DOCSLIB.ORG

Advanced Staining Catalog Novocastratm IHC Antibodies, Probes & Leica BOND Reagents

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Advanced Staining Catalog Novocastratm IHC Antibodies, Probes & Leica BOND Reagents Advanced Staining Catalog NovocastraTM IHC Antibodies, Probes & Leica BOND Reagents 2014 USA Edition Pathologists see the difference Over 20 Years of Expertise: Trust our IHC and ISH solutions to deliver quality results Leica’s dedication to immunohistochemistry has led to significant developments in advanced staining. Novocastra reagents deliver the high quality advanced stained slides that pathologists rely on. See the difference... t Optimized for high-quality staining – Confidence in interpretation for diagnosis Novocastra antibodies, in combination with t Flexible formats and sizes – Reduce costs, save time the Leica BOND platforms provide a fully t Robust antibody performance – Right first time, minimizing repeats integrated and automated approach to your advanced staining process. t Extensive antibody and reagent portfolio – One stop shop for all your IHC requirements Your complete solution – fully automated, fully integrated and ready to go. Confidence - Highly specific Speed - Reduce turnaround time Quality - Novocastra and BOND and sensitive compact polymer and increase workflow efficiency Ready-to-Use Antibodies detection systems with Leica BOND automation Don’t just take our word for it, see the results for yourself. SEE THE DIFFERENCE Contact your local Leica Representative to arrange your evaluation. FOR YOURSELF Visit www.LeicaBiosystems.com/contact Leica Biosystems is bringing the Laboratory of Tomorrow to you Follow the EXPERIENCELAB Online www.LeicaBiosystems.com/experiencelab Contents All BOND and Novocastra reagents can be found by going to the sections listed below. To quickly find antibody and ordering information, there is an Antibody Index Guide opposite. BOND Reagents and Consumables........................ 21 Novocastra Primary Antibodies........................... 87 Novocastra Manual Detection Systems .................. 195 Novocastra ISH Reagents/Probes........................ 201 Novocastra ASR Probes ................................. 205 Novocastra Epitope Retrieval Reagents and Buffers....... 207 OriginTM Reagents........................................211 PowerVision............................................ 217 Product Name Index .................................... 