Oncogene (1998) 17, 2573 ± 2583 ã 1998 Stockton Press All rights reserved 0950 ± 9232/98 $12.00 http://www.stockton-press.co.uk/onc A5'-CG-3'-rich region in the promoter of the transcriptionally frequently silenced RET protooncogene lacks methylated cytidine residues

Marc Munnes1, Giovanna Patrone2, Birgit Schmitz1, Giovanni Romeo2 and Walter Doer¯er1

1Institut fuÈr Genetik, UniversitaÈtzuKoÈln, D-50931 KoÈln, Germany; and 2UniversitaÁ di Genova, FacoltaÁ di Medicina e Laboratorio di Genetica Molecolare, Istituto G. Gaslini, I-16148 Genova, Italy

In a large proportion of familial and sporadic cases of Keywords: HSCR patients; RET protooncogene Hirschsprung disease (HSCR) mutations in the RET promoter; 5'-CG-3'-rich region in the RET promoter (rearranged during transfection) protooncogene have been described. We have investigated the structure of the RET gene promoter and have analysed a region of approximately 1000 nucleotides in its promoter and 5'- Introduction upstream segments for the occurrence of 5-methyldeoxy- cytidine (5-mC) residues by using the bisul®te protocol of The human RET protooncogene is controlled by a the genomic sequencing method. With an estimated promoter harboring several transcription factor sensitivity of about 93% of this technique, not a single binding sites (Itoh et al., 1992), such as four 5-mC residue could be detected in the control region of a tandemly repeated GC-boxes (Dynan and Tjian, gene that seems to be silenced or exhibit low activity in 1985), an ETF binding site (Kageyama et al., 1989) many adult tissues. In these experiments, the DNAs of and Sp1 and AP-2 binding sites. Most of these sites peripheral white blood cells (PWBC) from four healthy are located within the 5'-CpG-3'-rich region in individuals, from seven patients with familial HSCR, as proximity to the transcriptional start site. In a well as DNAs from di€erent human tissues and from a region of approximately 900 base pairs, 95 5'-CG-3' human embryonic kidney (HEK) cell line have been dinucleotide pairs are found of which the majority included. In a DNA segment starting 790 nucleotides are located within the putative promoter segment. upstream of the transcriptional start site of the RET Sequence-speci®c promoter methylation is frequently gene, a few 5-mC residues have been identi®ed. This responsible for the long-term inactivation of eukar- region possibly constitutes the transition site from an yotic genes (Doer¯er, 1983). During embryogenesis, unmethylated promoter to a more extensively methylated RET protooncogene expression is regulated in region in the human genome. The data presented are temporally and spatially strictly de®ned patterns remarkable in that a highly 5'-CG-3'-enriched segment of (Pachnis et al., 1993; Avantaggiato et al., 1994; the human genome with 49 5'-CG-3' dinucleotide pairs in Schuchardt et al., 1994, 1995; Tsuzuki et al., 1995). 400 bp within the putative promoter region is completely In most neural crest-derived tissues, RET protoonco- devoid of 5-mC residues, although this control region is gene expression can be detected during embryogen- not actively transcribed in most adult human tissues. By esis. In the kidney and the urogenital systems, the hybridization of a PCR-ampli®ed RET protooncogene RET gene is transcribed only at certain times during cDNA probe harboring exons 9 ± 15 to a membrane development. In most adult tissues the level of RET (Clontech) containing poly-A selected RNAs from 50 expression is very low, mRNA can be detected only di€erent human tissues, weak RET protooncogene in the adrenal medulla and in the cerebellum (Takaya expression in many of the neural cell derived tissues et al., 1996). Expression of the RET protooncogene has been detected. RNAs extracted from many other has been analysed in tumor tissues like neuroblasto- human tissues do not share sequence homologies to this ma, papillary thyroid carcinoma (PTC) (Bongarzone 32P-labeled probe. Mechanisms other than DNA methy- et al., 1994) or medullary thyroid carcinoma (MTC, lation obviously play the crucial role in the inactivation FMTC) in MEN2A patients. Some neuroblastoma of the RET gene promoter in these tissues. We have also cell lines overexpress the RET protooncogene (Ikeda demonstrated by the in vitro premethylation of a RET et al., 1990; Tahira et al., 1991), while most other promoter-chloramphenicol acetyltransferase (CAT) gene human cell lines analysed in culture show weak or no construct and transient transfection experiments into expression. neuroblastoma cells that the transcriptional activity of Hirschsprung disease (HSCR) (McKusick 249200) the RET promoter is decreased by HpaII (5'-CCGG-3') presumably results from an impaired development of methylation and abolished by SssI (5'-CG-3') methyla- neural crest-derived neurons of the enteric ganglia tion. Hence, the RET promoter region is sensitive to this during the a€ected individuals' ontogenetic develop- regulatory signal. However in vivo, DNA methylation of ment. Frequency is one in 5000 newborns with an as the promoter region seems not to be the predominant yet unexplained predominance of 3.75-fold among male regulatory mechanism for the RET protooncogene. individuals (Bodian and Carter, 1963; Okamoto and Possibly, in adults the RET gene can be occasionally Ueda, 1967; Goldberg, 1984; Badner et al., 1990; for a activated. recent review see Passarge, 1997). Extensive studies on the genetic origin of this congenital disorder have identi®ed several genes i.e. the RET protooncogene Correspondence: W Doer¯er (10q11.2), the gene for the endothelin-B receptor Received 26 January 1998; revised 1 June 1998; accepted 1 June 1998 (EDNRB) (13q22), glial cell line derived neurotrophic RET promoter and Hirschsprung disease M Munnes et al 2574 factor GDNF (5p12-13.1), endothelin 3 (EDN3) nucleotide sequence of the upstream regulatory (20q13.2), and possibly others to be involved in the segment (p6.3 clone) starting at position 75073 occurrence of the familial form of HSCR (Pu€enberger relative to the +1 transcriptional start site (Itoh et et al., 1994; Durbec et al., 1996; Hofstra et al., 1996; al., 1992) was determined (Patrone et al., 1997; Trupp et al., 1996). The major susceptibility gene for GenBank AF032124) in order to localize suitable 5'- the autosomal dominant form of HSCR appears to be CG-3' regions for the application of the genomic the RET protooncogene (Martucciello et al., 1991; sequencing protocol. The nucleotide sequence is Puliti et al., 1993; Lyonnet et al., 1994). presented in Figure 2. The schemes in Figure 1 We have studied the transcriptional activity of the illustrate relevant parts of the restriction map, and a RET gene in healthy and HSCR disease individuals survey of the 5'-CG-3' dinucleotides, HpaII and HhaI and have investigated the methylation status of the sites (vertical lines in Figure 1b) in the promoter and RET gene promoter in the same individuals. This very 5'-upstream sequence of the RET gene. The two 5'- 5'-CG-3'-rich promoter is transcriptionally inactive in CG-3'-rich regions I and II, that have been further many, though not all, human tissues. Nevertheless, in investigated by genomic sequencing, are designated as the promoter plus the 5'-upstream regions of the RET shaded areas in Figure 1b. The locations of gene, not a single 5-mC residue has been detected by individual primers used in the genomic sequencing applying the highly sensitive bisul®te protocol of the reactions are listed in Table 1. In the analysed genomic sequencing procedure. sequence of 900 nucleotides immediately upstream of the transcriptional start site of the RET gene, 95 5'- CG-3' dinucleotides are apparent. Upstream of this cluster, only 75 5'-CG-3' sequences are found in a Results stretch of 4300 nucleotide pairs. On the structure of the promoter of the human RET protooncogene Genomic sequencing: methylation analyses by the bisul®te protocol The promoter region of the RET protooncogene (Takahashi et al., 1985; Itoh et al., 1992) is CG-rich This previously described method (Frommer et al., (476%) with a 5'-CG-3' score of 0.93 (Gardiner- 1992; Clark et al., 1994) has been adapted in our Garden and Frommer 1987). A 6.3 kbp XhoI (X) ± laboratory and tested for its reliability in an earlier BamHI (B) fragment of the RET gene (Figure 1a,b) report (Zeschnigk et al., 1997). The following was subcloned into pBKSII (Stratagene). The additional critical control experiments to assess the

