Gene Therapy (1998) 5, 1656–1664  1998 Stockton Press All rights reserved 0969-7128/98 $12.00 http://www.stockton-press.co.uk/gt A strategy for enhancing the transcriptional activity of weak cell type-specific promoters

DM Nettelbeck, V Je´roˆme and R Mu¨ ller Institut fu¨r Molekularbiologie und Tumorforschung (IMT), Philipps-Universita¨t Marburg, Emil-Mannkopff-Strasse 2, D-35033 Marburg, Germany

Cell type- and tissue-specific promoters play an important moter to drive the simultaneous expression of the desired role in the development of site-selective vectors for gene effector/reporter gene product and a strong artificial tran- therapy. A large number of highly specific promoters has scriptional activator which stimulates transcription through been described, but their applicability is often hampered appropriate binding sites in the promoter. Using a VP16- by their inefficient transcriptional activity. In this study, we LexA chimeric transcription factor, we show that this describe a new strategy for enhancing the activity of weak approach leads to a 14- to Ͼ100-fold enhancement of both promoters without loss of specificity. The basic principle of the endothelial cell-specific von Willebrand factor promoter this strategy is to establish a positive feedback loop which and the gastrointestinal-specific sucrase-isomaltase pro- is initiated by transcription from a cell type-specific pro- moter while maintaining approximately 30- to Ͼ100-fold moter. This was achieved by using a cell type-specific pro- cell type specificity.

Keywords: tissue-specific promoters; endothelial cell-specific transcription; von Willebrand factor promoter; gastrointes- tinal-specific transcription; sucrase isomaltase promoter; transcriptional targeting

Introduction most, if not all, tumor cells have been successfully incor- porated into experimental gene therapy strategies. Fur- The construction of vectors targeting gene expression to thermore, regulatory sequences inducible by therapeutic specific sites in the organism is one of the current chal- dose of ionizing radiation, such as the egr-1 promoter,13 lenges in the field of gene therapy. In view of the fact or in response to oncogenic lesions, such as the erbB2 that the efficient targeted transduction of genes still rep- promoter,14 are worth mentioning in the same context. In resents a major obstacle, the possibility of restricting gene addition to these promoters, a plethora of other poten- expression to specific cell populations through specific tially useful transcriptional regulatory sequences with a 1–3 promoters is of particular importance. This not only high degree of specificity has been described.1–3 applies to the treatment of systemic diseases, such as Some of these promoters appear to be ideally suited metastatic cancer, but also to local gene therapy, whose for gene therapy, because they combine strong transcrip- efficacy and safety can be improved by the use of cell tional activity with a high degree of specificity. This is, type-specific promoters which keep the expression of the for instance, true for the melanocyte-specific tyrosinase therapeutic gene in non-target cells at a minimum. promoter.4–6,15 Frequently, however, specific promoters For these reasons, many of the recently described are inefficient activators of transcription which severely experimental gene therapy protocols make use of cell limits their applicability. A typical example is the von 1–3 type- or tissue-specific promoters. These include the Willebrand factor (vWF) promoter, which exhibits a tyrosinase promoter for directing gene expression to particularly high degree of endothelial cell (EC) speci- 4–6 ␣ melanoma cells, the -fetoprotein promoter for hepa- ficity compared with other EC promoters, but is a poor 7 toma cells, the mucin-1 promoter for mammary carci- activator of transcription16–19 (see also Results below). 8 noma, the prostate-specific antigen promoter for prostate Other EC promoters are stronger, but less specific, such 9 carcinoma or the neuron-specific enolase promoter for as the promoters for PECAM-1/CD3120,21 or flk- 10 neuronal cells. In other studies, transcriptional control 1/KDR.22,23 Another example is the promoter of the suc- elements which can stimulate transcription in response rase-isomaltase (SI) gene which is highly specific for to disease-specific alterations, such as hypoxic con- intestinal cells and gastrointestinal tumors,24,25 but again 11 12 ditions or the loss of cell cycle checkpoints in tumors, is a poor transcriptional activator (see Results below). In have also been used. In these scenarios, promoters con- the present study, we have chosen the vWF and SI pro- taining binding sites for hypoxia-inducible factor-1 (HIF- moters as models for the establishment of a strategy that 1) or the transcription factor E2F whose repression would be suitable for enhancing the transcriptional through the retinoblastoma protein pathway is lost in activity of weak promoters without affecting their speci- ficity (self-enhancing promoters).26 This goal was achi- eved by incorporating into these promoters a positive 26 Correspondence: R Mu¨ller feedback loop provided by a chimeric transcription fac- Received 20 May 1998; accepted 15 July 1998 tor consisting of the strong herpes simplex virus VP16 Enhancing cell type-specific transcription DM Nettelbeck et al 1657 transcriptional activation domain27,28 fused to the DNA- binding domain of LexA.29

Results

