing relationships between representative strains of Mycobacterium cheionae, Mycobacterium farcinogehese, Mycobacterium fortuitum and Mycobacterium, peregrinum based on DNA amplification fingerprint data. The similarity value was calculated by examining the spectral traces derived from the electrophoretic DNA profiles using Pearson's product moment correlation coefficient with clustering achieved using the Unweighted pair group method with arithmetic averages algorithm (Sneath & Sokal,1973). Almost complete 16S rDNA sequences analyses of the strains nucleotides were manually aligned with 65 corresponding mycobacterial 16S rDNA sequences derived from the GenBank and RDP databases Mycobacterium farcinogenes alignment procedure was strait forward and the sequences obtained for the M. Senegaluse test strains at 1482 nucleotides (Figure 3:10 and 3:11 Appendix). These data were compared with nucleotide sequences 1404 positions and with 50 partial 16S rDNA sequences at 1398 positions of the test strains {Mycobacterium»farcinogenes and Mycobactarium senegalenses). Figure 3:7 - 3:11 nucleotide signatures typical of Mycobactcria that is unique nucleotide sequences. Each of the strains contained a unique nucleotide signature that is the sequence 'GCTCCC for bovine farcy agents and 'GCTCCP and 'GGCCTCC for related taxa {Mycobacterium chelonae, Mycobacterium fortuitum and Mycobacterium peregrinum) at position 191 to 194 (E. coli numbering system). The pairwise nucleotide similarity values determined for Mycobacterium farcinogenes and Mycobacterium senegalenses range from 98.5% to 99.4% which corresponds to between 6 to 12 nucleotide differences (Table 3:3). These results gave substantial differences from corresponding sequences of its related taxa namely Mycobacterium chelonae (98.5% and 99.1%, and Mycobacterium fortuitum (99.0% and respectively). Table 3:3 Levels of nucleotide similarity based on 16SrDNA sequences of Mycobacwium farcinogenes and Mycobacterium senegalense and some related taxa. Taxona Number of nucleotide differences and % 16SrDNA similarities'*0 M. chelonae M.farcinogene M.fortuitum M.senegalense M.chelonae 100 20 1£ 12 Mfarcinogene 98.5 100 1± 7 M.frotuitiim 98.7 99.0 100 9 M.senegalense 99.1 99.4 99.3 100 a The type strain of each taxon was used. b Calculations were based on 1398 nucleotide positions » c The number on the upper right {italic & underlined) are the numbers of nucleotide differences and those on the lower left are percentage 16SrDNA sequence similarities. 93 !•=• 22« I; Oft s o 0.3 ' *'. *f o o .8 I it: (0 i: 1 r o o (D a > 8 :* /^I' . )•) 'ft Comparable results were obtained in the corresponding analyses on the 16S rDNA sequences of the test strains of Mycobacterium farcinogenes and Mycobacterium senegalenses. Corresponding to the universal primer 27f and p 1525r primer binding sites of 27f (S'AGAGTTTGATCMTGGCTAG-S1) and pl525r (5'AAGGAGGTGWTCCARCC-3') respectively for 1134 nucleotide positions (Table 2:3) with the unalignable regions and gaps from unsequenced regions in many positions. The 16S rRNA nucleotide sequences of the farcy agents contained the short helix at positions 451 to 482 that is the sequence which is characteristic of mycobacteria (Figure 3:7-11) as manually aligned in this research. DNA sequencing results (Figures 3:7-11) out lined the lanes of the automated DNA sequencing and analyses (electrograms Benson et al 1977) and the results were obtained as follows:- Figure 3:7a, Lane 8: Mycobacterium farcinogene (clinical isolate). Primer MG1 (Primer close to the starting point and not clear from the beginning). The DNA sequencing gave low signal intensity of G (52), A(47), T(24), C(40). Priming, arlificacts-mispriming in the reverse primer binding site. Sequencing reaction with standard reverse dye primer, very low signal with high background noise was observed due to artifacts.related to DNA template composition., Elongation stop is due to secondary structures and distortion of sequence with a ploymerase elongation stop after a long poly-T stretch. O I 3 > '% £ O J •M 3 9 B ! O ! 1 If o 1 ft 3 51H .1- •' 5 Figure 3:7b Lane 9. Mycobacterium forcinogene (Clinical isolate). Sequenced using primer MG3 (CTACGGGAGCGGCAGCAC) size 16, with the binding sites 5'(342) and 3'(357) on the 16SrRNA molecule numbering according to the Eschericbia Coli numbering system (Brosius et al. 1978). Gave end sequencing with low template DNA resulting into low signal intensity G(46), A(43), T(20) and C(38). ,R (A I O I 8 J ii >i ri .«•< '•' Li « o 'A a i K" o 8 9 ...9 fi Hi 3 Figure 3:7c Lane 10: Mycobacteriumfarcinogene (clinical isolate). Primer MG3 (3'- O CTACGGGAGGCGGCAGCAC), size 16 with the binding sites 5' (342) and 3'(357) on the 16SrRNA molecule; E.coli numbering system (Brosius et al., 1978). Primer used in the PCR amplification of 16SrDNA and sequence primer in the dye deoxycycle sequencing of 16SrDNA. The genomic DNA sequencing resulted in the end sequencing with low template DNA resulted into low signal intensity G(61), A(59), T(28), C(55). f! B8 °3 f§i"* S fef1 i K >> S 88 O IT •.•»• to •»> $< «J o$ o«5 •I. I i si S 8 s i Ml o .8 it! O| .».1 ••> • «^H w - 1 1 to o 8! ;2 8 8 1.1 3 S! Ml O ft 1 O II to I 8 '•'I PS coi III* Figure 3:8a. Lane 11, Mycobacteriumfarcinogense (clinical isolate) was sequenced using two primers MG5 & 342r. Primer MG 5(AAACTCAAAGGAATTGACGG); size 20 with binding sites 5'(907) and 3'(926) on the 16S RNA molecule (Brosius et al, 1978). Primer 342r (CTACGGGAGGCAGCAG, reverse complement), used in the amplification of 16SrDNA and sequencing of the DNA. The genomic DNA sequencing gave poor results due to priming artifacts-mispriming in the reverse primer binding site which resulted in a very low signal G(47), A(44), T(23), C(43), with high background noise. Modal 377 12»37488/62#Y5-3427 SJgialG:19A:19T:14C:21 Pagei of 2 Version 3.3 DT{BDSetAny-Primar} W«d, Fab 24,1999 10:24 ABI100 Tua, Fsfc 23,1999 17:39 Verelon3.2 Lane 12 Points 12«> to 10182 Pk Hoc: 856 Spacing: 9.70{9.70} CCO3GGHSW CS3CCC CcrCT GMriC CTO.CGaA.CmGC rA TICT C CTATC 10 120 TCtarHGAC T-TGCA7G 't2CTAGGCAC GCCGA OMKSGAICA TC\ rCAAaCTCTjaCG ^5GH3 AHG aaB^B TIlSaSlGBWIGTTT 250 260 270 280 290 310 <2C 530 240 350 36C *7 fe«^(j?|^ AGcaaasrr 330 420 430 44C 450 460 470 48C 520 51C 560 610 T farcinogene (cfinical Isolate) Figure 3:8b. Lane 12. Mycobacterium farcinogene (clinical isolate). Primer 342r (CTACGGGAGGCAGCAG, reverse complement) used in the PCR amplification of 16SrDNA and sequencing of theDNA. The genomic DNA sequencing gave a very low signal with high background noise with the result of low signal intensity up to 310 followed by distortion of sequence elongation resulting in very low signal of Mod* 377 4007328/4444*4 Stgmi 0:483 A4Q6 1*281 <*4S7 VbraJonS.3 DTK)8APri} ABI1O0 bdtM Pointo 1280(<»9687 PkUoc047 Sparing: iaS1(io.5i} X^ aCGCCGT/iAACGATGAATGC TaGOTG r 1C 20 30 40 50 60 >:• 80 90 100 ilO 120 } 13C 140 23C rrsmCCTTarCrTCOGG^AGSGOAG&CAG^GGTGCATGGTTGJCGrCASCTC?' 250 260 270 230 290 300 310 220 330 GAC?GCC8Cm3ACa&AC OGGftGGAACKTG GGS AT« 450 4*0 470 4?C A^GOaCGG"7C 5JC- 543 5S0 SSO 570 5H0 590 | My<5pbQclertum farcinogen* (djnical teolat©) Figure 3:9a. Lane 40. Mycobacteriumfarcinogene (clinical isolate). Sequencing of o genomic DNA was carried out using primer MG4 (AATTCCTGGTGTAGCGGT); size 18 with the binding sites 5'(678) and 3'(692) on the 16SrRNA molecule numbering according to the Escherichia coli numbering system (Brosius et al., 1978). The genomic DNA sequencing gave a typical and very high signal intensities of G(483), A(466), T9221), C(457). iSSs. Figure 3:9b. Lane 41, Mycobacteriumfarcinogene (clinical isolate). Sequencing was carried out using primer MG 5(AAACTCAAAGGAATTGACGG); size 20 with binding sites 5'(907) and 3'(926) on the 16SRNA molecule numbering according to the system (Brosius et al, 1978), and used in the amplification of 16SrDNA. The genomic DNA sequencing gave a typical sequencing demonstrated the peak of signal intensities and height uniformity. G(40S), A(362), T(177), C(367). Figure 3:10a. Lane 38: Mycobacterium Sengealese. Primer MG3 (31- CfACGGGAGCGGCAGCAC), size 16 with the binding sites 5'(342) and 3'(357) on the 16SrRNA molecule numbering system (Brosius et ah, 1978). Primer used in the PCR amplification of 16SrDNA and sequence primer in the dye deoxycycle sequencing of 16SrDNA. The DNA sequencing resulted in template sequenced with a more distantly located primer due to priming artifacts. Mispriming in the reverse primer binding site with high signal intensity of G (141), A(l 19), T(50), C(104). Model 377 39»37325/444-M3 Signal 6:422 A:384 T:184 C 354 s 1 of 2 Version 3.3 DT {BD Set Any«Primw) Tt», F»b 18,1889 12:55 ABI1OO 3732*444-iM3 bdt96 Men, R* 15, tS88 17:34 Varsicn 3.2 Lane 38 PkiLoc:947 Spacing: ia.53fiO.53} 10 20 40 50 60 70 30 £0 100 113 11; 130 140 160 170 Tffi}"* "Tio '"""" 200™ :_•.'.•'*' 220 23C >:< CG:G7iiGCGGTGaAArGCG'DiGAGATGTGGAGGA^AC(^GIGGCGAAGGCGACTC'rC~GGGC' X 230 300 310 320 330 3AQ 350 ,-VVU •' * :'i '<>* Ikl 7GACGCTGAGGCGCG&A&GCGTGGGGAGCAAACAGGAT'LAGAT 'fQG'^VG-rCC^CGC CGTMACGATGAA7GCTAGGTGT •AGGGGTTTCGR.'SVCCCTTGGTGC CGA.ACT : 60 ..,- :7C 380 35G *:: 410 420 43:1 440 450 4*C 47€ •1 i'*> V \^ M a- 1 ;4 i KI\M Figure 3:1 Ob MycobcK2terjum sesnegatense. Figure 3:10b. Lane 39. Mycobacterium senegalense. Sequencing was carried using Primer MG3 (3'-CTACGGGAGCGGCAGCAC), size 16 with the binding sites 5'(342) and 3'(357) on the 16SrRNA molecule (numbering system Brosius et al, 1978). Primer used in the PCR amplification of 16SrDNA and sequence primer in the dye deoxycycle sequencing of 16SrDNA. The genomic DNA sequenced with a more distantly located primer due to mispriming in the reverse primer binding site which gave a very high typical signal of G (422), A(394), 1(184), C(354). Fig.3:lla. Lane 42 Mycobacterium senegalense). DNA sequencing was carried out using primer M6 (GCCTCAAGTCATCATGCC); size 19 with the binding site 5' (1190) and 3'(1208) (Chun, 1995), on the 16 SRNA molecule numbering system (Brosius et al, 1978), and used in the PCR amplification of 16 SrDNA. The genomic DNA sequencing results gave a typical sequencing which demonstrated the peak height uniformity obtained after A315. Note the quality of the DNA template reduces the signal level and results in the short fragments at lane points (430 to 590). The typical sequencing results giving a very high peak of signal intensities G (127), A(ii0),T(47),C(106). Fig. 3:11b. Lane 43, Mycobacterium senegalense. Primer 342r (CTACGGGAGGCAGCAG, reverse complement) used in the PCR amplification of 16SrDNA and sequencing of the DNA. Sequencing of genomic DNA of the clinical isolate was carried out using reverse complement primer 342r (reverse complement). The genomic DNA sequencing results gave a marked decreased intensities of longer fragments and the decreased read length at signals G(41), A(41), T(29), C(54). ELISA results obtained after sera analyses at absorbance filter 405nm (Multiskan Plus Version 2.1) scored absorption values as >0.25+. >0.50++. >1.00+++. >2.000 ++++. And >3.000 +++++ (Tables 3:5a-f) using serum samples from suspected bovine farcy infected cattle. Reference strains of Mycohacleriwn farcinogen.ses and Mycobacterium senegalense were used along with the field samples in the identification. Mycobaceterium farcinogenes and Mycobacterium senegalense reacted particularly strongly both with the homologous and the heterologous sera. Interest in immuno-stimulant for mediated immunity is growing because of its likely importance in resistance to microorganisms and tumors. However, the results of the animal pathogenicity test produced lesions and cultures from purulent materials revealing the inoculated test strains. Grown cultures on GYEA media showed typical bovine farcy agents microscopically. One guinea pig died at day 9 of inoculation showing the typical symptoms. Although mycobacteria are recognized as being particularly potent, the factors controlling the selective stimulation of cell-mediated immunity (CM1). The results of the animal test showed granuloma formation and skin reactions elicited. There was - less significant elevation of the skin-inoculated site relative to the inoculation of the pathogens and obtained sera. At day 7 after the challenge of the second group of the guinea pigs, significantly high response than the first group was seen. Some inoculated animals in replicate group died. Lesions were sampled, stained and subcultured onto the glucose yeasl extract agar media which showed microscopically and culturally the bovine farcy agents. Protein aniigen profiles of clinical strains of Mycobacterium farcinogenes studied using SDS PAGE method stained with Coomassie brilliant blue was used to analyze protein bands. The bands obtained were clear and indicative (Figure 3:12) and in line with the early work. Fractionation of protein bands with SDS-PAGE method with uniform concentration polyacrylamide gradient gels to enable determination of molecular size based on the distance migrated with molecular weight marker protein included in each gel and standard curve drawn for particular gel. This gave linear relationship between logio molecular weight and the Ratio (Rf). The distance of migration of dye front from the top of the gels was found to be 7.5 cm. The Ratio was calculated for molecular weight marker 0.32 (for 66.6 kD) and 0.59 (for 45 kD). The relationship between the logarithm of the above proteins 116 molecular weights (log 10 molecular weight) and the R-value for each of them was drawn in linear curve (Figure 3:13). The molecular weights of protein antigens were determined and different profiles were detected and gave the following results for each strain (Table 3*S). 117 Table 3:4 a-f ELISA test used for diagnosis of field sera using references strains Table 3:4a M. farciogene (.262) Sera 1 2 3 4 5 7 9 10 .11 12 1/100 A 1.460 2.469 1.160 2281 2.031 2.582 1.508 1.623 1.346 1.075 1.368 0.649 1/200 B 1.987 2.705 1.490 2.583 1.954 2.582 1.959 2.162 1.694 1.273 2.189 0.752 1/400 C 1.935 2.242 1.430 2.160 1.720 2256 1.877 2.051 1.737 1267 2.398 0.889 1/800 D 1.867 2.090 1.370 1.879 1.714 2.075 1.938 1.584 1.678 1208 2.347 0.835 1/1600 E 1.430 2.379 0.896 1.931 1.385 2.187 1.098 1.080 1.109 0.888 1285 0.427 1/3200 F 1.506 2.085 1.162 1.863 1.245 2.116 1.497 1.598 1.347 1.042 1.763 0.585 G 1.887 1/6400 2226 1.383 2.032 1.661 2.192 1.726 1.825 1.534 1.193 2.390 0.99 i 1/12800 H 1.970 2.060 1.368 1.870 1.800 2.003 1.880 1297 1.635 1.308 2.355 1.167 Table 3:4b Sera 1 2 3 4 5 6 7 8 9 10 11 12 1/100 A 1.610 2.646 1.315 2.500 2229 2.686 1.665 1.779 1.497 1.195 1.529 0.747 B 1/200 2.191 2.899 1.678 2.772 2.191 2.806 2.108 2327 1.838 1.381 2.394 0.852 1/400 C 2.160 2.489 1.611 2.326 1.875 2.411 2.034 2.193 1.866 1.392 2.630 1.034 1/800 D 2.112 2.349 1.497 2.066 1.926 2213 2.089 1.731. 1.867 1.323 2.612 0.942 1/1600 E 1.635 2.603 1.010 2.157 1.617 2.319 1270 1259 1.214 1.000 1.438 0.494 1/3200 F 1.851 2.383 1.362 2.148 1.534 2.311 1.743 1.730 1.526 1208 2.090 0.689 1/6400 G 2.0S3 2.486 1.524 2.218 1.83; 2.3S1 1.886 1.997 1.721 1.334 2.534 1.133 1/12800 H 2203 2289 1.544 2.065 1.990 2201 2.056 1.448 1.836 1.479 2.590 1299 f-00— _. >n vq o TT ro oo oo q r, rt r] rs, CN V> V» f~ (N ON t"» © t^ fN •-- r— CO <=>. ^ ~ -i CN CN CN —' —« — '-<©©©©©© ON f- CN OO OO O\ *o rt* co !•- ©s v> v^ i-- co CN ON © «—• toON CO VO *O CO *O 0 ! ^5 f•—*1 ON ON © © CN co r*~t- »p* ON Cd ^^ to ^" ^f ^1* CO ™~ ro CN o ddd'^'-iociociocicicZ 11 00 —< ON t-« •<• © CO © CN i™ VO © 00 M -" « >IO <-< CO oo oo ro o; ro rrvq'ovjcO'-jco^" d © d d d © d d C^ ON •"3- 1 ro SO ON VO VO 00 t ^ CN 00 Th CO 00 ON VO C3 ••^ CO 00 00 C^ "noot^^coqcico • Sdoddddo 00 «r> «o O oo O\ ON r-> — © r- v-> oo oo co t- © oo oo © a- 5ON § i? «o •-< CN © © o o o o © 0\t>nHf>N«rO «- CN co oo •* vo VO t © oo © ON ^™* ^^ co co t™** co *^* ^™^ •—> ON CO 00 00 t^ (N ON © CO vo 00 oo«noo«r>—»©r--o VO co •—' vo ON »-• CN VO CN ON ON ON CN fN CN — o* <-• ©' o* o' d ©' d r-l o co 00 00 CO ON CO C «i VO .S CO VJ VO VO VO CN ©O ON - h O H O] (S CO oo r-; r- ^i ^? ^* cN ct^ C? 4 dddddddd ^WOQWfcOJC •< CQ U Q W O X o © © _ oo •S iilOOOOVOcN o © oo S 8 _ N t *N i-j CO 00 © V> VO ON lr> o«r'»5oo»o ON o O CN CO OO Jj © vVoO O ON 000 —i r © r- co S 1 >ot--©©vo«n«n** —< oo S £' ddddodoo 8 g oo o\ dd TJ- CN r— •—< oo © Oi v© • rt; vq co rj; co ^ ddddcicidd c^ oo ^p ^* oo '•—* r^ ^? I—« *—t *-H •—< O *•* •"< «~< 00 00 ? ^^» Cd *"^ V© v^> ^^ ^^ SvOvoionti;^ °dddoddo ©ovi vo >-> H © CO CO- 00 !-• r-< < l cs>o 0't 'i'co©' CO CO t^O\—'t^CS — co v> co © t^» vo © t*^ jqq;;; •noooovqo>nvq>o dddddddd i^« r. CO co a © o © © JO © © © § § o o © vo CN B©ooo©©ooo oo j— jo t POOOOVOCN^CN Table 3:12 Strain bands detected bvJSDS - PAGE (molecular weights in kD). SI 84.2 80.4 66.6 62.2 52.8 47.8 44.4kD S2 85.4 79.8 72.6 68.8 60.4 59.8 47.8 5.4 & 32.2 kD S3 68.8 62.2 44.4 & 41.5 kD S4 80.4 62.2 52.8 kD S5 85.4 80.4 62.4 52.8 47.8 42, 36.8 & 32.2 kD S6 70.6 64.6 62.2 & 48.2 kD S7 80.6 70.6 68.0 61.8 52.8 42.6 40.2 & 32.2 kD S8 86 81.2 72.2 56.6 & 45.8 kD 121 Figure 3:13. Linear curve for the protein profiles. The 8 strains analyzed using SDS-PAGE method gave 30 protein bands of various molecular weights ranging between 86 and 32.2 kD. Two strains have 8 more bands, and 9 in only one base strain. One strain showed a very thick protein band of 86 kD molecular weight. Very faint bands were observed in three strains, these protein bands overlapped and ranging there between 84.2 to 32.2 kD molecular weight (Figure 3:13). Three strains have 3 each common bands of similar molecular weight of 80.4, 62.2, & 47.8 kD. Protein band 52.8 kD was common in four strains. Protein bands 86 and 45.8 kD was more clear and heavy. (Figure 3:12). 122 86 kD '66.6 kD 45 kD 32.2 kD Figure 3:12 SDS- PAGE analysis of Mycobactcrium farcinogcnesc protein bands composition using the slab gel format. Fractioned in a 2% linear gradient gel run at 40mA for one hour at room temperature. The track on the right contains the following molecular weight marker 66.6 and 45.0 kD. Bands were visualized after cleclrophoresis and staining with- Coomassie Brilliant blue R250. Bands range between 86 and 32.2 kilodaltons'with clear and common bands 85.4, 80.4, 62.2, 52.8, 4 7.8, 44.4 and 32.2 kD. «, !_.„ •0 O.I 0.2 0.3 1.0 R-value (distance in mm). Figure 3:13 Determination of protein iintiycns'profiles by SpS-PAfcE in linear gradient. CHAPTER FOUR DISCUSSION Mycobacterium is one of the most clinically important and intensively studied taxon and is recognized throughout recorded times (Kock 1882). However, the taxonomic history of ihe genus Mycobacterium is intricate and difficult to disentangle from those of related taxa (Bousfield and Goodfellow, 1976; Goodfellow and Minnikin, 1984). Mycobacterium farcinogense and Mycobaclerium senegalenses are members of the genus Mycobacterium and family Mycobacteriacea the causative agents of chronic disease of African bovines (Chamoiseau, 1970,1972,1979). - The clinical interest in Mycobacteria started with the work of Kock (1882), from thereon, there was an understandable, but nonetheless clinical bias which promoted a tendency to see different taxonomic kinds of mycobacteria solely in terms of their relationships with Mycobacterium tuberculosis. However, this taxonomic bias reflected in the common use of the term atypical mycobacteria for strains which could not be identified as either Mycobaclerium bovis or Mycobacterium tuberculosis e.g. Mycobacterium farcinogenes and Mycobacterium senegalenses (Goodfellow & Magee,19<>7). The collaborative studies carried out under the auspices of the International Working Group on Mycobacterial Taxonomy (IWGMT) are worthy of special attention as over five hundred mycobacteria were examined for around one hundred thousand characters (Wayne et al, 1983; Kubicaetal., 1972; Goodfellow et al., 1974). These cooperative studies not only provided comprehensive descriptions of defined taxospecie;;, but also yielded tests that proved to be of value in the identification of unknown strains (Wayne et al., 1974, 1976, 1980). It is interesting however that Mycobacterium was distinguished from the related genera in numerical phenetic surveys conducted on representative strains (Goodfellow et al., 1982a, 1982b; Goodfellow & Wayne, 1982). The understandable preoccupation with the detection and control of diseases caused by members of the Mycobacterium tuberculosis complex has tended to overshadow investigations into the pathology of non-tubercles mycobacteria. However, it is now clear that mycobacteria other than mammalian tubercle bacilli and the leprosy bacillus are important human pathogens (Good, 1991; Hoffner, 1993; Wallace, 1994). 