221 Reagent Ordering Information ...........................228 Use the simple Antibody Index Guide on the following pages to quickly view clones, formats, sizes and ordering codes. Page 165 Detailed information about each clone can be found by simply going to the page number listed. Use this Antibody Index Guide to quickly view clones, formats, sizes and ordering codes. Ordering code for: Page Description Clone Lyophilized Lyophilized Liquid Liquid Manual RTU BOND RTU 0.1 mL 1 mL 0.1 mL 1 mL 7 mL 7 mL 92 Adenomatous Polyposis Coli Protein EMM43 APC (APC) 88 Adenovirus 10/5.1.2 ADENO 88 Akt (Phosphorylated) LP18 AKT-PHOS-L-CE-S AKT-PHOS-L-CE 88 ALK (Anaplastic Lymphoma Kinase) 5A4 ALK-CE-S ALK-CE ALK-L-CE-S ALK-L-CE-H PA0306 (CD246) (p80) (0.5 mL) 89 Alpha-1-antitrypsin Polyclonal A1AP-A 89 Alpha-Actinin RBC2/1B6 ALPHA-ACT 89 Alpha B Crystallin G2JF ABCRYS-512 89 Alpha-Catenin 25B1 A-CAT 90 Alpha Fetoprotein C3 AFP-S AFP PA0963 90 Alpha Smooth Muscle Actin (SMA) ASM-1 SMA-CE SMA-R-7-CE PA0943 90 Alpha-Synuclein KM51 ASYN ASYN-L 90 Amyloid P Protein B5 AMP 91 Amyloid Precursor Protein 40.10 APP 88 Anaplastic Lymphoma Kinase (ALK) 5A4 ALK-CE-S ALK-CE ALK-L-CE-S ALK-L-CE-H PA0306 (CD246) (p80) (0.5 mL) 91 Androgen Receptor 2F12 AR-2F12 91 Androgen Receptor AR27 AR-318-CE-S AR-318-CE 91 APAF (Apoptosis Protease Activating Polyclonal APAF1 Factor 1) 92 APC (Adenomatous Polyposis Coli EMM43 APC Protein) 121 Apolipoprotein J (Clusterin) 7D1 CLUSTERIN 91 Apoptosis Protease Activating Factor 1 Polyclonal APAF1 (APAF) 92 Aurora Kinase 2 JLM28 AK2-L-A 92 B Cell Marker (MB2) MB2 MB2 92 B Cell Specific Octamer Binding Protein-1 TG14 BOB-1-L-A PA0558 (BOB-1) 93 Bcl-2 Oncoprotein 3.1 BCL-2-486-S BCL-2-486 93 Bcl-2 Oncoprotein BCL-2/100/D5 BCL-2-CE-S BCL-2-CE BCL-2-L-CE BCL-2-R-7-CE PA0117 93 Bcl-3 Oncoprotein 1E8 BCL-3 93 Bcl-6 Oncoprotein LN22 BCL-6-564-L-CE-S BCL-6-564-L-CE PA0204 93 Bcl-6 Oncoprotein P1F6 BCL-6-S BCL-6 94 Bcl-w 6C1 BCL-W 94 Bcl-x NC1 BCL-X 94 Beta 2 microglobulin Polyclonal B2MP 94 Beta Amyloid 6F/3D B-AMYLOID 95 Beta-Catenin 17C2 B-CAT B-CAT-L-U PA0083 Red Box = IVD Products in this catalog are subject to regulatory approval. Please consult your Leica Biosystems representative for availability in your region. / 6 ANTIBODY INDEX GUIDE Ordering code for: Page Description Clone Lyophilized Lyophilized Liquid Liquid Manual RTU BOND RTU 0.1 mL 1 mL 0.1 mL 1 mL 7 mL 7 mL 95 Beta-Dystroglycan 43DAG1/8D5 B-DG-CE-S B-DG-CE 105 BL-CAM (CD22) FPC1 CD22-2-S CD22-2 PA0249 137 Blood Coagulation Factor XIIIa E980.1 FXIIIA-L-U PA0449 (Factor XIIIa) 92 BOB-1 (B Cell Specific Octamer Binding TG14 BOB-1-L-A PA0558 Protein-1) 96 CA19-9 (Sialyl Lewisa) C241:5:1:4 CA19-9 CA19-9-L PA0424 96 CA125 (Ovarian Cancer Antigen) OV185:1 CA125-CE CA125-L-CE CA125-R-7-CE PA0539 96 Calbindin KR6 CALBINDIN 97 Calcitonin Polyclonal CALP (0.5mL) PA0406 97 Calcitonin CL1948 CALCITONIN-L-CE- CALCITONIN-L-CE S 97 Calpain CALP3C/11B3 CALP-11B3 (2.5 mL) 97 Calpain CALP3C/12A2 CALP-12A2-S CALP-12A2 (2.5 mL) 97 Calpain CALP3D/2C4 CALP-2C4 (2.5 mL) 97 Calponin (Basic) 26A11 CALPONIN-B-A PA0416 98 Calretinin (5A5) 5A5 CALRETININ-CE-S CALRETININ-CE CALRETININ-L-CE CALRETININ-R-7- CE 98 Calretinin (CAL6) CAL6 CALRET566-L-CE-S