A Coreceptor for HIV-1 Entry CXCR4, Suppresses, the Promoter Activity Of

USF/c-Myc Enhances, While Yin-Yang 1 Suppresses, the Promoter Activity of CXCR4, a Coreceptor for HIV-1 Entry

This information is current as Masako Moriuchi, Hiroyuki Moriuchi, David M. Margolis of September 23, 2021. and Anthony S. Fauci J Immunol 1999; 162:5986-5992; ; http://www.jimmunol.org/content/162/10/5986 Downloaded from

References This article cites 41 articles, 26 of which you can access for free at: http://www.jimmunol.org/content/162/10/5986.full#ref-list-1

Why The JI? Submit online. http://www.jimmunol.org/

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average by guest on September 23, 2021

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1999 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. USF/c-Myc Enhances, While Yin-Yang 1 Suppresses, the Promoter Activity of CXCR4, a Coreceptor for HIV-1 Entry

Masako Moriuchi,1* Hiroyuki Moriuchi,1,2* David M. Margolis,† and Anthony S. Fauci*

Transcription factors USF1 and USF2 up-regulate gene expression (i.e., HIV-1 long terminal repeats) via interaction with an E box on their target promoters, which is also a binding site for c-Myc. The c-Myc oncoprotein is important in control of cellular proliferation and differentiation, while Yin-Yang 1 (YY1) has been shown to control the expression of a number of cellular and viral genes. These two proteins physically interact with each other and mutually inhibit their respective biological functions. In this study, we show that USF/c-Myc up-regulates, while YY1 down-regulates the promoter activity of CXCR4, a coreceptor for T cell-tropic HIV-1 entry. We have identiﬁed an E box around ؊260 and a YY1 binding site around ؊300 relative to the transcription start site. Mutation of the E box abolished USF/c-Myc-mediated up-regulation of CXCR4 promoter activity, and

mutation of the YY1 binding site was associated with unresponsiveness to YY1-mediated inhibition. These data suggest that Downloaded from USF/c-Myc and YY1 may play an important role in the HIV-1-replicative cycle, by modulating both the viral fusion/entry process and viral expression. The Journal of Immunology, 1999, 162: 5986–5992.

number of cellular factors of the host have been shown monocytes has also been shown to be down-regulated upon dif- to modulate replication of HIV-1 at various steps of the ferentiation of these cells into mature macrophages (25). viral replication cycle (1). At the level of viral expres- In this study, we characterize the further upstream region of the A http://www.jimmunol.org/ sion, numerous cellular transcription factors regulate transcription CXCR4 promoter. We report that USF/c-Myc and YY1 bind to the from the long terminal repeat (LTR),3 the promoter of HIV-1. upstream region of the CXCR4 promoter, and positively or nega- While many of these factors (i.e., nuclear factor-␬B/Rel family tively regulate the CXCR4 promoter, respectively. Involvement of proteins (2), C/EBP (NF-IL6) (3, 4), Sp1 (5), or USF (6)) enhance USF and YY1 at two critical steps of HIV-1 replication, viral LTR activity (reviewed in Ref. 7), a few factors have been shown fusion/entry and expression, suggests that these transcription fac- to directly reduce HIV expression at the promoter level. YY1, a tors may play a role in the pathogenesis of HIV disease. multifunctional transcription factor, has been shown to repress a number of cellular and viral gene promoters (reviewed in Ref. 8), Materials and Methods including the HIV-1 LTR (9, 10). Plasmids by guest on September 23, 2021 Host cell factors also affect HIV at earlier steps in its replication Plasmid pGL-CXCR4(Ϫ357) contains the CXCR4 upstream sequence