124 Mycobacterium farcinogens and Mycobacterium senegalenses, the causative agents of bovine farcy and the related taxa, have a taxonomic history full of examples where the separate processes of classification and identification are confused; as strains were traditionally assigned to monothetic groups by a small number of subject chosen morphological and staining properites (Bousfield and Goodfellow, 1976; Goddfellow and Wayne, 1982). Precise identification of pathogens at species level is the primary aim of this study. The differentiation of species and subgroups of the genus Mycobacterium has traditionally entailed evaluation of growth characteristics and biochemical testing (Marks add Szulga, 1965; Kwok and Higushi, 1989; Boddinghans et al, J990; Fries et al., 1990; Kusunoki et ah, 1991). Moreover recent methodologies, including mycolic acid patterns by high-performance liquid chromatogrpahy (HPLC, Wallace et al., 1993; Hamid et ah, 1994), DNA probes and rRNA gene sequencing are hampered by the limited requirements (Telenti et ah, 1993). However, these species-specific typing systems are available for a limited set of species. Most of the Mycobacterium farcinogenes and Mycobacterium senegalense strains produced relatively stable branched filaments that were evident when Ziehl Neelsen stained smears were examined using light microscople (Cowan & Steel, 1974). Chronic disease such as bovine farcy is considered to be the most important economical and health disorder (Awad and Karib, 1957; El Nasri, 1961). The clinical history of bovine farcy, postmortem examination and other findings associated with the disease in this study were similar to those described previously as the earliest recorded isolation of the organism and predates the description of Mycobacterium farcinogenes in the Sudan (Awad and Karib, 1957; Karib and El Nasri, 1957, El Nasri, 1961 ). The recovery of Mycobacterium farcinogenes and Mycobacterium senegalenses in distinct clusters equivalent in rank with Mycobacterium chelonae and Mycobacttrium fortuitum is consistent with the recognition as distinct species (Chamoiseau, 1973, 1979) and with the results of the earlier study by Ridell and Goodfellow (1983). It is clear now then that bovine farcy strains from Somalia and Chad all belong to the homogenous taxon Mycobacterium farcinogenes. It is also evident that the strains from cases of bovine farcy in the Sudan assigned to the genus Nocardiae as Nocardia farcinica on the bases of chemical, physiological and serological critieria (Shigidi et ah, 1980) are typical strains of Mycobacterium farcinoget>.e.s. This later finding further questions the involvement of Nocardia 125 farcinica as an agent of bovine farcy though Nocardiafarcinica S488 was isolated from the mammary glands of a cow suffering from bovine farcy (Shigidi et al, 1980). Lipid data led several investigators to the view that actinomycetes causing bovine farcy in eastern and western Africa belonged to the genus Mycobacterium (Asselineau et al. 1969; Chamoiseau, 1969, 1973, 1979; El Sanousi */«/., 1977). Members of Mycobacterium farcinogenes and Mycobacterium senegalenses differ from all known mycobacteiia as they are found in lesions of the lymphatic system or the parenchyma of zebu cattle and present a stable mycelium, a positive malonamidase test and shows a distinctive pathogenicity for guinea pigs (Chamoiseau, 1979). A limited range of 4MU-linked substrates have been used to classify and identify actinomycetes notably mycobacteria (Grange and Clark, 1977; Slosarek, 1980; Hamid et al. 1994 and a range of mycolic acid containing actinomycetes (Goodfellow et al 1991; O'Donnel et al, 1994). Corresponding studies based on 7AMC derivatives have been carried out on mycobacteria (Goodfellow et al, 1987c, 1990b, 1991; Hamid et al., 1994). In the rapid fluorogenic enzyme analyses, fluorescence of molecules is caused by absorption of electromagnetic radiation, i.e., ultraviolet, visible and infrared radiation, leading to the promotion of electrons from a ground to an exited stale (James, 1994). The duration of the excited state is finite and loss of vibrations energy will occur either by collisional deactivation or by re-mission of radiant energy (fluorescence). The restricted number of enzymes tests currently used in Mycobacterial systematics attributed to the traditional emphasis placed on colonial and physiological criteria and to the problem of detecting small amounts of end product in large volumes of test media (Wayne and Kubica, 1986). However, compared with such conventional tests, micro-methods have the advantage of speed and the use of only small amounts of media. The preliminary data presented in this study suggested that the use of 7AMC- and 4MC linked derivatives for the detection of specific enzymes will provide valuable information upon characterization for the classification and identification of Mycobacterium farcinogenses and Mycobacterium senegaleme and the related taxa including Wocardia farcinica. It is clear from the results of this study and earlier that actionmycetes species have characteristic biochemical profiles tMt can be used for taxonomic purposes (Goodfellow et al, 1987; 1991). The recovery of Mycobacterium farcinogenses, Mycobacterium senegalenses and Nocardiafarcinica strains in well defined clusters is in a good agreement with an earlier numerical 126 taxonomie study based on a balanced set of taxonomic criteria (Ridell and Goodfellow, 1983). However, it is also encouraging that in the present study, all agents of bovine farcy and the related taxa (Mycobacterium chelonae, Mycobacterium fortuitum and Nocardiafarcinica can be separated from Mycobacterium farcinogems given Iheir ability to attack 4MC-a-D-glucoside whereas Mycobacterium farcinogenes, unlike Mycobacterium senegalense, cleave 4MC-B-D-galactoside. Mycobacterium farcinogenes and Mycobacterium senegalenses can also be distinguished as most strains of the former degrade 4MU-B-D- maltose and 4MU-a- D-mannopyranoside. These data however, suggested that diagnostic fluorogenic enzymes will provide a quicker and more accurate way of distinguishing between Mycobacterium farcinogenes and Mycobacterium senegalenses and other actinomycetes associated with bovine farcy agents than the currently recommended tests (Ridell et ah, 1985). The recovery of the representative phylogenetically close species of Mycobacterium chelonae, Mycobacterium farcinogenes, Mycobacterium fortuitum, Mycobacterium peregrinum and Mycobacterium senegalenses in distinct clusters in this study, is in good agreement with an earlier, albeit broad-based numerical taxonomic studies (Pitulle et al., 1992; Ridell and Goodfellow, 1983). It is particuahiy encouraging that members of these taxa can be separated and distinguished by the discontinuous distribution of enzymes. Mycobaaerium farcinogenes, Mycobacterium fortuitum and Mycobacterium senegalense strains, unlike Mycobacterium chelonae, cleave actyl-L- phyenylalaninne-L-arginine-7AMC, glycine-glycine-Lhenyl-7AMC and t- butyloxycarbonyl-L-leucine-L-lysine-7AMC. Similarly, Mycobacterium fortuitum can be distinguished from Mycobacterium farcinogene and Mycobacterium senegalense strains given their ability to attack 4MU-N-acetyl-B-D-galactosamine, 4MU-B-D-NB-N-diacetyl-chitoside and 4MU-B- D-N-N-triacetyl-chitotriose (Hamid et al, 1994). Mycobacterium fortuitum complex are rapidly-growing nonchromogenic mycobacteria which give a positive 3-day arylsulfatase tests, degrade periodic acid - Schiff reagent and are resistant to hydroxylamine hydroxide (Wayne and Kubica, 1986). The species included in the Mycobacserium complex can be distinguished from one another using biochemical and cultural tests as well as by chemical, serological and molecular systematic criteria. The taxonomic status of Mycobacterium fortuitum is supported by a wealth 127 of data, notably by the results of analyses of enzymes and protein (Hamid et al., 1994). The genomic DNA extraction is a key step 1 molecular technique in the isolation of nucleic acid and in the phylogenetic studies of nucleic acids and application of other molecular studies. However in order to obtain readable and reproducible electrophoretic patterns after cleavage by restriction endonucleases, extracted DNA must be of a high molecular weight and free from inhibitors that might interfere with endonucleases. The clinical strains of Mycobacterium farcinogenes in this study gave a clear genomic DNA bands of molecular weight (1500 base pairs) characteristic of the members of the bovine farcy agents. The use of PCR coupled with restriction endonuclease analyses of PCR products has been the recent focus of considerable interest for separation of mycobacteria associated with bovine farcy from the related taxa as well as recognition of individual Mycobacteriutn farcinogenes from Mycobacterium senegalense. However, in this study this methodology has proven to be sensitive, less time consuming and less labor intensive than traditional biochemical methods. The results of this study is in line with the previous work conducted on species of Mycobacteria and Nocardiae (Telenti etal.,1993). • Telenti et al., (1993) and Plikaytis e/#/., (1992) described a rapid* sensitive method for differentiation of mycobacterial and nocardial species through PCR amplification of gene sequences coupled with restriction endonuclease analysis. However, the application of this PCR-based methodology to the test strains of Mycobacterium farcinogenes (the clinical isolates), Mycobacterium senegalense and related taxa demonstrated the DNA sequence selected for this study revealed a high percent of the specie*; studied. Although improvements are still required to differentiate all the strains, this PCR- based technology provides a rapid, sensitive, time-and labor efficient method for the separation of the species of mycobacteria. Such a system should not be difficult to implement in reference laboratories, which would then be enabled to provide species identificatson of clinical isolates within few working hours. High percent of Mycobacterium farcinogenese and Mycobacterium senegalense and the related taxa were differentiated by restriction endonucleases Bamll and Hind III, gave good differentiating results and an observation quite similar to that of Lungu et al., (1994). PCR-based RFLP methodology applied for the wide range of 128 mycobacterial species as well as some nocardial species enables detection of DNA polymorphism among strains. The variations in DNA sequences were visualized by PCR amplification of DNA restriction fragments and the resultant polymorphism generated would enable the molecular identification and typing of bacterial strains. Such markers would also lead to a better comprehension of the epidemiology of bacterial infections. However, it has been previously reported that RFLP is a powerful tool for genome fingerprinting of DNA of any source or of any complexity including bacterial DNA (Valsangiacome et ai, 1995). In this siudy, dendogram results showed relationships between representative strains of Mycobacterium senegaiense, Mycobacterium farcinogenes and the related taxa (of Mycobacierium chelonae, Mycobacterium fortuitum and Mycobacterium peregrinum) based on ribotyping data. The similarity values derived from the electrophorectic DNA profiles achieved and in line with the previous work using the unweighted pair group method with arithmetic average algorithm (Sneath and Sokal, 1973). Many of these studies were directed towards the identification of pathogens and taxonomic analysis undertaken. However. Grimont and Grimont (1986) have suggested a broader taxonomic application of rRNA gene RFLPs and taxonomic analysis of RFLPs has shown good congruence with other taxonomic studies (Owen et al., 1989; Clarke et al., 1993; Vincent et al, 1995; Boumedine and Rodolakis, 1998). All test strains of genus Mycobacterium used in this study formed a single restriction endonuclease pattern similar to the other bacteria studied (Verger et al, 1987). Other taxonomic applications of this method have been published (Gottlieb and Rudner, 1985; Bercovier et al, 1986; Saunders et al, 1988; Yogev etal, 1988; Sela et al, 1989). The minor heterogeneity observed in DNA relatedness among Mycobacterium farcinogenes and Mycobacterium senegaiense, correlated with the finding of different patterns among which two were associated with the related taxa {Mycobacterium fortuitum and Mycobacterium peregrinum) more applications to epidemiological investigations have been published (Owen et al, 1988; Stull et al, 1988; De Buyser et al, 1989; Snipes etal, 1989) and that rRNA gene restriction patterns can, therefore, have either taxonomic or epidemiological interest. The number and the position of these endpnuclease-specific restriction sites on a DNA molecule determine the number and the sizes of the fragments generated by the cleavage. The development of the simple analytical methods for the separation of DNA fragments by the agarose gel clcclrophorcsis enabled in this study, comparison of restriction patterns of the 129 . genomic DNA of the strains, chromosomal and PCR amplification products of the tested strains. This work is in line with the other previous similar studies (Meyer el al., 1976; Bove and Saillard 1979). Proteins and nucleic acids are the only molecules that carry enough information in their sequences to measure the totality of bacterial diversity (Stackebrandt & Liesack, 1993), can be sequenced and compared by molecular techniques (Grimont & Grimont, 1986). However, several typing systems have been found to be helpful in delineating actinomycetes below species level and in clarifying the epdiemiology of mycobacterial infections (Gortler & Stanisich, 1996). It is one of the aims of this study to characterize bovine farcy agents by sequencing their genomic DNAs. However, a large effort has been undertaken to develop full scale automated DNA sequencing with independant number of primers. Almost complete 16SrDNA sequence obtained from the bovine farcy strains revealed good and comparable data (1482 nucleotides) with (65) corresponding almost complete nuclotide sequences (1404 positions) and with partial 16SrDNA sequences (1134 positions), a study similar to the early findings (Bourget et al, 1996). The acquisition of genomic DNA sequence information is an integral part of this research study. However, in this study, advantages included the production of comparable lanes of strong signals from small amounts of PCR amplified genomic. High 16SrDNA similarity values (99.8 - 99.9%) obtained corresponded between 7 and 12 ni icleotide differences and average nucleotide similarity between bovine farcy agents and related taxa (96.6 + 1-1.1%). However, the strains of Mycobacterium farcinogenes and Mycobacterium senegalense contained a unique nucleotide signature (sequence GCCCTT) at positions 191 to 194 of the manual alignment with 16SrDNA nucleotide signatures typical of mycobacteria (Brossius e/o/., 1978 and Besrae/a/ 1992b. 1994; Stackebrandt et al, 1997). Interestingly, sequencing of farcy agents 16SrRNA genes revealed a close phylogenetic relationships and with the related taxa similar to the previous data (Telenti et al. 1993). The stud/ has however, indicated that nucleic acid sequencing methods have developed so rapidly that comparative sequencing of homologous genes is now a standard technique in molecular systematic and phylogenetic studies of actinomycetes. The determination of sequence positions can be obscured owing to the method. However, sequence comparison of homologous genes requires a proper alignment of the sequences which is a pre-requisite to obtain correct results in the homologous positions. Comparative analyses of genomic DNA sequence conserved regions were aligned manually as well as by computer - assisted analyses in this study using direct genomic fluorescent on-line sequencing using in Vitro DNA amplification with results similar to previous work(Voss, etaL, 1989). In relation to 16SrRNA sequence analyses, mycolic acid- containing a ctionmycetes form a suprageneric relationships well defined branch within the evolutionary radiation by actionmyeetes (Embly & Stackebrandt, 1994). With this and other studies, rapid growing pathogenic bacteria are mainly attributed to members of the so-called Mycobacterium complex (M.abscessus, M.chelonae, M.fortuitum andM.peregrinum; Kusunoki & Ezaki, 1992; Wallace, 1994; Wayne & Sramek, 1992). however, members of these taxa share genotypic and phenotypic characteristics with Mycobacterium farcinogenes and Mycobacterium senegalense the sole agents of bovine farcy agents (Chamoiseau, 1979; Pitulle e/#/., 1992;Kirschennere/r//., 1993 + Bradley et al, 1978.. ELISA appears to be an excellent serological test and has been widely used in order to detect antibodies to many parasitic organisms (Cheng & Talmage, 1969, 1982). It is therefore evident from the present study that antigens prepared from Mycobacterium farcinogenes and Mycobacterium senegalense are efficient and reacted with the homologous and heterologous sera. However, the presence of immune serum may explain the antigenicity and strong cross-reaction. The relatively weak reaction shown by some strains of Mycobacterium senegalense is difficult to explain. The antigenic glycolipids located on the mycobacterial cell surface are probably important virulence factors which affect the interactions between mycobactei ia and phagocytic and immunogenic cells. However, antigens from mycobacteria or with limited cross- reactivity are of interest in the development of serodiagnosis (Ridell e/ al 1992). The cross-reaction observed distinguishable from the intensive reactions with the homologous sera, similar to the work of Cheng and Talmage (1969), Cummins and Harris (19.58). Animal pathogenicity experiment confirmed the potent activities of Mycobacteria for induction of DTH in the laboratory animals (guinea pigs) and interesting to note significant production of disease symptoms which may be diagnostic. However, the use of Mycobacterial antigens can be adequate and there was significant promotion of DTH, which is in line with the previous work of Magnussonand Mariat 1968) & (Collins & Macknes, 1968; Crowle, 1962 1965). 131 Taken overall, the bovine farcy agents displayed the most consistent activity for promotion of cell mediated immunity (CMI) indication with all the test employed. However, as it also reaches protective immunity, it would therefore seem to merit evaluation as an adjuvant for vaccine in circumstances where CMI may be important. (Draper, 1982,1989). The death of some experimental animals, might be attributed to the absorption of specific antibodies to Mycobacterium farcinogenes from the blood by circulating microorganisms. Similar evidence on the specific antibody absorption was reported (Chamoiseau, 1973,1979). The need to identify antigens at the molecular and submolecular levels have been a major impetus for what is now an enormous amount of literature on the application of protein antigen profiles analyses (using SDS-PAGE method). Extracted protein antigens from clinical Mycobacterium farcinogenes expressed good number of protein bands which may be diagnostically useful. It is however, of value to conclude that immunological analyses (using ELISA, animal pathogenicity and protein antigen profile determination-SDS-PAGE) of bovine farcy strains gave significant results for serological diagnosis, disease monitoring and molecular determination of protein antigen profiles respectively. Conciusioii The present study was based upon the isolation and identification of the clinical strains of Mycobacterium farcinogenes and Mycobacterium senegalenses which are relatively closely related. The species characterization tests (genotypic and phenotypic) employed had proved useful as in earlier studies on mycobacteria and nocardiae (Goodellow, 1971; Goodfellow et al, 1982a, 1982b; Ridell and Goodfellow, 1983). However, it is important to reveal that numerical taxonomic, DNA extraction, PCR amplification, restriction fragment length polymorphism and DNA sequencing characterization results have shown to provide valuable data for the strains causing bovine farcy. All these results were in line with the previous numerical laxonomic studies conducted on the members of the genus Mycobacterium (Jones and Sackin, 1980; Goodfellow and Wayne, 1982). Recommendation The present research study has gone some way towards the systematics of Mycobacterium farcinogenes and Mycobacterium senegalense and some related taxa. However, additional work is requried to delineate numerical and serological taxonomy of these boine farcy agents. 