DOCSLIB.ORG

A Coreceptor for HIV-1 Entry CXCR4, Suppresses, the Promoter Activity Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Coreceptor for HIV-1 Entry CXCR4, Suppresses, the Promoter Activity Of USF/c-Myc Enhances, While Yin-Yang 1 Suppresses, the Promoter Activity of CXCR4, a Coreceptor for HIV-1 Entry This information is current as Masako Moriuchi, Hiroyuki Moriuchi, David M. Margolis of September 23, 2021. and Anthony S. Fauci J Immunol 1999; 162:5986-5992; ; http://www.jimmunol.org/content/162/10/5986 Downloaded from References This article cites 41 articles, 26 of which you can access for free at: http://www.jimmunol.org/content/162/10/5986.full#ref-list-1 Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on September 23, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1999 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. USF/c-Myc Enhances, While Yin-Yang 1 Suppresses, the Promoter Activity of CXCR4, a Coreceptor for HIV-1 Entry Masako Moriuchi,1* Hiroyuki Moriuchi,1,2* David M. Margolis,† and Anthony S. Fauci* Transcription factors USF1 and USF2 up-regulate gene expression (i.e., HIV-1 long terminal repeats) via interaction with an E box on their target promoters, which is also a binding site for c-Myc. The c-Myc oncoprotein is important in control of cellular proliferation and differentiation, while Yin-Yang 1 (YY1) has been shown to control the expression of a number of cellular and viral genes. These two proteins physically interact with each other and mutually inhibit their respective biological functions. In this study, we show that USF/c-Myc up-regulates, while YY1 down-regulates the promoter activity of CXCR4, a coreceptor for T cell-tropic HIV-1 entry. We have identified an E box around 2260 and a YY1 binding site around 2300 relative to the transcription start site. Mutation of the E box abolished USF/c-Myc-mediated up-regulation of CXCR4 promoter activity, and mutation of the YY1 binding site was associated with unresponsiveness to YY1-mediated inhibition. These data suggest that Downloaded from USF/c-Myc and YY1 may play an important role in the HIV-1-replicative cycle, by modulating both the viral fusion/entry process and viral expression. The Journal of Immunology, 1999, 162: 5986–5992. number of cellular factors of the host have been shown monocytes has also been shown to be down-regulated upon dif- to modulate replication of HIV-1 at various steps of the ferentiation of these cells into mature macrophages (25). viral replication cycle (1). At the level of viral expres- In this study, we characterize the further upstream region of the A http://www.jimmunol.org/ sion, numerous cellular transcription factors regulate transcription CXCR4 promoter. We report that USF/c-Myc and YY1 bind to the from the long terminal repeat (LTR),3 the promoter of HIV-1. upstream region of the CXCR4 promoter, and positively or nega- While many of these factors (i.e., nuclear factor-kB/Rel family tively regulate the CXCR4 promoter, respectively. Involvement of proteins (2), C/EBP (NF-IL6) (3, 4), Sp1 (5), or USF (6)) enhance USF and YY1 at two critical steps of HIV-1 replication, viral LTR activity (reviewed in Ref. 7), a few factors have been shown fusion/entry and expression, suggests that these transcription fac- to directly reduce HIV expression at the promoter level. YY1, a tors may play a role in the pathogenesis of HIV disease. multifunctional transcription factor, has been shown to repress a number of cellular and viral gene promoters (reviewed in Ref. 8), Materials and Methods including the HIV-1 LTR (9, 10). Plasmids by guest on September 23, 2021 Host cell factors also affect HIV at earlier steps in its replication Plasmid pGL-CXCR4(2357) contains the