be- cycle. HIV-1 entry into cells requires the CD4 molecule as well as tween Ϫ357 and ϩ51 relative to the transcription start site (TSS), followed a fusion/entry cofactor (11–18). Several chemokine receptors serve by the luciferase gene (24). Plasmids pGL-CXCR4⌬E box and pGL- ⌬ as fusion/entry cofactors, among which CXCR4, a receptor for CXCR4 YY1 were constructed by PCR-based site-directed mutagenesis (26) to generate mutations on an E box around Ϫ260 and on a YY1 binding CXC chemokine stromal-derived factor (SDF-1) (19, 20), is a ma- site around Ϫ300 relative to the TSS, respectively (see Table I and Fig. 1). jor fusion/entry cofactor for T cell-tropic HIV-1. Functional ex- Plasmid pBpuro-c-myc-ER (a generous gift of T. D. Littlewood, Imperical pression of CXCR4 is inﬂuenced by other host cell factors. SDF-1, Cancer Research Fund, London, U.K.) encodes human c-Myc fused to the a ligand of CXCR4, regulates cell surface expression of CXCR4 hormone-binding domain of the mutant murine estrogen receptor. Func- (21, 22), whereas IL-2 regulates the steady-state level of CXCR4 tional expression of a c-Myc fusion protein by the transfected plasmid is induced by 4-hydroxytamoxifen (10 nM; Sigma, St. Louis, MO) (27). Plas- mRNA (23). We have recently cloned and analyzed the promoter mids pCMV-Myc and pCMV-Max were gifts of D. Ayer (University of region of CXCR4 (24), and found that two transcription factors, Utah, Salt Lake City, UT) (28) and used for in vitro synthesis of c-Myc and nuclear respiratory factor-1 (NRF-1) and Sp1, interact with the Max proteins. USF expression plasmids pSV-USF1 and pSV-USF2 were proximal region of the CXCR4 promoter, and that the former is kindly provided by M. Sawadogo (University of Texas M. D. Anderson Can- cer Center, Houston, TX) (29), and a YY1 expression plasmid pCMV-YY1 critical for CXCR4 promoter activity. CXCR4 expression on was a generous gift of T. Shenk (Princeton University, Princeton, NJ) (30). Cells *Laboratory of Immunoregulation, National Institute of Allergy and Infectious Dis- eases, National Institutes of Health, Bethesda, MD 20892; and †Institute of Human PBMC were obtained from healthy volunteers, as described previously (31). Virology, University of Maryland, Baltimore, MD 21201 A3.01 human CD4ϩ T cells were propagated as described previously (24, 32). Received for publication October 2, 1998. Accepted for publication February ␤ 16, 1999. Transfection, and luciferase and -galactosidase assays The costs of publication of this article were defrayed in part by the payment of page Transient expression and luciferase and ␤-galactosidase assays were per- charges. This article must therefore be hereby marked advertisement in accordance formed as described previously (32, 33). with 18 U.S.C. Section 1734 solely to indicate this fact. DNase I footprinting 1 M.M. and H.M. contributed equally to this project. 2 Address correspondence and reprint requests to Dr. H. Moriuchi, Department of DNase I footprinting was performed as described previously (34). Probes Pediatrics, Nagasaki University School of Medicine, 1-7-1 Sakamoto, Nagasaki 852- used for DNase I footprinting were prepared as follows: a MluI-SacI frag- 8501, Japan. ment and a MluI-SphI fragment of pGL-CXCR4(Ϫ357) were labeled with 32 3 Abbreviations used in this paper: LTR, long terminal repeat; bHLHZip, basic re- [ P]dCTP using Klenow enzyme and gel puriﬁed. These fragments span gion-helix-loop-helix-zipper; CyPA, cyclophilin A; NRF-1, nuclear respiratory fac- the CXCR4 promoter sequence between Ϫ357 and Ϫ277, and between tor-1; SDF-1, stromal-derived factor-1; TSS, transcription start site; YY1, Yin-Yang 1. Ϫ283 and Ϫ46, respectively, relative to the TSS. Furthermore, the CXCR4