Comparative analysis of EC-specific promoters A comparison of different EC promoters in various ECs and non-endothelial cell lines was performed in order to identify a suitable promoter for the transcriptional tar- geting of ECs. The promoters of the human vWF,17 PECAM-120,21 and KDR22 genes were analyzed in transi- ent luciferase assays using human umbilical vein ECs (HUVECs), bovine aortic ECs (BAECs), mouse NIH3T3 fibroblasts and the human melanoma cell line MeWo. As shown in Figure 1a, a clear selectivity for ECs was found with all three promoters, with the highest degree of cell type specificity seen with the vWF promoter. This is particularly well documented by the data in Figure 1b which show a complete lack of activity in all non-endo- thelial cell lines tested (NIH3T3, MeWo, 10T1/2, HeLa), ie RLU values similar to those obtained with the pro- moterless basic vector, while both the PECAM-1 and KDR promoter showed readily detectable activities in the non-endothelial cells (Figure 1a). We also tested other fragments of the KDR and PECAM-1 promoters (see Materials and methods for details), but these showed even lower levels of activity and/or specificity (data not shown). In contrast to its high degree of specificity, the vWF promoter is endowed with very poor transcriptional activation properties which severely limits its applica- bility (10–20% of SV40 promoter; Figure 1a). In a first attempt to improve the activity of the vWF promoter we tested a construct in which the SV40 enhancer was placed upstream of the promoter. This construct (SV40EvWF) showed strongly increased transcriptional activity, but the cell type specificity was largely lost. We also tested other EC promoters, including those of the human endo- glin (kindly provided by W. Graulich, IMT, Marburg, Figure 1 (a)Activity of different promoters in ECs and non-endothelial Germany) and human P-selectin30 genes, but these did cells after transient transfection of luciferase reporter constructs. Values not provide the same high degree of specificity seen with were standardized individually for each cell line using a SV40 promoter the vWF promoter (data not shown). We did not include (SV40p) construct. Basic, promoterless pGL3 vector; SV40EvWF, human the preproendothelin promoter31 in these studies because vWF promoter with an upstream SV40 enhancer. (b) Activity of the vWF promoter in ECs and non-endothelial cells after transient transfection of its activity has been reported to be restricted to bigger luciferase reporter constructs. Values were standardized individually for 32 blood vessels and is also active in some epithelial cells, each cell line using the promoterless pGL3 vector (basic) which allows for which precludes its use for targeting the vasculature in a clearer representation of the vWF promoter activity in the various cell tumors or other proliferative diseases. lines (especially the lack of activity in non-endothelial cells). The data shown are averages of triplicates. The error bars indicate the standard deviations. Establishment of a positive feedback loop for the vWF promoter: proof of principle In view of the data discussed above, we sought to estab- for details) into HUVECs, BAECs, NIH3T3 cells and lish a new strategy that would allow for an enhancement MeWo cells. The data in Figure 3b (standardized to SV40 of promoter activity by introducing a positive feedback promoter activity (SP40p) for each cell line) and Figure 3c loop. The basic principle of this strategy is to use a cell demonstrate that (1) the insertion of the seven LexA sites type-specific promoter to drive the simultaneous into the vWF promoter (LexvWFLuc) had no effect on expression of the desired effector/reporter gene product activity or specificity; (2) the cotransfection of a SV40 pro- and a strong artificial transcriptional activator, ie a chim- moter-driven expression vector encoding a VP16-LexA eric protein consisting of the DNA-binding domain of fusion protein (SV-VPLex) led to a dramatic increase in LexA29 and the strong herpes simplex virus VP16 tran- activity (approximately 30- to 70-fold), but the promoter scriptional activation domain,27,28 which can stimulate also showed some activity in non-endothelial cells; (3) the transcription through LexA binding sites introduced into coexpression of the same protein from the EC-specific the promoter (Figure 2). To test the principle of this vWF promoter resulted in a similar enhancement of tran- approach, we first used the vWF promoter as a model scription (23- to 66-fold), but expression was largely EC- and performed transient luciferase assays after cotrans- specific (57- to 156-fold relative to NIH3T3; 29- to 78-fold fection of expression and reporter plasmids (see Figure 3a relative to MeWo); and (4) cotransfection of a control vec- Enhancing cell type-specific transcription DM Nettelbeck et al 1658

Figure 2 Schematic outline of the positive feedback loop. Transcription is initiated by the cell type-specific promoter in target cells (thin arrows) which leads to the simultaneous expression of the reporter/effector gene and the VP16-LexA fusion protein. The VP16-LexA protein then interacts with the LexA-bindings sites upstream of the 5′ cell type-specific promoter leading to transactivation and thus an enhancement of transcription (bold arrows). The VP16-LexA fusion protein is expressed either via an IRES or a second cell type-specific promoter.

Figure 3 Establishment of a positive feedback loop for the EC-specific vWF promoter. (a) Structure of the constructs. NLS, nuclear localization signal. (b) Activity of the constructs shown in panel (a) after transient transfection of ECs and non-endothelial cells. Details were as described in the legend to Figure 1. (c) Quantitative evaluation of the data shown in panel (b).