Figure 1 Physical map of the promoter region of the RET protooncogene. (a) Chromosomal location of the RET protooncogene at 10q11.2 ¯anked by the microsatellite markers D10S141 and s-TCL2 (Larimore et al., 1993). The cosmid clone R1 (Pasini et al., 1995) of approximately 50 kbp was used to obtain the 6.3 kbp Xho (X)-BamHI (B) fragment comprising the RET promoter region and part of exon 1. E - EcoRI sites. (b) SmaI (Sm) and SacII (S) restriction map of the 6.3 kbp fragment. The locations of the putative promoter region and of exon 1 are indicated at the bottom of the graph. The positions of all 5'-CG-3' dinucleotides, HhaI (5'-GCGC-3') and HpaII (5'-CCGG-3') sites are designated by j. The transcriptional start site marked as +1 has been determined earlier (Itoh et al., 1992). The shaded regions I and II illustrate the sequences analysed with the bisul®te method, ampli®ed by PCR, cloned and genomically sequenced. The two analysed regions are ¯anked by the PCR primers listed in Table 1. The shaded SmaI fragment designated 2.9 kbp probe has been used for hybridization in the experiment shown in Figure 4 RET promoter and Hirschsprung disease M Munnes et al 2575 reliability of the bisul®te conversion in the RET using the DNA methyltransferase M-HhaI(5'- promoter sequence have now been performed. GCGC-3'), M-HpaII (5'-CCGG-3')orM-SssI(5'- CG-3') as detailed elsewhere (Zeschnigk et al., (i) The plasmid p6.3-cloned promoter sequence of the 1997). The di€erent methylation patterns deter- RET protooncogene has been left unmethylated, mined after in vitro premethylation reveal the has been mock methylated with M-HpaII DNA- presence of 5-mC (®lled squares) at the expected methyltransferase in the absence of S-adenosyl- sites in promoter region II (Figure 3a). Based on methionine (SAM), or has been premethylated by the results of these control experiments, we