Table I. Oligonucleotides used for gel mobility shift assays and Biotechnology), anti-USF-1, or anti-USF2 rabbit polyclonal Ab (provided site-directed mutagenesisa by M. Sawadogo).

Oligonucleotide Sequence Results L-E box 5Ј-TGCTAGCTTCCCACCTGTCTTCAGGCGCATC-3Ј ACGATCGAAGGGTGGACAGAAGTCCGCGTAG Identification of putative cis-acting elements in the upstream L-E box-m 5Ј-TGCTAGCTTCCTGTCTGTCTTCAGGCGCATC-3Ј region of the CXCR4 promoter ACGATCGAAGGACAGACAGAAGTCCGCGTAG E box 5Ј-GGAAGCAGACCACGTGGTCTGCTTCC-3Ј First, we assessed the binding of cellular transcription factors to the CCTTCGTCTGGTGCACCAGACGAAGG CXCR4 promoter region between Ϫ350 and Ϫ150 relative to the TSS L-YY1 5Ј-TAGCAAGGATGGACGCGCCACAGAGAGAC-3Ј in DNase I footprinting analysis. Among areas protected from DNase ATCGTTCCTACCTGCGCGGTGTCTCTCTG I digestion (Figs. 1 and 2), regions around Ϫ260 (FP-5) and Ϫ300 L-YY1-m1 5Ј-TAGCAAGGATCCACGCGCCACAGAGAGAC-3Ј ATCGTTCCTAGGTGCGCGGTGTCTCTCTG (FP-6) were found to share homology to an E box (a binding site for L-YY1-m2 5Ј-TAGCAAGGATGGACGCGCCACCTAGAGAC-3Ј basic region-helix-loop-helix-leucine zipper (bHLHZip) family pro- ATCGTTCCTACCTGCGCGGTGGATCTCTG teins (35)) and a YY1 binding site (8), respectively. YY1 5Ј-CGCTCCGCGGCCATCTTGGCGGCTGGT-3Ј GCGAGGCGCCGGTAGAACCGCCGACCA GATA 5Ј-CACTTGATAACAGAAAGTGATAACTCT-3Ј GTGAACTATTGTCTTTCACTATTGAGA bHLHZip proteins c-Myc, USF-1, and USF-2 bind to the STAT 5Ј-GTATTTCCCAGAAAAGGAAC-3Ј CXCR4 promoter Downloaded from CATAAAGGGTCTTTTCCTTG To demonstrate that the putative E box in the CXCR4 promoter a Sequences corresponding to cis-acting elements are underlined. Mutated nucle- region actually serves as a binding site for bHLHZip family of otides are shown in bold letters. Oligonucleotides E box, YY1, GATA, and STAT transcription factors, gel-mobility shift assays were performed us- were purchased from Santa Cruz Biotechnology. ing in vitro synthesized proteins. Either c-Myc/Max, USF-1, or USF-2 protein formed a complex with an L-E box oligonucleotide corresponding to the FP-5 region (Fig. 3A); however, c-Myc/Max promoter sequence spanning from Ϫ357 and Ϫ156 relative to the TSS was http://www.jimmunol.org/ amplified with PCR and subcloned into pCR2.1 (Invitrogen, Carlsbad, complex was detectable only after longer exposure (data not CA), and a SpeI-EcoRV fragment of the resultant plasmid (in which the shown). c-Myc protein alone could not form a complex with the SpeI site is located downstream of the 3Ј end of the CXCR4 promoter L-E box oligonucleotide (data not shown), most likely reflecting Ϫ 32 sequence position 156) was P labeled and purified, as described above. the fact that Max protein is an obligate heterodimeric partner for ϩ Nuclear extracts, propagation of transcription factors, and c-Myc (35). When A3.01 CD4 T cell nuclear extracts were used gel-mobility shift assays instead of purified proteins, a DNA-protein complex, which was specifically competed by unlabeled probe as well as by an oligo- Nuclear extracts were prepared from A3.01 cells or U937 cells, as described previously (33). c-Myc, Max, USF-1, and USF-2 proteins were nucleotide containing the consensus E box, was formed (Fig. 3B). synthesized in vitro from pCMV-Myc, pCMV-Max, pSV-USF1, and pSV- Supershift assays using specific Abs to c-Myc, USF1, or USF2 by guest on September 23, 2021 USF2, respectively, using T7 RNA polymerase/Wheat Germ Extract Sys- indicated that the major complex contained both USF1 and USF2, tem (Promega, Madison, WI), and rYY1 protein was purchased from Santa but not c-Myc (Fig. 3C). These results indicate that bHLHZip pro- Cruz Biotechnology (Santa Cruz, CA). Gel-mobility shift assays were per- teins c-Myc, USF1, and USF2 bind to the CXCR4 promoter E box; formed as described previously (33). Antisera used for supershift assays were the following: normal rabbit serum, anti-YY1 rabbit polyclonal Ab however, USF1 and USF2 have higher affinity for the E box than (Santa Cruz Biotechnology), anti-c-Myc rabbit polyclonal Ab (Santa Cruz does c-Myc.

FIGURE 1. Schematic diagram of the CXCR4 upstream sequence. Top, The horizontal arrows indicate the transcription start sites (TSS), and numbers above the sequence indicate nucleotide relative to the most 5Ј TSS. Sequences homologous to binding sites for cellular transcription factors NRF-1, Sp1, AP-1, vitamin D receptor, NF-AT/AP-1, STAT, c-Myc/ USF, YY1, nuclear factor-␬B, and serum-responsive factor are indicated. Bottom, The areas protected from DNase I digestion (FP-1 through FP-7) are indicated (see Fig. 2). An E box and a YY1 binding site are shown as italic letters, and mutations in pGL-CXCR4⌬E box and pGL-CXCR4⌬YY1 are shown by the downward arrows (also see Table I). 5988 REGULATION OF CXCR4 PROMOTER BY USF/c-Myc AND YY1

bHLHZip proteins c-Myc, USF-1, and USF-2 up-regulate CXCR4 promoter activity To investigate whether bHLHZip proteins c-Myc, USF1, and USF2, which can bind to the CXCR4 promoter, are capable of regulating expression from the CXCR4 promoter, expression vectors for these proteins were cotransfected with CXCR4 promoter- luciferase reporter constructs. Transfection of c-Myc up-regulated expression from the CXCR4 promoter; this effect was dependent upon the presence of an intact E box (Fig. 4A). Cotransfection with the Max expression vector did not further enhance c-Myc-mediated transactivation of the CXCR4 promoter (data not shown), probably because Max is constitutively and abundantly expressed in most cell types (35, 36). USF1, and to a slightly lesser extent, USF2, also increased expression of the CXCR4 promoter reporter gene. Mutation of the E box ablated this effect (Fig. 4B).