CXCR4 upstream sequence be- cycle. HIV-1 entry into cells requires the CD4 molecule as well as tween 2357 and 151 relative to the transcription start site (TSS), followed a fusion/entry cofactor (11–18). Several chemokine receptors serve by the luciferase gene (24). Plasmids pGL-CXCR4DE box and pGL- D as fusion/entry cofactors, among which CXCR4, a receptor for CXCR4 YY1 were constructed by PCR-based site-directed mutagenesis (26) to generate mutations on an E box around 2260 and on a YY1 binding CXC chemokine stromal-derived factor (SDF-1) (19, 20), is a ma- site around 2300 relative to the TSS, respectively (see Table I and Fig. 1). jor fusion/entry cofactor for T cell-tropic HIV-1. Functional ex- Plasmid pBpuro-c-myc-ER (a generous gift of T. D. Littlewood, Imperical pression of CXCR4 is influenced by other host cell factors. SDF-1, Cancer Research Fund, London, U.K.) encodes human c-Myc fused to the a ligand of CXCR4, regulates cell surface expression of CXCR4 hormone-binding domain of the mutant murine estrogen receptor. Func- (21, 22), whereas IL-2 regulates the steady-state level of CXCR4 tional expression of a c-Myc fusion protein by the transfected plasmid is induced by 4-hydroxytamoxifen (10 nM; Sigma, St. Louis, MO) (27). Plas- mRNA (23). We have recently cloned and analyzed the promoter mids pCMV-Myc and pCMV-Max were gifts of D. Ayer (University of region of CXCR4 (24), and found that two transcription factors, Utah, Salt Lake City, UT) (28) and used for in vitro synthesis of c-Myc and nuclear respiratory factor-1 (NRF-1) and Sp1, interact with the Max proteins. USF expression plasmids pSV-USF1 and pSV-USF2 were proximal region of the CXCR4 promoter, and that the former is kindly provided by M. Sawadogo (University of Texas M. D. Anderson Can- cer Center, Houston, TX) (29), and a YY1 expression plasmid pCMV-YY1 critical for CXCR4 promoter activity. CXCR4 expression on was a generous gift of T. Shenk (Princeton University, Princeton, NJ) (30). Cells *Laboratory of Immunoregulation, National Institute of Allergy and Infectious Dis- eases, National Institutes of Health, Bethesda, MD 20892; and †Institute of Human PBMC were obtained from healthy volunteers, as described previously (31). Virology, University of Maryland, Baltimore, MD 21201 A3.01 human CD41 T cells were propagated as described previously (24, 32). Received for publication October 2, 1998. Accepted for publication February b 16, 1999. Transfection, and luciferase and -galactosidase assays The costs of publication of this article were defrayed in part by the payment of page Transient expression and luciferase and b-galactosidase assays were per- charges. This article must therefore be hereby marked advertisement in accordance formed as described previously (32, 33). with 18 U.S.C. Section 1734 solely to indicate this fact. DNase I footprinting 1 M.M. and H.M. contributed equally to this project. 2 Address correspondence and reprint requests to Dr. H. Moriuchi, Department of DNase I footprinting was performed as described previously (34). Probes Pediatrics, Nagasaki University School of Medicine, 1-7-1 Sakamoto, Nagasaki 852- used for DNase I footprinting were prepared as follows: a MluI-SacI frag- 8501, Japan. ment and a MluI-SphI fragment of pGL-CXCR4(2357) were labeled with 32 3 Abbreviations used in this paper: LTR, long terminal repeat; bHLHZip, basic re- [ P]dCTP using Klenow enzyme and gel purified. These fragments span gion-helix-loop-helix-zipper; CyPA, cyclophilin A; NRF-1, nuclear respiratory fac- the CXCR4 promoter sequence between 2357 and 2277, and between tor-1; SDF-1, stromal-derived factor-1; TSS, transcription start site; YY1, Yin-Yang 1. 