Figure 2 Nucleotide sequence of part of the RET promoter segment, between nucleotides 75076 and +226 in the cloned XbaI± BamHI fragment as determined by the dideoxy chain termination protocol (Sanger et al., 1977) in an ABI 377A or 373A automated sequencer. EMBL accession number AF032124. The 5'-CG-3' dinucleotides that have been analysed by the bisul®te method of genomic sequencing are printed in bold letters and underlined. The transcriptional start site (?) and the beginning of exon 1 with the amino acid sequence (shaded) are also indicated. The sequence overlaps the previously described promoter region (Takahashi et al., 1985; Itoh et al., 1992) and di€ers in a few nucleotides from the published data RET promoter and Hirschsprung disease M Munnes et al 2576 recognize the bisul®te protocol to reveal 93% of entire promoter region of the RET gene in 10 the methylated sequences. independently isolated and sequenced clones. In the (ii) Possible inadvertent contaminations of the geno- schematic presentation chosen, open squares designate mic human DNA with traces of unmethylated p6.3 T-residues, indicative of C-residues in the original plasmid could have been detected as demonstrated nucleotide sequence prior to the bisul®te treatment by by propagating all plasmids or cosmids in bacterial the genomic sequencing reactions, ®lled squares strains, such as XL1BlueMRF' (Stratagene). Its represent bisul®te-resistant 5-mC-residues in the dcm+ methylation system methylates the sequence original nucleotide sequence. Apart from randomly 5'-CCNGG-3' at the C-residue neighboring N. We distributed ®lled squares in singular clones, which we never found methylated 5'CCNGG-3' sites in interpret as PCR artifacts, evidence for the presence of genomic human DNA samples, and thus con- 5-mC residues in this sequence has not been obtained. ®rmed their purity. Control plasmids were Thus, surprisingly, the entire promoter region is devoid methylated at this site. of 5-mC in all DNA samples investigated, including (iii) We have redetermined the methylation patterns in DNA samples from peripheral white blood cells of the DNA from a Prader-Willi patient and a healthy individuals and HSCR patients. Moreover, control proband in the SNRPN segment of the DNAs from ®ve healthy individuals and seven HSCR Prader-Willi region located on human chromo- patients, from a human embryonic kidney cell line and some 15q11-13 and reproduced the results pre- several human tissues yield the same negative results sented earlier (Zeschnigk et al., 1997). (Table 2). It is concluded that the transcriptionally often inactivated RET protooncogene promoter lacks We conclude that the previously established genomic 5-mC residues in 900 nucleotide pairs 5'-upstream of sequencing protocol using bisul®te in the C to T the site of initiation of transcription. conversion reaction of all C-residues, except the methylated ones, in a nucleotide sequence can also be Transition to a more 5'-upstream located, methylated reliably applied to the analysis of the promoter of the region RET protooncogene. The pictograms in Figure 3b and c summarize the The nucleotide sequence immediately upstream of the results of the genomic sequencing experiments over the 900 nucleotide pair segment investigated by genomic

Table 1 The positions and nucleotide sequences of all primers used in the genomic sequencing experimentsa Map Region I Nucleotide sequence position (nt. numbers) ®rst PCR p1Itop 5'GG(CT)GAGAATAGAGGATTTTTTTATTGAGTTATA-3' 7959 to 7926 p1Ibottom 5'AATCC(AG)C(AG)CACCTAC(AG)CAAAACCACTCTTC-3' 7307 to 7336 second PCR p1IItop 5'-TTGGGGAAAATTGGATTTTTTTTTTTTTTTTAT-3' 7835 to 7800 p1IIbottom 5'-ACTTACAATCCCTACCTTTTACCCTTTCCAC-3' 7354 to 7384 Region Map Region II Nucleotide sequence position (nt. numbers) ®rst PCR p2Itop 5'-GGTTAGATTTGTATTT(CT)G(CT)GTAGTATTTTTG-3' 7428 to 7397 p2Ibottom 5'-CTCCCAGTCAACATCCCTC(AG)AAATAAAAACCC-3' +318 to +284 second PCR p2IItop 5'-T(CT)GTATT(CT)GGTTTTTGT(CT)GGGTTTTTTT(CT)GGTTG-3' 7267 to 7233 p2IIbottom 5'-TAAATAAC(AG)AATAC(AG)AAC(AG)CTCAATCTAACC(AG)CCC-3' +133 to +107 aThe map positions of Regions I and II are shown in Figure 1b. The nucleotide (nt) numbers refer to those in Figure 2. Nucleotide sequences of all primers used in the genomic sequencing analyses. For each region, both sets of primers used in nested PCR are shown. Top primers are located 5' of the analysed region, bottom primers at the 3' end. In some primer sequences, a 1:1 mixture of C and T or, on the bottom strand, of A and G has been used, at positions that contain 5'-CG-3' dinucleotides in the primer region, to achieve optimal annealing of the primers RET promoter and Hirschsprung disease M Munnes et al 2577