CALRET566-L-CE PA0346 98 Carbonic Anhydrase IX TH22 CAIX-L-CE-S CAIX-L-CE 98 Carboxypeptidase M 1C2 CPMM 98 Carcinoembryonic Antigen (CD66e) 12-140-10 CEA-2-L-U PA0004 123 Caspase-3 (CPP32) JHM62 CPP32-S CPP32 99 Caspase-8 11B6 CASP-8 99 Cathepsin B CB131 CATH-B 99 Cathepsin D C5 CDM-S CDM 99 Cathepsin G 19C3 CATH-G 100 Caveolin-1 4D6 CAVEOLIN-1-L 100 CD1a JPM30 CD1A-220-S CD1A-220 100 CD1a MTB1 CD1A-235-CE-S CD1A-235-CE CD1A-235-L-CE-S CD1A-235-L-CE CD1A-235-R-7-CE PA0235 CD1A-235-L-CE-H (0.5 mL) 100 CD2 (LFA-2) AB75 CD2-271-CE-S CD2-271-CE CD2-271-L-CE CD2-271-R-7-CE 100 CD2 (LFA-2) 11F11 PA0271 101 CD3 LN10 CD3-565-L-CE-S CD3-565-L-CE PA0553 101 CD3 PS1 CD3-PS1-CE-S CD3-PS1-CE CD3-PS1-L-CE CD3-PS1-R-7-CE 101 CD3 UCHT1 CD3 101 CD4 1F6 CD4-1F6-CE-S CD4-1F6-CE CD4-1F6-L-CE CD4-1F6-R-7-CE 101 CD4 4B12 CD4-368-L-CE-S CD4-368-L-CE PA0368 CD4-368-L-CE-H (0.5 mL) Red Box = IVD / 7 Ordering code for: Page Description Clone Lyophilized Lyophilized Liquid Liquid Manual RTU BOND RTU 0.1 mL 1 mL 0.1 mL 1 mL 7 mL 7 mL 101 CD5 4C7 CD5-4C7-CE-S CD5-4C7-CE CD5-L-4C7-CE-S CD5-4C7-L-CE CD5-4C7-R-7-CE PA0168 CD5-L-4C7-CE-H (0.5 mL) 102 CD7 LP15 CD7-580-L-CE-S CD7-580-L-CE PA0266 102 CD8 1A5 CD8-295-CE-S CD8-295-CE CD8-295-L-CE CD8-295-R-7-CE 102 CD8 4B11 CD8-4B11-CE-S CD8-4B11-CE CD8-4B11-L-CE-S CD8-4B11-L-CE PA0183 CD8-4B11-L-CE-H (0.5 mL) 102 CD9 (Motility-Related Protein-1) 72F6 CD9 103 CD10 56C6 CD10-270-CE-S CD10-270-CE CD10-270-L-CE CD10-270-R-7-CE PA0270 103 CD11c 5D11 CD11C-563-L-CE-S CD11C-563-L-CE PA0554 103 CD13 38C12 CD13-304-L-U 103 CD14 7 CD14-223-S CD14-223 CD14-223-L 104 CD15 BY87 CD15-CE-S CD15-CE CD15-L-CE CD15-R-7-CE 104 CD15 CARB-1 PA0039 104 CD16 2H7 CD16-L-U 104 CD19 4G7/2E CD19-2 104 CD19 BT51E CD19-163-L-CE-S CD19-163-L-CE PA0843 CD20-L26-L-CE-H (0.5 mL) 105 CD20 7D1 CD20-7D1-S CD-20-7D1 105 CD20 L26 CD20-L26-CE CD20-L26-L-CE-S CD20-L26-L-CE CD20-L26-R-7-CE CD20-L-L26-CE-H (0.5 mL) 105 CD20 MJ1 CD20-MJ1-S CD20-MJ1 PA0906 105 CD21 2G9 CD21-2G9-CE-S CD21-2G9-CE CD21-2G9-L-CE PA0171 105 CD22 (BL-CAM) FPC1 CD22-2-S CD22-2 PA0249 106 CD23 1B12 CD23-1B12-CE-S CD23-1B12-CE CD23-1B12-L-CE-S CD23-1B12-L-CE CD23-1B12-R-7-CE PA0169 CD23-1B12-L-CE-H (0.5 mL) 152 CD25 (Interleukin-2 Receptor) 4C9 CD25-305-A PA0305 106 CD27 137B4 CD27 106 CD29 7F10 CD29-S CD29 107 CD30 15B3 CD30-365-S CD30-365 107 CD30 1G12 CD30-CE-S CD30-CE CD30-L-CE CD30-R-7-CE PA0153 107 CD30 JCM182 CD30-591-L-CE-S CD30-591-L-CE PA0790 107 CD31 (PECAM-1) 1A10 CD31-1A10-CE-S CD31-1A10-CE PA0250 107 CD33 PWS44 CD33-L-CE-S CD33-L-CE PA0555 108 CD34 (Endothelial Cell Marker) QBEND/10 END-L-CE-S END-L-CE END-R-7-CE PA0212 END-L-CE-H (0.5 mL) 108 CD35 RLB25 CD35-A 108 CD37 CT1 CD37 108 CD38 SPC32 CD38-290-CE-S CD38-290-CE CD38-290-L-CE 108 CD39 22A9 CD39 109 CD40 11E9 CD40-S CD40 Red Box = IVD Products in this catalog are subject to regulatory approval.