2283 and 246, respectively, relative to the TSS. Furthermore, the CXCR4 Copyright © 1999 by The American Association of Immunologists 0022-1767/99/$02.00 The Journal of Immunology 5987 Table I. Oligonucleotides used for gel mobility shift assays and Biotechnology), anti-USF-1, or anti-USF2 rabbit polyclonal Ab (provided site-directed mutagenesisa by M. Sawadogo). Oligonucleotide Sequence Results L-E box 59-TGCTAGCTTCCCACCTGTCTTCAGGCGCATC-39 ACGATCGAAGGGTGGACAGAAGTCCGCGTAG Identification of putative cis-acting elements in the upstream L-E box-m 59-TGCTAGCTTCCTGTCTGTCTTCAGGCGCATC-39 region of the CXCR4 promoter ACGATCGAAGGACAGACAGAAGTCCGCGTAG E box 59-GGAAGCAGACCACGTGGTCTGCTTCC-39 First, we assessed the binding of cellular transcription factors to the CCTTCGTCTGGTGCACCAGACGAAGG CXCR4 promoter region between 2350 and 2150 relative to the TSS L-YY1 59-TAGCAAGGATGGACGCGCCACAGAGAGAC-39 in DNase I footprinting analysis. Among areas protected from DNase ATCGTTCCTACCTGCGCGGTGTCTCTCTG I digestion (Figs. 1 and 2), regions around 2260 (FP-5) and 2300 L-YY1-m1 59-TAGCAAGGATCCACGCGCCACAGAGAGAC-39 ATCGTTCCTAGGTGCGCGGTGTCTCTCTG (FP-6) were found to share homology to an E box (a binding site for L-YY1-m2 59-TAGCAAGGATGGACGCGCCACCTAGAGAC-39 basic region-helix-loop-helix-leucine zipper (bHLHZip) family pro- ATCGTTCCTACCTGCGCGGTGGATCTCTG teins (35)) and a YY1 binding site (8), respectively. YY1 59-CGCTCCGCGGCCATCTTGGCGGCTGGT-39 GCGAGGCGCCGGTAGAACCGCCGACCA GATA 59-CACTTGATAACAGAAAGTGATAACTCT-39 GTGAACTATTGTCTTTCACTATTGAGA bHLHZip proteins c-Myc, USF-1, and USF-2 bind to the STAT 59-GTATTTCCCAGAAAAGGAAC-39 CXCR4 promoter Downloaded from CATAAAGGGTCTTTTCCTTG To demonstrate that the putative E box in the CXCR4 promoter a Sequences corresponding to cis-acting elements are underlined. Mutated nucle- region actually serves as a binding site for bHLHZip family of otides are shown in bold letters. Oligonucleotides E box, YY1, GATA, and STAT transcription factors, gel-mobility shift assays were performed us- were purchased from Santa Cruz Biotechnology.
Load more

Recommended publications
  • Identification of the Promoter and a Transcriptional Enhancer of The
    Proc. Natl. Acad. Sci. USA Vol. 90, pp. 11356-11360, December 1993 Developmental Biology Identification of the promoter and a transcriptional enhancer of the gene encoding L-CAM, a calcium-dependent cell adhesion molecule (gene expression/regulatory sequences/morphogenesis/cadherins) BARBARA C. SORKIN, FREDERICK S. JONES, BRUCE A. CUNNINGHAM, AND GERALD M. EDELMAN The Department of Neurobiology, The Scripps Research Institute, 10666 North Torrey Pines Road, La Jolla, CA 92037 Contributed by Gerald M. Edelman, August 20, 1993 ABSTRACT L-CAM is a calcium-dependent cell adhesion expressed in the dermis, but rather in the adjacent epidermis molecule that is expressed in a characteristic place-dependent (6). pattern during development. Previous studies of ectopic ex- L-CAM mediates calcium-dependent cell-cell adhesion (7) pression of the chicken L-CAM gene under the control of via a homophilic mechanism; i.e., L-CAM on one cell binds heterologous promoters in transgenic mice suggested that directly to L-CAM on apposing cells (8). In all tissues where cis-acting sequences controlling the spatiotemporal expression the molecule is expressed, L-CAM is detected as a trans- patterns ofL-CAM were present within the gene itself. We have membrane protein of 124 kDa (7). Mammalian proteins now examined the L-CAM gene for sequences that control its uvomorulin (9), E-cadherin (10), cell-CAM 120/80 (11), and expression and have found an enhancer within the second Arcl (12) are similar to L-CAM in their biochemical and intron of the gene. A 2.5-kb Kpn I-EcoRI fragment from the functional properties and tissue distributions.