tor coding for a protein lacking the VP16 activation of the reporter plasmid with the SV40 promoter-driven domain gave very low values similar to the transfection expression vector SV-VPLex (six- to 18-fold; see of the reporter alone. These observations constitute clear Figure 3c), (2) would it be possible to endow the system proof of principle. There are, however, several open ques- with an even higher specificity; and (3) is the same tions that required further attention: (1) What is the rea- approach also applicable to other cell type-specific pro- son for the observed EC selectivity after cotransfection moters? All three issues will be addressed below. Enhancing cell type-specific transcription DM Nettelbeck et al 1659 Mechanism of cell type specificity tem with a vector suitable for in vivo gene therapy. We The relatively good EC selectivity after cotransfection of therefore decided to introduce all necessary components the reporter plasmid with the ubiquitous SV40 promoter- into a single plasmid vector using two different stra- driven expression vector SV-VPLex points to the exist- tegies. The first construct contains two copies of the vWF ence of a second mechanism conferring specificity on the promoter, one directing the expression of VP16-LexA, the promoter enhancement system established above (in second being VP16-LexA-responsive and driving the addition to the cell type-specific feedback loop). This transcription of the luciferase gene (construct vWF-2P in could in principle be due to two mechanisms: (1) a cell Figure 5a). The second construct contains a single VP16- type-specific, promoter-independent function of the VP16 LexA-responsive promoter which directs the expression transactivation domain, which could be due to the exist- of a bicistronic transcript containing both the luciferase ence of cell type-specific interacting modulators; or (2) and VP16-LexA coding sequences separated by an the suppression of VP16 activity in non-endothelial cells internal ribosome entry site (IRES; construct vWF-I in in the context of a silent vWF promoter, eg due to the Figure 5a).34 Both constructs were tested in HUVECs and assembly of a promoter-bound protein complex which is BAECs, as well as in NIH3T3 and MeWo cells. vWF-2P unable to mediate, or actively represses, the activation was also analyzed in the non-endothelial cell lines PC-3 function of VP16. In order to distinguish between these (human prostate carcinoma) and HepG2 (human possibilities we constructed a reporter plasmid which, hepatoma). As negative controls, we also constructed instead of a cell-type specific promoter, only contained a both vectors with a deletion of the VP16 domain (vWF- TATA-box and an initiator element (Inr)33 downstream 2P⌬VP and vWF-I⌬VP). From the data in Figure 5b and of seven LexA sites (LexTATA/ILuc; Figure 4a). As c, it is clear that the two promoter construct vWF-2P was expected, transfection of this construct on its own superior with respect to promoter strength compared resulted in hardly any luciferase activity, while the with the IRES-containing vector vWF-I. Thus, with cotransfection of SV-VPLex gave rise to a strong tran- respect to the wild-type vWF promoter, vWF-2P showed scriptional activity (Figure 4b). Most importantly, high a 20- and 169-fold enhanced activity in BAECs and activities were seen in both ECs and non-endothelial cells HUVECs, respectively (Figure 5c). As expected, the (MeWo and LoVo colon carcinoma cells), which clearly deletion of the VP16 moiety diminished the promoter demonstrates that the activity of VP16 itself – at least in activities to very low levels in both cases (Figure 5b), pro- the systems analyzed – is not subject to cell type-depen- ving the functionality of the VP16-dependent feedback dent regulation. We therefore conclude that the transcrip- loop. While the data on promoter strength (at least for tional activation function of VP16 is dependent on the vWF-2P) were similar to the results obtained by cotrans- context of the promoter and suppressed through the vWF fection (Figure 3c), a substantial improvement was seen promoter in non-target cells. when the promoter specificities were compared. Thus, both single-plasmid systems were practically silent in Establishment of a single-vector system non-endothelial cells, with values that were very similar The cotransfection protocol described above has the to those obtained with the empty reporter plasmid. potential disadvantage that not all transduced cells Although precise calculations are difficult, the promoter receive an optimum molar ratio of promoter and trans- specificity was estimated to be 47- to Ͼ200-fold in BAECs activator which might lead to a sub-optimal activity and approximately 100- to Ͼ1000-fold in HUVECs com- and/or specificity. In addition, the requirement for two pared with the other four cell lines (Figure 5c). different plasmids would make it difficult to use the sys- Establishment of a positive feedback loop for the SI promoter Finally, we sought to verify the positive feedback loop system by applying it to a second cell type-specific pro- moter. Towards this end, we chose the promoter of the SI gene which is specifically active in crypt cells of the gut and in gastrointestinal tumor cells.24,25,35 Appropriate plasmids were constructed (Figure 6a) analogous to the vWF promoter system and tested by cotransfection into the colon carcinoma cell lines LoVo and CaCo-2, as well as the non-target cells NIH3T3 and MeWo. The following results were obtained with this system (Figure 6b and c): (1) the SI promoter was highly specific for colon carci- noma cells, but showed a very weak transcriptional activity (approximately 20% the activity of the SV40 promoter); (2) the insertion of the seven LexA sites upstream of the SI promoter (LexSILuc) had no signifi- cant effect on either activity or specificity; (3) the cotrans- fection of the SV40 promoter-driven expression vector SV-VPLex led to a dramatic increase in activity (approximately 30- to 40-fold), however, the promoter Figure 4 Cell type specificity of the positive feedback loop is dependent was also weakly activated in non-target cells; (4) the coex- on a cell type specific promoter. (a) Structure of the non-specific promoter construct LexTATA/ILuc. (b) Activity of SV-VPLex on LexTATA/ILuc pression of the same protein from the cell specific SI pro- after transient transfection of BAECs and non-endothelial cells. Details moter also resulted in a strong enhancement of transcrip- were as described in the legend to Figure 1. tion (14- to 37-fold), but in this case transcription was Enhancing cell type-specific transcription DM Nettelbeck et al 1660

Figure 5 Establishment of a one-vector system conferring an enhancement of EC-specific transcription. (a) Structure of the constructs. (b) Activity of the constructs shown in panel (a) after transient transfection of ECs and non-endothelial cells. ⌬VP, VP16 moiety deleted. Details were as described in the legend to Figure 1. (c) Quantitative evaluation of the data shown in panel (b).