Load more

Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Loss of At-Catenin Alters the Hybrid Adhering Junctions in the Heart and Leads to Dilated Cardiomyopathy and Ventricular Arrhythmia Following Acute Ischemia
    1058 Research Article Loss of aT-catenin alters the hybrid adhering junctions in the heart and leads to dilated cardiomyopathy and ventricular arrhythmia following acute ischemia Jifen Li1,*, Steven Goossens2,3,`, Jolanda van Hengel2,3,`, Erhe Gao1, Lan Cheng1, Koen Tyberghein2,3, Xiying Shang1, Riet De Rycke2, Frans van Roy2,3,* and Glenn L. Radice1 1Center for Translational Medicine, Department of Medicine, Thomas Jefferson University, Philadelphia, PA, USA 2Department for Molecular Biomedical Research, Flanders Institute for Biotechnology (VIB), B-9052 Ghent, Belgium 3Department of Biomedical Molecular Biology, Ghent University, B-9052 Ghent, Belgium *Authors for correspondence ([email protected]; [email protected]) `These authors contributed equally to this work Accepted 4 October 2011 Journal of Cell Science 125, 1058–1067 ß 2012. Published by The Company of Biologists Ltd doi: 10.1242/jcs.098640 Summary It is generally accepted that the intercalated disc (ICD) required for mechano-electrical coupling in the heart consists of three distinct junctional complexes: adherens junctions, desmosomes and gap junctions. However, recent morphological and molecular data indicate a mixing of adherens junctional and desmosomal components, resulting in a ‘hybrid adhering junction’ or ‘area composita’. The a-catenin family member aT-catenin, part of the N-cadherin–catenin adhesion complex in the heart, is the only a-catenin that interacts with the desmosomal protein plakophilin-2 (PKP2). Thus, it has been postulated that aT-catenin might serve as a molecular integrator of the two adhesion complexes in the area composita. To investigate the role of aT-catenin in the heart, gene targeting technology was used to delete the Ctnna3 gene, encoding aT-catenin, in the mouse.
    [Show full text]
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • Characterization of FLT3-Itdmut Acute Myeloid Leukemia
    Travaglini et al. Blood Cancer Journal (2020) 10:85 https://doi.org/10.1038/s41408-020-00352-9 Blood Cancer Journal ARTICLE Open Access Characterization of FLT3-ITDmut acute myeloid leukemia: molecular profiling of leukemic precursor cells Serena Travaglini1, Daniela Francesca Angelini 2, Valentina Alfonso1, Gisella Guerrera2,SerenaLavorgna1, Mariadomenica Divona1, Anna Maria Nardozza1, Maria Irno Consalvo1, Emiliano Fabiani1,MarcoDeBardi 2, Benedetta Neri3,FabioForghieri4, Francesco Marchesi5, Giovangiacinto Paterno1, Raffaella Cerretti1, Eva Barragan 6, Valentina Fiori7,SabrinaDominici7, Maria Ilaria Del Principe1, Adriano Venditti 1, Luca Battistini2, William Arcese1, Francesco Lo-Coco1, Maria Teresa Voso 1,2 and Tiziana Ottone1,2 Abstract Acute myeloid leukemia (AML) with FLT3-ITD mutations (FLT3-ITDmut) remains a therapeutic challenge, with a still high relapse rate, despite targeted treatment with tyrosine kinase inhibitors. In this disease, the CD34/CD123/CD25/CD99+ leukemic precursor cells (LPCs) phenotype predicts for FLT3-ITD-positivity. The aim of this study was to characterize the distribution of FLT3-ITD mutation in different progenitor cell subsets to shed light on the subclonal architecture of FLT3-ITDmut AML. Using high-speed cell sorting, we sequentially purified LPCs and CD34+ progenitors in samples from patients with FLT3-ITDmut AML (n = 12). A higher FLT3-ITDmut load was observed within CD34/CD123/CD25/CD99+ LPCs, as compared to CD34+ progenitors (CD123+/−,CD25−,CD99low/−)(p = 0.0005) and mononuclear cells (MNCs) (p < 0.0001). This was associated with significantly increased CD99 mean fluorescence intensity in LPCs. 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Significantly higher FLT3-ITDmut burden was also observed in LPCs of AML patients with a small FLT3-ITDmut clones at diagnosis.