    [Show full text]
  • Molecular Basis of the Function of Transcriptional Enhancers
    cells Review Molecular Basis of the Function of Transcriptional Enhancers 1,2, 1, 1,3, Airat N. Ibragimov y, Oleg V. Bylino y and Yulii V. Shidlovskii * 1 Laboratory of Gene Expression Regulation in Development, Institute of Gene Biology, Russian Academy of Sciences, 34/5 Vavilov St., 119334 Moscow, Russia; [email protected] (A.N.I.); [email protected] (O.V.B.) 2 Center for Precision Genome Editing and Genetic Technologies for Biomedicine, Institute of Gene Biology, Russian Academy of Sciences, 34/5 Vavilov St., 119334 Moscow, Russia 3 I.M. Sechenov First Moscow State Medical University, 8, bldg. 2 Trubetskaya St., 119048 Moscow, Russia * Correspondence: [email protected]; Tel.: +7-4991354096 These authors contributed equally to this study. y Received: 30 May 2020; Accepted: 3 July 2020; Published: 5 July 2020 Abstract: Transcriptional enhancers are major genomic elements that control gene activity in eukaryotes. Recent studies provided deeper insight into the temporal and spatial organization of transcription in the nucleus, the role of non-coding RNAs in the process, and the epigenetic control of gene expression. Thus, multiple molecular details of enhancer functioning were revealed. Here, we describe the recent data and models of molecular organization of enhancer-driven transcription. Keywords: enhancer; promoter; chromatin; transcriptional bursting; transcription factories; enhancer RNA; epigenetic marks 1. Introduction Gene transcription is precisely organized in time and space. The process requires the participation of hundreds of molecules, which form an extensive interaction network. Substantial progress was achieved recently in our understanding of the molecular processes that take place in the cell nucleus (e.g., see [1–9]).
    [Show full text]
  • Promoter Architecture and Sex-Specific Gene Expression In
    | INVESTIGATION Promoter Architecture and Sex-Specific Gene Expression in Daphnia pulex R. Taylor Raborn,*,†,1 Ken Spitze,* Volker P. Brendel,*,†,2 and Michael Lynch*,2 *Department of Biology and †School of Informatics and Computing, Indiana University, Bloomington, Indiana 47405 ORCID IDs: 0000-0001-6249-8033 (R.T.R.); 0000-0003-4289-6637 (K.S.); 0000-0002-8055-7508 (V.P.B.) ABSTRACT Large-scale transcription start site (TSS) profiling produces a high-resolution, quantitative picture of transcription initiation and core promoter locations within a genome. However, application of TSS profiling to date has largely been restricted to a small set of prominent model systems. We sought to characterize the cis-regulatory landscape of the water flea Daphnia pulex, an emerging model arthropod that reproduces both asexually (via parthenogenesis) and sexually (via meiosis). We performed Cap Analysis of Gene Expression (CAGE) with RNA isolated from D. pulex within three developmental states: sexual females, asexual females, and males. Identified TSSs were utilized to generate a “Daphnia Promoter Atlas,” i.e., a catalog of active promoters across the surveyed states. Analysis of the distribution of promoters revealed evidence for widespread alternative promoter usage in D. pulex, in addition to a prominent fraction of compactly-arranged promoters in divergent orientations. We carried out de novo motif discovery using CAGE- defined TSSs and identified eight candidate core promoter motifs; this collection includes canonical promoter elements (e.g., TATA and Initiator) in addition to others lacking obvious orthologs. A comparison of promoter activities found evidence for considerable state- specific differential gene expression between states. Our work represents the first global definition of transcription initiation and promoter architecture in crustaceans.