132 REFERENCES. ABDULLE, M. A. (1983). Numerical and chemical classification of mycobacteria causing bovine farcy. M. Sc. Thesis, University of Newcastle upon Tyne. UK. ABED, Y.; DAVIN REGLI, A.; BOOLET, C. & DE MICCO, P. (1995). Efficient discrimination of Mycobacterium tuberculosis strains by 16S-23S spacer region-based random amplified polymorphic DNA analysis. Journal of Clinical Microbiology 33:1418-1420. ABOU-ZEID, C, FILLEY, E., STEEL, J. & ROOK, G. A. W. (1987). Specific protein aniigen of Mycobacteria. Journal of Immunological Methods 98:5-10. AHMED, R. & GRAY, D. (1996). Immunological memory and protective immunity: understanding their relationship. Science 272: 54-60. ALDERSON, G. (1985). The application and relevance of nonhier^chial methods in taxonomy. In Computer-Assisted Bacterial Systematics, pp. 227-263. Edited by M. Goodfellow, D. Jones & F. G. Priest. London; Academic Press. ALM, R. A. & MANNING, P. A. (1990). Biotype-specific probe for Vibrio cholerae serogroup 01. Journal of Clinical Microbiology 28: 823-824. ANDREWS, P. (1965). The gel filtration behavior of proteins related to their molecular weights over a wide range. Biochem. J. 96:595. ANDREW, D. P.; ROTT, L. S.; KILSHAW, P. J.; BUTCHER, E. C. (1996). Distribution of alpha4 beta7 and alphaEbeta7 integrins on thymocytes, intestinal epithelial lymphocytes and peripheral lymphocytes. Eur. J. Immunol. 26: 897-905. ANSORGE, W. & SPROAT, B. STEGEMANN, J.; SCHANGER, C. & ZENKE, M. (1987). Nucleic Acids Research 15, 4593. ANZAI, Y.; OKUDA, T. & WATANABE, J. (1994). Application of the random amplified polymorphic DNA using the polymerase chain reaction for efficient elimination of duplicate strains in microbial screening. II. Actinomycetes. Journal of Antibiotics 47: 183-193. ARBEIT, IL; SLUTSKY, A.; BARBER, T. W.; MASLOW, J. N.; NIEMECZYK, S.; FALKINHAM III, J. O.; ONCONNOR, G. T.; & VON REYN, F. (1993). Genetic diversity among strains of Mycobacterium avium causing monoclonal and polyclonal bacteremia in aptients with AIDS. The Journal of Infectious disease 167: 1384-1390. ASSELINE AU, C. & ASSELINEAU, J. (1978). Trehalose-containing glycolipids. Progress in the Chemistry of Fats and other Lipids. 16: 56-99. 133 ASSELINEAU, J.; LANEELE, M. A. & CHAMOISEAU, G. (1969). De l'etiologie du farcin de zebus tchadiens: Nocardiose ou mycobacteriose? II. Composition lipidique. Revue d'elevage et de Medicine Veterinaire des pays Tropicausx 22: 205-209. AUSTIN, B. & COL WELL, R. R. (1977). Evaluation of some coefficients for use in numerical taxonomy of micro-organisms. International Journal of Systematic Bacteriology 27,204-210. AUSTIN, B. & PRIEST, F., eds. (1986). Modern Bacteriological Taxonomy, 2nd ed. London: Champan & Hall. . AW AD, F. I. (1958). The interrelationship between tuberculosis and bovine farcy. Journal of Comparative Pathology 68; 324-329. AW AD, ¥. I. & KARIB, A. A. (1958). Studies on bovine farcy (nocardiosis) among cattle in the Sudan. Zentralbaltt fur Veterinarimedizen 5,265-272. AWAD EL-KAREEM, M. H. & MUSTAFA, A. A. (1974). Bovine nocardiosis, tuberculosis and other caseous infections at Omdurman Central Abattoir. Sudan Journal of Veterinary Science and Animal Husbandry, 15, 57-60. BAESS, I. & WEIS BENTZON, M. (1978). Deoxyribonucleic acid hybridization between different species of mycobacteria. Acta Pathologica. Scandinavia B86:71-76. BAESS, I. (1979). Deoxynucleic acid relatedness among species of slowly-growing mycobacteria. Acta Pathologica. Scandinavia B8:7221-226. BAESS, I. (1982). Deoxyribonucleic acid among the rapidly-growing mycobacteria.. Acta Pathologica. Scandinavia. B90: 371-3765 BAESS, I. (1983). Deoxyribonucleic acid relatedness between different serovars of Mycobacierium avium, Mycobacterium intracellulare and Mycobacterium scrofulaceum. Acta Pathologica Immunologica. Scandinavia. 91: 201-203. BALDACCI, E. (1985). Development in the classification of actinomycetes species. Giornale di Microbiologia 6: 10-27. BANKS, J.; SMITH, A. P. & JENKINS, A. (1985). Mycobacteria malmoense. Problems with treatment and diagnosis. A case report. Tubercle. 64: 217-219. BARKSDALE, L. & KIM, K. S. (1977). Mycobacterium. Bacteriological Reviews 41:217-312. BARSOTTI, O.; DECORET, D.; BENAY, G.; CARLOTTI, A.; FRENEY, J.; GUERIN-FUBLEE, V. & MOORIER, J.-J. (1994). RNA gene restriction patterns as possible taxonomic tools for the genus Actinomyces. Zentralblatt fur Bakteriologie 280:411433. 134 BASS AM, B. J.; CAETANO-ANNOLES, G. & GRESSHOFF, P. M. (1992). DNA amplification fingerprinting of bacteria.. Applied Microbiology and Biotechnology 38: 70-76. BATES, J. H. & MITCHISON, D. A. (1969). Geographic distribution of bacteriophage types of Mycobacterium tuberculosis. American Review of Respiratory Diseases 100: 189-193. BATTIG, U.; WEGMANN, P.; MEYER, B. & PENSEYRES, J. H. (1990). Nocardia mastitis in cattle. I. Clinical observations and diagnosis in 7 particular cases, Schweizer Archiev Tieheilkunde 132:315-322. BEAMAN, B. L. & BEAMAN, L. (1994). Nocardia species: host-parasite relationships. Clinical Microbiological Reviews 7: 213-264. BEAMAN, B. L. & SUGAR, A. M. (1983). Nocardia in naturally acquired and experimental infections in animals. Journal of Hygiene (London) 91: 393-419. BECK, O'KEEFFE, T. COULL, J. M. & KOSTER, H. (1989). Nucleic acids Res. 17,5115. BEJI, A., IZARD, D., GAVANI, F., LECLERC, H., LESEINE-DELSTANCHE, M. & KREMBEL, J. (1987). A rapid chemical procedure for isolation and purification of chromosomal DNA from Gram negative bacilli. Anal. Biochem. 162: 18-23. BERCOV1ER, H.; KAFRI, O. & SELA, S. (1986). Mycobacteria possess a surprisingly small number of ribosomal RNA genes in relation to the size of their genome. Biochemical Research Communications 136: 1136-1141. BERD, I). (1973). Nocardia asteroides. A taxonomic study with clinical correlations. American Review of Respiratory Diseases 108,909-917. BERGEY, D. H.; HARRISON, F. C; BREED, R. S.; HAMMER, B. W. & HUNTOON, F. M. (1923). Bergey's Manual of Determinative Bacteriology, 1st Edition. Williams & Wilkins Co., Baltimore. BERKELEY, R. C. W.; GOODACRE, R.; HELYER, R. & KELLEY, T. (1991). Pyrolysis,-Mass Spectrometry (PyMS) 7n:The Identification of Microorganisms. Laboratory Practice 39, 81 -83. BESRA, G. S.; McNEIL, M. R. & BRENNAN, P. J. (1992b). Characterisation of the specific antigenicity of Mycobacterium fortuitum. Biochemistry 31, 6404-6509. BESRA, G. S.; GURCHA, S. S.; KHOO, K.-H.; MORRIS, H. R.; DELL, A.; HAMID, M. E.; MINNIKIN, D. E. & BRENNAN, P. J. (1994). Characterisation of the specific antigenicity of representatives of Mycobacterium senegalense and the related bacteria. Zentralblatt fur Backteriologie 281; 415-432. 135 BIRNBOIM, C. (1983). A rapid alkaline extraction method for the isolation of plasmid DNA. Methods in Enzymology 100; 243-255. • • • BIRNBOIM, C. ; & DOLY, J. (1979). Rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7: 1513-1523. BLACKWELL, J. M., BARTON, C. H.; WHITE, J. K.; ROACH, T. I. A.; SHAW, M. A.; WHITEHEAD, S. H.; MOCK, B. A.; SEARLE, S.; WILLIAMS, H.; BAKER, A.M. (1994). Genetic regulation of leishmanial and mycobacterial infections. 43: 99-107. BLOOD, D. C; RODOSTITS, O. M. & HUNDRESON, J. A. EDS. (1983). Bovine farcy (mycotic lymphangitis, bovine nocardiosis). In Veterinary medicine: A textbook of the Diseases of Cattle, Sheep, Pigs, Goats Horses, 61'1 ed. Pp. 654-655, London: Bailliere Tindall. BOCART, D. & GICQUEL, B. (1989). Detection and identification of mycobacteria by amplification of mycobacterial DNA. Molecular Microbiology 3: 843-849. BOEHRINGER MANNHEIM BIOCHEMICA. (1994). Catalougue P^.Boehringer Mannheim UK, Lewes. BODDINGHAUS, S.; ROGALL, T.; FLOHR, T. BLOCKER, H. & BOTTGER, E. (1990). Detection and identification of mycobacteria by amplification of rRNA. J. Clin. Miciobiol. 28: 1751-1759. BOMFOltD, R. (1980). The comparative selectivity of adjuvants for humoral and cell-mediated immunity. I. Effect on the antibody response to bovine serum albumin and sheep red blood cells of Freud's incomplete and complete adjuvants, aldehydrgel, Corynebacterium, Bordetella pertussis, muramyl dipeptide and saponin. Clin. Exp. Immunol. 39,426. BOJALIL, L. J. & CERBON, J. (1961). Taxonomic analysis of non pigmented rapidly-growing mycobacteria. Journal of Bacteriology 81, 338-345. BOJALIL,L. F.; CERBON, J. & TRUJILLO, A. (1962). Adansonian classification of mycobacteria. Journal of General Microbiology 28: 333-346. BONICKE, R.; ROHRSCHEIDT, E. & PASCOE, E. (1962). Die Verbreitung der nitrtreduktase innerhalb der Gattung Mycobacterium. Naturwissenschaften 49,43-44. BOUMEDINE, K. S. & RODOLAKIS, A. (1998). Amplified fragment length polymorphism (AFLP) allows the identification of genomic markers of ruminant Chlamydia psittaci strains useful for typing and epidemiological studies. Institute Pasteur/ Elsevier. Res. Microbiol: 149, 735-744. BOURGET, N. L.; PHILLIPE, H; MANGIN, I. & DECARIS, B. (1996). 16S rRNA and 16S to 23S internal transcribed spacer sequence analyses reveal inter- and intraspecific Bifidobacterium phylogeny. International Journal of Systematic Bacteriology 46: 102-111. 136 BOUSFIELD, I. J. & GOODFELLOW, M. (1976). The rhodococcus complex and its relationships with allied taxa. In; The Biology of Nocardiae, pp 39-65. Editted by Goodfellow, M.; Brownwell, G. H. & Serrano, J. A. Academic Press, London. BOVE', X M. & SAILLARD, C. (1979). Cell biolog of Spiroplasma. In: The Mycoplasma, vol. 3, (Whitecbmb, R. F. and Tully, J. G., eds), pp. 83-153. New York: Academic Press. BOVIL, R. A. (1991). Rapid methods in Staphylococcus Systematics. Ph.D. Thesis, University of Northumbria at Newcastle upon Tyne, UK. BOWDEN, G. H. & GOODFELLOW, M. (1990). The actinomycetes: Actinomyces, Nocardia and related genera, In: Topley and Wilson's Principles of Bacteriology, Virology and Immunology 8th ed., vol. 2 Systematic Bacteriology, pp. 31-57. Edited by M. T. Parker & B. I. Duerden. London: Edward Arnold. BRADBURY, J.M. (1977). Rapid biochemical tests for characterisation of Mycoplasmatales. Journal of Clinical Microbiology 5; 531-534. « BRAGLEY, S, G. (1971). Criteria for definition of Mycobacterium, Nocardia and Rhodococcus complex. Advancing Frontiers of Plant Sciences 28, 349-362. BRAGLEY, S. G.; EQUIST, W. & SCHRIBNER, H. E. (1978). Heterogeneity among deoxyribonucleotide sequences of Actinomycetales. In: Genetics of Actinomycetales, pp. 207-224. Edited by E. Freerksen, I. Tarnok & J. H. Thunin Stuttgart: Gustav V Fischer Vertag. BREED, R. S.; MURRAY, E. G. D. & HITCHENS, A. P. (1948). Bergey's Manual of Determinative Bacteriology, 6th Edition. The Williams and Wilkins Co., Baltimore. BREED, R. S.; MURRAY, E. G. D. & SMITH, N. R. (1957). Bergey's Manual of Determinative Bacteriology, 6th Edition. The Williams and Wilkins Co., Baltimore. BRENNAN, P. J. (1984). In: Microbiology 1994 (Lieve, L. & Sclessinger, D. eds.), pp.366-375 ASM Press, Washington, D. C. BRENNAN, P. J. (1989). Structure of Mycobacteria: Recent developments in defining cell wall carbohydrates and proteins. Review of Infectious Diseases II, S420- S430. BRENNER, D. J., McWHORTER, A.C., LEETE-KNUTSON, J. K. & STEIGERWALT, A. G. (1982). Escherichia vulneris: A new species of Enterobacteriaceae associated with human wounds. J.Clin. Microbiol. 15: 1133-1140. BRITTEN, R. J., GRAHAM, D. E. & NEUFELD, B. R. (1974). Analysis of repeating DNA sequences by reassociation. Methods Enzymol. 29: 363-408. BROSIUS, J.; PALMER, J. L.; KENNEDY, J. P. & NOLLER, H. F. (1978). Complete nuclcolide sequence of a 16S ribosomal RNA gene from Escherichia coli. 137 Proceedings of the national Academy of Sciences of the United Stales of America 75: 4801-4805: BfcOUSSEAU, R.;' SAINT-ONGE,; PREFONTAINE, G.; MASSON, L. & CABANA, J. (1993). Arbitrary primer polymerase chain reaction, a powerful method to identify Baccilus thuringiensis serovars and strains. Applied & Environmental Microbiology 59; 114-119. BROWN, A. G. (1986). Clavulanic acid, a novel beta-lactamase inhibitor-a case studyin drug discovery and development. Drug Design & Delivey 1: 1-21. BUCHANAN, R. E. (1918). Studies in the classification and nomenclature of the bacteria. VIII. Subgroups and genera of the Actinomycetales. Journal of Bacteriology 3: 403-40O. BUTCHER, E. C. & PICKER, U. (1996). Lymphocyte homing and homeostatis. Science 272: 60-66. CAETANO-ANNOLES, G.; BASSAM, B. J. & GRESSHOFF, P. M. (1991). DNA amplification fingerprinting using very short arbitrary oligonucleotide primers. Biotechnology 9: 553-557. CANHOS, V. P.; MANFIO, G. P. & BLAINE, L. D. (1993). Software tools and databases for bacterial systematics and their dissemination via global networks. Antonie van Leeuwenhoek. 64: 205-229. CANTOR, C. R. (1990). Orchestrating the Human Genomic Project Science 248: 49-51. CAROTHERS, A. M., URLAUB, G., MUCHA, J., GRUNBERGER, D. & CHASIN, L. A. (1989). BioTechniques 7,494. CASTELLANI, A. & CHALMERS, A. J. (1919). Manual of Tropical Medicine, 3rd Edition. William, Wood and Co., New York. CASTELNUOVO, G. GUADIANO, A., MORELLINI, M, PENSO, G., ROSSI, C. (1960). Gli antigeni der microbatteri. Rendiconte dell Instituto Superiore de Sanita, Roma 23: 1222-1233. CHAMOISEAU, G. (1969). De l'etiologie du farcin de zebus tchadiens. Nocardiose ou mycobacteriose? I. Etude bacteriologique et biochemique. Revue d'elevage et de Medicine Veterinaire des pays Tropicaux 22:195-204. CHAMOISEAU, G. (1972). De 1'etiologie du farcin de zebus tchadiens Nocardiose ou mycobacteriose? I. Activite amidasique. Revue d'Elevage et de Medicine Veterinaire des pays Tropicaux 25,191-194. CHAMOISEAU, G. (1973). Mycohacterium farcinogenes agent,causal du farcin de boeuf en-Afrique. Annals de Microbiologie de I 'Institut Pasteur (Paris) 124A, 215- 222. 138 CHAMOiSEAU, G. (1974). Mycobacteriumfarcinogenes agent c,ausal du farcin du boeuf en Afrique. Revue d'Eelevage et de Medicine Veterinaire des pays tropicaux 27, 61-65. CHAMOISEAU, G. (1979). Etiology of farcy in African bovines: Nomenclature of causal organisms Mycobacterium farcinogenes Chamoiseau and Mycobacterium senegalen.se (Chamoiseau) comb. Nov. International Journal of Systematic Bacteriology 29; 407-410. CHAMOISEAU, G. & ASSELLINEAU, J. (1970). Eamen des lipides d1 une Souche de nocardia farcinica: Presence d' acides mycoloques. Compte rendu hebdomadaire des Seances de I'Academie des Sciences 270D, 2603-2604. * CHAMPOMIER, M. C, MNTEL, M. C, GRIMONT, F. & GRIMONT P. A. D. (1987). Genomic identification of meat lactobacilli as Lactobacillussake. Ann. Inst. Pasteur Microbiol. 138: 751 -758. CHAPARAS, D., BROWN, T.M. & HYMAN, I. S. (1978). Antigenic relationships of various mycobacterial species with Mycobacterium tuberculosis. American Review of Respiratory Diseases. 117: 1091-1097. CHAPA11AS, D. (1981). Antigenic Relationships among Mycobacterial species studied by Modified-Rocket and Crossed Immunoelectrophoresis. Reviews of Infectious Diseases. 3:934-943. CHAPARAS, D. (1982). The immunology of mycobacterial infections. Crit. Rev. Microbiol. 9:139-197. CHEN, K. Y. & SEEBURG, P. H. (1985). DNA 4 165. CHEN, A., EDGAR, D. B. & TRELA, J. M. (1976). Deoxyribonucleic acid polymerase from the extreme thermophile Thermus aquaticus. J. Bacteriol. 127: 1550- 1557. CHENG, W. C. & TALMAGE, D. W. (1969). The reaction of immunoglobulin- coated bentonite and radioiodinated antigen as a basis for antibody detection and antigen binding. Journal of Immunology 103: 1385. CHIODtNI, R. J. (1990). Characterisation of Mycobacterium paratuberculosis and organisms of the Mycobacterium avium complex by restriction polymorphism of the rRNA gene region. Journal of Clinical Microbiology 28:489-494. CHUN, J. & GOODFELLOW, M. (1995). A phylogenetic analysis of the genus Nocardia with 16S rRNA gene sequences. International Journal of Systematic Bacteriology 45: 240-245. CHUN, J. (1995). Computer-assisted classification and identification of actinomycetes. Ph.D. Thesis, Department of Microbiology, University of Newcastle upon Tyi»e (UK). 139 CHUN, J. KANG, S.-O.; HAH, Y. C; & GOODFELLOW, M. (1996). Phylogeny of mycolic acid-containing actinomycetes. Journal of Industrial Microbiology 17: 205-213. * CILIA, V.; LAFAY, B. & CHRISTEN, R. (1996). Sequence heterogeneities among 16S rRNA sequences and their effect on phylogenetic analyses at the species level. Molecular Biology and Evolution 13:451-461. CLARK!,, S. D., RITCHIE, D. A. & WILLIAMS, S. T. (1993). Ribosomal DNA restriction fragment analysis of some closely related Streptomyces species. J. System. Appl. Microbiol. 16, 256-260. COLLINS, F.M. & MacKNESS, G. B. (1968). Delayed hypersensitivity and Arthus reactivity in relation to host resistance in Salmonella-infected mice. Journal of Immunology. 101:830. COLLINS, M. D. (1984). DNA restriction endonuclease analysis of Mycobacterium tuberculosis and Mycobacterium bovis BCG. Journal of Clinical Microbiology 130; 1019-1021, COLLINS, M. D. (1985). DNA restriction endonuclease analysis of Mycobacterium bovis and other members of the tuberculosis complex. Journal of Clinical Microbiology 21; 562-564. COLLINS, M. D. & JONES, D. (1981). Distribution of isoprenoid quinone structural types in bacteria and their taxonomic implications. Microbiological Reviews 45: 316-354. COLLINS, M. D. (1994). Isoprenoid quinones. In: Chemical methods in prokaryotic, systematic pp. 265-309. Edited by Goodfellow, M. & O'Donnell, A. G. John Wiley & Sons, Chichester. COLLINS, M. D.; BURTON, R. A. & JONES, D. (1988). Corynebacterium amycolatnm sp. nov. a new mycolic acid-less Corynebacterium species from human skin. FEMS Microbiology Letters 49; 349-352. COLLINS, M. D.; PIROUZ, T.; GOODFELLOW, M.; MINNKKIN, D. E. (1977). Distribution of menoquinones in actinomycetes and Corynebacteria. Joournal of General Microbiology 100,221-230. COLLINS, M. D.; SMIDA, J.; DORSCH, M. & STACKEBRANDT, E. (1988). Tsukamwella gen. nov. harboring Corynebacterium pawometabolum and Rhodococcus aurantiacus. International Journal of Systematic Bacteriology 38, 385- 391. COLWELL, R. R. & MANDEL, M. (1964). Adonsotiian analysis and deoxyribonucleic acid base composition of some Gram-negativfe bacteria. Journal of Bacteriology 87: 1412-1422. 140 COLWELL, R. R. (1970). Polyphasic taxonomy of bacteria. In Culture Collections of Microorganisms, pp. 421-336. Edited by Iizuka, H. & Hasegawa, T. University Park Press, Baltimore. CRAWFORD, J. T. & BATES, J. H.(1985). Phagetyping of Mycobacterium avium- intrcellulare scrofulaceum complex. American Review of Respiratory Diseases 132: 386-389. CRAWFORD, J. T. & BATES, J. H. (1985). Analysis of plasmids in M. avium- intracellulare isolates from persons with acquired immunodeficiency syndrome (AIDS). American Review of respiratory Diseases 134:659-661. CROWLE, A. J. (1962). Factors which affect induction of delayed hypersensitivity to protein antigens in mice. Journal of Allergy 33:458. CROWLE, A. J. & HU, C. C. (1965). Attempts to induce early-iype (Jones-Mote) delayed hypersensitivity in mice. Journal of Immunology 95:834. CROWTMER, R. C. & McCARTHY, C. M. (1986). Guanine plus cystosine content of the Mycobacterium avium complex and other mycobacteria by high performance liquid chiomatography analysis of deoxynucleotides. Current Microbiology 13: 307- 311. CUMMINS, C. S. & HARRIS, H. (1958). Studies on the cell wall composition and taxonomy of actinomycetales and related group. Journal of General Microbiology 18: 173-189. DA COSTA CRUZ, J. C. (1938). Mycobacterium fortuitum novo bacillo acidoresisiance pathogenicico para o homen. Acta Medica, Rio de Janiero 1: 297-301. DAFFE, M.; LANEELLE, M. A.; ASSELINEAU, C; LEVY-FREBAULT, V. & DAVID, H. (1983). Interet taxonomique des acides gras des mycobacteries: proposition d' une methde d' analyse. Annales de microbiologie (Institut, Pasteur) 134B, 241-256. DAFFE, M.; LACAVE, C; LANEELLE, M. A. & LANEELLE, G. (1987). Structure of the major triglycosyl phenol-phthiocerol of Mycobacterium tuberculosis (strain Canetti). European Journal of Biochemistry 167,155-160. DAMS, E.; HENDRIKS, L.; VAN DE PEER, Y.; NEEFS, J.