    [Show full text]
  • Prospective Isolation of NKX2-1–Expressing Human Lung Progenitors Derived from Pluripotent Stem Cells
    The Journal of Clinical Investigation RESEARCH ARTICLE Prospective isolation of NKX2-1–expressing human lung progenitors derived from pluripotent stem cells Finn Hawkins,1,2 Philipp Kramer,3 Anjali Jacob,1,2 Ian Driver,4 Dylan C. Thomas,1 Katherine B. McCauley,1,2 Nicholas Skvir,1 Ana M. Crane,3 Anita A. Kurmann,1,5 Anthony N. Hollenberg,5 Sinead Nguyen,1 Brandon G. Wong,6 Ahmad S. Khalil,6,7 Sarah X.L. Huang,3,8 Susan Guttentag,9 Jason R. Rock,4 John M. Shannon,10 Brian R. Davis,3 and Darrell N. Kotton1,2 2 1Center for Regenerative Medicine, and The Pulmonary Center and Department of Medicine, Boston University School of Medicine, Boston, Massachusetts, USA. 3Center for Stem Cell and Regenerative Medicine, Brown Foundation Institute of Molecular Medicine, University of Texas Health Science Center, Houston, Texas, USA. 4Department of Anatomy, UCSF, San Francisco, California, USA. 5Division of Endocrinology, Diabetes and Metabolism, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts, USA. 6Department of Biomedical Engineering and Biological Design Center, Boston University, Boston, Massachusetts, USA. 7Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, Massachusetts, USA. 8Columbia Center for Translational Immunology & Columbia Center for Human Development, Columbia University Medical Center, New York, New York, USA. 9Department of Pediatrics, Monroe Carell Jr. Children’s Hospital, Vanderbilt University, Nashville, Tennessee, USA. 10Division of Pulmonary Biology, Cincinnati Children’s Hospital, Cincinnati, Ohio, USA. It has been postulated that during human fetal development, all cells of the lung epithelium derive from embryonic, endodermal, NK2 homeobox 1–expressing (NKX2-1+) precursor cells.
    [Show full text]
  • Identification of a Receptor Required for the Anti-Inflammatory Activity of IVIG
    Identification of a receptor required for the INAUGURAL ARTICLE anti-inflammatory activity of IVIG Robert M. Anthonya, Fredrik Wermelinga,b, Mikael C. I. Karlssonb, and Jeffrey V. Ravetcha,1 aThe Laboratory of Molecular Genetics and Immunology, The Rockefeller University, New York, NY 10065; and bDepartment of Medicine, Karolinska Institutet, 171 76 Stockholm, Sweden This contribution is part of the special series of Inaugural Articles by members of the National Academy of Sciences elected on April 25, 2006. Contributed by Jeffrey V. Ravetch, October 11, 2008 (sent for review October 1, 2008) The anti-inflammatory activity of intravenous Ig (IVIG) results from patients suffering from autoimmune diseases (3). Monomeric IgG, a minor population of the pooled IgG molecules that contains purified from the serum of thousands of healthy donors (IVIG) is terminal ␣2,6-sialic acid linkages on their Fc-linked glycans. These a commonly administered at high doses (1–2 g/kg) for the treatment anti-inflammatory properties can be recapitulated with a fully of a number of autoimmune diseases, including immune-mediated recombinant preparation of appropriately sialylated IgG Fc frag- thrombocytopenia, chronic inflammatory demyelinating polyneu- ments. We now demonstrate that these sialylated Fcs require a ropathy, Kawasaki Disease and Guillain-Barre syndrome, and is specific C-type lectin, SIGN-R1, (specific ICAM-3 grabbing non- widely used in other autoimmune disorders (4–6). integrin-related 1) expressed on macrophages in the splenic mar- A number of hypotheses have been advanced to explain the ginal zone. Splenectomy, loss of SIGN-R1؉ cells in the splenic paradoxical activity of high dose IgG, and include models that marginal zone, blockade of the carbohydrate recognition domain attribute the activity to the polyclonal binding specificities, encoded (CRD) of SIGN-R1, or genetic deletion of SIGN-R1 abrogated the in the variable domains of the administered antibodies that may anti-inflammatory activity of IVIG or sialylated Fc fragments.