    [Show full text]
  • Escherichia Coli (Gene Fusion/Attenuator/Terminator/RNA Polymerase/Ribosomal Proteins) GERARD BARRY, CATHERINE L
    Proc. Natl. Acad. Sci. USA Vol. 76, No. 10, pp. 4922-4926, October 1979 Biochemistry Control features within the rplJL-rpoBC transcription unit of Escherichia coli (gene fusion/attenuator/terminator/RNA polymerase/ribosomal proteins) GERARD BARRY, CATHERINE L. SQUIRES, AND CRAIG SQUIRES Department of Biological Sciences, Columbia University, New York, New York 10027 Communicated by Cyrus Levinthal, July 2, 1979 ABSTRACT Gene fusions constructed in vitro have been regulation could occur (4-7). Yet under certain conditions, used to examine transcription regulatory signals from the operon coordinate of the RNA which encodes ribosomal proteins L10 and L7/12 and the RNA expression polymerase subunits and polymerase P and #I subunits (the rplJL-rpoBC operon). Por- ribosomal proteins is not observed. This is especially true of the tions of this operon, which were obtained by in vitro deletions, rplJL-rpoBC transcription unit which encodes the ribosomal have been placed between the ara promoter and the lacZgene proteins L10 and L7/12 and the RNA polymerase subunits 13 in the gene-fusion plasmid pMC81 developed by M. Casadaban and 13'. For example, only the ribosomal proteins are modulated and S. Cohen. The effect of the inserted DNA segment on the by the stringent regulation system (8, 9) whereas a transient expression of the IacZ gene (in the presence and absence of arabinose) permits the localization of regulatory signals to dis- stimulatory effect of rifampicin is specific for the RNA poly- crete regions of the rpIJL-rpoBC operon. An element that re- merase subunits (10, 11). In addition, different amounts of duces the level of distal gene expression to one-sixth is located mRNA hybridize to the rpl and rpo regions of the rplJL-rpoBC on a fragment which spans the rplL-rpoB intercistronic region.
    [Show full text]
  • Promoter RNA Sequencing
    www.nature.com/scientificreports OPEN Promoter RNA sequencing (PRSeq) for the massive and quantitative promoter analysis in vitro Received: 7 August 2018 Shoji Ohuchi1,3, Thorsten Mascher 1 & Beatrix Suess2 Accepted: 1 February 2019 Analysis of promoter strength and specifcity is important for understanding and engineering gene Published: xx xx xxxx regulation. Here, we report an in vitro promoter analysis method that can achieve both massiveness and quantitativeness. In this approach, a pool of single-stranded DNA with a partially randomized promoter sequence to be analyzed is chemically synthesized. Through enzymatic reactions, the randomized sequence will be copied to the downstream region, resulting in a template DNA pool that carries its own promoter information on its transcribed region. After in vitro transcription of the DNA pool with an RNA polymerase of interest, the sequences of the resulting transcripts will be analyzed. Since the promoter strength linearly correlates to the copy number of transcript, the strength of each promoter sequence can be evaluated. A model experiment of T7 promoter variants demonstrated the quantitativeness of the method, and the method was applied for the analysis of the promoter of cyanophage Syn5 RNA polymerase. This method provides a powerful approach for analyzing the complexity of promoter specifcity and discrimination for highly abundant and often redundant alternative sigma factors such as the extracellular function (ECF) sigma factors. Transcription initiation is the key step for controlling gene expression especially in bacterial and archaeal cells. Tus, analysis of promoter strength and specifcity is important for understanding gene regulation. Traditionally, promoter analysis is performed employing in vivo reporter gene fusions [reviewed in1].