YY1 binds to the CXCR4 promoter

To determine whether YY1 actually binds to the region, gel-mo- Downloaded from bility shift assays were performed using bacterially synthesized YY1 protein. Purified YY1 protein formed a complex with an oligonucleotide corresponding to the FP-6 region (Fig. 5A). A3.01 CD4ϩ T cell nuclear extracts were found to contain two complexes binding to the FP-6 region, which were specifically competed by unlabeled probe; a fast migrating complex, but not a slowly mi- http://www.jimmunol.org/ grating complex, was also specifically competed by an oligonucleotide containing the consensus YY1 binding motif (Fig. 5B; Table I). Gel-shift interference assays using anti-YY1 Ab con- FIGURE 2. DNase I footprinting with nuclear extracts from A3.01 firmed that the fast migrating complex contains YY1 (Fig. 5C). cells. Lanes 1, 4, and 7,GϩA chemical cleavage ladder; lanes 2, 3, 5, 6, Thus, these results clearly indicate that YY1 binds to the CXCR4 8, and 9, DNA fragment pattern generated by DNase I treatment after promoter. A slowly migrating complex was specifically competed incubation of a 5Ј end-labeled probe in the presence of BSA (lanes 2, 5, by an oligonucleotide containing the consensus GATA binding and 8) or A3.01 nuclear extracts (NE) (lanes 3, 6, and 9). Positions relative motif (Fig. 5B); however, Ab to GATA1, GATA2, or GATA3 did to the TSS are shown on the left. The boxes and dots on the right indicate not affect the mobility or formation of the complex (data not by guest on September 23, 2021 the protected regions (FP-1 through 7 (Fig. 1, bottom)) and the hypersen- shown). In addition, the FP-6 region has only limited homology to sitive nucleotides, respectively.

FIGURE 3. bHLHZip proteins c-Myc, USF1, and USF2 bind to the CXCR4 promoter. A, In vitro synthesized c-Myc, USF1, and USF2 proteins bind to the E box in CXCR4 promoter. L-E box (see Table I) probe was incubated with in vitro synthesized c-Myc/Max (lane 3), USF-1 (lane 6), USF2 (lane 7), or control reaction (lanes 2 and 5). Lanes 1 and 4 represent probe alone. Arrows and F. P. indicate DNA-protein complexes and free probe, respectively. B, Gel-mobility shift and competition assays. L-E box probe was incubated with A3.01 nuclear extracts in the presence of a 500-fold molar excess of nonlabeled oligonucleotides (see Table I) indicated above the ﬁgure as competitors. Lane 1 represents probe alone, and lanes 2–6 represent reactions in the presence of A3.01 nuclear extracts. The arrow represents the DNA-protein complex. C, Supershift assays. Nuclear extracts from A3.01 cells were incubated with the indicated Abs for 30 min on ice before incubation with L-E box probe. The arrow indicates USF complexes, and the solid and open circles indicate the shift of USF1 and USF2 complexes, respectively. The Journal of Immunology 5989

FIGURE 4. bHLHZip proteins c-Myc, USF1, and USF2 up-regulate CXCR4 promoter activity. A, c-Myc up-regulates CXCR4 promoter activity. Forty million PBMCs were transfected with 20 ␮g of either pGL- CXCR4(Ϫ357) or pGL-CXCR4⌬E box along with 20 ␮g of pBpuro-c-myc-ER, and either untreated (control) or treated (Myc) with 10 nM of 4-hydroxytamoxifen (Sigma) 24 h after transfection. 4-Hydroxytamoxifen at this con- centration by itself had no effect on CXCR4 promoter activity (data not shown). Cells were harvested 48 h after transfection for luciferase assays. Fold induction indicates luciferase activity relative to basal promoter activity. Results were representative of four independent experiments. B, USF1 and USF2 up- regulate CXCR4 promoter activity. PBMC were transfected with 20 ␮g of either pGL-CXCR4(Ϫ357) or pGL-CXCR4⌬E box along with 20 ␮g of either pSV2-CAT, pSV- Downloaded from USF1, or pSV-USF2. Results were representative of four independent experiments.

GATA binding motif. Identiﬁcation of this complex is currently in viewed by Shrivastava and Calame, Ref. 8). To investigate how progress. YY1 regulates activity of the CXCR4 promoter, we transfected http://www.jimmunol.org/ A3.01 CD4ϩ T cells with a CXCR4 promoter/luciferase reporter YY1 suppresses CXCR4 promoter activity construct along with a YY1 expression vector. The cells were ei- In the context of other promoters, YY1 has been shown to activate ther unstimulated or stimulated with PMA and ionomycin imme- transcription, repress transcription, or initiate transcription (re- diately after transfection, and cell lysates were tested for luciferase by guest on September 23, 2021