specific for the colon carcinoma cells (Ͼ200-fold); and (5) that specific promoters are often relatively weak inducers cotransfection of a VP16-deleted control vector gave rise of transcription. We have therefore decided to establish to similar values as seen with the reporter alone. These a strategy for the enhancement of the transcriptional observations therefore clearly show that the colon carci- activity of such promoters without losing the specificity. noma-specific activity of the SI promoter can be substan- In the present study, we describe such a strategy and tially increased by the system established in the present demonstrate its applicability to enhance the transcrip- study. As in the case of the vWF promoter, the higher tional efficiency of two weak cell type-specific promoters, transcription in colon carcinoma cells observed with the the EC-specific vWF promoter17 and the intestinal cell- SV40 promoter-driven expression vector SV-VPLex (see specific SI promoter.24 The principle of this strategy is the (3) above) appears to be due to promoter-specific sup- implementation of a positive auto-regulatory loop pro- pression of the VP16 activation function in non-target vided by a VP16-LexA fusion protein which is expressed cells, since no specificity was seen in LoVo cells with the simultaneously with the effector/reporter gene product TATA-Inr driven reporter plasmid LexTATA/ILuc (see and can bind to LexA sites inserted 5′ to the cell type- Figure 4b). specific promoter (Figure 2). The feasibility of this approach was shown in cotransfection experiments, Discussion which showed an enhancement of transcriptional activity in the range of 23- to 67-fold for the vWF promoter, and A frequent problem with the generation of tissue- or cell 14- to 37-fold for the SI promoter. In spite of this dramatic type-specific vectors is the lack of promoters suitable for increase in promoter activity, specificity was completely transcriptional targeting. A major reason lies in the fact retained, and was in the order of 30- to 147-fold for the Enhancing cell type-specific transcription DM Nettelbeck et al 1661 vWF promoter (Figure 3) and Ͼ200-fold for the SI pro- moter when compared to the activities in non-target cells (Figure 6). Some of the data obtained in the experiments shown in Figures 3 and 6 suggest a second mechanism to be involved in conferring cell type specificity. Thus, expression of the VP16-LexA activator protein from the ubiquitous SV40 promoter resulted in a clearly cell type specific auto-regulatory loop. In order to address the basis of this observation we implemented the identical VP16-LexA-mediated feedback loop system into a ubiqui- tous basal promoter, TATA-Inr. In this case, the SV40- driven expression of VP16-LexA did not result in any cell type specificity, indicating that the VP16 protein itself is not subject to cell type-dependent modulatory mech- anisms. This finding rather suggests that the vWF and SI promoters are able to suppress the action of a heterolog- ous activator, such as VP16, in non-target cells where the promoter is silent. This scenario is supported by the observation that repression apparently plays a role in silencing the vWF promoter in non-endothelial cells.19 A similar mechanism may operate in the case of the SI pro- moter, since we reproducibly observed a decrease in luciferase activities in non-target cells upon insertion of the SI promoter into the promoterless reporter plasmid pGL3. We also investigated the effect of a positive auto-regu- latory loop on a strong tissue-specific promoter, the mel- anocyte-specific tyrosinase promoter.15 In this case, we also observed an increase in activity, but this enhance- ment was relatively modest (approximately two-fold; data not shown). Melanocyte-specific expression was not affected. These findings indicate that the promoter enhancement system in principle also works with the tyrosinase promoter, but that the increase in activity is rather poor presumably due to its strong activity in the wild-type form. We therefore anticipate that our strategy is particularly useful for enhancing the activity of weak promoters. In this context it will be interesting to investi- gate in future studies whether the same approach can also be used to increase the activity of promoters endowed with other kinds of specificity, such as cell