    [Show full text]
  • The Prevalence of MADH4 and BMPR1A Mutations in Juvenile Polyposis and Absence of BMPR2, BMPR1B, and ACVR1 Mutations
    484 ORIGINAL ARTICLE J Med Genet: first published as 10.1136/jmg.2004.018598 on 2 July 2004. Downloaded from The prevalence of MADH4 and BMPR1A mutations in juvenile polyposis and absence of BMPR2, BMPR1B, and ACVR1 mutations J R Howe, M G Sayed, A F Ahmed, J Ringold, J Larsen-Haidle, A Merg, F A Mitros, C A Vaccaro, G M Petersen, F M Giardiello, S T Tinley, L A Aaltonen, H T Lynch ............................................................................................................................... J Med Genet 2004;41:484–491. doi: 10.1136/jmg.2004.018598 Background: Juvenile polyposis (JP) is an autosomal dominant syndrome predisposing to colorectal and gastric cancer. We have identified mutations in two genes causing JP, MADH4 and bone morphogenetic protein receptor 1A (BMPR1A): both are involved in bone morphogenetic protein (BMP) mediated signalling and are members of the TGF-b superfamily. This study determined the prevalence of mutations See end of article for in MADH4 and BMPR1A, as well as three other BMP/activin pathway candidate genes in a large number authors’ affiliations ....................... of JP patients. Methods: DNA was extracted from the blood of JP patients and used for PCR amplification of each exon of Correspondence to: these five genes, using primers flanking each intron–exon boundary. Mutations were determined by Dr J R Howe, Department of Surgery, 4644 JCP, comparison to wild type sequences using sequence analysis software. A total of 77 JP cases were University of Iowa College sequenced for mutations in the MADH4, BMPR1A, BMPR1B, BMPR2, and/or ACVR1 (activin A receptor) of Medicine, 200 Hawkins genes. The latter three genes were analysed when MADH4 and BMPR1A sequencing found no mutations.
    [Show full text]
  • Microtubule and Cortical Forces Determine Platelet Size During Vascular Platelet Production
    ARTICLE Received 5 Jan 2012 | Accepted 11 Apr 2012 | Published 22 May 2012 DOI: 10.1038/ncomms1838 Microtubule and cortical forces determine platelet size during vascular platelet production Jonathan N Thon1,2, Hannah Macleod1, Antonija Jurak Begonja2,3, Jie Zhu4, Kun-Chun Lee4, Alex Mogilner4, John H. Hartwig2,3 & Joseph E. Italiano Jr1,2,5 Megakaryocytes release large preplatelet intermediates into the sinusoidal blood vessels. Preplatelets convert into barbell-shaped proplatelets in vitro to undergo repeated abscissions that yield circulating platelets. These observations predict the presence of circular-preplatelets and barbell-proplatelets in blood, and two fundamental questions in platelet biology are what are the forces that determine barbell-proplatelet formation, and how is the final platelet size established. Here we provide insights into the terminal mechanisms of platelet production. We quantify circular-preplatelets and barbell-proplatelets in human blood in high-resolution fluorescence images, using a laser scanning cytometry assay. We demonstrate that force constraints resulting from cortical microtubule band diameter and thickness determine barbell- proplatelet formation. Finally, we provide a mathematical model for the preplatelet to barbell conversion. We conclude that platelet size is limited by microtubule bundling, elastic bending, and actin-myosin-spectrin cortex forces. 1 Hematology Division, Department of Medicine, Brigham and Women’s Hospital, Boston, Massachusetts 02115, USA. 2 Harvard Medical School, Boston, Massachusetts 02115, USA. 3 Translational Medicine Division, Brigham and Women’s Hospital, Boston, Massachusetts 02115, USA. 4 Department of Neurobiology, Physiology and Behavior and Department of Mathematics, University of California Davis, Davis, 95616, USA. 5 Vascular Biology Program, Department of Surgery, Children’s Hospital, Boston, Massachusetts 02115, USA.