Figure 3 Absence of DNA methylation in the RET promoter sequence. (a) Control experiment: Distribution of 5-mC-residues in the in vitro premethylated plasmid p6.3 DNA from the promoter region of the RET protooncogene. Each horizontal lane demonstrates the occurrence (®lled squares) or the absence (open squares) of 5-mC in a typical clone of each type of control DNA. The di€erent DNA-methyltransferases used for premethylation are indicated at the right side of each lane. The HpaII (5'-CCGG-3', triangles) and HhaI(5'-GCGC-3', diamonds) DNA-methyltransferase recognition sites are indicated at the positions described in Figure 1b and in the nucleotide sequence shown in Figure 2. (b,c) The presence of 5-mC-residues in the two analysed 5'- and promoter regions of the RET protooncogene in DNA isolated from peripheral white blood cells (PWBC) was tested in DNA from healthy control individuals (b) or from HSCR patients (c). For each type of DNA sample, 10 independent clones (horizontal lanes of squares) were sequenced and analysed. The ®lled squares indicate the occurrence of an unconverted cytosine residue which has been derived from a 5-mC-residue in the original DNA sequence prior to bisul®te treatment. Each vertical column of squares presents the data for one 5'-CG-3' dinucleotide in the promoter sequence. For each patient, healthy control individual or tissue DNA, at least 10 independent clones have been analysed. Only part of the data has been reproduced here; all data have been summarized in Table 2 RET promoter and Hirschsprung disease M Munnes et al 2578 The activity of the RET protooncogene promoter is sequencing contains only 75 5'-CG-3' sequences among inhibited by DNA methylation in transfection and about 4300 nucleotide pairs. By dint of the reduced transient transcription experiments number of 5'-CG-3' dinucleotides in the segment between nt72000 and nt74500 (Figure 1b) and the The complete absence of 5-mC in the RET gene scarcity of HpaII (5'-CCGG-3')andHhaI(5'-GCGC- regulatory region prompted us to investigate whether 3') restriction sites, we decided to investigate the the transcriptional activity of the RET gene could be methylation status of that area by restriction analyses a€ected at all, e.g. by in vitro methylation. The with HpaII or HhaI followed by Southern blotting genomic segment between nucleotides73092 to +53 (Southern, 1975). A hybridization probe, a puri®ed contains multiple 5'-CG-3' sequences that can be 2.9 kb SmaI fragment of the p6.3 clone (Figure 1b, premethylated in vitro by the M-HpaII, M-HhaIor shaded segment) comprising the area of interest was the M-SssI DNA-methyltransferase as shown pre- used. The restriction pattern of MspI (M) (5'-CCGG- viously for several viral promoters (Kruczek and 3') was used as reference because of the enzyme's Doer¯er, 1983; Langner et al., 1984; Weisshaar et al., ability to cut even methylated DNA at the recognition 1988; Munnes et al., 1995). The CAT (chloramphenicol sites. The HpaII (H) and HhaI (Hh) patterns of this 5'- acetyltransferase) gene has been chosen as activity upstream DNA segment reveal intensely methylated indicator (Figure 5), and the neuroblastoma cell line restriction sites (Figure 4). Due to the abundance of 5'- CHP134 as a suitable recipient for transfection CG-3' sequences in the analysed area, some cross experiments. This cell line has been reported to be hybridization to unrelated parts of the genomic DNA able to express the RET protooncogene (Bunone et al., with a smeary appearance of the blots have to be 1995). The RET promoter-CAT reporter gene con- tolerated. We conclude that the genomic region struct has been methylated with M-HhaI(5'-GCGC-3'), starting at about nucleotide72000 and extending to M-HpaII (5'-CCGG-3') or the M-SssI(5'-CG-3') about74500 nucleotide pairs 5'-upstream of the RET DNA-methyltransferase. Mock-methylation experi- promoter is methylated at least in some of the 5'- ments have been performed with M-HhaI DNA- CCGG-3' and 5'-GCGC-3' sequences. This genome methyltransferase in the absence of SAM. The section possibly represents the site of transition from constructs (map in Figure 5) have been transfected the completely unmethylated RET promoter region to into CHP134 cells and CAT activity has been measured a more densely methylated area. at 48 h posttransfection. All transfections have been

Table 2 Summary of the results of genomic sequencing experiments in the RET promoter regiona Region I DNA source Methylation status una€ected probands n=2 female rarely methylated male rarely methylated HSCR patients n=2 TCA009 rarely methylated SAB rarely methylated

Region II DNA source Methylation status human tissues n=4 testes unmethylated sperm unmethylated chorion male unmethylated chorion female unmethylated

cell line HEK unmethylated una€ected probands n=4 male unmethylated female unmethylated HSCR patients n=7 TCA009 unmethylated HDC001 unmethylated HDC019 unmethylated HDF003 unmethylated HDF034 unmethylated EST unmethylated Figure 4 DNA methylation in a presumptive transition zone 5'- SAB unmethylated upstream of the promoter sequence. Experimental details are described in the text. An autoradiogram of a Southern blot has a Among the una€ected probands, males and females have been been reproduced. The DNA of two healthy individuals was analysed. The methylation status `unmethylated' derives from at least cleaved with restrictases as indicated: M (MspI), H (HpaII), Hh 10 independent clones that all show absence of methylation. The (HhaI), E (EcoRI). Cosmid RI was cleaved with EcoRI (lane 1). status `rarely methylated' refers to a few methylated 5'-CG-3' The SmaI fragment designated in Figure 1b was used as a 32P- dinucleotides in position 7780 nt. as shown for region I in Figure labeled hybridization probe which had been preannealed to 3b and c human cotI DNA. Size marker: l DNA cut with HindIII RET promoter and Hirschsprung disease M Munnes et al 2579 performed as cotransfections with the b-galactosidase in separate dots on a membrane (Clontech, Human expressing vector pCMV-b-gal to normalize CAT RNA Master blot) and hybridized to a 32P-labeled PCR reactions for transfection eciency. The RET proto- cDNA fragment corresponding to exons 9 ± 15 of the oncogene promoter exhibits activity levels in CHP134 RET protooncogene. Hybridization signals have been cells comparable to those of the early SV40 promoter obtained after a 16 h exposure in most neural crest- present in the SV40 promoter-CAT gene construct derived tissues and in brain (Figure 6). The strong (pSVCAT) used as control (Figure 5). Mock-methyla- signal in RNA from substantia nigra (Figure 6, panel tion does not signi®cantly alter the promoter activity, B3) may be due to the high density of motoneurons in HpaII methylation reduces promoter activity slightly, this tissue. Compared to the weak signal seen with while SssI methylation completely abolishes it. The total human control DNA (Figure 6a, panel H8), most HhaI methylated construct showed probably insigni®- of the faint signals obtained with RNAs from other cantly enhanced activity. Figure 5 summarizes the tissues can be considered evidence for very low, if any, results of ®ve di€erent experiments. activity. RNAs from all other sources lack sequences We conclude that the human RET promoter is homologous to the human RET protooncogene as sensitive to DNA methylation at 5'-CG-3' sites in vitro. detectable by Northern blot hybridization. These Transcriptional regulation of the RET gene mediated results are similar to previously published work by C-methylation is therefore possible and might be (Schuchardt et al., 1995; Takaya et al., 1996). operative during development as in many other Apparently, the RET gene is not eciently transcribed developmentally regulated genes (Constantinides et in most adult human tissues. al., 1977; for review Cedar and Razin, 1990).