FIGURE 5. YY1 binds to CXCR4 promoter. A, In vitro synthesized YY1 protein binds to CXCR4 promoter. L-YY1 probe was incubated with in vitro synthesized YY1 protein (lane 2) or BSA (lane 3) as a control. B, Gel-mobility shift and competition assays. L-YY1 probe was incubated with A3.01 nuclear extracts in the presence of a 500-fold molar excess of nonlabeled oligonucleotides (see Table I) indicated above the ﬁgure as competitors. Lane 1 represents probe alone, and lanes 2–8 represent reactions in the presence of A3.01 nuclear extracts. F. P. indicates free probe, and the solid and open arrows indicate the YY1 complex (see C) and another uncharacterized protein-DNA complex, respectively. C, Gel-shift interference analysis with anti-YY1 Ab. The reaction mixture for binding between L-YY1 oligonucleotide and A3.01 nuclear extracts was incubated with either normal rabbit serum (lane 3) or anti-YY1 rabbit polyclonal Ab (lane 4). The solid arrows indicate the YY1 complex, which was disrupted by anti-YY1 Ab (lane 4), but not control serum (lane 3). Lane 1 represents probe alone, and lanes 2–4 represent reactions in the presence of A3.01 nuclear extracts. 5990 REGULATION OF CXCR4 PROMOTER BY USF/c-Myc AND YY1 activity 2 days later. Overexpression of YY1 suppressed the CXCR4 promoter in A3.01 cells up to 80% in a dose-dependent manner (Fig. 6A). To determine whether the YY1 binding site on the CXCR4 promoter sequence involves YY1-mediated repression of the CXCR4 promoter, site-directed mutations were introduced on the YY1 binding site, and its activity was compared with that of wild-type promoter. An oligonucleotide with mutations on the YY1 binding site (L-YY1-m1 in Table I) lost its ability to disrupt the YY1 complex formation in gel-mobility shift assays (Fig. 5B). Intro- duction of mutations into the CXCR4 promoter/luciferase reporter construct resulted in approximately a 2-fold increase in the basal activity (Fig. 6B), and its activity was not markedly inﬂuenced by cotransfection with the YY1 expression vector (Fig. 6A). These results indicate that YY1 inhibits the expression of the CXCR4 promoter through its binding to a site around Ϫ300 relative to the TSS. c-Myc and YY1 mutually inhibit the transregulatory functions on the CXCR4 promoter Downloaded from YY1 has been shown to physically associate with c-Myc, and the interaction between the two proteins appears to result in mutual inhibition of their transregulatory functions (37). To investigate whether these two transcription factors mutually affect their functions related to CXCR4 promoter activity, expression vectors for YY1 and c-Myc were transfected into A3.01 cells individually or http://www.jimmunol.org/ in combination along with pGL-CXCR4(Ϫ357). As shown above, overexpression of YY1 repressed, while c-Myc transactivated, the CXCR4 promoter activity; however, the net effect of the cotransfection of both expression vectors on the promoter was negligible (Fig. 7), implying their mutually inhibitory interaction.

Discussion

In this study, we have demonstrated that cellular YY1 transcription by guest on September 23, 2021 factor down-regulates CXCR4 expression through its interaction with the CXCR4 promoter. Previous studies demonstrated that T cell activation with IL-2 or anti-CD3 Ab increased CXCR4 expression (24, 36), and a cellular transcription factor, NRF-1, is critical for CXCR4 promoter activity (24). YY1 is the first cellular factor to be identified as a repressor of CXCR4 expression. YY1 is widely expressed and highly conserved among mamma- lian species, and thus can be categorized as a ubiquitous transcription factor (8, 30). YY1 can directly interact with a wide array of cellular and viral proteins and regulates a number of cellular and viral promoters, depending on the gene as well as the cell type in question (reviewed in Ref. 8). For example, YY1 has been shown to associate with the c-Myc protein, and this association may lead to mutual inhibition of the transcription functions of both proteins (37). The c-Myc protein is a potent regulator of cell growth and differentiation, and c-Myc expression is down-regulated upon differentiation of cells of the monocyte/macrophage lineage into FIGURE 6. YY1 represses CXCR4 promoter activity. A, Overexpres- more mature phenotypes (38). Considering the relatively weak af- sion of YY1 down-regulates CXCR4 promoter. A3.01 cells were cotransfected with either pGL-CXCR4(Ϫ357) (Ⅺ) or pGL-CXCR4⌬YY1 (F) finity of c-Myc protein to the CXCR4 promoter E box, we hy- along with the indicated amounts of pCMV-YY1. Total amounts of trans- pothesized that this oncoprotein may activate CXCR4 promoter fected plasmid DNA were adjusted by adding pCMV. Cells were incubated primarily through the relief of repression mediated by YY1, as has without any stimulation, and harvested 48 h after transfection for luciferase been reported in other promoter contexts (30). Our hypothesis was assays. Representative results from three independent experiments are supported by the results shown in Fig. 7. In contrast to c-Myc, shown. B, Mutation on the YY1 binding site increases CXCR4 promoter other bHLHZip transcription factors, USF1 and USF2, which have activity. A3.01 cells were transfected with 10 ␮g of either pGL- higher affinity for the CXCR4 promoter E box than does c-Myc CXCR4(Ϫ357), pGL-CXCR4⌬YY1, or pGL-CXCR4⌬E box as well as 10 and are not known to interact with YY1, appear to act through their ␮g of pCMV-␤-gal, incubated without any stimulation, and luciferase ac- direct binding to the E box. tivity was determined in the cell lysates 48 h after transfection. The ␤ Other cellular proteins associated with YY1 include cyclophilin amounts of cell lysates were standardized by -galactosidase activity in the lysates. Results are means and SDs from four independent experiments. A (CyPA) and FK506-binding protein 12 (39). These two proteins specifically interact with YY1 and alter its transcriptional activity, The Journal of Immunology 5991

acterization of the promoter regions for these cofactors will help delineate the molecular mechanisms that control their expression.