cycle-controlled, mitogen-regulated, oncoprotein- inducible or hypoxia-responsive promoters. The enhancement of transcription and promoter speci- ficity were particularly impressive when all components of the positive feedback loop system were cloned into the same plasmid vector, which was demonstrated for the EC-specific activity of the vWF two-promoter construct vWF-2P (approximately 50- to Ͼ1000-fold relative to non- endothelial cells; Figure 5). We ascribe this result to an equal ratio of the transgene products in all transduced cells, a situation that cannot be achieved in cotransfection experiments. Surprisingly, a considerably reduced activity was seen when an IRES was used instead of the second promoter. A possible reason for this observation Figure 6 Establishment of a positive feedback loop for the intestine-specific SI promoter. (a) Structure of the constructs. (b) Activity of the constructs might be a less efficient expression of the VP16-LexA shown in panel (a) after transient transfection of colon carcinoma cell lines gene downstream of the IRES. We did not pursue this (LoVo and CaCo-2) and non-target cells. Details were as described in issue in view of the high activity and pronounced speci- the legend to Figure 1. (c) Quantitative evaluation of the data shown in ficity of the two-promoter construct. panel (b). The functionality of the single plasmid system is of particular relevance when viral vectors are to be used for transduction. Viral vectors are currently the preferred means to achieve efficient transduction efficiencies in vivo. We are therefore currently in the process of generat- Enhancing cell type-specific transcription DM Nettelbeck et al 1662 ing replication-deficient adenoviruses with a vWF pro- amplification using the listed oligonucleotides. The PCR moter feedback loop to be able to investigate the activity products were digested with the corresponding restric- and specificity of the positive feedback loop system in tion enzymes and ligated into the pGL3basic vector. The animal experiments. These experiments will also have to KDR promoter (−115/+240) construct was cloned using address the critical question as to whether the viral the intrinsic KpnI restriction site. The SV40EvWF con- sequences will interfere with the transcriptional feedback struct containing the vWF promoter and SV40 enhancer loop of the inserted transgene. was obtained by replacing the SV40 promoter of the Previous studies have shown that the natural vWF pGL3control plasmid with the vWF promoter. promoter is suitable to transduce a suicidal signal to LexvWFLuc, LexSILuc and LexTATA/ILuc contain ECs using the herpes simplex virus thymidine seven LexA binding sites (5′-GTCGAGTACTGTATGTA- kinase/ganciclovir system after selection for transduced CATACAGTAC-3′)29 inserted upstream of the promoters cells.36 In view of the strong increase in promoter activity in the vWF and SI constructs or upstream of a synthetic achieved by the system established in the present study TATA-box/initiator element33 in pGL3. SV-VPLex was it is very likely that the efficacy of such gene therapeutic constructed by replacing the luciferase gene of pGL3 pro- approaches can be dramatically increased, especially if moter with a fusion of the sequences encoding the one takes into account the poor transfection efficiencies nuclear localization signal (NLS) of the SV40 large T anti- in vivo and that other effector systems can also be success- gen and the transcriptional activation domain of the her- fully used. In this context it is also relevant that a VP16- pes virus protein VP16 (aa 411–455) to a cDNA fragment based transcriptional activator has been shown to be of the E. coli repressor LexA (aa 2–202) encoding its DNA functional in vivo,37 albeit in a different context. We there- binding domain.29 PCR amplifications were performed fore feel that the system established in the present study using the oligonucleotides nVP16–5′, nVP16–3′ (template: could represent an important step in the development of pVP16; Clontech, Heidelberg, Germany), LexA-5′, and efficient genetic therapies. LexA-3′ (see below). The constructs vWF-VPLex and SI- VPLex were obtained by replacing the SV40 promoter of SV-VPLex with the vWF promoter or the SI promoter. Materials and methods vWF-Lex and SI-Lex were cloned by inserting a PCR- amplified fragment encoding the SV40 large T NLS fused Cell