    [Show full text]
  • CG-3'-Rich Region in the Promoter of the Transcriptionally Frequently Silenced RET Protooncogene Lacks Methylated Cytidine Residues
    Oncogene (1998) 17, 2573 ± 2583 ã 1998 Stockton Press All rights reserved 0950 ± 9232/98 $12.00 http://www.stockton-press.co.uk/onc A5'-CG-3'-rich region in the promoter of the transcriptionally frequently silenced RET protooncogene lacks methylated cytidine residues Marc Munnes1, Giovanna Patrone2, Birgit Schmitz1, Giovanni Romeo2 and Walter Doer¯er1 1Institut fuÈr Genetik, UniversitaÈtzuKoÈln, D-50931 KoÈln, Germany; and 2UniversitaÁ di Genova, FacoltaÁ di Medicina e Laboratorio di Genetica Molecolare, Istituto G. Gaslini, I-16148 Genova, Italy In a large proportion of familial and sporadic cases of Keywords: HSCR patients; RET protooncogene Hirschsprung disease (HSCR) mutations in the RET promoter; 5'-CG-3'-rich region in the RET promoter (rearranged during transfection) protooncogene have been described. We have investigated the structure of the RET gene promoter and have analysed a region of approximately 1000 nucleotides in its promoter and 5'- Introduction upstream segments for the occurrence of 5-methyldeoxy- cytidine (5-mC) residues by using the bisul®te protocol of The human RET protooncogene is controlled by a the genomic sequencing method. With an estimated promoter harboring several transcription factor sensitivity of about 93% of this technique, not a single binding sites (Itoh et al., 1992), such as four 5-mC residue could be detected in the control region of a tandemly repeated GC-boxes (Dynan and Tjian, gene that seems to be silenced or exhibit low activity in 1985), an ETF binding site (Kageyama et al., 1989) many adult tissues. In these experiments, the DNAs of and Sp1 and AP-2 binding sites. Most of these sites peripheral white blood cells (PWBC) from four healthy are located within the 5'-CpG-3'-rich region in individuals, from seven patients with familial HSCR, as proximity to the transcriptional start site.
    [Show full text]
  • Regulation of RNA Polymerase II Transcription
    Regulation of RNA polymerase II transcription Ronny Drapkin, Alejandro Merino and Danny Reinberg Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, Piscataway, USA Transcription initiation plays a central role in the regulation of gene expression. Exciting developments in the last year have furthered our understanding of the interactions between general transcription factors and how these factors respond to modulators of transcription. Current Opinion in Cell Biology 1993, 5:469-476 Introduction TFIIJ. Formation of the DAB--polFEHJ complex, in the presence of each of four ribonucleoside triphosphates, Cellular growth and differentiation employ precise mech- enables RNAPII to clear the promoter region and initiate anisms to regulate the expression of various genes. One RNA synthesis from a specific start site [ 51. of the most rudimentary mechanisms for a cell to control The past year has seen intense activity aimed at elucidat- the functional levels of a protein is to modulate the lev- ing the molecular mechanisms underlying transcription els of mRNA encoding that polypeptide. It is therefore not initiation. In particular, the interactions that GTFs can surprising that most of the genetic programs that main- mediate, the GTF requirements for initiation, the role tain the cell in a constant state of flux mediate their effects of RNAPII phosphorylation, and the phenomenon of by impinging on mechanisms that control transcription antirepression in the process of activation have been initiation. the subject of many studies. These most recent develop- In contrast to prokaryotic RNA polymerase, eukaryotic ments are the focus of this review. enzymes require multiple accessory proteins to acquire promoter specificity.
    [Show full text]
  • Saccharomyces Cerevisiae Promoter Engineering Before and During the Synthetic Biology Era
    biology Review Saccharomyces cerevisiae Promoter Engineering before and during the Synthetic Biology Era Xiaofan Feng and Mario Andrea Marchisio * School of Pharmaceutical Science and Technology, Tianjin University, 92 Weijin Road, Tianjin 300072, China; [email protected] * Correspondence: [email protected] or [email protected] Simple Summary: Promoters are DNA sequences where the process of transcription starts. They can work constitutively or be controlled by environmental signals of different types. The quantity of proteins and RNA present in yeast genetic circuits highly depends on promoter strength. Hence, they have been deeply studied and modified over, at least, the last forty years, especially since the year 2000 when Synthetic Biology was born. Here, we present how promoter engineering changed over these four decades and discuss its possible future directions due to novel computational methods and technology. Abstract: Synthetic gene circuits are made of DNA sequences, referred to as transcription units, that communicate by exchanging proteins or RNA molecules. Proteins are, mostly, transcription factors that bind promoter sequences to modulate the expression of other molecules. Promoters are, therefore, key components in genetic circuits. In this review, we focus our attention on the construction of artificial promoters for the yeast S. cerevisiae, a popular chassis for gene circuits. We describe the initial techniques and achievements in promoter engineering that predated the start of the Synthetic Biology epoch of about 20 years. We present the main applications of synthetic Citation: Feng, X.; Marchisio, M.A. promoters built via different methods and discuss the latest innovations in the wet-lab engineering Saccharomyces cerevisiae Promoter of novel promoter sequences.