Discussion In several adult human tissues and human cell lines the RET protooncogene is not or only weakly transcribed Mutations in the human RET protooncogene have It has been reported that the RET gene is not been implicated in the causation of familial and transcribed in adult human tissues but is expressed sporadic cases of HSCR (Attie et al., 1995). These during embryonic development in a variety of mutations are frequently associated with autosomal vertebrates (Pachnis et al., 1993; Avantaggiato et al., dominant inheritance of the disease in families 1994; Schuchardt et al., 1995). We have investigated (Ceccherini et al., 1994; Romeo et al., 1994). It is poly A-selected RNA samples extracted from 50 also of interest that certain mutations occur in families human tissues. These RNAs have been immobilized a‚icted by both HSCR and MEN2a (Kambouris et

Figure 5 The RET promoter can be inactivated by sequence-speci®c DNA methylation. Top: The bar graphs summarize the results of ®ve di€erent experiments in which CAT activities have been measured after the transfection of unmethylated, mock-methylated or di€erently methylated RET promoter-CAT gene constructs into the human neuroblastoma cell line CHP134. The ordinate refers to relative activities. Experimental details have been described in the text. Bottom: Restriction map of the RET promoter region with the locations of a BglII and MaeII restriction site, which have been used for subcloning a *3 kbp fragment in front of the chloramphenicol-acetyl-transferase (CAT) reporter gene. This BglII ± MaeII fragment contains the 5' and promoter regions of the RET gene found to be unmethylated in all analysed DNA samples (see Figure 3). Several SmaI sites are also indicated RET promoter and Hirschsprung disease M Munnes et al 2580

Figure 6 Lack or low levels of RET gene-speci®c signals in RNA from several human tissues and cell lines. (a) Autoradiogram (16 h exposure) of a Northern Human Master Blot (Clontech) hybridized against a 32P-labeled PCR fragment spanning exon 9 ± 15 of the RET protooncogene. The RET protooncogene expression ranges from moderate levels in tissue samples from substantia nigra (B3) to not detectable by the Northern blot technique in tissues as peripheral leukocytes (panel E6), testis (panel D1), or kidney (panel E1), that have been analysed by the bisul®te protocol of the genomic sequencing method in this study. The strongest signals are detectable in neural cell-derived tissues. (b) Panel of 50 tissue-speci®c RNA samples distributed into single spots on a positively charged membrane as used in the experiment shown in (a). Lane H contains control RNA and DNA samples from yeast, E.coli or humans