culture to LexA (aa 2–202). For PCR amplification the The mouse fibroblast cell lines NIH3T3 and 10T., and the oligonucleotides nLexA-5′ and LexA-3′ were used. human cell lines LoVo (ATCC CCL 229; colon For cloning of vWF-2P and vWF-2P⌬VP, NotI/SalI carcinoma), CaCo-2 (ATCC HTB 37; colon carcinoma), digests of vWF-VPLex or vWF-Lex were converted to HeLa (ATCC CCL 2; cervix carcinoma), PC-3 (ATCC CRL blunt ends and ligated into blunted, NotI-digested 1435; prostate carcinoma), HepG2 (ATCC HB 8065; LexvWFLuc in a head-to-tail orientation. Two cloning hepatoma), and MeWo38 (melanoma) were grown at 37°C steps were necessary to generate the vWF-I and vWF- in a humidified atmosphere of 5% CO2. PC-3 cells were I⌬VP constructs. Firstly, the IRES sequence of pIRES- maintained in RPMI 1640 (Boehringer Ingelheim Bio- EGFP (Clontech) was PCR amplified using the oligonu- Products, Heidelberg, Germany) and the other cell lines cleotides IRES-5′ and IRES-3′ and cloned into the XbaI in Dulbecco-Vogt modified Eagle’s medium (DMEM; site of LexvWFLuc (the initiation ATG was reverted to Boehringer Ingelheim BioProducts). RPMI 1640 and the original position of the encephalomyocarditis virus).34 DMEM were supplemented with 10% fetal bovine serum Then, the NcoI/SalI fragments of the vWF-VPLex and (FBS; Life Technologies, Eggenstein, Germany) and 2 mm vWF-Lex plamids were introduced into the IRES- l-glutamine. MeWo cells were obtained from I Hart NcoI/SalI sites to give, respectively, the vWF-I and the (London, UK) and LoVo cells from Hoechst Marion Rous- vWF-I⌬VP constructs. sell (Marburg, Germany). BAECs were kindly provided All plasmid DNAs were amplified in E. coli and pur- by W Risau (Bad Nauheim, Germany) and maintained ified according a standard protocol (Qiagen, Hilden, in DMEM supplemented with 10% inactivated FBS (PAA Germany). Plasmids obtained by PCR amplification were Laboratories, Coelbe, Germany), and 2 mml-glutamine. verified by DNA sequencing. The following oligonucleo- HUVECs were prepared by the method of Jaffe,39 as tides were used for PCR amplification (numbers refer to modified by Thornton et al,40 and cultivated in EGM-2 nucleotide positions, restriction sites are shown in italics): medium (Boehringer Ingelheim BioProducts). vWF promoter17 5′-primer: 5′-AGTCGCTAGCATCTTTAGCCGATC Plasmids CATTCAA (−487/−467) pGL3basic (basic), pGL3promoter (SV40p), and pGL3 3′-primer: 5′-AGTCCTCGAGCCCCTGCAAATGAG control were purchased from Promega (Heidelberg, GGCT (+247/−230) Germany). The basic construct lacking eukaryotic pro- moter and enhancer sequences was used for determining PECAM-1 promoter20 the vector-related background activity. The SV40p con- 5′-primer: 5′-GATCGCTAGCGAAAAGTCAGCCC struct was used for standardizing transfection CAAGAAAG (−50/−30) efficiencies. The luciferase constructs containing the 3′-primer: 5′-GTAGCTCGAGACTGCAGGCACAG human vWF promoter17 (−487/+247), the human TTAGTTCTGC (+491/+469) PECAM-1 promoter20 (−50/+469 in Figure 1, we also cloned the −939/+469, −228/+469 and +232/+469 Other PECAM-1 promoter constructs: fragments), the KDR promoter22 (−225/+240 in Figure 1, 5′-primer (−939/+469): 5′-GATCGGTACCGGGTTCA we also cloned the −780/+240 and −115/+240 fragments), AGCGATTCTCCTGCCT and the SI promoter24 (−175/+70) were cloned by PCR (−939/−917) Enhancing cell type-specific transcription DM Nettelbeck et al 1663 5′-primer (−228/+469): 5′-GATCGGTACCTTATTTT because in previous experiments we found that all GTATGTTCTTCTTCTAT ubiquitous promoters (including SV40 and CMV) are (−228/−205) more or less influenced by cotransfected plasmids, in particular those encoding (domains of) transcription fac- 5′-primer (+50/+469): 5′-GATCGCTAGCGGCCGCG tors, and can sometimes also affect the activity of the TTCGGTGGCCCCTCAG regulatory sequences to be tested. This may result in an (+50/+72) incorrect standardization. We therefore feel that it is more appropriate to transfect the reference plasmid separately KDR promoter22 ′ ′ and to perform each assay several times to control for 5 -primer: 5 -GATCGCTAGCGTTGTTGCTCTGG experimental variation. GATGTTCTC (−225/−205) 3′-primer: 5′-GTACCTCGAGTCTAGAGAAGGA GGCGCGG (+240/+211) Acknowledgements KDR promoter −780/+240 construct: 5′-primer (−780): 5′-GATCGCTAGCCCTCCTTC We are grateful to Dr S Bru¨ sselbach, Prof W Risau and CCCTGGGCCT (−780/−763) Dr M Clauss for HUVECs and BAECs, to Profs I Hart