-M.; SMITHS, G.; VANDENKEMPT, J. 7 DE WACHTER, R. (1988).Compilation of small ribosomal subunit RNA sequences. Nucleic Acid Research 16: r87-rl75. DAWSOf^, D. J. & JENNIS, F. (1980). Mycobacteria with a growth requirement for ferric ammonium citrate, identified as Mycobacterium haemophilum. Journal of Clinical Microbiology 11; 190-192. DAYHOI-F, M. O.; ECK, R. V.; CHANG, M. A. & SOCHARD, M. R. (1965). Atlas of protein sequence and structure. Silver Spring. MD: national Biomedical Research Foundation. 141 DANIEL, T. M. & FERGUSON, L. E. (1970). Purification and characterization of two protein from culture filtrates of Mycobacterium tuberculosis H37 Ra strain. Infect. Immun. 1:164. DAVID, H. L.; JAHAN, M.; JUMEN, E.H. (1978). Numerical taxonomy analysis of Mycobacterium africanum. International Journal of Systematic bacteriology 28, 464-472. DAVIDSON, W. H. T.; SLANEY, S. & WRAGG, A. L. (1954). A Novel Method for Identification of polymers. Chemistry and Industry 1356. DE BOER, L.; DIJKHUIZEN, L.; GROBBEN, G.; GOODFELLOW, M.; STACKEBRANDT, E.; PARLETT, J. H.; WHITEHEAD, D. & WITT, D. (1990). Amycolatopsis methanolica sp. nov., a facultatively methylotrophic actinomyeete. International journal of Systematic Bacteriology 40:194-204. DE BUYSER, M. L., MORVAN, A., GRIMONT, F. & ELSOLH, N. (1989). Characterization of Staphylococcus species by ribosomal RNA gene restriction patterns. Journal of Gen. Microbiology 135: 989-999. DE LEYV J. (1970). Molecular techniques and application in bacterial taxonomy. In. The Actinomycetales, pp. 317-327. Edited by Prauser, H. Veb Gustav Fisher Verlag, Jena. DE RIJK, P.; VAN DE PEER, Y. DE WACHTER, R. (1997). Database on the structure of large ribosomal subunit RNA. Nucleic Acid Research 25: 117-122. DE SMEDT, J. & DE LEY, J. (1977). Intra-and intergeneric similarities of Agrobacterium ribosomal ribonucleic acid cistrons. International Journal of Systematic Bacteriology 27: 222-240. DE SOETE, G. (1983). On the construction of the "optimal" phylogenetic trees. ZeitschriJt fur Naturforschung-Section C-Biosciences. 38; 156-158. DE ZOYSA, A.; EFSTRATIOU, A.; GEORGE, R. C; JAHKOLA, M.; VUOPIO-VARKILA, J.; DESHEVOI, S.; TSENEVA, G. & RIKUSHIN, Y. (1995). Molecular epidemiology of Corynebacterium diphtheriae from north western Russia and the surrounding countries studied by using ribotyping and pulsed-field gel electrophoresis. Journal of Clinical Microbiology 33: 1080-1083. DIENES, L. (1930). The first manifestation of developing hypersensitiveness. Proc. Soc. Exp. Biol.Med. 28: 75. DOBSON, G.; MINNIKIN, D. E.; MINNIKIN, S. M.; PARLETT, J. H.; GOODFELLOW, M.; RIDELL, M. & MAGNUSSON, M. (1985). Systematic analysis of complex Mycobacterial lipids. In Chemical Methods in Bacterial Systematics, pp. 265-237. Edited by M. Goodfellow & D. E. Minnikin. London Academic Press. * 142 DOMENECH, P.; MENENDEZ, M. C. & GRACIA, M. J. (1994). Restriction fragment length polymorphisms of 16S rRNA genes in the differentiation of fast- growing mycobacterial species. FEMS Microbiology Letters 116: 19-24. •? DRYDEN, S. G. & KAPLAN, S. (1990). Localization and structural analyses of the ribosomal RNA operons of Rhodococcus sphaeroides. Nucleic acids Research 18: 7267-7277. DRAPER, P. (1982). The Anatomy of mycobacteria. In: The Biology of Mycobacteria, pp. 9-52. Edited by Ratledge, C. & Standford, J.L. Academic Press London. DRAPER, P. (1989). Pathogenic mechanisms and immunology of mycobacteria. Current Opinions in Infectious Diseases 2, 796-803. DURO, G. IZZO, V. & BARBIERI, R. (1993). Methods for recovering nucleic acid fragments from agarose gel. J. Chromatogr. 618: 95-104. ELDER, J. K. & SOUTHERN, E.M. (1983). Measurement ofDNA length by gel electrophoresis II: Comparison of methods for relating mobility to fragment length. Analytical Biochemistry. 128: 227-231. EL-NASRI, M. H. (1961). Some observation on bovine farcy. The Veterinary Record 73, 370-372. EL-SANOUSI, S. M. & SALIH, M. A. M (1979). Miliary bovine farcy experimentally induced in a zebu calf. Veterinary Pathology 16, 372-373. EL-SAONUSI, S. M. & TAG EL-DIN, M. H. (1986). On the aetiology of bovine farcy in the Sudan. Journal of General Microbiology 132, 1673-1675. EL-SANONUSI, S. M.; TAG EL-DIN, M. H. & ABDEL WAHAB, S. M. (1977). Classification of bovine farcy organisms. Tropical Animal Health and Production. 9, 124. EL-SANOUSI, S. M.; SALIH, M. A. M.; MUSA, M. T.; TAG EL-DIN, M. H. & ALI, A. A. M. (1979). Further studies on the properties of the aetiology of bovine farcy isolated from Sudanese cattle. Revue d1 Elevage et de Medicine Veterinaire des pays Tropicaux 32, 13 5-141. EMBLY/T. M. & STACKEBRANDT, E. (1994). The molecular phylogeny and systematics of the actinomycetes. Annual Review of Microbiology 48: 257-289. EMBLY, T. M. & STACKEBRANDT, E. (1997). Species in practice: exploring uncultured prokaryote diversity in natural samples, in Species: the Units of Biodiversity, pp 61-81. Edited by Claridge, M. F. Dawah, h. A. & Wilson, M. R., Champan & Hall, London. 143 EMBLY, T. M. & WAIT, R. (1994), Structural lipids in Eubacteria. In Chemical Methods in prokaryotic systematic, pp 121-161. Edited by Goodfellow, M. & 6'Donnell, A. G. John Wiley Sons, Chichester. EPSTEIN, W. L. (1967). Granolomatous hypersensitivity. Progr. Allergy. 11.36. • ERLICH, H. A., MULLIS, K. & SAIKI, R. K. (1991). Preface: In: PCR Topics: Usage of PCR in Genetic and Infectious Dideases. A. Rolfs, H. C. Schumacker., P. Marx (Ed<;.)- ETEMADI, A. H. (1967). The use of gas chromatogrphy and mass spectroscopy in the study of the structure of mycolic acids. Journal of Gas Chromotagraphy 5,447- 456. EXMELIN, L.; MALBRUNY, B.; VERGNAUD, M.; PROVOST, F.; BOIRON, P. & MOREL, C. (1996). Molecular study of nocosomal nocardiosis outbreak involving heart transplant recipients. Journal of Clinical Microbiology. 34: 1014- 1016. EZAKI, T. & SUZUKI, S. (1982). Achromopeptidase for lysis of anaerobic Gram positive cocci. J. Clin. Microbiol. 16:844-846. FALKINIIAM, HI. J. O. (1996). Epidemiology of Infection by non-tuberculous Mycobaaeria. Clinical Microbiology Review 9: 177-215. FRANCE, A. J., McLEOD, D. T., CALDER, M. A. & SEATON, A. (1987). Mycobacterium malmoense infections in Scotland: an increasing problem. Thorax 42: 593-595. FRANC!;, A. J.; McLEOD, D. T.; CALDER, M. A. & SEATON. A. (1987). Mycobacierium malmoense infections in Scotland: An increasing problem. Thorax 42: 593-595. FRIES, J., PATEL, R., PIESSENS, W. & WIRTH, D. (1990). Genus-and species- specific DNA probes to identify mycobacteria using the polymerase chain reaction. Mol. Cell. Probes. 4:87-105. FROTHS NGHAM, R. & WILSON, K. H. (1993). Sequence-based differentiation of strains in the Mycobacterium avium complex. Journal of Bacteriology 175: 2818- 2825. FROTHiNGHAM, R. & WILSON, K. H. (1994). Molecular phytogeny of Mycobacierium avium complex demonstrates clinically meaningful divisions. Journal of Infectious Diseases 169:305-312. GARNIER, T.; CANARD, B. & COLE, S. T. (1991). Cloning , mapping, and molecular characterisation of the rRNA operons of Clostridium perfringem. Journal of Bacteriology 173: 5431 -5438. 144 GILMOUR, J. S. L. (1937). A taxonomic problem. Nature, 1040-1042. GIMPL, F. & LANYI, M. (1965). Use of the gel-precipitation method for determining the type of mycobacteria and the clinical diognosis. Bulletin of the International Union against Tuberculosis 36:22-25. GIOVANNONI, S. J., De LONG, E. F., OLSEN, G. J. & PACE, N. R. (1988a). Phylogenetic group-specific oligodeoxy nucleotide probes for the identification of single microbial cells. J. Bacteriol. 170:720-726. GOOD, R. C. (1991).The genus Mycobacterium-medical. In: The Prokaryotes, Volume H. pp.2016-2027.Editted by Starr, M. P., Stolp, H., Truper, H. G.^Balows, A., Schlegel, H. G. Springer Verlag, Berlin. GOODFELLOW, M. (1977). Numerical taxonomy. In CRC Handbook of Microbiology vol. 1. BacteriaBacteria, 2nd ed., pp. 579-597. Edited by A. I. Laskin & H. A. Lechevalier. Ohio: CRC Press. GOODFELLOW, M. & LECHEVALIER, M. P. (1989). The genus Nocardia Trevisan 1889, 9AL, In: Bergey 's Manual of Systematic Bacteriology, Vol. Pp. 2350- 2361. Edited by Williams, S. T.; Sharpe, M. E. & Holl, J. G. Williams and Wilkins, Baltimoore. GOODFELLOW, M. &MAGEE, J. (1997). Taxonomy of Mycobacteria, Mycobacteria, Volume I: Basic aspects. Edited by Gangadharam, P.; Jenkins, P. A.; Champhan & Hall, New York, in Press. GOODFELLOW, M. & MINNIKIN, D. E. (1977). Nocardioform bacteria. Annual Review of Microbiology 31:159-180. GOODFELLOW, M. (1991b). Identification of some mycoiic acid-containing actinomycetes using fluorogenic probes based on 7-amino-4-methylcoumarin and 4- methyllumbelliferone. Actinomycetologia 5,21-27. GOODFELLOW, M. & ALDERSON, G. (1977). The actinomycete genus Rhodococcus: A home for the "rhodococcus" complex. Journal of General Microbiology 100,99-122. GOODFSLLOW, M. & CROSS, T. (1984). Classification. In The Biology of Actinomycetes, pp. 7-164. Edited by M. Goodfellow, M. Mordarski & S. T. Williams. London: Academic Press. GOODFELLOW, M. & JAMES, A. L. (1994). Rapid enzyme tests in the characterisation and identification of micro-organisms. Edited by D. L. Hawksworth. Wallington: CAB International (in press). GOODFELLOW, M. O'DONNELL, A. G. (1993). Roots of Bacterial Systematics. In Handbook of New bacterial Systematics, pp. 3-54. Edited by M. Goodfellow & A. G. O'Donnell. London: Academic Press. 145 GOODFELLOW, M. & O'DONNELL, A. G. (1994). Chemosystematics: Current state and future prospects. In Chemical Methods in the Prokaryotic Systematics, pp. i-20. Edited by M. Goodfellow & A. G. O'Donnell. Chichester: John Wiley &, Sons. GOODFELLOW, M. & MINNIKIN, D. E. (1985). Chemical Methods in Bacterial Systematics. Academic Press, London. GOODFELLOW, M. & MINNIKIN, D. E. (1981b). Introduction to the Coryneform bacteria. In: The Prokaryotes, Volume II. pp. 1811-1826. Edited by Starr, M. P.; Stoip, H.; Triiper, H. G.; Balows, A. & Schlegel, H. G. Springer Verlag, Berlin. GOODFELLOW, M. & MINNIKIN, D. E. (1984). Circumscription of the genus. In: The Mycobacteria. A Sourcebook, pp. 1-24. Edited by Kubica, G. P. & Wayne, L. G., Marcei Dekker, New York. GOODFELLOW, M, O'DONNELL, A. G. (1994). Chemical Methods in prokaryotic systematics. John Wiley & Sons, Chichester (UK). GOODFF.LLOW, M. & PIROUZ, T. (1982). Numerical classification of sporoactintomycetes containing mesO-diaminopimelic acid in the cell wall. Journal of Applied Microbiology 128; 503-527. GOODFELLOW, M. & SIMPSON, K. E. (1987). Ecology of Streptomycetes. Frontiers in Applied Microbiology 2: 97-125. GOODFI.LLOW, M. & WAYNE, L. G. (1982). Taxonomy and Nomenclature. In: The Biology of Mycobacteria, pp. 471-521. Edited by Ratledge, C. <& Standford, J. L., Academic'Press, London. GOODFELLOW, M.; FLEMING, A. & SACKIN, M. J. (1972). Numerical classification of Mycobacterium rhodococcus and Runyon's Group IVMycobacteria. International Journal of Systematic Bacteriology 22, 81-98. GOODFELLOW, M. (1971). Numerical Taxonomy of nocardioform bacteria. Journal of General Microbiology 69; 33-80. GOODFELLOW, M. (1989). The Actinomycetes I. Suprageneiic classification of actinomycetes. In: Bergey's Manual of Systematic Bacteriology, pp. 2333-2339. Edited by Williams, S. T.; Sharp, M. E. & Holt, J. G., Vol. 4. Willians &> Wilkins, Baltimore. GOODFELLOW, M. (1992). The family Nocardiaceae. In: The Prokaryoles, vol. 2, 2nd edition. Edited by Balows, A.; Triiper, H. G.; Dworkin, M.; Hardier, W. & Schleifer, K. H., Springer-Verlag, New York. GOODFELLOW, M. (1997). The Actinomycetes: Actinomyces, Nocardia and related genera In: Nocardia and related genera. In; Topley and Williams Microbiology and Microbial Infections, 9thEd. vol. 2, Systematic Bacteriology. Edited by Balows, A. & Duweden, B. I. Edward Arnold, London. 146 GQODFELLOW, M. JONES, D. & PRIEST, F. G. (eds) (1985). Computer- Assisted Bacterial Systematics. Academic Press, London. GOODFELLOW, M.; WEAVER, C.R. & MINNIKIN, D. E. (1982b). Numerical classification of some Rhodococci, Corynebacteria and related organisms. Journal of General Microbiology 128: 731-745. GOODFELLOW, M.; BROWN, A. M.; CAI, J.; CHUN, J.; & COLLINS, M. D. (1997a). Amicolaptopsis japonicum sp. nov. an actinomycete producing (S,S)-N.N'- ethylenediaminedisuccinic acid. Systematic and Applied Microbiology 20; 78-84. GOODFELLOW, M; LIND, A.; MORDARSKA, H.; PATTYN, S. & TSUKAMURA, M. (1974). A co-operative numerical analysis of cultures considered to belong to the rhodococcus' taxon. Journal of general Microbiology 85,291-302. GOODFELLOW, M.; LONSDALE, C; JAMES, A. L. & MacNAMARA, O. C. (1987b). Rapid biochemical tests for the characterisation of streptomycetes. FEMS Microbiology Letters 43: 39-44. • t. GOODFELLOW, M.; MANFIO, G. P. & CHUN, J. (1997b). Towards a practical species concept for cultivatable bacteria. In: Species The Units of Biodiversity, pp. 25-59. Edited by Claridge, M. F.; Dawah, H. A. & Wilson, M. R. Champan & Hall. GOODFELLOW, M.; MINNIKIN, D. E.; TODD, C; ALDERSON, G.; MINNIKIN, S. M. & COLLINS, M. D. (1982b). Numerical and chemical classification of Nocardia amarae. Journal of General Microbiology 128, 1283-1297. GOODFELLOW, M.; STACKEBRANDT, E. & KROPPENSTEDT, R. M. (1988). Chemotaxonomy and actinomycete Systematics. In Biology of Actinomycetes, pp. 233-238. Edited by Y. Okani: Japan Scientific Societies Press. GOODFELLOW, M.; LACEY, J.; ATHALYTE, M.; EMBLEY, T. M. & BO WEN, T. (1989). Saccharopolyspora gregorii and Sacchatopolyspora hordei: Two new actinomycete species from fodder. Journal of General Microbiology 135, 2125-2139. GOODFELLOW, M.; ZAKRZEWWSKA-CZERWINSKA, J.; THOMAS, E. G.; MORDARSKI, M.; WARD, A. C. AND JAMES, A. L. (1991). Polyphasic taxonomic study of the genera Gordona and Tsukamurra including the description of tsukamurella wratislaviensis sp. nov. Zentralblatt fur Bakteriologie 275,162-178. GOODI ELLOW, M.; CHUN, J.; ATLAN, E. 7 SANGLIER, J. J. (1994). Curie- point pyrolysis mass spectrometry and its application to bacterial systematics. In Bacteria) Systematics and Diversity. Edited by F. G. Priest, A. Ramus Cormenzana & B. J. Tindall. Oxford: Plenum. GORDON, R. E. & MIHM, J. M. (1962a). The type species of (he genus Nocardia. Journal of General Microbiology 27, 1-10. 147 GORDON, R. E. & MIHM, J. M. (1962b). Identification of Nocardia caviae (Erikson) nov. comb. Annals of the New York Academy of Sciences 98: 628-636.. GORDON, R. E. (1967). The taxonomy of soil bacteria. In : The Ecology of Soil Bacteria, pp. 293-321. Editted by T. R. G. Gray & D. Parkinson. Liverpool: Liverpool University press. GOREN, M. B.; CERNICH, M. & BROKL, O. (1978). Some observations on mycobacterial acid-fastness. American Review of Respiratory Diseases 118; 151-154. GOTTLIEB, D. (1963). Recommendation for description of some acinomycetales appearing in patent applications. International Bulletin of Bacteriological Nomenclature and Taxonomy 13; 159-160. GOTTLIEB, P.; La FAUCI, G. & RUNDER, R. (1985). Alteration in the number of rRNA operons within the Bacillus subtilis genome Gene 33 :259-268. GRANGE, J. M. & STANFORD, J. L. (1974). Re-evaluation of Mycohacterium fortuitum (synonym Mycobacterium ranae). International Journal of Systematic bacteriology 24, 320-329. GRANGE, J. M. AND CLARK, K. (1977). Use of methylumbelliferone derivatives in the study of enzyme activities of mycobacteria. Journal of Clinical Pathology 30, 151-153. GRANGE, J. M. (1978). Fluorogenic assay of Mycobacterial group specific hydrolase enzymes. Journal of Clinical Pathology 31, 378-381. GRANGE, J. M.AND McINTYRE, G. (1979). Fluorogenic glycoside substrayes. Their use in the identification of some slowly-growing mycobacteria. Journal of Applied Bacteriology 47,285-288. GRAY, 1). (1993). Immunological memory. Ann. Rev. Immunol. 11:69-77. GREEN, E. P.; TIZARD, M. L. V; MOSS, M. T.; THOMPSON, J.; WINTERBOURNE, D. J.; McFADDEN, J. J. & HERMON-TAYLOR, J. (1989). Sequence: and characterisation of IS900, an insertion element identified in a human Crohn's disease isolate of Mycobacterium paratuberculosis. Nucleic Acid Research 17:9063-9073. GRIMONT, F. & GRIMONT, P. A. D. (1986). Ribosomal ribonucleic acid gene restriction patterns as potential taxonomicc tools. Annales de I'lnstitut Pasteur, Microbiologie 137B:165-175. GRIMONT, F. & GRIMONT, P. A. D. (1991). DNA fingerprinting. In: Nucleic Acid Technique in Bcaterial Systematics, pp. 249-279. Edited by Stackebrandt, E. & Goodfel low, M. John Wiley & Sons, Chichester. , GRIMONT, F.; VERGER, J. M.; CORNELIS, P.; LIMET, J.; LEFERVE, M.; GRAY( >N, M.; REGNAULT, B.; VAN BROEK, J. & GRIMONT, P. A. (1992). 148 Molecular typing of Bntcella with cloned DNA probes. Research in Microbiology 143: 55-65. K ' ••' ' GROSS, W. M. & WAYNE, L. G. (1970). Nucleic acid homology in the genus Mycobacterium. Journal of Bacteriology 104; 630-634. GUERRANT, G. O.; LAMBERT, M. A. & MOSS, C. W. (1981). Gas chromatographic analysis of mycolic acid cleavage products in Mycobacteria. Journal of Clinical microbiology 13, 899-907. GUERRERO, C; BERNASCONI, C; BURKI, D.; BODMER, T. & TELENTI, A. (1995). IS1245: a novel insertion element of Mycobacterium avium is a specific marker for analysis of strain relatedness. Journal of Clinical Microbiology ^33:304- 307. GURTLER, V. & STAISSICH, V. A. (1996). New approach to typing and identification of bacteria using 16S-23S rDNA spacer region. Microbiology 42; 3-16. HACKEL, C; HOUARD, S.; PORTAELS, F.; VAN ELSEN, A.; HERZOG, A. & BOLLEN, A. (1990). Specific identification of Mycobacterium leprae by the polymera.se chain reaction. Molecular and Cellular Probes. 4:205-210. HAIN, T.; WARD-RAINEY, N.; KROPPENSTEDT, R. M.; STACKEBRANDT, E. & RAINEY, F. A. (1997). Discrimination of Streptomyce? alhidoflavus strains based on the size and number of 16s-23S ribosomal DNA intergenic spacers.RRRRR 47: 202-206. HAMID, M. E.; MINNIKIN, D. E.; GOODFELOW, M. & RIDELL, M. (1993a). Thin layer chromatographic analysis of glycolipids and mycolic acids from Mycobacterium senegalense, and related taxa. Zentralblatt fur Bakteriologie 279: 354- 367. ; HAMID, M. E.; MINNIKIN, D. E.; GOODFELOW, M. & RIDELL, M. (1993a)..; FRASER, J. L.; WALLACE, P. A.; BESRA, G. S.; MINNIKIN, D. E.; GOODFELOW, M. & RIDELL, M. (1993b). Antigenic glycolpids of Mycobaciehum fortuitum based on trehalose acylated with 2-methyloctadec-2-enoic acid. Lett. Appl. Microbiol. 16:132-135: HAMID,' M. E. & GOODFELLOW, M. (1995). Rapid growth and increased biomass yield of Mycobacterium farcinogenes and some related taxa in broth and agar media. J. Vet. Med. 42: 397-404. HANCOCK, C. R. (1994). Analysis of cell wall constituents of Gram positive bacteria. In Chemical Methods in Prokaryotic Systematics, pp. 68-84. Edited by M.Goodfellow & A. G. O'Donnell. Chichester: John Wiley & Sons. HANKER, J. S. AND RABIN, A. N. (1975). Colour reaction streak test for catalase- positive microorganisms. Journal of Clinical Microbiology 2; 463-464. HANSE'N, G. A. (1880). Bacillus leprae. Virchov's Archieves 79: 32-42. . 149 HARTMANN, S.; BESRA, G. S.; FRASER, J. L.; KONIG, W. A.; MINNIKIN, D. E. & RIDELL, M. (1994). Stereochemistry of 2,4-dimethyleicos-2 enoate from the pyruvylated glycolipid of Mycobacterium smegmatis. Biochimica & Biophysica Acta (in press). HARTMANN, S. DE BONT, J. (1991). The genus Mycobacterium-non medical. In The Prokaryotes. A handbook on the Biology of Bacteria: Ecophysiology, Isolation, Identification, Applications, 2nd ed., pp. 1214-1237. Edited by A. Balovvs, H. G. Truper, M. Dworkin, W. harder, & K. H. Schleifer. New York: Springer-Verlag. HAUN, G. & GOEBEL, U. (1987). dligonucleotide probes for genus species - specific identification of representatives of the genus Proteus. FEMS Microbiol. Lett. 43:187-193. HEINONEN, T.Y.; SCHNARE, M. N. & GRAY, M. W. (1990). Sequence heterogeneityin the duplicate large subunit ribosomal RNA genes of Tetrahymena pyriformis mitocondrial DNA. Journal of Biological Chemistry 265; 22336-22341. HELLS FROM, K. E. & IIELLSTROM, I. (1969). Cellular immunity against tumour itntigens. Adv. Cancer Res. 12,167. . IIELLYKR, T. J.; BROWN, I.N.; DALE, J. W. & EASMON, C. S. (1991). Plasmid analysis of Mycobacterium avium-intracellulare (MAI) is plated in UK from patients with and without AIDS. Journal of Medical Microbiology 34: 225-231. HERBERMAN, R. B. (1974). Cell-mediated immunity to tumour cells. Adv. Cancer lies. 19,207. HIRSCH, C. F. & SIGMUND, J. M. (1995). Use of polymerase chain reaction (PCR) fingerprinting to differentiate bacteria for microbial product screening. Journal of Industrial Microbiology 15: 85-93. HOFFNER, S. E.; HJELM, U & KALLENNIUS, G. (1993). Susceptibility of Mycobacterium malmoense to antibacterial drug and drug combinations. Antimicrobial Agents and Chemotheraphy 37: 1285-1288. HOHM, B. & COLLINS, J. (1980). A small cosmid for efficient cloning of large DNA fragments. Gene 11: 291-298. HOUANG, E.; LOVETT, I. S.; THOMPSON, F. D.; HARRISON, A. R.; JOEKES, M. A. & GOODFELLOW, M. (198O). Nocardia asteroides infection a transmissible disease. Journal of Hospital Infection 1: 31-40. HUMBLE, N. W.; KING, A. AND PHILLIPS, I. (1977). API-ZYMJ A simple rapid system for the detection of bacterial enzymes. Journal of Clinical Pathology 30275-277. 