Acknowledgments We thank T. D. Littlewood, D. E. Ayer, M. Sawadogo, and T. Shenk for reagents, and J. Weddle for graphic work.

References 1. Fauci, A. S. 1996. Host factors and the pathogenesis of HIV-induced disease. Nature 384:529. 2. Nabel, G., and D. Baltimore. 1988. An inducible transcription factor activates expression of human immunodeficiency virus in T cells. Nature 326:711. 3. Ruocco, M. R., X. Chen, C. Ambrosino, E. Dragonetti, W. Liu, M. Mallardo, G. De Falco, C. Palmieri, G. Franzoso, I. Quinto, et al. 1996. Regulation of HIV-1 long terminal repeats by interaction of C/EBP (NF-IL6) and NF-␬B/Rel transcription factors. J. Biol. Chem. 271:22479. 4. Henderson, A. J., X. Zou, and K. L. Calame. 1995. C/EBP proteins activate FIGURE 7. c-Myc and YY1 mutually inhibit the transregulatory func- transcription from the human immunodeficiency virus type 1 long terminal repeat tions on the CXCR4 promoter. Forty million PBMCs were transfected with in macrophages/monocytes. J. Virol. 69:5337. ␮ Ϫ ␮ ␮ 5. Jones, K. A., J. T. Kadonaga, P. A. Luciw, and R. Tjian. 1986. Activation of the 20 g of pGL-CXCR4( 357), 10 g of pBpuro-c-myc-ER, and 10 gof AIDS retrovirus promoter by the cellular transcription factor Sp1. Science 232: Downloaded from either pCMV or pCMV-YY1. The transfected cells were either untreated 755. (control) or treated (Myc) with 10 nM of 4-hydroxytamoxifen 24 h after 6. d’Adda di Fagagna, F. D., G. Marzio, M. I. Gutierrez, L. Y. Kang, A. Falaschi, transfection. Cells were harvested 48 h after transfection for luciferase and M. Giacca. 1995. Molecular and functional interactions of transcription factor USF with the long terminal repeat of human immunodeficiency virus type 1. assays. Fold induction indicates luciferase activity relative to basal pro- J. Virol. 69:2765. moter activity. Results were representative of three independent 7. Nabel, G. J. 1993. The role of cellular transcription factors in the regulation of experiments. human immunodeficiency virus gene expression. In Human Retroviruses.