al., 1996). The RET protooncogene is transcriptionally silenced (Ikeda et al., 1990; Nagao et al., 1990; active during certain stages of embryonic development, Szentirmay et al., 1990). Of course, it is unknown but frequently silenced in many adult human tissues whether the RET gene might be occasionally activated and human cell lines in culture. It has therefore been under certain conditions. Nevertheless, the long-term worth investigating to what extent the promoter of the inactivation of this gene might be independent of a long-term inactivated RET protooncogene is methy- sequence-speci®c methylation pattern. Other conven- lated. When complemented by appropriate control tionally discussed factors, like proteins bound to experiments with in vitro speci®cally premethylated speci®c promoter motifs, e.g. AP2, Sp1 or ETF, or DNA constructs (Figure 3a) and when based on the a certain structure of the promoter within the bounds sequencing of a sucient number of cloned PCR of a higher chromatin order, could be contributing products, the bisul®te protocol of the genomic elements of maintaining the quiescent state of this sequencing method (Frommer et al., 1992) has proved regulatory domain. Transcription factor binding sites a reliable and ecient method to determine DNA Krox-20 or -24 (Patrone et al., 1997) may also play a methylation patterns in the human genome (Clark et role. It is a matter of conjecture whether the high 5'- al., 1994; Zeschnigk et al., 1997; this study). CG-3' density in the region itself contributes to the The putative RET promoter segment carries 49 5'- structural characteristics of this domain. CG-3' dinucleotides in a stretch of some 400 With this remarkable promoter structure, it has been nucleotide pairs. This segment can be considered a important to assess experimentally whether this 5'-CG-3' rich promoter. Our analyses on the occur- promoter could be inactivated by sequence-speci®c rence of 5-mC residues in a region of about 900 methylation in transfection and transient expression nucleotide pairs in the RET promoter plus 5'- experiments. In similar studies on the activity and upstream regions with the genomic sequencing methylation-mediated inactivation of viral promoters, method have revealed the total absence of this we and others have developed this technique more than modi®ed nucleotide (Figure 3b,c; Table 2). This a decade ago (e.g., Keshet et al., 1985; Kruczek and result pertained to the DNAs from several human Doer¯er, 1983; Langner et al., 1984; Weisshaar et al., tissues of healthy and HSCR individuals and to the 1988; Munnes et al., 1995). The promoter, whose DNA from human cell lines. In a series of studies on sensitivity towards sequence-speci®c methylation had DNA methylation patterns in the human genome to be challenged, has been frequently fused to the performed in our laboratory (Kochanek et al., 1990, procaryotic CAT gene (Gorman et al., 1982). The 1993; Behn-Krappa and Doer¯er, 1993; Zeschnigk et relevant experiments performed with a RET promoter- al., 1997), the RET gene promoter is the ®rst DNA CAT gene construct (Figure 5) demonstrate that the region of considerable size that completely lacks 5-mC RET gene promoter activity can be inhibited by 5'- residues. This ®nding is particularly remarkable in CCGG-3' (M-HpaII) methylation, but can be com- that this DNA segment appears to be frequently pletely silenced by 5'-CG-3' (M-SssI) methylation. RET promoter and Hirschsprung disease M Munnes et al 2581 Hence, the RET promoter is capable of responding to promoter and exon 1 of the RET protooncogene was C-residue modi®cations, although this instrument of subcloned into pBluescript II (Stratagene). Maps of the long-term silencing appears not to be used in the plasmids, cosmids or subclones used were presented in human tissues and cell lines investigated. Figures 1 and 5. The absence of 5-mC residues in the RET promoter has been noted in the DNA from tissues Determination of the nucleotide sequence of the clone p6.3 and of both healthy and HSCR individuals (Figure 3b,c, of the cloned PCR products Table 2). It is also worth noting that in a segment of The p6.3 genomic fragment containing the 5'-upstream genomic DNA starting at about72000 nucleotides 5'- region of the RET gene was sequenced as described upstream of the transcriptional start site of the RET elsewhere (Patrone et al., 1997). The nucleotide sequences protooncogene, 5-mC residues can be detected in 5'- of the cloned PCR products generated by the bisul®te CCGG-3' (HpaII) and 5'-GCGC-3' (HhaI) sites. protocol of genomic sequencing experiments were deter- Could this region represent a transitory segment of mined by using the sequencing primers SP6, T3 and a 19 human DNA between an area devoid of 5-mC and a nucleotide universal primer in the automated Applied more completely methylated domain in the human Biosystems DNA Sequencer 373A or 377A. genome. The data on the transcription of the RET protooncogene in di€erent human tissues reveal low Genomic sequencing by the bisul®te protocol to moderate levels of RET-speci®c polyadenylated Bisul®te treatment (Frommer et al., 1992; Clark et al., RNA in cerebellum, cerebral cortex, medulla oblonga- 1994) of genomic DNA (5 mg) and plasmid or cosmid DNA ta, occipital lobe, substantia nigra, temporal lobe, (10 pg mixed with 5 mg unspeci®c DNA) was performed thalamus, subthalamic nucleus, spinal cord, and after cleavage with the restriction enzyme EcoRI or BamHI adrenal gland (Figure 6). Thus, most neural tissues exactly as described earlier (Zeschnigk et al., 1997). PCR show some transcription of the RET gene in the adult. was performed in a Perkin-Elmer 480 thermocycler under the following conditions: 1 cycle for 5 min at 948C, 30 There are very weak signals with RNAs from a few cycles for 1 min at 948C ± 1 min at 558C ± 2 min at 728C, additional tissues. We pursue the possibility that followed by 1 cycle for 3 min at 728C. transcription of the RET protooncogene may not be completely and permanently silenced. It is conceivable that at certain times, even in adult life, RET transcripts Analysis of human tissue RNAs for the presence of RET may be required, possibly only in certain cell types of gene-speci®c signals organs such as the liver or the prostate. This concept is PCR products have been ampli®ed from 50 pg of cloned consistent with the very low, if any, transcription in RET protooncogene cDNA under the following conditions: some of these organs. Moreover, this notion would 1.8 mM Mg2+,50mM KCl, 10 mM Tris-HCl, pH 9.0, 0.1% explain the lack of promoter methylation since that Triton X-100, 1.2 mM of each primer modi®cation is usually used in long-term promoter inactivation which is inadvertent for genes whose F: CACTGCGATGTTGTGGAGAACC function is occasionally required. R: TCCGAAATCTTCATCTTCCGC. Cycle conditions (35 cycles) were 30 s at 958C, 30 s at 648C, 45 s at 728C (Perkin-Elmer PE9600). Subsequently, the PCR fragments were puri®ed by electrophoresis on a 2% Material and methods agarose gel, extracted with QiaSpin gel extraction columns, and 32P-labeled by standard procedures for 16 h at 378C. This Patients probe was hybridized to RNAs on a RNA-Master Blot The Hirschsprung disease (HSCR) patients whose DNA (Clontech # 7770-1) at 688C for 16 h. The RNA membrane was investigated in this paper were phenotypically had been precoated with salmon sperm DNA. After characterized. Linkage studies implied involvement of the hybridization, the membrane was washed three times in RET locus in these families. The molecular analyses of the 26SSC, 1% SDS, each for 10 min at 688C. After control DNA samples were described in detail elsewhere exposure, the ®lter was washed again in 0.16SSC, 0.5% SDS (Ceccherini et al., 1993, 1994). for 10 min at 688C.