150 HUNTER, S. W.; FUJIWARA, T. & BRENNAN, P. J. (1982). Structure and antigenicily of the major specific glycolipid antigen of Mycobacterium leprae. Journal of Biological Chemistry 257,15072-15078. HUNTER, S. W.; MURPHY, R. C; CLAY, K.; GOREN, M. B. & BRENNAN, P. J. (1983). Trehalose-containinglipooligosaccharides. A new class of species-specific antigens from Mycobacterium. Journal of Biological Chemistry 258,10481-10487. 1MAEDA, T.; BROSLAWSKI, G. & IMAEDA, S. (1988). Genomic relatedness among mucobacterial species by nonisotopic blot hybridization. International Journal of Systematic Bacteriology 38: 151-156. INGRAM, C. W.; TANNER, D. C; DURACK, D. T.; KERNODIE. Jr. G. W. & COREY, G. R. (1993). Disseminated infection with rapidly-growing mycobacteria. Clinical Infections Diseases 16: 463-471. INNIS, M. A., MYAMBO, K. B., GELFAND, D. H. & BROW, M. A. D. (1988). DNA sequencing with Thermus aquaticus DNA polymerase and direct sequencing of polymerase chain reaction-amplified DNA. Proc. Natl. Acad. Sci. USA. 85:9436- 9440. JACCARD, P. (1908). Nouvelle researches sur la distribution florale. Bulletin de la Societe vaudoise Science Naturelle 44,223-270. JAMES, A. L. (1993). Enzymes in taxonomy and diagnostic bacteriology. In; Goodfellow, M. and O'Donnell, A. G. (ed.), In: Chemical Methods in Prokaryotes, John Wiley and Sons Ltd., Chichester, UK. JAMES, A. L. (1994). Enzymes in taxonomy in Diagnostic Bacteriology. Chemical Methods in Prokaryotic Systematics, pp. 471-491. Edited by M. Goodfellow & G. O'Donnell. Chichester: John Wiley & Sons Press. * JAMES, A. L. & YEOMAN, P. (1987). Detection of specific bacterial enzymes by high contrast metal chelate formation. Part 1 8-Hydroxyquinoline-B-glucuronide, an alternative to aesculin in the differentiation of Enterobacteriaceae. Zentralbaltt fur bakteriologie, mikrbiologie und Hygiene 267,188-193. JAMES, A. L.& YEOMAN, P. (1988). Detection of specific bacterial enzymes by high conirast metal chelate formation. Part II. Specific detection ofEscherchia coli on multipoint-inoculated plates using 8-hydroxyquinoline-B-glucuronide. Zentralbaltt fur Bakteriologie, Mikrobiologie und Hygiene 267,316-321. JAMES, A. L.; YEOMAN, R.; RASBURN, J. W. & ZIG, M. (1986). Sensitive reagents for detection of indole production by bacteria. Zentralblatt fur Bakteriologie A262; 195-202. JAMES, S. L., CORREA-OLIVEIRA, R. & LEONARD, E. J. (1984). Ineffective vaccine-induced immunity to Schistosoma mansoni in P strain mice. 11 Analysis of cellular Responses. J. Amer. Assoc. of Immunologists 133: 1587-1593. 151 JANIKI, B. W., WRIGHT, G. L., Jr. GOOD, R. C, CHAPARAS, S. D. (1976). Comparison of antigens in sonic and pressure cell extracts of Mycobacterium tuberculosis. Infect. Immun. 13:425-437. JANSSEN, P.; COOPMAN, R.; HUYS, G.; SWINGS, J.; BLLEKER, M.; VOS, P.; ZABEAU, M. & KERSTERS, K. (1996). Evaluation of the DNA fingerprinting method, amplification fragment length polymorphism (AFLP) as a new tool in bacterial laxonomy. Microbiology 142: 1881-1893. JENKINS, P. A.; MARKS, J. & SCHAEFER, W. B. (1971). Lipid chromatography and seroagglutination in the classification of rapidly growing mycobacteria. American Journal oí Respiratory Diseases 103,170-187. „ * JENKINS, P. A.; MARKS, J. & SCHAEFER, W. B. (1972). Thin layer chromatography of mycobacterial lipids as an aid to classification. The scotochromogenic mycobacteria, including Mycobacterium scrofulaceum, M. xenopi, M. aquae, M. gordonae and M. flavescenes. Tubercle 53: 118-127. JENSEN, H. L. (1930). Actinomycetes in Danish soils. Soil Science30: 59-77. JHY-JHU, L., KUO, J. & MA, J. (1996). A PCR-based DNA fingerprinting technique: AFLP for molecular typing of bacteria. Nucleic Acids Res. 24:3649-3650. JI, Y. E.; COLSTON, M. J. & COX, R. A. (1994a). Nucleotide sequence and secondary structures of precursor 16S rRNA of slow-growing mycobacteria. Microbiology 140: 123-132. JI, Y. E.; COLSTON, M. J. & COX, R. A. (1994b). Ribosomal RNA (rm) opérons of fast-growing mycobacteria: Primary and secondary structures and their relations to rm opérons of pathogenic slow growers. Microbiology 140:2829-2840. JOHNSON, J. L. (1985). DNA reasssociation and RNA hybridization of bacterial nucleic acids. Methods Microbiol. 18:33-74. JOHNSON, J. L. (1991). DNA reassociation experiments: In Nucleic Acid Techniques in Bacterial Systematics, pp. 21-44. Edited by Stackebrandt, E. & Goodfellow, M. John Wiley & Sons, New York. JOHNSON, J. L. (1995). Isolation and purification of Nucleic acids. In: PCR Topics: Usage of PCR in Genetic and Infectious Diseases. (Eds.), A. Rolls, H. C. Schumacher 7 P. Marx. Pp 1-19. JONES, D. & SACKIN, M. J. (1980). Numerical methods in the classification and identification of bacteria with especial reference to the Enterobacteriaceae. In. Microbiological Classification and Identification, pp. 73-106. Edited by M. Goodfellow & R. G. Board. London; Academic Press. JONES, L. A. & BRADLEY, S. G. (1964). Phenetic classification of actinomycetes. Developments in industrial Microbiology 5,267-272. » 152 JU, J., RUAN, C, FULLER, C. W., GLAZER, A. N. & MATHIES, R. (1995). Proc. Natl. Ac«d. SgL USA. 92,4347. JUDICIAL COMMISSION (1954). Opinion 13. Conservation and rejection of names of genera of bacteria proposed by Trevisan 1842-1890. International Bulletin of Bacteriology, Nomenclature and Taxonomy 4,151-156. JUDICIAL COMMISSION (1954). Opinion 58. Confirmation of the types in the Approved Lists as nomenclature types including recognition of Nocardia asteroides (Eppinger, 1891 ;Blanchard 1896) and Pasteurella multicida (Lehmann and Neimann, 1899; Rosenbush and Merchant 1939) as a respective type species of the genera Nocardia and Pasteurella and rejection of the species names Pasteurella gallicida (Burril, 1883; Bushanan,1925). International Journal of Systematic Bacteriology 35, 538-540. » JUKES, T. H. & CANTOR, C. R. (1969). Evaluation of protein molecules. In Mammalian protein metabolism, pp. 21-132. Edited by Munro, H. N., vol. 3. Academic Press, New York. KAMPFER, P.; RAUHOFF, O. & DOTT, W. (191b). Glycosidase profiles of members of the family Enterobacteriaceae. Journal of Clinical Microbiology 29, 2877-2879. KANAUJIA, G. V.; KATOCH, V. M.; SHIVANNAVAR, C. T.; SHARMA, V. D. & PATIL, M. (1991). Rapid characterisation of Mycobacterium fortuitum-chelonae complex by restriction fragment length polymorphism of ribosomal RNA genes. FEMS Letters 77: 205-208. KANETSUNA, F. & BARTOLI, A. (1972). A simple chemical method to differentiate Mycobacterium from Nocardia. Journal of General Microbiology 70, 209-212. KARLSON, A. G & LESSEL, E. F. (1970). Mycobacterium bovis nom. nov. International Journal of Systematic Bacteriology 20: 273-282. KARRASEVA, V.; WEISZFEILER, J. & KRASZNAY,E. (1965). Occurrence of atypical mycobacteria in macacus rhesus. Acta Microbiologica Academiae scientarum Hungaricae 12: 275-282. KAUPP1NEN, J,; MANTYJARVI, R. J. & KATILA, M. L. (1994). Random amplified polymorphic DNA genotyping of Mycobacterium malmdense 32: 1827-182. KAUPP3NEN, J., PELKONEN, J. & KATILA, M. L. (1994). RFLP analysis of Mycobacterium malmoense strains using ribosomal RNA gene probes: An additional tool to examine intraspecies variation. Journal of Microbiological Methods. 19:261- 267. KESTLE, D. G.; ABBOTT, V. D. & KUBICA, G. P. (1967). Differential identification of mycobacteria. II. Subgroups of groups II and III (Ruayon) with different clinical significance. American Review of Respiratory diseases 95: 1041- 1052. 153 KILPPER,-BLAZ, R. (1991). DNA-rRNA hybridization. In: Nucleic Acid Techniques in Bacterial Systematics, pp. 45-68. Edited by Stackebrandt, E. & Goodfellow, M. John Wiley & Sons, New York. KIM, D., CHUN, J., SAHIN, N., HAH, Y. C. & GOODFELLOW, M. (1996). Analysis of thermophilic clades within the genus Streptomyces by 16SrDNA sequence comparisons. Ntemational Journal of systematic Bacteriology 46:581-587. KIRSCHNER, P.; TESKE, A.; SCHRODER, K. H.; KROPPENSTEDT, R. M.; WOLTERS, J. & BOTTGER, E. C. (1992). Mycobacterium alvei sp. nov. International Journal of Systematic Bacteriology 42,257-162. KIRSCHNER, P.; SPRINGER, B.; VOGEL, U.; MEIER, A.; WREDE, A.; KIENKENBE C.K., M.; BANGE, F. C. & B0TTGER, E. C. (1993). Genotypic identification of mycobacteria by nucleic acid sequence determination: report of a 2- year experience in a clinical laboratory. Journal of Clinical Microbiology 13; 2882- 2889. KIRBY, K. S. (1957). A new method for the isolation of deoxyribonucleic acids: Evidence on the nature of bonds between deoxyribonucleic acids and protein. Journal of Biochemistry. 66:495-504. ) KIRBY, K. S. (1965). Isolation and characterisation of ribonucleic acids. Journal of Biochemistry.90: 266-269. KIRBY, S. K, FOF-CARTER, E. and GUES, M. (1967). Isolation of deoxyribonucleic acid and ribonucleic acid from bacteria. Journal of Biochemistry. 104:258-262. KLEESPIES, M.; KROPPOENSTEDT, R. M.; RAINEY, F. A.; WEBB, L. E.; STACKEBRANDT, E. (1996). Mycobacterium hodleri sp. nov., a new member"of the fast-growing mycobacteria capable of degrading polycyclic aromatic hydrocarbons. International Journal of Systematic Bacteriology 46: 683-687. KLIJN, N.; WEERKAMP, A. H. & de VOS, W. M. (1991). Identification of mesophilic lactic acid bacteria polymerase chain reaction-amplified variable regions of 16S rRNA and specific DNA probes. Applied and Environmental Microbiology 57: 3390-3393. KOCK, R, (1882). Die Aetiologie der Tuberculose, Berliner Klinische Wochenschrift 19:221-238. KOMAGATA, K. & SUZUKI, K-I. (1987). Lipid and cell wall analysis in bacterial systematics. Methods in Microbiology 19, 191 161-207. KOUKILA-KAIIKOLA, P.; SPRINGER, B.; BTTGER, E. R.; PAUMN, L.; JANTZEN, E. & KATILA, M. L. (1995).Mycobacteriumbramkri sp. nov. anew 154 potentail human pathogen. International Journal of Systematic Bacteriology 45; 549- 553. » _ KOZOLIC,C. B. (1995). Gel electrophoresisofDNA and Proteins; Recnt advances in theory and Practical applications: In: Molecular Biology: Current Innovations and Future trends. Part 1. Annette M. Griffin and Hugh G. Griffin (Eds.) pp 51-68. KRETZ, K. A. (1995). Thermal Cycle Sequencing: In: Molecular Biology-Current Innovations and Future Trends. Annette, M. Griffin and Hugh G. Griffin (eds). Part I pp25-37. KRIEG, N. R. (1988). Bacterial clssification an overview. Canadian Journal of Microbiology 34:536-540. KROPPENSTEDT, R. M. (1985). Fatty acid menaquinone analysis of actinomycetes and related organisms. In: Clinical Methods in Bacterial Systematics, pp. 173-199. Edited by Goodfellow, M. & Minnikin, D. E. 1st ed. Academic Press, London. KROPPENSTEDT, R. M. & KUTZNER, H. J. (1978). Biochemical taxonomy of some problem actinomycetes. InNocardiaandstreptomyces, pp. 125-133. Edited by Mordarski, M.; Kurylowicz, W. & Jeljaszewicz, J. Gustav Fischer VtSrlag, Stuttgat. KROPPENSTEDT, R. M.; STACKEBRANDT, E. & GOODFELLOW, M. (1990). Taxonomic revision of the actinomycetes genera Act'momadura and Microtetraspora. Systematic and Applied Microbiology 13: 148-160. KUBICA, G. P.; BAESS, I.; GORDON, R. E.; JENKINS, P. A.; KWAPINSKI, J. B. G.; McDURMONT, C; PATTYN, S. R.; SAITO, H.; S1LCOX, V. A.; STANFORD, J. L.; TAKEYA, K. & TSUKAMURA, M. (1972). A co-operative numerical analysis of rapidly-growing mycobacteria. Journal of General Microbiology 73; 55-70. KUBICA, G. P., SILCOX, V. & HALL, E. (1973). Numerical taxonomy of Selected slowly-growing mycobacteria. Journal of general Microbiology 74: 159-167. LABEDA, D. P. & LYONS, A. J.. (1991b). DNA relatedness among species of Streptomyces cyaneus cluster. Systematic and Applied Microbiology 14:158-164. LABEDA, D. P. (1992). DNA-DNA hybridization in the systematics of Streptomyces. Gene 115:249-253. LAEMMLI, U. K. (1970). Nature (London) 227, 680-685. LAGRANGE, P. H., MACKNESS, G. B. & MILLER, T. E. 1974). Potentiation of T-cell mediated immunity by selective supression of antibody formation with cyclophosphamide. J. Exp. Med. 139,1529. 155 LAMBERT, M. A.; MOSS, C. W.; SILCOX, V. A. & GOOD, R. C. (1986). Analysis of mycolic acid cleavage products; cellular fatty acid cleavage products and cellular fatty acids of Mycobacterium species by capillary gas chromatography. Journal of Clinical Microbiology 23,731-736. LAMBIN,F. & FINE, J.M. (1979). Anal.Biochem. 98,160. LANDENGREN, U., KAISER, R., CASKEY, T. & HOOD, I. (1988). DNA diagnostic-molecular techniques and automatation. SCIENCE 242:229-237. LANE, D. J. (1991). 16S/23S rRNA sequencing. In: Nucleic Acid Techniques in Bacterial Systematics, pp. 115-175. Edited by Stackebrandt, E., Goodfellow M, John Wiley'& Sons, New York. LANE, D. J.; PACE, B.; OLSEN, G. J.; STAHL, D. A.; SOGIN, M. L. & PACE, N. R. (1985). Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proceedings of the national Academy of Sciences of the United States of America 82:6955-6959. LANEELLE, G.; ASSELINEAU, J. & CHAMOISEAU, G. (1971). Presence de myco.sides C" (formes simplfre de mycosides C) dans les bacte>ies isolees atteint du farcin. FEBS Letters 19: 109-111. LAURENT, F.; CARLOTTI, A.; BOIRON, P.; VILLARD, J. & FRENEY, J. (1996). Ribotyping a tool for taxonomy and identification of Nocardia aesteroides complex species. Journal of Clinical Microbiology 34; 1079-1082. LECHEVALIER, H. A. & LECHEVALIER M. P. (1970a). Chemical composition as a criterion in the classification of aerobic actinomycetes. International Journal of Systematic Bacteriology 20:435-443. LECHEVALIER, H. A. & LECHEVALIER, M. P. (1970b). A critical evaluation of the genera of aerobic actinomycetes. In: The Actinomycetales, pp. 393-405. Edited by Prauser, H. Veb. Gustav Fischer Verlag, Jena. LECHEVALIER, H. A.; SOLOTOROVSKY, M. & McDURMONT, C. I. (1961). A new genus of Actinomycetales; Micropolyspora gen. nov. Journal of General Microbiology 26: 11-18. LEOIEVALIER, M. P. (1976). The taxonomy of genus nocardia: Some light at the end of the tunnel? In: The Biology of the Nocardiae, pp. 1-38. Edited by Goodfellow, M.; Brownwell, G. H. & Serrano, J. A. Academic Press, London. LECHEVALIER, M. P.; De BIEVRE, C. & LECHEVALIER, H. A. (1977). Chemotaxonomy of aerobic actinomycetes: Phospholipid Composition. Biochemical Systeinatics & Ecology 5: 249-260. LECHEVALIER, M. P.; HORAN, A. C. & LECHEVALIER, II. A. (1971). Lipid composition in the classification of nocardia and mycobacteria. Journal of General Bacteriology 105: 313-318. • 156 LECHEVALIER, M. P.; STERN, A. E. & LECHEVALIER, H. A. (1981). Phospholipids in the taxonomy of actinomycetes, In: Actinomycetes, pp. 111-116. Edited by Schaal, K. P. & Pulver, G. Gustav Fischer Verlag, Stutgart. LEE, L. G., CONNELL, C. R., WOO, S. L., CHENG, R. D., McARDLE, B. F., FULLER, C. W., HALLORAN, N.D., & WILSON, R. K. (1992). Nucleic Acids Res. 20,2471. LEE, S. Y., CHOI, Y. (1997). A novel component of the TNFR and CD30-TRAF signalling complex that inhibits TRAF2-mediated NF-kB activation. J. Exp. Med. 185:1275-1286. LEHMANN, K. B. & NEUMANN, R. (1896). Atlas und Grundis der bakteriologie und Lehrbuch der speciellen bacteriologischen Diagnostik, 1st. Edition. LeJimann.J. F., München, Germany. LEHMANN, K. B. & NEUMANN, R. O. (1907). Lehmann's Medizin^ Handatlanten, X. Atlas und grundriss der bakteriologie und Lehrbuch der Speziellen bakteriologischen Diagnostik, 4 Aulf. Teil 2. pp. 1-730. München: J. F. Lehmann. LEOREY, E. H., WEISSMAN, I. L., WOOD, W.B., WILSON, J.H. (1984). The immune system recognises foreign substances by their molecular features. Immunology 1-46. LÉVY-FREBAULT, V.; GRIMONT, F.; GRIMONT, P. A. D. & DAVID, H. L. (1986). Deoxyribonucleic Acid relatedness study of the Mycohacterium fortuitum- Mycobacterium chelonae complex. International Journal of Systematic Bacteriology 36: 458-460. LÉVY-FREBAULT, V.; GRIMONT, F.; GRIMONT, P. A. I). & DAVID, H. L. (1984). Deoxyribonucleic Acid relatedness study of the Mycobacterium fallax. International Journal of Systematic Bacteriology. 34:423-425. LÉVY-FREBAULT, V.V. & PORTAELES, F. (1992). Proposed minimal standards for the genus Mycobacterium and for the description of new slowly-growing Mycobacterium species. International Journal of Systematic Bacteriology.42:315-323. LEVY-FREBAULT, V. V., THOREL, M. F., VARNEROT, A. & GICQUEL, B. (1989). DNA polymorphism in Mycobacterium paratuberculosis. 'wood pigeon mycobacteria and related mycobacteria analyzed by fi,pld inversion gel electîiophoresis. J. Clin. Microbiol. 27:2823-2826. LIESACK, W., PITULLE, C, SELA, S. & STACKEBRANDT, E. (1990). Nucleotide sequences of the 16SrRNA from Mycobacterium leprae. Nucleic Acids Res. 18:55-58. LIESACK, W., WEYLAND, H. & STACKEBRANDT, E. (19«>l).Potential risks of gene amplification by PCR as determined by 16SrDNA analysis of mixed-culture of strict barophilic bacteria. Methods in Microbiology 21:191 -198. 157 LIU, J., FUJIWARA, M., BUU, N. T., SANCHEZ, F.,CELLIER, M., PARADIS, A. J., FRAPPIER., D., SKAMENE, E., GROS, P., MORGAN, K., SHURR, E. (1995). Identification of polymorphisms and sequence variants in the human honolgue of the mouse natural resistance-associated macrophage protein gene. A,merican Journal of Human Genetics 56:845-853. LIEW, F. Y. (1977). Regulation of delayed-type hypersensitivity. I. T-suppressor cells for delayed-type hypersensitivity to sheep erytrocytes in mice. Eur. J. Immunol. 7, 714. LIND, A. OUCHETERLONY, O. & RIDELL, M. (1980). Mycobacterial antigens. Inrlnfektions krankheiten und ihre Erreger: Mykobakterien und mykobakterielle Krankheiten, Band 4, Teil 1, pp245-303. Editted by G. meissner & A. Schmiedel. Jena: Fischner Verlag. LIPKE, J. A., STRZEMPKO, M. N., RAIA, F. F., SIMON, S. L. & FRENCH, C. K. (1987). Isolation of intact high molecular weight DNA by using guanidine isothiocyanate. Appl. Environ. Microbiol. 53:2588-2589. LIQUIN, M. MARGARIT, L. COMDOM, M. J. & AUSSINA, V. (1987). Mycolic acid of Mycobacterium porcium. International Journal of Systematic Bacteriology 37: 75-77. LIQUIN, M.; AUSINA, V.; LOPEZ-CALAHORRA, F.; BELDA, F.; GARCIA BARCELO, M.; CELMA, C. & PRATS, G. (1991a). Evaluation of Practical Chromatographie Procedures for identification of clinical isolates of mycobacteria. Journal of Clinical Microbiology 29:120-130. LIQUIN, M.; LANÉELLE, M. A.; AUSINA, V.; GARCIA BARCELO, M.; BELDA, F.; ALONSO, C. & PRATS, G. (1991b). Distribution^ of a novel mycolic acid in species of the genus Mycobacterium. International Journal of Systematic Bacteriology 41: 390-394. LORÍAN, E. (1968). Differentiation of Mycobacterium tuberculosis and Runyon Group III strains on direct reading agar. American Review of Respiratoy Diseases 97:1133-1138. LOUGHNEY, K., LUND, E. & DAHLBERG, J. E. (1982). TRNA genes are found between 16S and 23 SrRNA genes in Bacillus subtulis. Nucleic Acids Res. 10:1607- 1624 LOWE, G. H. (1962). The rapid detection of lactose fermentation in paracolon organisms by the demonstration of ß-D-galactosidase. Journal of Medical laboratory Technology 19:21-23. LOCHT, J. S. & TOMPKINS, L. S. (1991). Restriction enzyme and southern hybridization analyses of Pseudomonas aeruginosa strains from patientswith cystic fibrosis. Journal Clin. Microbiol. 29:2897-2900. 