and HH Sedlacek (HMR) for tumor cell lines and to SI promoter24 M Krause for oligonucleotide synthesis. This work was 5′-primer: 5′-TGCATGCATGCAGGATCCCAATT supported in part by a grant from the BMBF. ACTAATTAACTTAGA (−175/−156) 3′-primer: 5′-ACGTACGTACGTAAGCTTATGAG CCATAGACTACCTTA (+70/+61) References ′ ′ nVP16–5 :5-GATCAAGCTTCCACCATGGGCCC 1 Sikora K. Gene therapy for cancer. Trends Biotech 1993; 11: TAAAAAGAAGCGT 197–201. nVP16–3′:5′-CTAGGTCGACCCCACCGTACTCGT 2 Miller N, Vile RG. Targeted vectors for gene therapy. FASEB J CAATTCC 1995; 9: 190–199. ′ ′ 3 Miller N, Whelan J. Progress in transcriptionally targeted and LexA-5 :5-GATCGTCGACCTCGAGGCGCCAA regulatable vectors for genetic therapy. Hum Gene Ther 1997; 8: GAAGAA ′ ′ 803–815. LexA-3 :5-ACGTTCTAGAGTTACAGCCAGTCG 4 Vile RG, Hart IR. Use of tissue-specific expression of the herpes CCGTTG simplex virus thymidine kinase gene to inhibit growth of estab- nLexA-5′:5′-GATCAAGCTTCCACCATGGGCCC lished murine melanomas following direct intratumoral injec- TAAAAAGAAGCGTAAAGTCAAAG tion of DNA. Cancer Res 1993; 53: 3860–3863. CGTTAACGGCCAGGCAA 5 Vile RG, Hart IR. In vivo and in vitro targeting of gene expression to melanoma cells. Cancer Res 1993; 53: 962–967. IRES-5′:5′-GATCGCTAGCGCCAATTCCGCCC 6 Siders WM, Halloran PJ, Fenton RG. Transcriptional targeting CTCTCCCT (1287/1307) of recombinant adenoviruses to human and murine melanoma IRES-3′:3′-GATCTCTAGATCACCATGGTATCA cells. Cancer Res 1996; 56: 5638–5646. TCGTGTTTTTCAAAGGAA (1869/1847) 7 Arbuthnot PB et al. In vitro and in vivo hepatoma cell-specific expression of a gene transferred with an adenoviral vector. Hum Transfections and luciferase assays Gene Ther 1996; 7: 1503–1514. NIH3T3, LoVo, CaCo-2, PC-3, HepG2, MeWo cells and 8 Chen L et al. Breast cancer selective gene expression and therapy mediated by recombinant adenoviruses containing the BAECs (passage 10 to 14) were transfected at 50% con- DF3/MUC1 promoter. J Clin Invest 1995; 96: 2775–2782. fluency in six-well plates using the cationic liposome 9 Lee C-H, Liu M, Sie K-L, Lee M-S. Prostate-specific antigen DOTAP as described by the manufacturer (Boehringer driven gene therapy targeting DNA-polymerase ␣ and topoiso- Mannheim, Mannheim, Germany). Three micrograms of merase IIa in prostate cancer. Anticancer Res 1996; 16: 1805–1812. plasmid (for cotransfection experiments 1 ␮g of reporter 10 Abdallah B et al. A powerful nonviral vector for in vivo gene plasmid and 2 ␮g of activator plasmid or pUC19) were transfer into the adult mammalian brain: polyethylenimine. used per well and mixed with 6 ␮l of DOTAP in transfec- Hum Gene Ther 1996; 7: 1947–1954. tion buffer. The transfection mixture was mixed with 11 Dachs GU et al. Targeting gene expression to hypoxic tumor OptiMEM (Life Technologies) or EGM-2 (for BAECs) and cells. Nature Med 1997; 3: 5515–5520. 12 Parr MJ et al. Tumor-selective expression in vivo mediated by added to the cells, followed by a 6-h incubation. 10T. and an E2F-responsive adenoviral vector. Nature Med 1997; 3: HeLa cells were transfected at 80% confluency by the 1145–1149. 41 DEAE-dextran technique. HUVECs (passage 4 to 6) 13 Hallahan DE et al. Spatial and temporal control of gene therapy were transfected at 80% confluency with Superfect using ionizing radiation. Nature Med 1995; 1: 786–791. (Qiagen) following the manufacturer’s protocol. 1.5 ␮g 14 Sikora K, Harris J, Hurst H, Lemoine N. Therapeutic strategies plasmid (or 0.5 ␮g reporter plasmid + 1 ␮g activator plas- using c-erbB-2 promoter-controlled drug activation. Ann NY mid or pUC19) and 9 ␮l Superfect per well were mixed Acad Sci 1994; 716: 115–124. with serum-free DMEM and incubated for 2 h in EGM-2 15 Shibata K et al. Identification of a cis-acting element that on the cells. Luciferase activities were determined 40 h enhances the pigment cell-specific expression of the human tyrosinase gene. J Biol Chem 1992; 267: 20584–20588. after replacement of the transfection medium with nor- ′ 42 16 Ferreira V et al. The role of the 5 -flanking region in the cell- mal growth medium as decribed. Transfections were specific transcription of the human von Willebrand factor gene. performed in triplicates and repeated at least once using Biochem J 1993; 253: 641–648. an independent plasmid preparation. The standard devi- 17 Jahroudi N, Lynch DC. Endothelial-cell-specific regulation of ations were in the range of 5–20%. We did not use a von Willebrand factor gene expression. Mol Cell Biol 1994; 14: second cotransfected plasmid for standardization, 999–1008. Enhancing cell type-specific transcription DM Nettelbeck et al 1664 18 Jahroudi N, Ardekani AM, Greenberger JS. Ionizing irradiation ing the DNA specificity of a prokaryotic repressor. Cell 1985; 43: increases transcription of the von Willebrand factor gene in 729–736. endothelial cells. Blood 1996; 88: 3801–3814. 