Cell lines In vitro premethylation of the p6.3 plasmid DNA and of the The DNA of a human embryonic kidney (HEK) cell line RET gene promoter-CAT gene constructs was analysed with the method of genomic sequencing. In As an internal control for the bisul®te treatment of DNA, tests for the transient expression of several di€erent RET 10 pg of M-HpaII, M-HhaIorM-SssI premethylated or promoter-CAT gene constructs, a RET gene-expressing mock-methylated p6.3 plasmid was mixed with 5 mg human neuroblastoma cell line CHP 134 (Bunone et al., herring sperm DNA and used in the genomic sequencing 1995) was transfected. All cell lines were grown in reactions. The in vitro methylation was performed by using Dulbecco minimal essential medium (DMEM) supplemen- 10 U of one of the DNA-methyltransferases per 1 mgDNA ted with antibiotics and 10% fetal calf serum (FCS). andbyincubationfor16hat378C as described earlier (Munnes et al., 1995). The plasmids used in transfection DNA preparations, plasmids and cosmids and transient transcription experiments were incubated with 4 U of DNA-methyltransferases per mgDNA. Genomic DNAs from peripheral white blood cells and the Complete premethylation was ascertained by cleavage HEK cell line were prepared as described elsewhere with the appropriate restriction endonucleases followed (Kunkel et al., 1977; Kochanek et al., 1993, respectively). by polyacrylamide gel electrophoresis. For mock-methyla- A6.3kbXhoI ±BamHI fragment from the 3'-partofthe tion experiments, the methyldonor S-adenosylmethionine cosmid RI (Pasini et al., 1995) including the putative (SAM) was omitted. RET promoter and Hirschsprung disease M Munnes et al 2582 Transfection and transient expression experiments using tion experiments and their evaluation were described by unmethylated, methylated or mock-methylated RET gene Patrone et al. (1997). promoter-CAT gene constructs For transient expression experiments, we used the promoter construct pRET promoter-CAT gene containing Acknowledgements the genomic region from73092 to +53 of the RET locus We are grateful to Alexander M Holschneider, KoÈ ln for (Figure 2) in the promoter-less pCATBasic vector identifying families with HSCR disease and to the families (Promega). The 6.3 kb XhoI±BamHI fragment was partly for providing blood samples. MM is indebted to Michael cleaved with MaeII restriction endonuclease. A 5109 bp Zeschnigk, formerly of this laboratory, for introducing him fragment comprising nucleotides75056 to +53 of the RET to the genomic sequencing technique. This research was locus was isolated, cloned into the ClaIsiteofthe supported by the Bundesministerium fuÈ r Bildung, Wis- pBluescript vector (Stratagene) and subsequently trans- senschaft, Forschung und Technologie, Bonn through the ferredintotheXbaI±HindIII site of the pCATBasic vector. Center for Molecular Medicine KoÈ ln, TP13, and at a later pRET promoter-CAT is a deletion clone derived fom this stage by the Fritz Thyssen-Stiftung, KoÈ ln, AZ 97-2068 to longer promoter construct by HindIII ± BglII cleavage, WD. The Italian Association for Cancer Research (AIRC) blunting and subsequent ligation. Details of the transfec- awarded a fellowship to GP.