    [Show full text]
  • Biol. Pharm. Bull. 43(4): 742-746 (2020)
    742 Biol. Pharm. Bull. 43, 742–746 (2020) Vol. 43, No. 4 Note PRC2 Components Maintain DNA Hypermethylation of the Upstream Promoter and Regulate Robo4 Expression in Endothelial Cells Kohei Izawa,# Keisuke Shirakura,# Koji Kakiuchi, Nobuaki Funahashi, Naoki Maekawa, Nobumasa Hino, Toru Tanaka, Takefumi Doi, and Yoshiaki Okada* Graduate School of Pharmaceutical Sciences, Osaka University; 1–6 Yamadaoka, Suita, Osaka 565–0871, Japan. Received November 15, 2019; accepted January 24, 2020 Roundabout4 (Robo4) is an endothelial cell-specific protein that stabilizes the vasculature in pathologi- cal angiogenesis and inflammation. We previously determined a 3-kb Robo4 promoter and demonstrated the importance of the upstream region for nuclear factor-kappaB (NF-κB)-mediated promoter activation in- duced by tumor necrosis factor α (TNFα). This region contains unique genomic features, including promoter region-specific DNA hypermethylation and chromatin condensation; however, the function of the region re- mains poorly understood. In this study, we analyzed the DNA sequences of the region and identified a motif for polycomb repressive complex 2 (PRC2). Chromatin immunoprecipitation assay indicates the binding of the PRC2 component, SUZ12, to the motif. A mutation in the motif decreased DNA methylation in embryonic stem cells and increased Robo4 promoter activity in endothelial cells. An inhibitor for the PRC2 component, EZH2, induced the promoter activity and expression of Robo4 in endothelial cells treated with or without TNFα. Taken together, these
    [Show full text]
  • EZH2 Regulates Neuroblastoma Cell Differentiation Via NTRK1 Promoter Epigenetic Modifications
    Oncogene (2018) 37:2714–2727 https://doi.org/10.1038/s41388-018-0133-3 ARTICLE EZH2 regulates neuroblastoma cell differentiation via NTRK1 promoter epigenetic modifications 1,2 1 3,4 3,5 1 Zhenghao Li ● Hisanori Takenobu ● Amallia Nuggetsiana Setyawati ● Nobuhiro Akita ● Masayuki Haruta ● 1 1 1,6 1 1 1 Shunpei Satoh ● Yoshitaka Shinno ● Koji Chikaraishi ● Kyosuke Mukae ● Jesmin Akter ● Ryuichi P. Sugino ● 7 8 9 1 1,2 Atsuko Nakazawa ● Akira Nakagawara ● Hiroyuki Aburatani ● Miki Ohira ● Takehiko Kamijo Received: 25 May 2017 / Revised: 20 October 2017 / Accepted: 27 November 2017 / Published online: 6 March 2018 © The Author(s) 2018. This article is published with open access Abstract The polycomb repressor complex 2 molecule EZH2 is now known to play a role in essential cellular processes, namely, cell fate decisions, cell cycle regulation, senescence, cell differentiation, and cancer development/progression. EZH2 inhibitors have recently been developed; however, their effectiveness and underlying molecular mechanisms in many malignancies have not yet been elucidated in detail. Although the functional role of EZH2 in tumorigenesis in neuroblastoma (NB) has been investigated, mutations of EZH2 have not been reported. A Kaplan–Meier analysis on the event free survival and 1234567890();,: overall survival of NB patients indicated that the high expression of EZH2 correlated with an unfavorable prognosis. In order to elucidate the functional roles of EZH2 in NB tumorigenesis and its aggressiveness, we knocked down EZH2 in NB cell lines using lentivirus systems. The knockdown of EZH2 significantly induced NB cell differentiation, e.g., neurite extension, and the neuronal differentiation markers, NF68 and GAP43.