30 Pan J, McEver RP. Characterization of the promoter for the 19 Jahroudi N, Ardekani AM, Greenberger JS. An NF1-like protein human P-selectin gene. J Biol Chem 1993; 268: 22600–22608. functions as a repressor of the von Willebrand factor promoter. 31 Kawana M, Lee ME, Quertermous EE, Quertermous, T. Cooper- J Biol Chem 1996; 271: 21413–21421. ative interaction of GATA-2 and AP1 regulates transcription of 20 Almendro N et al. Cloning of the human platelet endothelial cell the endothelin-1 gene. Mol Cell Biol 1995; 15: 4225–4231. adhesion molecule-1 promoter and its tissue-specific expression. 32 Harats D et al. Targeting gene expression to the vascular wall Structural and functional characterization. J Immunol 1996; 157: in transgenic mice using the murine preproendothelin-1 pro- 5411–5421. moter. J Clin Invest 1995; 95: 1335–1344. 21 Gumina RJ, Kirschbaum NE, Piotrowski K, Newman PJ. Charac- 33 Kaufmann J, Smale ST. Direct recognition of initiator elements terization of the human platelet/endothelial cell adhesion mol- by a component of the transcription factor IID complex. Genes ecule-1 promoter: identification of a GATA-2 binding element Dev 1994; 8: 821–829. required for optimal transcriptional activity. Blood 1997; 89: 34 Rees S et al. Bicistronic vector for the creation of stable mam- 1260–1269. malian cell lines that predisposes all antibiotic-resistant cells to 22 Patterson C et al. Cloning and functional analysis of the pro- express recombinant protein. Biotechniques 1996; 20: 102–104. moter for KDR/flk-1, a receptor for vascular endothelial growth 35 Rodolosse A et al. A limited upstream region of the human suc- factor. J Biol Chem 1995; 270: 23111–23118. rase-isomaltase gene confers glucose-regulated expression on a heterologous gene. Biochem J 1996; 315: 301–306. 23 Ro¨nicke V, Risau W, Breier G. Characterization of the endo- 36 Ozaki K et al. Use of von Willebrand factor promoter to trans- thelium-specific murine vascular endothelial growth factor duce suicidal gene to human endothelial cells, HUVEC. Hum receptor-2 (Flk-1) promoter. Circ Res 1996; 79: 277–285. Gene Ther 1996; 7: 1483–1490. 24 Wu GD, Wang W, Traber PG. Isolation and characterization of 37 Fang B, Ji L, Bouvet M, Roth JA. Evaluation of GAL4/TATA in the human sucrase-isomaltase gene and demonstration of intes- vivo. Induction of transgene expression by adenovirally tine-specific transcriptional elements. J Biol Chem 1992; 267: mediated gene codelivery. J Biol Chem 1998; 273: 4972–4975. 7863–7870. 38 Bean MA et al. Cell-mediated cytotoxicity for bladder carcinoma: 25 Traber PG, Wu GD, Wang W. Novel DNA-binding proteins evaluation of a workshop. Cancer Res 1975; 35: 2902–2913. regulate intestine-specific transcription of the sucrase-isomaltase 39 Jaffe E (ed). Culture and identification of large vessel endothelial gene. Mol Cell Biol 1992; 12: 3614–3627. cells. In: Biology of Endothelial Cells. Martinus Nijhoff: Boston, 26 Mu¨ ller R, Sedlacek HH. Selbstversta¨rkende, pharmakologisch 1986, pp. 1–13. kontrollierbare Expressionssysteme. Patent Application: 1997; 40 Thornton SC, Mueller SN, Levine EM. Human endothelial cells: DE 19651443.6. use of heparin in cloning and long-term serial cultivation. 27 Sadowski I, Ma J, Triezenberg S, Ptashne M. GAL4-VP16 is an Science 1983; 222: 623–625. unusually potent transcriptional activator. Nature 1988; 335: 41 Pollock R, Treisman R. Human SRF-related proteins: DNA-bind- 563–564. ing properties and potential regulatory targets. Genes Dev 1991; 28 Triezenberg SJ, Kingsbury RC, McKnight SL. Functional dissec- 5: 2327–2341. tion of VP16, the trans-activator of herpes simplex virus 42 Lucibello FC et al. Periodic cdc25C transcription is mediated by immediate–early gene expression. Genes Dev 1988; 2: 718–729. a novel cell cycle-regulated repressor element (CDE). EMBO J 29 Brent R, Ptashne M. A eukaryotic transcriptional activator bear- 1995; 14: 132–142.