References

Attie T, Pelet A, Edery P, Eng C, Mulligan LM, Amiel J, Ikeda I, Shizaka I, Tahira T, Suzuki T, Onda M, Sugimura T Boutrand L, Beldjord C, Nihoul-Fe ke te C, Munnich A, and Nagao M. (1990). Oncogene, 5, 1291 ± 1296. Ponder BAJ and Lyonnet S. (1995). Hum. Mol. Genet., 4, Itoh F, Ishizaka Y, Tahira T, Yamamoto M, Miya A, Imai 1381 ± 1386. K, Yachi A, Takai S, Sugimura T and Nagao M. (1992). Avantaggiato V, Dathan NA, Grieco M, Fabien N, Lazzaro Oncogene, 7, 1210. D, Fusco A, Simeone A and Santoro M. (1994). Cell Kageyama R, Merlino GT and Pastau I. (1989). J. Biol. Growth Di€er., 5, 305 ± 311. Chem., 254, 15508 ± 15514. Badner JA, Sieber WK, Garver KL and Chakravarti A. Kambouris M, Jackson CE and Feldman GL. (1996). Hum. (1990). Am.J.Hum.Genet.,46, 568 ± 580. Mutat., 8, 64 ± 70. Behn-Krappa A and Doer¯er W. (1993). Hum. Mol. Genet., Keshet I, Yisraeli J and Cedar H. (1985). Proc. Natl. Acad. 2, 993 ± 999. Sci. USA, 82, 2560 ± 2564. Bodian M and Carter CO. (1963). Ann. Hum. Genet., 26, Kochanek S, Toth M, Dehmel A, Renz D and Doer¯er W. 261 ± 277. (1990). Proc. Natl. Acad. Sci. USA, 87, 8830 ± 8834. Bongarzone I, Butti MG, Coronelle S, Borello MG, Santoro Kochanek S, Renz D and Doer¯er W. (1993). EMBO J., 12, M, Modellini P, Pilotti S, Fusco A, Della Porta G and 1141 ± 1151. Pierotti MA. (1994). Cancer Res., 54, 2979 ± 2985. Kruczek I and Doer¯er W. (1983). Proc. Natl. Acad. Sci. Bunone G, Borrello MG, Picetti R, Bongarzone I, Peverali USA, 80, 7586 ± 7590. FA, de Franciscis V, Della Valle G and Pierotti MA. Kunkel IM, Smith KD, Boyer SH, Borgaonkor DS, Wachtel (1995). Exp. Cell Res., 217, 92 ± 99. SS, Miller OJ, Breg WR, Jones Jr HW and Rary JM. CeccheriniI,BocciardiR,LouY,PasiniB,HofstraR, (1977). Proc. Natl. Acad. Sci. USA, 74, 1245 ± 1249. Takahashi M and Romeo G. (1993). Biochem. Biophys. Langner K-D, Vardimon L, Renz D and Doer¯er W. (1984). Res. Comm., 196, 1288 ± 1295. Proc. Natl. Acad. Sci. USA, 81, 2950 ± 2954. CeccheriniI,HofstraRMW,LuoY,StulpRP,BaroneV, Larimore TC, Dou S, Howe JR, Chi D, Carlson K, Veile R, Stelwagen T, Bocciardi R, Nijven H, Bolino A, Seri M, Mishra SK, Wells Jr SA and Donis-Keller H. (1993). Proc. Ronchetto P, Pasini B, Bozzano M, Buys CHCM and Natl. Acad. Sci. USA, 90, 492 ± 496. Romeo G. (1994). Oncogene, 9, 3025 ± 3029. Lyonnet S, Edery P, Mulligan LM, Pelet A, Dow E, Abel L, Cedar H and Razin A. (1990). Biochim. Biophys. Acta, 1049, Holder S, Nihoul-Fe ke te C, Ponder BA and Munnich A. 1±8. (1994). C. R. Acad. Sci. III, 317, 358 ± 362. Clark SJ, Harrison J, Paul CL and Frommer M. (1994). Martucciello G, Bicocchi MP, Dodero P, Lerone M, Slingo Nucleic Acids Res., 22, 2990 ± 2997. Cirillo M, Puliti A, Gimelli G, Romeo G and Jasonni V. Constantinides PG, Jones PA and Gevers W. (1977). Nature, (1991). Pediatr. Surg. Int., 7, 308 ± 310. 267, 364 ± 366. Munnes M, Schetter C, HoÈ lker I and Doer¯er W. (1995). J. Doer¯er W. (1983). Annu. Rev. Biochem., 52, 93 ± 124. Virol., 69, 2240 ± 2247. Durbec P, Marcos-Gutierrez C, Kilkenny C, Grigoriou M, Nagao M, Shizaka Y, Nakagawara A, Kohno K, Kuwano Wartiowaara K, Suvanto P, Ponder B, Costantini F, M, Tahira T, Itoh F, Ujedam U and Sugimura T. (1990). Saarma M, Sariola H and Pachnis V. (1996). Nature, 381, Jpn. J. Cancer Res., 81, 309 ± 312. 785 ± 789. Okamoto E and Ueda T. (1967). J. Pediatr. Surg., 2, 437 ± Dynan WS and Tjian R. (1985). Nature, 316, 774 ± 778. 485. Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Pachnis V, Mankoo B and Constantini F. (1993). Develop- Grigg GW, Molloy PL and Paul CL. (1992). Proc. Natl. ment, 119, 1005 ± 1017. Acad. Sci. USA, 89, 1827 ± 1831. Pasini B, Hofstra RM, Yin L, Bocciardi R, Santamaria G, Gardiner-Garden M and Frommer M. (1987). J. Mol. Biol., Grootscholten PM, Ceccherini I, Patrone G, Priolo M, 196, 261 ± 282. Buys CH and Romeo G. (1995). Oncogene, 11, 1737 ± Goldberg EL. (1984). Int. J. Epidemiol., 13, 479. 1743. Gorman CM, Mo€at LF and Howard BH. (1982). Mol. Cell. Passarge E. (1997). In: Principles and Practice of Medical Biol., 2, 1044 ± 1051. Genetics, third edition. Rimoin DL, Connor JM and Hofstra RMW, Osinga J, Tan-Sindhunata G, Wu Y, Pyeritz RE (eds), pp 1527 ± 1532. Kamsteeg E-J, Stulp RP, van Ravenswaaij-Arts C, Patrone G, Puliti A, Bocciardi R, Ravazzolo R and Romeo Majoor-Krakauer D, Angrist M, Chakravarti A, Meijers G. (1997). FEBS Letts, 419, 76 ± 82. C and Buys CHCM. (1996). Nature Genetics, 12, 445 ± 447. RET promoter and Hirschsprung disease M Munnes et al 2583 Pu€enberger EG, Hosoda K, Washington SS, Nakao K, Tahira T, Ishizaka Y, Itoh F, Nakayasu M, Sugimura T and deWit D, Yanagisawa M and Chakravarti A. (1994). Cell, Nagao M. (1991). Oncogene, 6, 2333 ± 2338. 79, 1257 ± 1266. Takahashi M, Ritz J and Cooper GM. (1985). Cell, 42, 581 ± Puliti A, Covone AE, Bicocchi MP, Bolino A, Lerone M, 588. Martucciello G, Jasonni V and Romeo G. (1993). TakayaK,YoshimasaT,AraiH,TamuraN,MiyamotoY, Cytogenet. Cell Genet., 63, 102 ± 106. Itoh H and Nakao K. (1996). J. Mol. Ped., 74, 617 ± 621. Romeo G, Ronchetto P, Luo Y, Barone V, Seri M, Trupp M, Arenas E, Fainzilber M, Nilsson AS, Sieber BA, Ceccherini I, Pasini B, Bocciardi R, Lerone M, Grigoriou M, Kilkenny C, Salazar-Grueso E, Pachnis V, KaÈ aÈ riaÈ inen H and Martuciello G. (1994). Nature, 367, ArumaÈ e U, Sariola H, Saarma M and Iba nez CF. (1996). 377 ± 378. Nature, 381, 785 ± 789. Sanger F, Nicklen S and Coulson AR. (1977). Proc. Natl. Tsuzuki T, Takahashi M, Asai N, Iwashita T, Matsuyama M Acad. Sci. USA, 74, 5463 ± 5467. and Asai J. (1995). Oncogene, 10, 191 ± 198. Schuchardt A, D'Agati V, Larsson-Blomberg L, Constantini Weisshaar B, Langner K-D, JuÈ ttermann R, MuÈ ller U, Zock F and Pachnis V. (1994). Nature, 367, 380 ± 383. C, Klimkait T and Doer¯er W. (1988). J. Mol. Biol., 202, Schuchardt A, Srinivas S, Pachnis V and Constantini F. 255 ± 270. (1995). Oncogene, 10, 641 ± 649. Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke Southern EM. (1975). J. Mol. Biol., 98, 503 ± 517. B and Doer¯er W. (1997). Hum. Mol. Genet., 6, 387 ± 395. Szentirmay Z, Eshizaka Y, Ohgaki H, Tahira T, Nagao M and Esumi H. (1990). Oncogene, 5, 701 ± 705.