158 Sequence databases. In: Molecular Microbial Ecology Mannual. Pp, 1-22 Akkermans, i.A. D.L., van Elsas J. D. & de Bruijn, F. J. Kluwer (eds) Academic Publishers Netherlands. • LUDWIG, W. & SCHLEIFER, K. H. (1994). Bacterialphylogeny based on 16S and 23SrRNA sequence analysis. FEMS Microbiology Reviews 15:155-173. LUDWIG, W., NEUMAIER, J., KLUGBAUER, N., BROCKMANN, E., ROLLER, C, JILG, S., LUDVIGSEN, A., BACHLEITNER, M., FISCHNER, U. & SCHLEIFER, K. H. (1993). Phylogenetic relationships of bacteria based on comparative sequence analysis of elongation factor Tu and ATP-synthase B-subunit genes. Antonie van Leeuwenhoek. International Journal of general and Molecular Microbiology 64:285-305. LUNGU, O., LATTA, P. D., WEITZMAN, I. & SILVERSTEIN S. (1994). Differentiation of Nocardia from rapidly growing Mycobacterium species by PCR- RFLP analysis. Diagnostic Microbiology & Infectious Diseases 18:13-18. MacüONELL, M. J. & COLWELL,RR. (1985). The contribution of numerical taxonomy to the Systematics of Gram-negative bacteria. In: Computer-Assisted bacterial Systematics, pp. 107-135. Edited by M. Goodfellow, D. Jones & F. G. Priest. Academic Press, London. « » * MacFADDIN, J. F. (1980). Biochemical tests for the Identification of medical bacteria (2nd Ed), Williams and Wilkins, Baltimore, M. D. USA. MacICANESS, G. B., LAGRANGE, P. H., & ISHIBASHI, T. (1974). The modifying effect of BCG on immunological induction of T-cells. J. Exp. Med. 139, 1540. MacKAY, C. R. (1993). Immunological memory. Adv. Immunol. 53:217-265. MADEN, B. E., DENT, C. L., FARRELL, T. E., GARDE, J., McCALLUM, F. S. & WAKEMAN, J. A. (1987). Clones of human ribososmal DNA containing the compílete 18SrRNA and 28SrRNA genes.Characterization, a detailed map of the humanribosomaltranscription unit and diversity among clones. Biochemical Journal 246:519-527. MADDOCKS, J. L. & GREEN, M. J. (1975). A rapid method for the identifying bacterial enzymes. Journal of Clinical Pathology 28; 686-687. MAGEE, J. G.; GOODFELLOW, M.; SISSON, P. R. & LIGHTFOOT, N. F. (1994). Differentiation of rapidly-growing non-chromogenic species of mycobacteria utilising pyrolysis mass spectrometry. Zentralblatt für Bactériologie (in press). MAGEE, J. T. (1993). Whole-organism fingerprinting. In: Handbook of New Bacterial Systematics, pp. 383-427. Edited by M. Goodfellow & A. G. O'Donnell. Academic Press, London. 159 MAGEE, J. T. (1994). Analytical fingerprinting methods. In: Chemical Methods in Prokaryotic Systematic, pp. 523-553. Edited by M. Goodfellow & A. G. O'Donnell. Chichester: John Wiley & Sons. MAGEE, J. T.; HINDMARCH, J. M. AND MEECHAN, D. F. (1983). Identification of Staphylococci by pyrolysis gas-liquid chromatography. Journal of Medical Microbiology 16:483-495. MAGNUSSON, M. (1976). Sensitin tests as an aid in the taxonomy of Nocardia and its pathogenicity. In; The Biology of the Nocardiae, pp. 236-265,. Edited by M. Goodfellow, G. H. Brownwell & J. A. Serrano. Academic Press, London. MAGNUSSON, M. AND MARIAT, F. (1968). Delineation of Nbcardia farcinica by delae MAIBAK, B. L., OLSEN, G. L., LARSEN, N., OVERBEEK, R., McCAUGHEY, M. J. & WOESE, C. R. (1997). The ribosomal database project. Nucleic Acids Res. 25:109-110. MALO, D., VOGAN, K., VIDAL, S., HU, J., CELLIER, M., SCHURR, E., FUKS, A., BUMSTEAD, N., MORGAN, K., GROSS, P. (1994). Halotype mapping and sequence analysis of the mouse Nramp gene predicts susceptibility to infection with intracelllular parasites. Genomics 23:51-61. MANAFI, M.; KNEIFEL, W. AND BASCOMB, S. (1991). Fluorogenic and chromogenic substrates used in bacterial diagnosis. Microbiological Reviews 55,335- 348. MANDEL, M. & MARMUR,J. (1968). Use of ultraviolet absorbance temperature profile for deterrmining the guanidine plus cytosine content of DNA. Methods in Enzymology 12:195-206. MANFIO, G. P., ZAKRZEWSKA-CZERWINSKA, J., ATALAN, E. & GOODFELLOW, M. (1995). Towards minimal standards for the description of Strepmyces species. Biotechnologica 78:242-252. MARCHOT, P. H.; AMANFU, W. & LEROY, P. L. (1989). Bovine farcy in the Accra plain of Ghana, Revue d'Elevage et de Medicine Veterinaire des pays Tropicaux. 42: 173-175. MARGOLIS, J. & KENRICH, K.G (1967). Nature (London) 214,1334. MARKS, J. & SZULGA, T. (1965). Thin-layer chromatography of mycobacterial lipids as an aid to clssification; technical procedures; Mycobacterium fortuitum. Tubercle 46:400-411. MARMUR, J. (1961). Procedures for the isolation of deoxyribonucleic acid from microorganisms. J. Mol. Biol. 3:208-218. 160 MARMUR, J. &DOTY, P. (1961). Thermal renaturation of DNA. Journal of Molecular Biology 3:585-594. ii MARMUR, J. &DOTY, P. (1962). Determination of the base composition of DNA from its thermal denaturation temperature. Journal of Molecular Biology 5:109-118. MATSIOTA-BERNARD, P., WASER, S., TASIOS, P.T., KYRIAKOPOULOS, A. & LEGAKIS, N. J. (1997). Rapid discrimination of Mycobacterium avium strains from AIDS patients by randomly amplified polymorphic DNA analysis. Journa of Clinical Microbiology 35:158-1588. MAYER, L. (1988). Use ofplasmid profiles in epideiologic surveillance of disease outbreaks and in tracing the transmission of antibiotic resistance. Clin. Micrbiol. Reviews 1:228-243. . • MANAFI, M.; KNEIFEL, W. AND BASCOMB, S. (1991). Fluorogenic and chromogenic substrates used in bacterial diagnosis. Microbiological Reviews 55,335- 348. McADAM, R. A., GUILHOT, C. & GICQUEL, B. (1994). Transposition in mycobacteria. In: Tuberculosis: pathogenesis, protection and control, pp 199-216. Bloom, B. R.(ed). American Society for Microbiology, Washington DC. MCCARTHY, A. J. & CROSS, T. (1984). A taxonomic study of ihermomospora and other monosporic actinomycetes. Journal of General Microbiology 130: 5-25. McFIE, H. J. H. & GUTTERIDGEi C. S. (1982). Comparative studies on some methods for handling quantitative data generated by analytical pyrolysis. Journal of Analytical and Applied Pyrolysis 4: 175-204. McLlvOD, R., BUSHMAN, E., ARBUCKLE, L. D., SKAMENE, E. (1995). Immiinogenetics in the analysis ofresistance to inyracellular pathogens. Curr. Opin. Immunol. 7:539-552. MEYER, K. AND SCHONFIELD, H. (1926). Ueber die Unterscheidung des Entercoccus vom Streptococcus viridans und die beziehungen beidur zum Streptococcus lactis. Centralblatt fUr Bakteriologie, Parasiteenkunde, Infektionskrankheiten und Hygiene, 1. Abtelung Orginale 99,402-418. MIDDENDORF, L.R., BRUCEJ.C, ECKLES, R. D., GRONE, D. L., ROEMER, S. C, SLONIKER, G. D., STEFFENS, D. Li, SUTLER, S. L., BRUMBAUGH, J. A. & PATONY, G. (1992). Electrophoresis. 13,487.1 MINNIKIN, D. E. & Goodfellow, M. (1980). Lipid composition in the classification and identification of acid-fast bacteria. In: Microbiological Classification and Identification, pp. 189-256. Edited by M. Goodfellow & R. G. Board. Academic Press, London. MINMKIN, D. E. & O'DONNELL, A. G. (1984). Actinomycete envelope lipid and peptidoglycan composition. In: The Biology of the Actinomycetes, pp. 337-388. Edited by M. Goodfellow, M. Mordarski and S. T. Williams. Academic Press: 161 London. MINNIKIN, D. E.; ALSHAMAONY, L. & GOODFELLOW, M. (1975). Differentiation of Mycobacterium, Nocardia and related taxa by thin-layer chroniatographic analysis of whole organism methanolysates. Journal of General Microbiology 88:200-204. MINNIKIN, D. E.; HUTCHINSON, I. G.; CALDICOTT, A. B. & GOODFELLOW, M. (1980). Thin-layer chromatography of methanolysates of mycolic acid-containing bacteria. Journal of Chromatography 188: 221-233. MINNIKIN, D. E.; MINNIKIN, S. M.; GOODFELLOW, M. & STANDFORD, J. L. (1982). The mycolic acids of Mycobacterium chelonae. Journal of General Microbiology 128; 8176-822. MINNIKIN, D. E.; MINNIKIN, S. M.; HUTCHINSON, I. G.; GOODFELLOW, M. & GRANGE, J. M. (1984a). Mycolic acid patterns of representative strain of Mycobacterium fortuitum, "Mycobacterium peregrinum" and Mycobacterium smegmatis. Journal of General Microbiology 130; 363-367. MINNIKIN, D. E.; MINNIKIN, S. M.; O'DONNELL, A. G. & GOODFELLOW, M. (1984b). Extraction of mycobacterial mycolic acids and other long-chain compounds by Alkaline Methanolysis Procedure, Journal of Microbiological Methods 2; 243-249. MINNIKIN, D. E.; MINNIKIN, S. M.; GOODFELLOW, M. & MAGNUSSON, M. (1984c). Mycolic acid patterns of some species of Mycobacterium. Archives of Microbiology 139: 225-231. MINNIKIN, D. E.; MINNIKIN, S. M.; PARLETT, J. H. 7 GOODFELLOW, M. (1985b). Mycolic acid patterns of some rapidly-growing species of mycobacteria. Zentralblatt fur Bakteriologie und Hygiene A 259; 446-460. • MOHAN, K. (1985). Mycobacterium senegalense from bovines in Eastern Nigeria. Journal of Bacteriology 59; 277-281. MOORE, M. &FRERICHS, J. B. (1953). An unusual acid-fast infection of the knee with subcutaneous abscess-like lesions of the gluteal region. Journal of Investigative Dermatology 20; 133-169. MORDARSKA, H.; MORDARSKI, M. & GOODFELLOW, M. (1972). Chemotaxonomic characters and classification of some nocardiofonn bacteria. Journal of General Microbiology 71: 77-86. MOROARSKA, M.; GOODFELLOW, M. ; SCHAAL, K.P.; TKACZ, A.; PULVERER, G.;. AND. (1980). Ribosomal ribonucleic acid similarities in the classification of Rhodococcus and related taxa. Journal of General Microbiology 118:313-319. 162 MpRDARSKA, M.; $CHAAL, K.P.; TKACZ, A.; PULVERER, G.; SZYBA, K. AND GOODFELLOW, 1VL (1978). Deoxyribonucleic acid base composition and homology studies on*Nocardia. Zentralbaltt fr Bakteriologie, Parasitenkunde Infektionskrankheiten und hygiene. 1. Abteilung, Supplement 6: 43-51. MORRIS, C. W. & BODDY, L. (1992). Intelligent computing in Microbiology. Binary 4: 185-188. MOSS, M. T.; MALIK, Z. P.; TIZARD, M. L.; GREEN, E. P. ; SANDERSON, J. D.; HERMON-TAYLOR, J. (1992). IS902, an insertion element of the chronic- entritis causing Mycobacterium avium subspecies silvaticum. Journal of General Microbiology 138:139-145. MOSTAFA, I. E. (1962). Studies on cattle nocardiosis (bovine farcy) in the Sudan. Sudan Journal of Veterinary Science and Animal Husbandry 7:1-9. MOSTAFA, I. E. (1966). Bovine nocardiosis (cattle farcy); A review. The Veterinary Bulletin 36: 189-193. MOSTAFA, I, E. (1967a). Studies on bovine farcy in the Sudan I. Pathology of the disease. Journal of Comparative Pathology 77:223-229. » MOSTAFA, I. E. (1967b). Studies on bovine farcy in the Sudan. II. Mycology of the disease. Journal of Comparative pathology 77: 231-237. MOSTAFA, I. E. (1967c). The relationship between bovine farcy and tuberculosis. The Veterinary Record. 79: 74-75. MUFTIC, M. (1967). Application of chromogenic substrates to the determination of peptidases in mycobacteria. Folia Microbiologica 12: 500-507. MULLÍS, K. B. & FALOONA, F. A. (1987). Specific synthesis of DNA in vitro via a polymerase chain reaction. Methods in Enzymology 155:335-350. MUNOZ, J. (1967). Immediate hypersensitivity reactions induced in mice*by active and passive means. Journal of Immunology 98:638. MURRAY, R. G. E.; BRENNER, D. J.; COLWELL, R. R.; De Vos P.; GOODFELLOW, M.; GRIMONT, P. A. D.; PFENNING, N. P.; STACKEBRANDT, E. & ZAVARZIN,G. A. (1990). Repon of ad hoc committee on approaches to taxonomy within the Proteobacteria. Intenational Journal of Systematic Bacteriology 40; 213-215. MVI.VA<;ANAM, S. SI DKNNIS, P. l\ (I9<)2). Sn|ucme lielnoj'.rnHly lu ¡wein» Ilic two ¡-cues encoding 1(>S iKNA from (he halophilic arehaebaeleiuim Ilalouiciilaiiiaris morlui. Genetics 130:399-410. NAKAYAMA, Y. NAKAYAMA, H. & TAKEYA, K. (1970). Studies on relationship between Mycobacterium fortuitum and Mycobacterium runyonii. Amei ¡can Review of Respiratory Disease 101: 558-568. 163 NEI, M. (1987). Molecular evolutionary Genetics. Columbia University Press, New York; NIE, N. H.; HULL, C. H.; JENKINS, J. G.; STEINBRENNER, K. & BENT, D. H., eds. (1975). Statistical package for the Social Sciences (SPSS), 2nd ed. New York: McGraw-Hill. NIENET, B.; MONOD, M.; EMLER, S.; PAWLOWSI, J.; METRAL, C; RO1INE, P.; AUCKENTHALER, R. & HIRSCHEL, B. (1996). Two different rRNA genes in a mycobacterial strains. Journal of Clinical Microbiology 34: 2531- 2536. i) NOCARD, E. (1888). Note sur la maladie de boeufs dela Guadeloupe cnnue sous le non de farcin. Annales de 1'Institut Pasteur, Paris 2: 293-302. NOLAN, R. D. & CROSS, E. (1988). Isolation and screening of actinomycetes. In: Actinomycetes in biotechology, pp. 1-32. Editted by Goodfellow, M.; williams, S. T. & Mordarski, M. Academic Press, London. O'BRIEN, M. AND DAVIS, G. H. G. (1982). Enzymatic profile of Pseudomonas maltophila. Journal of Clinical Microbiology 16:417-421. O'BRIEN, M. & COLWLL, R. R. (1987). Characterisation tests for numerical taxonomic studies. Methods in Microbiology 19: 69-104. » O'DONNELL, A. G.; FALCONER, C; GOODFELLOW, M. WARD, A. C. & WILLIAMS, E. (1994). Biosystematics and diversity amongst novel carboxydotropic actinomycetes. Antonie van Leeuwenhoek (in Press). OCHI, K. & MIYADOH, S. (1992). Polyacrylamide gel electrophoresis analysis of ribosomal protein AT-L30 from an actinomycete genus Streptosporangium. International Journal of Systematic Bacteriology 42:151-155. OLSEN, C. E. M.; MARTIN,C. S. & BRONSTEIN, I. (1988).Biotechniquesl5, 480. ORCHARD, V. A. & GOODFELLOW, M. (1980). Numerical classification of some named strains of Nocardia asteroides and related isolates from the soil. Journal of General Microbiology 118; 295-312. ORCHARD, V. A.; GOODFELLOW, M. & WILLIAMS, S. T. (1977). Selective isolaiion and occurrence of nocardia in the soil. Soil Biology and Biochemistry 9: 233-238. OTTEY, T. W. & MADDOCK, J. (1986). The use of pyrolysis mass spectrometry. Laboratory practice, October, 53-55. OWEN,R. J.; COSTAS, M.; DAWSON, C. (1989). Application of different chromosomal DNA restriction digest fingerprints to specific and subspecific 164 identification of Campylobacter isolates. Journal of Clinical Microbiology. 27:2338- 2343. OYEKUNLE, M. A. & OJO, M. O. (1988). Preliminary observation on bovine cutaneous nocardiosis and dermatophilosis in sub-humid climate of Nigeiia. Revue d'Elevage et de Medicine Veterinaire des Pays Tropicaux 41:347-357. PAGE, R. D. M. (1996). TREEVIEW: An application to display phylogenetic trees on personal computers in the Biosiences 12:357-358. PAL1TTAPONGARNIPM, P.; CHOMIC, S.; FANNING, A. & KUNN1MOTO, D. (1993). DNA fragment length polymorphism analysis of Mycobacterium tuberculosis isolates by arbitrarily primed polymerase chain reaction. Journal of Infeciious Diseases 167:975-978. PARK, Y. H.; SUZUKI, K. I.; YIM,D. G.; LEE, K. C; KIM, E.; YOON, J.; KIM, S.; KHO, Y. H.; GOODFELLOW, M. & KOMAGATA, K. (1993). Suprageneric classification of peptidoglycan groupB actinomycetes by nucleotide sequencing of 5SrRNA. Antonie van Leeuwenhock International Journal of general and Molecular Microbiology 64:307-313. PATTYN, S. R.; MAGNUSSON, M.; STANDFORD, J. L. & GRANGE, J. M. (1974). A study of mycobacterium fortuitum (renae). Journal of medical Microbiology 7; 67-76. PENSO, G. & ORTALI, V.(1949). Studie recerche sui microhatteri. Nota II. I fagi dei microbatteri. Rendiconte dell' Instituto Sueriore de Sanita,Roma. 12:903-918. PERFEZAT, A.; DESTOMBES, P. & MARIAT, F. (1967). Etude histopathologigue de la nocardiose du boeuf ou Tchad et caracteres biochemiques de Nocardia farcinica. Revue d'Elevage et de medicine Veterinaire des Pays Tropicaux 20: 429-435. PIER, A. E. & FICHTNER, R. E. (1971). Serologic typing of Nocardia asteroides by immunodiffusion. American Review of Respiratory Diseses 103; 698-707. PITCHER, D. G.; SAUNDERS, N. A. & OWEN, R. J. (1989). Rapid extraction of bacterial genomic DNA with guanidium thiocynate. Letters in Applied Microbiology 8;151-156. PITI1LLE, C; DORSCH, M.; KAZDA, J.; WALTER, J. & STACKEBRANDT, E. (1992). Phylogeny of rapidly-growing members of geflus Mycobacterium. Intenlational Journal of Systematic Bacteriology 42; 337-343. PLIKAYTIS, B. B.; BUTLER, W. R.; WOODLEY, C. L,; SILCOX, V. A. & SHINNICK, T. M. (1992). Differentiation of slowly growing Mycobacterium species, including Mycobacteriumtuberculosis, by gene amplification and restriction fragment length polymorphism analysis. Journal of Clinical Microbiology 30: 1815- 1822. 165 PORTAELS, F.; DAWSGN, D. J.; LARSSON, L. & RIGOUTS, L. (1993). Biochemical properties and fatty acid composition of Mycobacterium haemophilum. Study of 16 isolates from Australian patients. Journal of Clinical Microbiology 31: 26-30. PORTAELS, F.; FONTEYNE, P. A.; De BEENHOUWER, H.; De RIJIK, P.; GUEDENON, A.; HAYMAN, J. & MEYERS, W. M. (1996). Variability in 3' end of 16SrRNA sequence of Mycobacteriumulcerans is related to geographic origin of isolates. Journal of Clinical Microbiology 34:962-965. PRAUSER, H. (1981). Nocardioform organisms: General characterization and taxonomic relationships. Zentralblatt fur Bakteriologie, Mikrobiologie und hygiene, Supplement 1, 17-24 PRESS, W. H.,; FLANNERY, B. P.,; TEUKOLSKY, S.A. & VETTERLING, W. T. (1986). Numerical Recipes: The Art of Scientific Computing. Cambridge University Press. Cambridge. PRESSENT, D. H.; LINDNER, A. E. & JANOWIT,Z. (1966). Granulomatous diseases of the gastrointestinal tract. Ann. Rev. Med. 17:243. PRIEST, F. G. & WILLIAMS, S. T. (1993). Computer-assisted identification. In: Handbook of New Bacterial Systematics, pp. 361-382. Edited by M. Goodfellow & A. G. O'Donnell. London: Academic Press. PROBER, J. M.; TRAINOR, G. L.; DAM, R. J.; HOBBS, F. W.; ROBERTSON, C. W.; ZAGURSKY, R. J.; COCUZZA, A. J.; JENfeDA.; & BAUMEISTER, K. (1987). Science 238-336. PROMEGA CORPORATION (1995). Promega 1994/1995 Catalog: Biological Research Products. Promega Corporation, Madison. QIAGEN (1996). Tag DNA polymerase-QIAGEN brings innovation to PCR-QIAGEN News 5,2. PULVERER, G. & SCHAAL, K. P. (1978). Pathogenicity of Medically important aerobic actinomycetes. Zentralbaltt ftir Bakteriologie und hygiene. 1 Abteilung, Supplement 6: 417-427. PULVERER, G.; SCHUTT-GEROWITT, H. & SCHAAL, K. P. (1975). Bacteriophage of Nocardia aster oides. Medical microbiology and Immunology 161; 113-122. QIAGEN (1996). Tag DNA polymerase-QIAGEN brings innovation to PCR- QIAGEN News 5,2. QIAN, N. & SEJNOWSKI, T. S. (1988). Predicting the secondary structure of globular proteins using neural network models. Journal of Molecular Biology 202: 867-884. 166 RASTOGI, N. & DAVID, H. L. (1988). Mechanism of pathogenicity in mycobacteria. J. Biochemie 70:1101 -1120. RAUZIER, J.; MONIZ-PEREIRA, J. & GICQUEL-SANZEY, I*. (1988). Complete nucleotide sequence of pA15000, a plasmid from Mycobacterium fortuitum. Gene 71: 315-321. RAVIGLIONE, M.C.; SINDER, D.E. Jr. & KOCHI, A. (1995). Global epidemiology of tuberculosis. JAMA 273:220-226. RIDELL, M. (1975). Taxonomic study of Nocardia farcinica using serological and physiological characters. International Journal of Systematic Bacteriology 25; 124- 132. RIDELL, M. (1981). Immunodiffusion analysis of Mycobacterium farcinogenes, Mycobacterium senegalense and some other mycobacteria. Zentralbaltt fr bakteriologie, Parasitenkunde Infektionskrankheiten und Hygiene. 1. Abteilung, Supplement 11:235-241. RIDELL, M. (1981a). Immunudiffusion studies of Mycobacterium, Nocardia and Rhodococcus for taxonomical purposes. Zentralblatt fur Bakteriologie, Parasitenkunde, Infektionskrankheiten und Hygiene. (I. Abteilung), Supplement II, 235-241. « RIDLL, M. (1981b). Immunodiffusion studies of some Nocardia strains. Journal of General Microbiology 13,69-74. RIDELL, M. (1983). Immunodiffusion analysis of Mycobacterium farcinogenes, Mycobacterium senegalense and some other mycobacteria. Journal of General Bacteriology 129; 163-619. RIDELL, M. & GOODFELLOW, M. (1983). Numerical classification of Mycobacterium farcinogenes .and Mycobacterium senegaleme and related taxa. Journal of General Microbiology 129; 599-611. RIDELL, M. NORLIN, M. (1973). Serological study of Nocardia by using Mycobacterial precipitation reference systems. Journal of Bacteriology 113: 1-7. RIDELL, M.; GOODFELLOW, M. & ABDULLE, M. A. (1985). Identification of actinomycetes isolated from cases of bovine farcy in the Sudan. Zentralbaltt fiir Bakteriologie, Mikrobiologie und Hygiene A 259:43-50. RIDELL, M.; WALLERSTROM, G.; MINNIKIN, D. E.; BOLTOM, R. C. & MAGNUSSON, M. (1992). A comparative serological study of antigenic glycolipids from Mycobacterium tuberculosis. Tubercle and Lung diseases 73; 101-105. RIDELL, M.; MINNIKIN, D. E.; MINNIKIN, S. M. & IIUTCHINSON, I.G. (1982). Classification of Mycobacterium farcinogenes and Mycobacterium senegalenses by immunodiffusion and thin-layer chromatography of long chain components. Journal of General Microbiology 128; 1299-1307. 167 ROCOURT, J.; GRIMONT, F.; GRIMONT, P.A. D. & SEELIGER, H. P. R. (1982). DNA relatedness among serovars of Listeria monocytogenes. Current Miciobiol. 