B. R. Cullen, ed. IRL Press, Oxford, pp. 49–73. http://www.jimmunol.org/ 8. Shrivastava, A., and K. Calame. 1994. An analysis of genes regulated by the multi-factorial transcriptional regulator Yin Yang-1. Nucleic Acids Res. 22:5151. 9. Margolis, D. M., M. Somasundaran, and M. R. Green. 1994. Human transcription and cyclosporin A and FK506 efficiently disrupt the YY1-CyPA factor YY1 represses human immunodeficiency virus type 1 transcription and virion production. J. Virol. 68:905. and YY1-FK506-binding protein 12 interactions, respectively 10. Romerio, F., M. N. Gabriel, and D. M. Margolis. 1997. Repression of human (39). It has also been shown that CyPA binds the HIV-1 Gag immunodeficiency virus type 1 through the novel cooperation of human factors protein, is specifically incorporated into HIV-1 virion particles, YY1 and LSF. J. Virol. 71:9375. 11. Alkhatib, G., C. Combadiere, C. C. Broder, Y. Feng, P. E. Kennedy, and is required for efficient uncoating of the virions after cellular P. M. Murphy, and E. A. Berger. 1996. CC CKR5: a RANTES, MIP-1␣, MIP-1␤ entry (40, 41). Therefore, it is possible that YY1 influences mat- receptor as a fusion cofactor for macrophage-tropic HIV-1. Science 272:1955. uration and uncoating of the HIV-1 virions through interaction 12. Choe, H., M. Farzan, Y. Sun, N. Sullivan, B. Rollins, P. D. Ponath, L. Wu, by guest on September 23, 2021 C. R. Mackay, G. LaRosa, W. Newman, et al. 1996. The ␤-chemokine receptors with CyPA. Furthermore, YY1 is one of a few cellular transcrip- CCR3 and CCR5 facilitate infection by primary HIV-1 isolates. Cell 85:1135. tion factors known to repress HIV LTR transcription activity (9, 13. Deng, D., R. Liu, W. Ellmeier, S. Choe, D. Unutmaz, M. Burkhart, P. DiMarzio, 10). Taken together, YY1 may affect replication of HIV-1 at sev- S. Marmon, R. E. Sutton, C. M. Hill, et al. 1996. Identification of a major coreceptor for primary isolates of HIV-1. Nature 381:661. eral different stages: it may inhibit viral fusion/entry through 14. Deng, H., D. Unutmaz, V. Kewal Ramani, and D. Littman. 1997. Expression down-regulation of expression of CXCR4, a fusion/entry cofactor cloning of new receptors used by simian and human immunodeficiency viruses. for T-tropic HIV-1; it may inhibit uncoating of virions through Nature 388:296. 15. Doranz, B. J., J. Rucker, Y. Yi, R. J. Smyth, M. Samson, S. C. Peiper, interaction with CyPA; and it may inhibit viral expression through M. Parmentier, R. G. Collman, and R. W. Dom. 1996. A dual-tropic primary down-regulation of HIV-1 LTR activity. It remains unknown HIV-1 isolate that uses fusin and the ␤-chemokine receptors CKR-5, CKR-3, and whether the transcription factors investigated in this study can ac- CKR-2b as fusion cofactors. Cell 85:1149. 16. Dragic, T., V. Litwin, G. P. Allaway, S. R. Martin, Y. Huang, K. A. Nagashima, tually modulate cell surface expression of CXCR4 and fusogenic- C. Cayanan, P. J. Maddon, R. A. Koup, J. P. Moore, and W. A. Paxton. 1996. ity of cells with T-tropic HIV Env; however, preliminary studies HIV-1 entry into CD4ϩ cells is mediated by the chemokine receptor CC-CKR-5. Nature 381:667. have shown that overexpression of YY1 can markedly decrease 17. Feng, Y., C. Broder, P. E. Kennedy, and E. A. Berger. 1996. HIV-1 entry co- cell surface expression of CXCR4 (D. Margolis, unpublished ob- factor: functional cDNA cloning of a seven-transmembrane G protein-coupled servation). Thus, it is likely that YY1-mediated down-regulation of receptor. Science 272:872. 18. Liao, F., G. Alkhatib, K. Peden, G. Sharma, E. Berger, and J. Farber. 1997. CXCR4 can modulate fusion/entry of T-tropic HIV-1. STRL33, a novel chemokine receptor-like protein, functions as a fusion cofactor Cellular entry is one of the critical events during the HIV-1 for both macrophage-tropic and T cell line-tropic HIV-1. J. Exp. Med. 185:2015. replication cycle. A recent study demonstrating that levels of ex- 19. Bleul, C. C., M. Farzan, H. Choe, C. Parolin, I. Clark-Lewis, J. Sodroski, and T. A. Springer. 1996. The lymphocyte chemoattractant SDF-1 is a ligand for pression of CCR5, a fusion/entry cofactor for macrophage-tropic LESTR/fusin and blocks HIV-1 entry. Nature 382:829. ϩ HIV-1 (11–13, 15, 16), correlate with infectability of CD4 T cells 20. Oberlin, E., A. Amara, F. Bachelerie, C. Bessia, J.-L. Virelizier, by macrophage-tropic HIV-1 in vitro (42) implies that levels of F. Arenzana-Seisdedos, O. Schwartz, J.-M. Heard, I. Clark-Lewis, D. F. Legler, et al. 1996. The CXC chemokine SDF-1 is the ligand for LESTR/fusin and pre- CXCR4 expression may also influence infectability of cells with vents infection by T-cell-line-adapted HIV-1. Nature 382:833. T-tropic HIV-1. In addition, from previous studies demonstrating 21. Amara, A., S. L. Gall, O. Schwartz, J. Salamero, M. Montes, P. Loetsher, that SDF-1, a natural ligand for CXCR4, inhibits cellular entry of M. Baggiolini, J.-L. Virelizier, and F. Arenzana-Seisdedos. 1997. HIV coreceptor down-regulation as antiviral principle: SDF-1␣-dependent internalization of the T-tropic HIV-1 (19, 20) as well as a recent study showing that a chemokine receptor CXCR4 contributes to inhibition of HIV replication. J. Exp. genetic variation in the SDF-1 gene is associated with prognosis of Med. 186:139. 22. Signoret, N., J. Oldridge, A. Pelchen-Matthews, P. J. Klasse, T. Tran, L. F. Brass, HIV disease (43), it is very likely that availability of functional M. M. Rosenkilde, T. W. Schwartz, W. Holmes, W. Dallas, et al. 1997. Phorbol CXCR4 is one of the critical parameters that determine the rate of esters and SDF-1 induce rapid endocytosis and down-modulation of the chemo- progression of HIV disease in vivo. Therefore, it is important to kine receptor CXCR4. J. Cell Biol. 139:651. 23. Loetscher, P., M. Sietz, M. Baggiolini, and B. Moser. 1996. Interleukin-2 regu- understand the molecular and cellular mechanisms whereby ex- lates CC chemokine receptor expression and chemotactic responsiveness in T pression of HIV fusion/entry cofactors is regulated. Further char- lymphocytes. J. Exp. Med. 184:569. 5992 REGULATION OF CXCR4 PROMOTER BY USF/c-Myc AND YY1