    [Show full text]
  • Cis-Acting Elements Responsible for Muscle-Specific Expression of the Myosin Heavy Chain ,3 Gene
    kQ-D 1992 Oxford University Press Nucleic Acids Research, Vol. 20, No. 7 1793-1799 Cis-acting elements responsible for muscle-specific expression of the myosin heavy chain ,3 gene Noriko Shimizul +, Gwen Prior4, Patrick K.Umeda5 and Radovan Zak' 2S* Departments of 1Medicine, 2Organismal Biology and Anatomy, and 3Pharmacological & Physiological Sciences, The University of Chicago, Chicago, IL 60637, 4Marine Biology Laboratory, Woods Hole, MA 02543 and 5Department of Medicine, University of Alabama at Birmingham, Birmingham, AL 35294, USA Received August 8, 1991; Revised and Accepted February 19, 1992 ABSTRACT The 5' flanking region of the rabbit myosin heavy chain (1). In mammals, one of the members, the myosin HC , gene, (HC) a gene extending 295 bp upstream from the cap is expressed early during development in skeletal muscles and site provides muscle-specific transcriptional activity. In becomes restricted to slow twitch fibers in adults. The myosin this study, we have identified and functionally HC is also a major myosin HC isoform in cardiac muscle. The characterized cis-acting elements that regulate the differential expression of the HC ,3 gene, like that of most of muscle-specific expression within this region. By using the other muscle-specific genes, is regulated primarily by linker-scanner (LS) mutants between - 295 bp and a transcriptional mechanisms (2), indicating that the interaction of putative TATA box, we found five distinct positive cis- the cis-acting regulatory elements with the trans-acting nuclear acting sequences necessary for transcription: element factors plays an important role in determining the specific pattern A, the sequences between -276 and -263, which of transcriptional regulation.
    [Show full text]
  • Gene Regulation in the Lac Operon
    GENE REGULATION IN THE LAC OPERON by Kathryn Grace Patterson A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Mathematics MONTANA STATE UNIVERSITY Bozeman, Montana July, 2009 c Copyright by Kathryn Grace Patterson 2009 All Rights Reserved ii APPROVAL of a dissertation submitted by Kathryn Grace Patterson This dissertation has been read by each member of the dissertation committee and has been found to be satisfactory regarding content, English usage, format, citations, bibliographic style, and consistency, and is ready for submission to the Division of Graduate Education. Dr. Tom´aˇsGedeon Approved for the Department of Mathematical Sciences Dr. Kenneth L. Bowers Approved for the Division of Graduate Education Dr. Carl A. Fox iii STATEMENT OF PERMISSION TO USE In presenting this dissertation in partial fulfillment of the requirements for a doc- toral degree at Montana State University, I agree that the Library shall make it available to borrowers under rules of the Library. I further agree that copying of this dissertation is allowable only for scholarly purposes, consistent with \fair use" as pre- scribed in the U.S. Copyright Law. Requests for extensive copying or reproduction of this dissertation should be referred to ProQuest Information and Learning, 300 North Zeeb Road, Ann Arbor, Michigan 48106, to whom I have granted \the exclusive right to reproduce and distribute my dissertation in and from microform along with the non-exclusive right to reproduce and distribute my abstract in any format in whole or in part." Kathryn Grace Patterson July, 2009 iv ACKNOWLEDGEMENTS I would like to thank my advisor Tom´aˇsGedeon for his guidance, support and all of the opportunities he has provided.
    [Show full text]