7: 383-388. ROGAL, T.; WOLTERS, J.; FOHR, T. & BOTTGER, E. (1990). Towards aphylogeny and definition of species at the molecular level within the genus Mycobacterium. International Journal of Systematic Bacteriology 40; 323-330. ROIZ, M. P.; PALENQUE, E.; GUERRRERO, C. & GARCIA, M. J. (1995). Use of restriction fragment length polymorphism as a genetic marker for typing Mycobacterium avium strains. Journal of Clinical Microbiology 33: 1389-1391. ROTT, L.S.; BRISKIN, M.J.; ANDREW, D. P.; BERG, E. L. & BUTCHER, E. C. (£996). A fundamental subdivision of circulating lymphocytes defined by adhesion to mucosal adhesion cell adhesion molecule-1. J. Immunol. 156: 3727-3736. ROSS, B. C; RAIOS, K.; JACKSON, K.; SIEVERS, A.. & DWYER, B. (1991). Differentiation of Mycobacterium tuberculosis strains by use of a nonradioactive Southern blot hybridization method. The Journal of Infectious Diseases 163:904-907. ROSENBLUM, B.B.; LEE, L. G.; SPURGEON, S. L,; KHAN, S. H.; MENCHEN, S. M.; HEINER, C. R. & CHEN, S. M. (1997). Nucl. Acids Res. 25, 4500. RUNYON, E. H. (1958). Mycobacteria encountered in clinical laboratories. Leprosy Briefs 9:21. RUNYON, E. H. (1959). Anonymous mycobacteria in pulmonary diseases. Medical Clinics of North America 43: 273-290. RUlsfYON, E. H. (1965). Pathogenic mycobacteria. Adv. Tuber. Res. 14: 235-287. RUNYON, E. H. (1972). Conservation of the specific epithet fortuitum in the name of crgansims known as Mycobacterium fortuitum (da Costa Cruz-requests for an opinion).International Journal of Systematic Bacteriology 22: 50-51. RUNYON, E. H.; WAYNE, L. G. & KUBICA, G. P. (1974). Genus Mycobacterium. In Bergey's Manual of Determinative Bacteriology, 8th ed., pp.682- 701. Edited by R. E. Buchnan & N. E. Gibbsons. Baltimore: Williams & Wilkins Co. RUSSEL, P. J.; DOENIAS, J. M. & RUSSEL, S.J. (1991). GELYMAC: a Macintosh application for calculating DNA fragment size from gel elctrophoresis migration data. CABIOS 7:265-266. RYCHLIK, W. & RHOADS, R. E. (1989). A computer program for choosing optimal oligonucleotides for filter hybridization, sequencing and in vitro amplification of DNA. Nucl. Acid Res. 17:8543-8551. 168 SACKIN, M. J. AND JONES, D. (1993). Computer-Assisted classification. In: Goodfellow, M. and O'Donnell/ A. G. (eds.), In: Handbook of New Bacterial Systematics, Academic Press London. SADDLER, G. S.; FALCONER, C. & SANGLIER, J. J. (1989). Preliminary experiments for the selection and identification ofactinomycetes by pyrolysis mass spectrometry. Actimycetologia 2: S3-S4. SAI1CI, R. K.; SCHARF, S.; FALOONA, F.; MULLIS, K. B.; HORN, G. T.; ERLICH, H. A. & ARNHEIM, N. (1985). Enzymatic amplification of the beta- globin genomic sequences and restriction site analysis for diagnosis of Sickle cell anaemia. Science. 230:1350-1354. SAIia, R. K.; GELFAND D. H.; STOFFEL, S.; SCHARF, S. J.; HUGUSHI, R; MULLIS, K. B.; HORN, G. T.; ERLICH, H. A. (1988a). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-494. • SALIH, M. A.; EL-SANOUSI, S. M. & TAG EL-DIN, M. H. (1978). Predilection sites of bovine farcy lesions in the Sudanese cattle. Bulletin of Animal Health and Production in Africa 26; 169-171. SALvlN, S. B. (1958). Occurrence of delayed hypersensitivity during the development of Arthus type hypersensitivity. Journal of Experimental Medicine 107:109-110. SAM BROOK, J.; FRITSCH, E. F. & MANIATIS, T. (1989). Molecular Cloning: a Laboratory manual. 2nd ed. Cold Spring Harbor laboratory Press, New York. SANGER, W. (1984). Principles of Nucleic Acid structure. Berlin: Springer-Verlag. SANGER, F.; NICKLEN, S. & COULSON, A. R. (1977). DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA. 74: 5463-5467. SANGLIER, J. J.; WHITEHEAD, D.; SADDLER, G. S.; FURGUSON, E. V. & GOODFELLOW, M. (1992). Pyrolysis mass spectrometry as a method for the classification and selection ofactinomycetes. Gene 115: 235-242. SAUNDERS, N. A.; HARRISON, T. G.; KACHWALLA, N. & TAYLOR, A. G. (1988). Identification of species of the genus Legionella using a cloned rRNA gene from Legionella pneumophila. Journal of General Microbiology 134:2363-2374. SCHAAL, K. P. (1985). Identification of clinically significawt actinomycetes and related bacteria using chemical techniques. In: Chemical Methods in Bacterial Systematics, pp. 359-381. Edited by M. Goodfellow & D. E. Minnikin. London: Academic Press. SCHAAL, K. P. & LEE, H-J. (1992). Actinomycete infections in humans: A Review. Gene. 115: 201-211. 169 SCHAAL, K. P. & REUTERSBERG, H. (1978). Numerical taxonomy of nocardia asteroides. Zentralbaltt fur Bakteriologie, parasitenkundelnfektionskrankheitenund Hygiene. 1. Abteilung, Supplement 6,53-62. SCHLEIFER, K. H.; LUDWIG, W. & AMANN, R. (1993). Nucleic acids probes. In; Handbook of new bacterial systematics, pp. 464-510. Edited by Goodfellow, M. & O'Donnell, A. G. Academic Press, London. SELLA, S.; CLARK-CURTIS, J. E. & BERCOVIER, H. (1989). Characterization and taxonomic implications of the rRNA genes of Mycobacterium leprae. J. Bacteriol. 171:70-73. SETO, N. & IIZUKA, H. (1970). Microbiological studies on petroleum and natural gas. XI. A new hydrocarbon-utilizing actinomycete. Journal of General and Applied Microbiology 16:127-135. SHEATER, A. L. (1920). Bovine lymphaginitis. Journal of Comparative Pathology and Theraphy 33,158-185. SHIGIDI, M. T. A.; MIRGHANI, T. & MUSA, M. T. (1980). Characterisation of Nocardia farcinica isolated from cattle with bovine farcy. Research in Veterinary Science 28,207-211. SHl.AES, D. M. & CURRIE-McCUMBER, C. A. (1986). Plasmid analysis in molecular epidemiology: a summary and future directions. Reviews of Infectious diseases. 8:738-746. SIERRA, G. (1957). A simple method for the detection of lipolytic activity of microorganisms and some observations on the influence of contact between cells and acid substrates. Antonie van Leeuwenhoek 23,15-22. SIGivIA CHEMICAL COMPANY (1994).Biochemicals organic compounds for research and diagnostic reagents. 1994. Ed. Sigma Chemical lompany Ltd., Poole UK.' SILVESTRI, L.; TURRI, M.; HILL, L.R. & GILARDI, E. (1962). A quantitative approach to the Systematics of Actinomycetales based on over all similarity. Symposia of the Society for General Microbiology 12,333-360. SLIFKIN, M. & GIL, G. M. (1983). Rapid biochemical tests for the identification of groups A, B, C, F and G streptococci from throat cultures. Journal of Clinical Microbiology 18,29-32.. SLGSAREK, M. (1980). Fluorescent method for testing the enzymic activity of mycobacteria. Folia Microbiol. (Prague) 25:439-441. , SMITH-VAUGHAN, H. C; SRIPRAKASH, K. S.; MATHEWS, J. D. & KEMP, D. J. (1995). Long PCR-ribotyping of nontypeable Haemophilus influenzae. Journal of Clinical Microbiology 33: 1192-1195. 170 SMITH, D. W.; RANDALL, H. M.; MacLANNAN, A. P.? PUTNEY, R. K. & RAO, S. V. (1960). Detection of specific lipids in mycobacteria by infrared spectroscopy. Journal of Bacteriology 79:217-229. SNEATH, P. H. A. & SOKAL, R. R. (1973). Numerical taxonomy: The Principles and Practice of Numerical Classification. San Francisco; W. H. Freeman. SNEATH, P. H. A. (1993). Evidence from Aeromonas for genetic crossing-over in ribosomal sequences. International Journal of Systematic Bacteriology 43:626-629. SNIPES, K. P.; HIRSH, D. C; KASTEN, R. W.; HANSEN, L. M.; HIRD, D. W.; CARPENTER, T. E. & McCAPES, R.H. (1989). Use of an rRNA probe and restriction endonuclease analysis to fingerprint Pasteurella multocida isolated from turkeys and wildlife. J. Clin. Microbiol. 27:1847-1853. SOINI, H. & VILJANEN, M.K. (1997). Diversity of the 32-kilodalton protein gene may form a basis for species determination of potentially pathogenic mycobacterial species. Journal of Clinical Microbiology 31: 769-773. SOINI, H. BOTTGER, E. C. & VILJANEN, M. K. (1994). Identification of mycobacteria by PCR-based sequence determination of the 32-kilodalton protein gene- Journal of Clinical Microbiolgy 31: 2944-2947. • SOKAL, R. R. & MICHENER, C. D. (1958). A statistical method for evaluating systematic relationships. Kansas University Science Bulletin 38; 1409-1438. SOKAL. R. R. & ROHLF, F. J. (1962). The comparison of dendrograms by objective methods. Taxon 11: 33-40. SOKAL, R. R. & SNEATH, P.H. A. (1963). Principles of Numerical Taxonomy. Freeman San Francisco. SOTO, A.; PITCHER, D. G. & SORIANO, F. (1991). A numerical analysis of ribososmal RNA gene patterns for typing clinical isolates of Corynebacterium group D2. Epidemiology and Infection 107: 263-272. SOUTHERN, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. Journal of Molecular Biology 98: 503-517. SPRENT, J. (1993). T and B memory cells. Cell 76: 315-322. SPRENT, J. & WEBB, S. R. (1995). Intrathymic and extrathymic clonal detection of T cells. Curr. Opin. Immunol. 7: 196-205. SRIVASTAVA, A. K. & SCHLESSINGER, D. (1990). Mechanism and regulation of bacterial ribosomal RNA processing. Annual Review of Microbiology 44:105- 129.!, 171 STACKEBRANDT, E. & GOODFELLOW, M. (1991). In: Nucleic Acid Techniques in Bacterial Systematic, pp. ix-xxix. Edited by E. Stackebrandt & M. Goodfellow. Chichester: John Wiley & Sons. STACKEBRANDT, E & LIESACK, W. (1993). Nucleic acids and classification. In: Handbook of New Bacterial Systematics, pp. 197-202. Edited by M. Goodfellow & A. G. O'Donell. London: Academic Press. STACKEBRANDT, E. & GOEBEL, B. M. (1994a). A place for DNA:DNA reassociation and 16SrRNA sequence analysis in the present species definition in bacteriology. International Journal of Systematic Bacteriology 44:846-849. STACKEBRANDT, E. & LUDWIG, W. (1994b). The importance of using out- group reference organisms in phylogenetic studies: the Atopobium case. Systematic and Applied Microbiology 17:39-43. STACKEBRANDT, E. & SMIDA, J. (1988). The phylogeny of the genus Mycobacterium as determined by the 16SrRNA sequences and development of DNA probes. In: Biology of Actinomycetes 88, pp244-250. Edited by Okami, Y.; Beppu, T & Ogawara, H., Japan Scientific Societies Press, Tokyo. STACKEBRANDT, E. & RAINEY, F. A. (1995). Partial and complete 16SrDNA sequences, their use in generation of 16SrDNA phylogenetic trees and their implications in molecular ecological studies. Pp, 1-17, In: Molecular Microbial Ecology Manual. Edited by Akkermans, A. D. 1.; van Elsas J. D. 7 de Bruijn, F. J. Kulwer Academic Publishers Netherlands. STACKEBRANDT, E. & RAINEY, F. A. & WARD-RAINEY, N. L.(1997). Proposal for a new hierachic classification system, Actinobacteria ciassis nov. International Journal of Systematic bacteriology 47:479-491. STACKEBRANDT, E.; LIESACK, W. & WITT, D. (1992). Ribosomal RNA and ribosomal DNA sequence analysis. Gene 115:255-260. STACKEBRANDT, E. & WOESE, C. R. (1981). Towards a phylogeny of the actinomycetes and related organisms. Current Microbiology 5:131-136. STACKEBRANDT, E.; WUNNER-FUSSL, B.; FOWLER, V.J. & SCHLEIFER, K. H. (1981). Dioxyribonucleic acid homologies and ribososrnal ribonucleic acid similarities among sporeforming members of the order Actinomycetales. International Journal of Systematic Bacteriology 31:420-431. STANFORD, J. L. & GUNTIIORPE, W. J. (1969). Serological and Bacteriological investigation of Mycobacterium ranae (fortuitum). Journal of Bacteriology 98: 375- 383. STANFORD, J. L.; GUNTHORPE, W. J.; PATTYN, S. It & PORTAELS, F. (1972). Studies on Mycobacterium chelonae. Journal of Medical Microbiology 5: 171-182. 172 ^STANFORD, J. L. & GRANGE, J. M. (1974). The meaning and the structure of species as applied to mycobacteria. Tubercle 55:143-152. STAHL, D.; KRUPP, G. & STACKEBRANDT, E. (1988). £NA sequencing. In: Nucleic Acid Sequencing: A partial Approach (Howe, C. J. and Ward, E. S., ed.), pp 137-183. Oxford and Washington, D. C: IRL. Press. STAHL, D. A. & URBANCE, J. W. (1990). The division between fast-and slow- growing species and corresponds to natural relationships among the mycobacteria. Journal of Bacteriology 172:116-124. SUZUKI, K.; GOODFELLOW, M. & O'DONNELL, A. G. (1993). Cell envelopes and classification. In: Handbook of New Bacterial Systematics, pp. 195-250. Edited by M Goodfellow & A. G. O'Donnell. London: Academic Press. SWAMINATHAN, B. & MATAR, G. M. (1993). Molecular typing methods. In: Diagnostic molecular microbiology, principles and applications, pp. 26-51. Edited by Persing, D. H.; Smith, T. F.; Tenover, F. C. & White, T. J. American Society for Microbiology, Washington D.C. SWAMPSON, D. S.; PAN,XI. & MUSSER, J. M. (1996). Identification and subspecific differentiation of Mycobacterium scrofulaceum by automated sequencing of a region of the gene (hsp6S) encoding a 65-kilodalton heat-shock protein. Journal of Clinical Microbiology 34:3151-3159. SWAMPSON, D. S.; KAPUR, V.; STOCKBAUER, K.; PAN XI.; FROTHINGHAM, R.; MUSSER, J. M. (1997). Sub-specific differentiation of Mycobaclerhim avium complex strains by automated sequencing of a region of the gene (hsp65) encoding a 65-kilodalton heat-shock protein. International Journal of Systematic Bacteriology 47:414-419. TABOR, S. & RICHARDSON, C. C. (1995). Proc. Natl. Acad. Sci. USA. 92,6539. TAKEWAKI, S.; OKUZUMI, K.; MANABE, I.; TANIMURA, M.; MIYAMURA, K.; TACQUET, A.; PLANCOT, M. T.; DEBRUYNE, Z.; DEVULDER, B.; JOSEPH, M. & LOSFIELD, J. (1971). Etudes preliminaires sur la classification numerique des mycobacteries et des nocardiae. Annales Institut Pasteur, Lille 22,121. TAKEWAKI, S.; OKUZUMI, K.; MANABE, I.; TANIMURA, M.; MIYAMURA, K.; NAKAHARA, K. I.; YAZAKI, Y.; OHKUBO, A. & NAGAI, R. (1994). Nucleotide sequence comparison of the mycobacterial dnaJ gene and PCR-restriction fragment length polymorphism analysis for identification of mycobacteria species. International Journal of Systematic Bacteriology 44: 159-166. TAMAOKA, J. (1994). Determination of DNA base composition. In: Chemical methods in prokaryotic systematics pp. 463-470. Edited by Goodfellow, M.& O'Donnel, A. G. JohnWiley & Sons Chichsester, UK. 173 TAMAOjCA, J. KOMAGATA, K. (1984). Determination of DNA base composition by jjpvese-phase high-performance liquid chromatography. FEMS Microbiology Letters. 25:125-128. • * • . • • ' i TELENTE, A.; MARCHESI, F.; BALZ, M.; BALLY, F.; BOTTGER, E.C. & BODMER, T. (1993). Rapid identification of mycobacteria to the species level by PCR amplification and restriction enzyme analysis. Journal of Clinical Microbiology 35:149-153. THOMPSON, J. & GILLESPIE, D. (1987). Molecular hybridization with RNA probes in concentrated solutions of guanidine thiocyanate. Anal. Biochem. 163:281- 291. TIMPE, A. & RUNYON, E. H. (1954). Relationship of "atypical" acid-fast mycobacteria to human disease. Journal of Laboratory and Clinical Medicine 44:202- 209. TITUS, D. E. (ed) (1991). Promega protocols and applications guide. 2nd ed. Promega Corporation, Madison. TOMIYASU, I. & YANO, I. (1984). Separation and analysis of novel polysaturated mycolic acids from a psychrophilic, acid-fast bacterium, Gordona aurantiacus. European Journal of Biochemistry 139: 173-180. TOWBIN, H. (1988). New developments in immunoblotting and associated detection systems. Biochemical Society Transactions 16;131-134. TOWNER, K. J. & COCKKAYNE, A. (1993). Molecular methods for microbial identification and typing, Chapman & Hall, UK. TREVISAN, V. (1889). I Generi ele Specie delle Bacteriacaee. Milano: Zanabonie Gabuzzi. Reproduced in: International Bulletin of Bacteriology, Nomenclature and Taxonomy 2 (1952) 13. TSANG, A. Y.; BARR, V. L.; McCLATCHY, J.K.; GOLDBERG, M.; DRUPA, I. & BRENNAN, P. J. (1984). Antigenic relationships of the Mycobacterium fortuitum-Mycobacterium chelonae complex. International Journal of Systematic Bacteriology 34: 35-44. TSUKAMURA, M. (1969). Numeriacal taxonomy of the genus Nocardia. Journal of General Microbiology 56: 265-287. Tsukamura, M. (1970). Differentiation between Mycobacteria abscesus and Mycobacterium borsteleme. American review of Respiratory Diseases 101: 426-428. TSUivAMURA, M. (1981). Numerical analysis of rapidly-growing nonphotochromogenic mycobacteria, including Mycobacterium agri (Tsukamura) Tsukamura sp. nov., nomen rev. International Journal of Systematic Bacteriology 31: 247-:;58. TSUKAMURA, M.; MIZUNO, S. & TSUKAMURA, S. (1968). Classification of 174 rapidly-growing mycobacteria. Japanese Journal of Microbiology 12; 151 -166. TSUKAMURA, M.; MIZUNO, S. & TSUKAMURA, S. (1969). Numerical classification of slowly-growing mycobacteria. American Review of Respiratory Diseases 99,299-303. TSUKAMURA, M,; MIZUNO, S.; TSUKAMURA, S. &TSUKAMURA, J. (1979). Comprehensive numerical classification of 369 strains of Mycobacterium, Rhodococcus and Nocardia. International Journal of Systematic Bacteriology 28,110- 129. TSUKAMURA, M.; SHIMOIDE, H.; KANEDA, K.; SAKA, R.&SEINO,A. (1988). A case of lung infection caused by an unusual strain of Nocardia farcinica. Microbiology and Immunology 32: 541-546. TSUZUKI, Y.; MIURA, S.; SUEMATSU, M.; KUROSE, L; SHIGEMATSU, T.; & ISHII, H. (1996). fl-4 integrin plays a critical role in early stages oft lymphocyetes migration in Peyer's patches of rats. Int. J. Immunol 8:287-295. UHR, J. W.; SALVIN, S. B.; & PAPPENHEIMER, Jr, A. M. (1957). Delayed hypersensitivity. II. Induction of hypersensitivity in guinea pigs by means of antigen- antibody complex. Journal of Experimental Medicine 105,11. ULLMANN, J. S. & MCCARTHY, C. M. (1973).The relationship between mismatched base pairs and the thermal stability of DNA duplexes. Biochemica et Biophsica Acta 294:416-424. VALLERO-GUILLEN, P.L.; MARTIN-LUENGO, F.; LARSSON, L. & JIMENZE, J. (1987). Demonstrations of 2-methyl branched chain fatty acids in some rapidlY-growing mycobacteria. FEMS Microbiology Letters 44: 303-305. VALSANGIACOMO, C; BAGGI, F.; GAIA, V.; BALMELLI, T.; PEDUZZI, R. & PIFFARETTI, J. C. (1995). Use of amplifed fragment length polymorphism in molecular typing of Legionella pneumophila and application to epidemiological studies. J. C. Microbiol. 33;1716-1719. • VANDEN-BERGHE, D. A. & PATTYN, S. R. (1979). Comparison of Mycobacterium fortuitum, Mycobacterium nonchromogenicum and Mycobacterium terrae using flat bed electrophoresis. J. General Microbiology 283-291. VANDAMME, P.; POT, B.; GILLIS, M.; de VOS, P.;KERSTERS, K. & SWINGS, J. (1996). Polyphasic taxonomy, a consensus approach to bacterial systematics. Microbiological Reviews 60:407-438. VAN DE PEER, Y.& De WACHTER, R. (1994). TREECO for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Computer Applications in the Biosciences. 10;569- 570. 175 VAUTERIN, L.; SWING, J. & KERSTERS, K. (1993). Protein electrophoresis and classification. In: handbook of new bacterial systematics, pp.251-280. Edited by Goodfellow, M. & O'Donnell, A. G. academic Press, London. VAUTERIN, L.; YOUNG, P. & SWING, J. (1996). Utilization of fatty acid methyl esters for the differentiation of new Xanthomonas species. International Journal of Systematic Bacteriology 46:298-304. VERGER, J. M.; GRIMONT, F.; GRIMONT, P. A.D. & GRAYON, M. (1987). Taxonomy of the genus Brucella. Ann. Inst. Pasteur Microbiol 138:235-238. VERISSIMO,; MORAIS, P. V.; DIOGO, A.; GOMES, C. & DA COSTA, M.S. (1996). Characterization of legionella species by numerical analysis of whole-cell protein electrophoresis. International Journal of Systematic Bacteriology 46:41-49. VERSALOVIC, J.; KOEUTH, T. & LUPSKI, J. R. (1993). Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res. 19:6823-6831. VIDAL, S.; MALO, D.; VOGAN, K.; SKAMENE, E. & GROS, P. (1993). Natural resistance to infection with intracellular parasites: isolation of candidate for BCG. Cell 73;469-486. VIDAL, S.; PINNER, E.; LEPAGE, P.; GUTHIER, S. & GROS, P. (1996). Natural resistance to intracellular infections: (Nrampl D169) mouse strains. Journal of Immunology 157:3559-3568. VINCENT, S. A.; GIBSON, J. L.; BROWNS, B. A.; ZHANG, Y.; WILSON, JR. W.; RAJAGOPALAN, M. & WALLACE, R. (1995). PCR amplification and restriction endonuclease analysis of a 65 kD heat shock protein gene sequence for taxonomic separation of rapidly growing mycobacteria. Journal of Clinical Microbiology 35:149-153. VINCENT, S. A.; WILSON, R. W.; GIBSON, J. L.; BROWNS, B. A.; JOST, K. C; BLACKLOCK, Z.; & WALLACE, R.(1997). Rapid identification of clinically significant species and taxa of aerobic actinomycetes, including Actinomadura, Gordona, Nocardia, Rhodococcus, Streptomyces and Tsukamurella isolates by DNA amplification and restriction endonuclease analysis. Journal of Clinical Microbiology 35;817:822. VON GRAEVENITZ, A. & BEGER, U. (1980). A plea for linguistic accuracy. International Journal of Systematic Bacteriology 30: 520. VOSS, H.; SCHWAGER, C; WIRKNER, U.; STROATA, B.; ZIMMERMANN, J.; ROSENTHAL, A.; ERFLE, H.; STEGMANN, J. 7 ANSORGE, W. (1989). Direct genomic fluorescent on-line sequencing using in vitro amplification of DNA. Nucl. Acids Res. 17:2517-2527. 