24. Moriuchi, M., H. Moriuchi, W. Turner, and A. S. Fauci. 1997. Cloning and 34. Moriuchi, H., M. Moriuchi, and A. S. Fauci. 1997. Cloning and analysis of the analysis of the promoter region of CXCR4, a coreceptor for HIV-1 entry. J. Im- promoter region for CCR5, a coreceptor for HIV-1 entry. J. Immunol. 159:5441. munol. 159:4322. 35. Bleul, C. C., L. Wu, J. A. Hoxie, T. A. Springer, and C. R. Mackay. 1997. The 25. McKnight, A., D. Wilkinson, G. Simmons, S. Talbot, L. Picard, M. Ahuja, HIV coreceptors CXCR4 and CCR5 are differently expressed and regulated on M. Marsh, J. A. Hoxie, and P. R. Clapham. 1997. Inhibition of human immu- human T lymphocytes. Proc. Natl. Acad. Sci. USA 94:1925. nodeficiency virus fusion by a monoclonal antibody to a coreceptor (CXCR4) is both cell type and virus strain dependent. J. Virol. 71:1692. 36. Luscher, B., M. Austin, A. Sommer, S. Hilfenhaus, and M. Henriksson. 1996. 26. Moriuchi, H., M. Moriuchi, and J. I. Cohen. 1994. The RING finger domain of Transcriptional regulation by the Myc-Max/Mad network. In Transcription Fac- the varicella-zoster virus open reading frame 61 protein is required for its tran- tors in Eukaryotes. A. G. Papavassiliou, ed. R. G. Land Company, New York. sregulatory functions. Virology 205:238. 37. Shrivastava, A., S. Saleque, G. V. Kalpana, S. Artandi, S. P. Goff, and K. Calame. 27. Littlewood, T. D., D. C. Hancock, P. S. Danielian, M. G. Parker, and G. I. Evan. 1993. Inhibition of transcriptional regulator Yin-Yang-1 by association with c- 1995. A modified oestrogen receptor ligand-binding domain as an improved Myc. Science 262:1889. switch for the regulation of heterologous proteins. Nucleic Acids Res. 23:1686. 38. Ayer, D. E., and R. N. Eisenman. 1993. A switch from Myc:Max to Mad:Max 28. Ayer, D. E., C. D. Laherty, Q. A. Lawrence, A. P. Armstrong, and heterocomplexes accompanies monocyte/macrophage differentiation. Genes Dev. R. N. Eisenman. 1996. Mad proteins contain a dominant transcription repression 7:2110. domain. Mol. Cell. Biol. 16:5772. 29. Meier, J. L., X. Luo, M. Sawadogo, and S. E. Straus. 1994. The cellular tran- 39. Yang, W.-M., C. J. Inouye, and E. Seto. 1995. Cyclophilin A and FKBP12 in- scription factor USF cooperates with varicella-zoster virus immediate-early pro- teract with YY1 and alter its transcriptional activity. J. Biol. Chem. 270:15187. tein 62 to symmetrically activate a bidirectional viral promoter. Mol. Cell. Biol. 40. Franke, E. K., H. E. H. Yuan, and J. Luban. 1994. Specific incorporation of 14:6896. cyclophilin A into HIV-1 virions. Nature 372:359. 30. Shi, Y., E. Seto, L.-S., Chang, and T. Shenk. 1991. Transciptional repression by 41. Thali, M., A. Bukovsky, E. Kondo, B. Rosenwirth, C. T. Walsh, J. Sodroski, and YY1, a human GLI-Kruppel-related protein, and relief of repression by adeno- H. G. Gottlinger. 1994. Functional association of cyclophilin A with HIV-1 viri- virus E1A protein. Cell 67:377. ons. Nature 372:363. 31. Moriuchi, H., M. Moriuchi, C. Combadiere, P. M. Murphy, and A. S. Fauci. ϩ 42. Wu, L., W. A. Paxton, N. Kassam, N. Ruffing, J. B. Rottman, N. Sullivan, 1996. CD8 T-cell-derived factor(s), but not ␤-chemokines RANTES, MIP-1␣,

H. Choe, J. Sodroski, W. Neuman, R. A. Koup, and C. R. Mackay. 1997. CCR5 Downloaded from and MIP-1␤, suppress HIV-1 replication in monocytes/macrophages. Proc. Natl. Acad. Sci. USA 93:15341. levels and expression pattern correlate with infectability by macrophage-tropic 32. Moriuchi, H., M. Moriuchi, and A. S. Fauci. 1997. Nuclear factor-␬B potently HIV-1, in vitro. J. Exp. Med. 185:1681. up-regulates the promoter activity of RANTES, a chemokine that blocks HIV 43. Winkler, C., W. Modi, M. W. Smith, G. W. Nelson, X. Wu, M. Carrington, infection. J. Immunol. 158:3483. M. Dean, T. Honjo, K. Tashiro, D. Yabe et al, ALIVE Study, Hemophilia Growth 33. Moriuchi, H., M. Moriuchi, and J. I. Cohen. 1995. Proteins and cis-acting ele- and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), ments associated with transactivation of the varicella-zoster virus (VZV) imme- Multicenter Hemophilia Cohort Study (MHCS), and San Francisco City Cohort diate-early gene 62 promoter by VZV open reading frame 10 protein. J. Virol. (SFCC). 1998. Genetic restriction of AIDS pathogenesis by an SDF-1 chemokine

69:4693. gene variant. Science 279:389. http://www.jimmunol.org/ by guest on September 23, 2021