176 . f VREDEVOE, D. L. (1964). The production and transfer of immune reactions to .bovine serum':albumin (BSA) in isogenic andallogenicmicell. Dermal reactivity. Journal of Immunology 92, 717. WAKSMAN, S.A. & HENRICI, A. T. (1943). The nomenclature and classification of the actinomycetes. Journal of Bacteriology 46;337-341. WALLACE, P. A.; MINNIKIN, D. E. & RIDELL, M. (1994). Synthesis and structure of 2,3-Di-O-acyl- tf,or-trehalose lipid antigen from Mycobacterium fortuitum. J. Chem. Soc. Chem. Commun. 329-330. WALLACE, R. J., Jr.; TSUKAMURA, M.; BROWN, B. A.; BROWN, J. M. STEINGRUDE, V. A.; ZHANG, T. & NASH, D. R. (1990). Cefotaxime resistant Nocardia asteroides strains are isolates of the controversial species Nbcardia farcinica. Journal of Clinical Microbiology 28; 2726-2732. WALLACE, R. J. Jr.; BROWN, B. A.; TSUKAMURA, M.; BROWN, J.M. & OHYI, G. O. (1991). Clinical and Laboratory features of Nocardia nova. Journal of Clinical Microbiology 29; 2407-2411. WARREN, K.S.; DOMINGO, E. O. & COWAN, R. B.T. (1967). Granulomatous formation as a manifestation of delayed hypersensitivity. Amer. Journal of Pathology 51,307. WATSON, J. D. (1990). The Human Genomic Project: Past, Present and Future Science, 248:44-49. WATSON, J. D.; HOPKINS, N. H.; ROBERTS, J. W.; STEITZ, J. A. & WEINER, A. M. (1987). Molecular Biology of the gene. Menlo Park, C. A: The Benjamin/Cunnings Publishing Co. WAYNE, L. G. (1966). Classification and Identification HI. Species within Group III. American Review of Respiratory Diseases 93: 919-928. WAYNE, L. G. & KUBICA, G. P. (1986). Genus mycobacterium Lehmann and Neumann 1896, 363 ALM. In Bergey 's Manual of Systematic Bacteriology, vol. 2, pp. 1436-1457. Edited by P. H. A. Sneath, N. S. Mair, M. E. Sharpe & J. G.Holt. Baltimore: Williams & Wilkins. WAYNE, L. G.; DIETZ, T. M.; GERNEZ-RIEUX, C; JENKINS, P. A.; KAPPLER, W.; KUBICA, G. P.; KWAPINSKI, J. B. G.$ MEISSNER, G.; PATTYN, S. R.; RUNYON, E. H.; SCHRODER, K. H.; SILCOX, V. A.; TACQUET, A.; TSUKAMURA, M. & WOLINSKY, E. (1971). A co-operative numerical analysis of scotochromogenic, slowly-growing mycobacteria. Journal of Genei al Microbiology 66: 255-271. WAYNE, L.G.; ENGBACK, H. C; ENGEL, H. W. B.; FROMAN, S.; GROSS, W.; HAWKINS, J.; KAPPLER, W.; KARLSO, A. G.; KLEEBERG, H. H.; KRASNOW, I.; KUBICA, G. P.; McDURMONT, C; NEIL. E. E.; PATTYN, S. R.; SCHRODER, K. H.; SHOWALTER, S.; TARNOK, I.; TSUKAMURA, M.; 177 fVERGMANN, Ifc & WOLINSKY? E. (1974). Highly reproducible techniques for use in Systematic* Bacteriology in genus Mycobacterium. Tests for pigment, urease, resistance to sodium chloride, hydrolysis of Tween 80 and B-galactosidase. International Journal of Systematic Bacteriology 24; 412-419. WAYNE, L. G.; ENGEL, H. W. B.; GRASSI, S.; GROSS, W.; HAW.KINS, J.; JENKINS, P. A.; KAPPLER, W.; KLEEBERG, H. H.; KRASNOW, I.; NEIL, E. E.; PATTYN, S. R.; RICHARD, P. A.; SHOWALTER, S-; SLOSAREK, M.; SZABO, I.; TARNOK, I.; TSUKAMURA, M.; VERGMANN, B. & WOLINSKI, E. (1976). Highly reproducible techniques for the use in Systematic Bacteriology 26; 311-318. WAYNE, L.G.; ANDRADE, L.; FROMAN, S.; KAPPLER, W.; KUBICA, E.; MEISSNER, G. & TSUKAMURA, M. (1978). A co-operative numerical analysis of Mycobacterium gastri, Mycobacterium kansassi and Mycobacterium marinum. Journal of General Microbiology 109: 319-327. WAYNE, L. G.; KRICHEVSKI, E. G.; LOVE, L. L.; JOHNSON, R. 7 KRICHEVSKI, M. I. (1980). Taxonomic probability matrix for use with slowly- growing mycobacteria. International Journal of Systematic Bacteriology 30: 528-538. WAYNE, L. G.; GOOD, R. G.; KRICHEVSKI, M. I.; BEAM, R. E.; BLACKLOCK, Z.; DAVID, H. L.; DAWSON, D.; GROSS, W.; HAWKINS, P. A.; JUHLIN, I.; KAPPLER, W.; KLEEBERG, H. H.; KRASNOW, I.; LEFf ORD, P. A.; RUSCH, S.; SCHRODER, K. H.; SILCOX, V. A.; SZABO, L.; TSUKAMURA, M.; VANDENBZEEN, L. & VERGMANN, B. (1983). Second report of the co-operative open-endedstudy of slowly-growing mycobacteria by the International Working Group on Mycobacterial taxonomy. International Journal of Systematic Bacteriology 33:265-274. WEINER, M.P.; GACKSTELLER, T.; COSTA,, G. L.; BAUER, J. C. & KRETZ, K. A. (1995). Recent Advances in PCR Methodology: In: Mol. Biology: Current Innovations and Future Trends. Annette M. Graffin & Hugh G. Griffin (eds). Horizon Scientific Press pp 11-14. WELLINGTON, E. M. H. & WILLIAMS, S. T. (1978). Preservation of actinorriycete inoclum in frozen glycerol. Microbiological Letters 6,151-159. WELSH, J. & McCLELLAND, M. (1990). Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Research 18:187213-7218. WILLIAMS, S. T.; GOODFELLOW, M.; ALDERSON, G.; WELLINGTON, E.M. H.; SNEATH, P. H. A. AND SACKIN, M. J. (1983). Numerical classification of Streptomyces and related genera. Journal of General Microbiology 129,1743-1813. WILLIAMS, J. G. K.; KUBELIK, A. R.; LIVAK, K. J.; RAFALSKI, J. A. & TINCEY, S. V. (1990). DNA polymorphisms amplified by tertiary primers are useful as genetic markers. Nucleic Acids Res. 18:6531-6535. WITS, D.; LIESACK, W. & STACKEBRANDT, E. (1990). Identification of 178 Streptomyciptes by 16S rRNA sequences and probes. In: Recent Advances in Microbioal Ecology.by Hatjorj, T.ylshida, Y., Maruyama, Y., Morita, R. and Uchida, A. (eds), pp 679-684. Tokyo: Japan Scientific Society Press. WOESE, C. R. (1987). Bacterial evolution. Microbiological reviews 51:221-271. WOLINSKY, E. (1979). Non-tuberculous mycobacteria and associated diseases. American Review of Respiratory Diseases 119:107-159. YAMADA, K. & KOMAGATA, K. (1970). Taxonomic studies of coryneform bacteria. III. DNA base composition of coryneform bacteria. J. Gen. Appl. Microbiol. 16:215-224. YANO, I.; IMEADA, T. & TSUKAMURA, M. (1990). Characterisation of Nocardia nova. International Journal of Systematic Bacteriology 40; 170-174. YASSIN, A. F.; BINDER, C. & SCHAAL, K. P. (1993a). Identification of mycobacterial isolates by thin-layer and capillary gas-chromatography under diagnostic routine conditions. Zentralbaltt fur bakteriologie 278,34-48. YOGEV, D.; HALACHAMI, D.; KENNY, G. E.; RAZIN, S. (1988). Distinction of species and strains of Mycoplasma (Molicutes) by genomic DNA fingerprints with an rRNA gene probe. J. Clin. Microbiol. 26, 1198-1201. YOUNG, D.; LATHIGRA, R.; HENDRIX, R.; SWEETER, D.; YOUNG, R. A. (1988). Stress proteins are immune targets in leprosy and tuberculosis. Proceedings of the National Academy of Sciences of the United States of America. 85;4267-4270. ZINKERNAGEL, R. M.; BACHMANN, M. F.; KUNDIG, T. E.; QEHENS, S.; PIRCHET, H.; HENGARTNER, H. (1996). On immunological memory. Ann. Rev. Immunol. 14;333-368. ZOLG, J. W. & PHILIPPI-SCHULZ, S. (1994) The super oxide dimutase gene, a target for detection and identification of mycobacteria by PCR. J. Clin. Micrbiol. 32;2«01-2812. ZOPF, W. (1883). Die Spaltpilze Edward trewendt, Breslau. ZUCKERKANDAL, E. & PAULING, I (1965). Molecules as documents of evolutionary history. Journal of Theoretical Biology 8:357-366. 179 APPENDIX. Media. Adenine degradation (Gordon, 1967). Yeast extract (Difco), lOg; glucose (Difco), lOg; adenine, 5g; agar, (OxoidNo3), 15g;sterile distilled water, 1 litre; pH 6.8. and autoc laved at 110°C for 20 minutes. Control included but without adenine. Aesculin degradation (Williams et.al. 1983a). Yeast extract 3g; aesculin, lg; ferric ammonium citrate, 0.5g; agar (Sigma),7.5g 1 litre sterile distilled water; pH 7.2. Autoclaved at 110°C for 20 minutes. Control included but without aesculin. Allantoin degradation (Gordon, 1967). Potassium di-hydrogen orthophosphate, 9.1g; di-sodium hydrogen phosphate, 9.5g; yeast extract, 0.1g;allantoin, 3.3g; phenol red, 0.0Ig; sterile distilled water, 1 litre. Autoclaved at 110°C for 15 minutes. Arbulin degradation (Williams et.al., 1 minutes. Elastin degradation.983a) Yeasi extract, 3g; arbutin, lg; ferric ammonium citrate, 0.5g; agar Lab M), 7.5g; sterile distilled water, 1 litre; pH 7.2. Autoclaved at 110°C for 20 minutes. Controls as above but without arbutin. Arylstdphate activity (Tsukamura, 1975) Dubcs TB Broth Base (Difco; Tween free), 6g; tripotassium phenolphthalein- disulphate, 1.3g; sterile distilled water, 800ml. Autoclaved at 121 °C for 20 minutes. Glua .se, 7.5g; sodium chloride, 0.85g; sterile distilled water, 100ml. Bovine serum, 100ml; heat at 56°C for 30minutes. Sterilised at 100°C for 15 minutes. Solutions A and B are mixed aseptically and 15ml and 5ml aliquots dispensed into test tubes. The reagent, 10% of di-sodium carbonate in aqueous solution, was added to cultures after three days. Carbon and Nitrogen utilisation medium (Tsukamura, 1967a). ISO Basai medium Potassium di-hydrogen orthophosphate, 0.5g; magnesium sulphate heptahydrate, 0.5g; agar, (Oxoid, No.l), lOg; sterile distilled water, 1 litre. Nitrogen compounds (%, w/v). The Nitrogen compounds (Acetamide 0.15; Benzamide, 0.24; D-Glucosamine hydrochloride 0.25; Monoethanolamine, 0.6% v/v; L-serine, 0.21; sodium-L- glutamate 0.4% w/v) were added to the basal medium to give a final concentration of 0.o2M. The media were adjusted to pH 7.0 by the by the utilisation of 10% potassium hydroxide except in the case of monoethanolamine which was adjusted to pH 7.0 with 10% concentrated hydrochloric acid. All but one of the media was sterilised at 115°C for 30 minutes the medium supplemented with D-glucosamirys hydrochloride was sterilised at 100°C for 15 minutes daily for 2 consective days. Casein degradation. A solution (10%,w/v) of skimmed milk powder( Oxoid, L31), autoclaved at 110°C for 15 minutes was added to molten, sterilised glucose yeast extract agar (final concentration of 1%, w/v) DN&se test agar Bacto-Dnase Test Agar (Difco Laboratories), 42g; sterile distilled water, 1 litre pH 7.3. Autoclaved at 121 °C for 15 minutes. Yeast extract agar, lOg; glucose, 10g;elastin 3g; agar (Oxoid No3), 15g; sterile distilled water, 1 litre; pH 6.8 autoclaved at 110c for 20 minutes. Gelatin degradation Yeast extract lOg; glucose, lOg; gelatin 4g (pre-soaked in 40ml of cold sterile distilled watei); agar (Sigma), 15g; sterile distilled water, 960ml; pH 6.8. Autoclaved at 110°C for 20 minutes 181 Glucose yeast agar. Yeast extract, lOg; glucose, lOg; agar Nol (Sigma), 15g; sterile distilled waterl liter; pH 6.8.autoclaved at 110°C for 20 minutes. Hypoxanthine degradation. Yeast extract, lOg; glucose, lOg; hypoxanthine, 4g (Oxoid No3),15g; sterile distilled water 1 litre pH 6.8. autoclaved at 110°C for 20 minutes. » Lowenstein-Jensen Medium.(Cowan and Steel, 1974) a. Mineral salt solution. Potassium-di-hydrogen phosphate, 1.2g; magnesium sulphate heptahydrate 0.12g; magnesium citrate, 0.3g; asperagine, 1.8g; glycerol, 6g; sterile distilled water 300 ml. Potalo starch was added to the above solution and the mixture boiled for 15 minutes b. Malachite green solution. Malachite green ,0.2g; sterile distilled water, 100ml. Heat at 37c for 2 hours Mix the Malachite green solution with the mineral salts solution and autoclave at 115c for 10 minutes. c. Egg mixture. The egg white and yolk of 11 to 12 eggs were shaken vigorously and 500ml of egg mixture aseptically added to the sterile mineral salt/malachite green solution. The mixture was dispensed (3ml) into sterile Bijou bottles which were laid horizontally and inspissated at 75°C for 1 hour, and then at 75°Con the following day for a further hour. Mart xmkey agar. Pepton (Oxoid L37), 20g; lactose, 10g;bile salts (Oxoid L55), 5g; neutral red, 0.075g; agar (Oxoid No3), 12g; sterile distilled water, 1 litre; pH7.4.Autoclaved at 121 °C for 15miuutes. 182 Nitrate reduction and hydrogen sulphide production (Skerman, 1967). Poatssium nitrate, 2g; nutrient broth, 1 litre (Oxoid); agar, 7.5g (Oxoid No3);pH 7.0. Dispensed into test tubes in 3ml amounts and autoclaved at 110°C for 20 minutes. Lead acetate filter paper strips (3ml) were placed in the neck of sterile tubes. Phosphatase production (Cowan and Steel,1975). A 1% aqueous solution of sodium phenolphthalein diphosphate (BDH Chemical Ltd.) was sterilised by filtration. Nutrient agar (Oxoid No3) 28g; sterile distilled water, 1 litre. Autoclaved at 121 °C for 15 minutes. The sterile phenolphthalein phosphate solution was added to the sterile nutrient agar to give a concentration of 0.1% (w/v). RNase degradation (Goodfellow, et.al.,1979). Trypton, 20g; sodium chloride, 5g; ribonucleic acid, 3g; agar (Oxoid No3), 15g; sterile distilled water, 1 litre; pH 7.3. Autoclaved at 110°C for 20 minutes. Saulon Medium (Modified after Mordarks, et.al.,1979). L-Asparagine, 5g; vitamin free casamino acids (Difco 0231-01), 2g; glucose, 15g; potassium di-hydrogen orthophosphate, 5g; trisodium citrate, 1.5g; magnesium sulphate heptahydrate,0.5g; di-potassium sulphate,0.5g; ferric ammonium citrate, trace; agar (Oxoid Nol), lOg; sterile distilled water, 1 litre; pH 7.3. Autoclave at 110c for20 minutes. Glucose, 500g was added to 1 litre of distilled water, the solution autoclaved at 110°C for 20 minutes then aseptically added to the sterile basal medium to give a final concentration of 1.5%,w/v glucose. Sierras basal Medium for hydrolysis of Tweens (Sierra, 1957). Bacto pepton (Difco Laboratories Ltd.),10g; sodium chloride, 5g;calcium chloride dihydrate ,0.1 g; agar (Oxoid Nol), lOg; sterile distilled water, 1 litre; pH 7.4. Autociaved at 121°C for 15 minutes. Tweens were sterilised separately (110°C for 183 15minutes) and added to Sierras medium aseptically to give a final concentration of Starch degradation. Yeast extract, lOg; glucose, lOg; starch, 5g; agar (Oxoid No 1 )r 15g; sterile distilled water, 1 litre; pH 6.8. Autoclaved at 110°C for 20 minutes. Stevunsons Medium (Carbon source utilization). Basal Medium. Agar (Oxoid Nol, Lll), 11.8g distilled water, 1 liter. Autoclaved at 121c Dfor 20minutes. Nitrogen source. A xlO solution of Difco Yeast Nitrogen Bsae (Difco B 392) was prepared by dissolving 67g in 1 litre of sterile distilled water. One hundred milligram of casamino acid solution was added and the solution sterilised by filtration. Di-potassium hydrogen orthophosphate,lOg; distilled water, 100ml. Autoclaved at 121°C for 15 minutes.80ml of Yeast Nitrogen Base/ Casaminp acid solution was added* to 20 ml of di-potassium hydrogen orthophosphate to give a pH 6.8-7.0. Carbon source. Four grams of each carbon source( as with nitrogen) were dissolved in 200ml of distilled water to give a concentration of 20%,w/v. The solutions were sterilised by Tyndallisation on three consecutive days for 1 hour. To obtain 1 litre of medium with a final carbon source concentration of l%,w/v, 100ml of yeast nitrogen base and casamino acid solution and 50ml of carbon source solution were added asepiically to 850m! of sterile molten agar. Testostrone degradation. 184 Yeast extract, lOg; glucose, lOg (Oxoid No3), 15g; sterile distilled water, 1 litre; pH 6.8. Autoclaved at 110c for 20 minutes.The testesterone was sterillised separatelly by Tyndallisation as before and then 10ml of sterile solution (1%, w/v) aseptically added to 90ml of the sterile medium. Tirbutrin cigar. A preprepared sterile agar was used (Oxoid, PM4). L Tyrosine degradation -. Yeast extract ,10g; glucose, lOg; L-tyrosine, 5g; agar(Oxoid No3), 15g; sterile distilled water, 1 litre; pH 6.8.Autoclaved at 110c for 20 minutes. Urea degradation. Potassium di-hydrogen phosphate orthophosphate, 9.1g; di-sodium hydrogne phosphate,9.5g; yeast extract, O.lg; phenol red, 0.01 g; sterile distilled water, 1 litre; pi I 6.8. autoclaced at 110c for 15 minutes. Ten ml of a filter stcrillised solution of urea(l 5%, w/v) was added to 75ml of sterillied basal broth. Xanthine degradation. Yeast extract, lOg; glucose, lOg; xanthine, 4g; agar (Oxoid No3), 15g; sterile distilled water, 1 litre; pH 6.8. autoclaved at 110c for 20 minutes. B.Rcagents Gelatin reagent-Acid mercuric chloride( Frazier, 1926).Mercuric chloride, 12g; sterile distilled water, 1 litre; concentrated hydrochloric acid, 16ml. Lugob iodine (Starch reagent, Cowan and Steel, 1974). Iodine. 5g; potassium iodide, lOg; sterile distilled water. 100ml. Dissolved Iodine and potassium iodide in 10ml of sterile distilled water before making up to 100ml The reagent was diluted 1 in 5 with sterile distilled water before use. Niacin reagent (Runyon et.al.,1959). 185 Aniline solution: A 4ml volume of aniline was mixed with 96ml of 95% ethanol. Cyhogen bromide solution. Ten grams of cynogen bromide was dissolved in 90ml of sterile distilled water. Ziehl-Neelsens reagents (Cowan and Steel, 1974). Acid alcohol: Concentrated hydrochloric acid, 3ml and ethanol (95%), 97ml. Strong Carbon-Fuchsin * Solution A. Basic fuchsin, lOg and ethanol (95%), 100ml. Mixed and kept at 37°C over night. Solution B.Phenol, 5g; sterile distilled water, lOOml.Mix and dissolve 10ml of solution A to 100ml of solution B. Malachite green solution. Malachite green, 5g, and sterile distilled water, 100ml. Heated at 37°C for 2 hours to dissolve. Ziehl-Neelsens stain method (Cowan and Steel, 1974). Fixed smears on slides were flooded with strong carbol-fuchsin and heated until steam was produced. The preparations were then cooled for 2-3 minutes, prior to heating as before. Slides were then washed thoroughly under running water. Decolourised in acid-alcohol until traces of red had disappeared. Washed again in water and then flooded with 0.5%(w/v) malachite green for one minute. The preparation was then washed thoroughly under running water and allowed to dry. c. Buffers. Preparation of Mel lvaine buffer (Elving, Markowitz and Rosenthal, 1956). Compi fsition (g/liter) 186 pH. NaHPO4.12Hi!n. Citric acid Hm KCI (g/litre/ionic strength of O.SM. 4.0 27.6 12.9 25.4 4.6 33.4 11.2 26.6 5.0 36.9 10.2 18.2 5.6 41.5 8.72 13.3 6.0 45.2 7.4 0 11.6 6.6 52.1 5.72 8.50 7.0 58.9 3.70 5.44 7.6 67.2 1.35 0 8.0 69.6 0.589 0 Antimicrobial compounds. Antimicrobial compounds used in the numerical phenetic study. (Data taken from Wolf. 1979; Kucers& Bennett;and Edwards, 1980). Cephaloridine hydrochloride: Structure substituted cephalosporin (3ally is a-pyridium methyl ..analogue). It inhibits cell wall synthesis during final cross linkage procedure. Chloiotetracycline and Methacycline hydrochloride (all are structural types of tetracycline) Their mode of action is to inhibit binding of aminoacyl tRNA to bacterial 30 S ribosome sub unit This is due to blocking of accumulation of tetracycline in the bacterial cell by modification of membrane located proteins which promote energy-dependent influx of tetracycline (Tait&Bayer,1978; Chopra, 1984).Studies have shown that determinants of tetracycline resistance(Tet A) are located on transposons Tn 1721 and Tet B within transposon Tn 10.DNA hybridization had shown the presence of plasmids in other species to be containing 187 each of the four determinants: Tet A,B,C and D: the most common being Tet B.(Levy, et.al. ,1985) Dapsone: Its structural type is Bis (4-aminophenyl) sulphone. It inhibits folic acid biosynthesis. Genlamycin, Neomyccin, Strepomycin,and Tobramycin sulphates are aminoglyosides Resistane to aminoglycoside antibiotics is due to the action of modifying enzymes. The modifying enzymes involved are adenyltransferase, acetyltranferase and phosphotransferase (Yamada et.al.l968.Ozanne 1969; Phillips & Shannon, 1969).Their mode of action is to inhibit protein synthesis by binding to30S ribosome sub units causing distortion of condon-anticondon interaction. Isoniazid: Structural type is isonicotinic acid hydrazide and the mode of action is to inhibit the biosynthesis of mycolic acids. Lincomycin. The structural type is Lincosamide.lt inhibits protein synthesis by binding and alteration of a protein component of 50 S ribosomal sub unit which is a substitute of amino acids that resulted from base exchange by mutation (Tamaka et.al'.1976). Olearidomycin. Is a marcolide structural type. The mode of action is to inhibit protein synthesis by binding to ribosome sub units. . Rifampicin. This antimicrobial compound inhibits DNA-dependent RNA polymerase by blocking the initiation of transcription. Its structural type is rifarnpicin. Vancnmycin hydrochloride:The mode of action of this compound is to inhibit cell wall synthesis during the second stage of peptidoglycan synthesis. The structural type is polypeptide. The acquired resistance to vancomycin is by the sequestration of the antibioticc molecule by non-specific binding and altered accessibility of the target site 188 site. Genetic studies have shown that ressitance was mediated in some strains by self- trasferable plasmids (Courvalin 1990). 189