    [Show full text]
  • Reciprocal Regulation of TEAD4 and CCN2 for the Trophectoderm Development of the Bovine Blastocyst
    155 6 REPRODUCTIONRESEARCH Reciprocal regulation of TEAD4 and CCN2 for the trophectoderm development of the bovine blastocyst Hiroki Akizawa1,2, Ken Kobayashi3, Hanako Bai1, Masashi Takahashi1, Shinjiro Kagawa1, Hiroaki Nagatomo1,† and Manabu Kawahara1 1Laboratory of Animal Genetics and Reproduction, Research Faculty of Agriculture, Hokkaido University, Sapporo, Japan, 2Japan Society for the Promotion of Science (JSPS Research Fellow), Tokyo, Japan and 3Laboratory of Cell and Tissue Biology, Research Faculty of Agriculture, Hokkaido University, Sapporo, Japan Correspondence should be addressed to M Kawahara; Email: [email protected] †(Hiroaki Nagatomo is now at Department of Biotechnology, Faculty of Life and Environmental Science, University of Yamanashi, Kofu, Japan) Abstract The first segregation at the blastocyst stage is the symmetry-breaking event to characterize two cell components; namely, inner cell mass (ICM) and trophectoderm (TE). TEA domain transcription factor 4 (TEAD4) is a well-known regulator to determine TE properties of blastomeres in rodent models. However, the roles of bovine TEAD4 in blastocyst development have been unclear. We here aimed to clarify the mechanisms underlining TE characterization by TEAD4 in bovine blastocysts. We first found that the TEAD4 mRNA expression level was greater in TE than in ICM, which was further supported by TEAD4 immunofluorescent staining. Subsequently, we examined the expression patterns of TE-expressed genes; CDX2, GATA2 and CCN2, in the TEAD4-knockdown (KD) blastocysts. These expression levels significantly decreased in the TEAD4 KD blastocysts compared with controls. Of these downregulated genes, the CCN2 expression level decreased the most. We further analyzed the expression levels of TE-expressed genes; CDX2, GATA2 and TEAD4 in the CCN2 KD blastocysts.
    [Show full text]
  • The Role of Vimentin Intermediate Filaments in Cortical and Cytoplasmic Mechanics
    1562 Biophysical Journal Volume 105 October 2013 1562–1568 The Role of Vimentin Intermediate Filaments in Cortical and Cytoplasmic Mechanics Ming Guo,† Allen J. Ehrlicher,†{ Saleemulla Mahammad,jj Hilary Fabich,† Mikkel H. Jensen,†** Jeffrey R. Moore,** Jeffrey J. Fredberg,‡ Robert D. Goldman,jj and David A. Weitz†§* † ‡ School of Engineering and Applied Sciences, Program in Molecular and Integrative Physiological Sciences, School of Public Health, and § { Department of Physics, Harvard University, Cambridge, Massachusetts; Beth Israel Deaconess Medical Center, Boston, Massachusetts; jj Department of Cell and Molecular Biology, Northwestern University Feinberg School of Medicine, Chicago, Illinois; and **Department of Physiology and Biophysics, Boston University, Boston, Massachusetts ABSTRACT The mechanical properties of a cell determine many aspects of its behavior, and these mechanics are largely determined by the cytoskeleton. Although the contribution of actin filaments and microtubules to the mechanics of cells has been investigated in great detail, relatively little is known about the contribution of the third major cytoskeletal component, intermediate filaments (IFs). To determine the role of vimentin IF (VIF) in modulating intracellular and cortical mechanics, we carried out studies using mouse embryonic fibroblasts (mEFs) derived from wild-type or vimentinÀ/À mice. The VIFs contribute little to cortical stiffness but are critical for regulating intracellular mechanics. Active microrheology measurements using optical tweezers in living cells reveal that the presence of VIFs doubles the value of the cytoplasmic shear modulus to ~10 Pa. The higher levels of cytoplasmic stiffness appear to stabilize organelles in the cell, as measured by tracking endogenous vesicle movement. These studies show that VIFs both increase the mechanical integrity of cells and localize intracellular components.
    [Show full text]
  • Human Endoglin/CD105 Quantikine
    Quantikine® ELISA Human Endoglin/CD105 Immunoassay Catalog Number DNDG00 For the quantitative determination of human Endoglin concentrations in cell culture supernates, serum, and plasma. This package insert must be read in its entirety before using this product. For research use only. Not for use in diagnostic procedures. TABLE OF CONTENTS SECTION PAGE INTRODUCTION .....................................................................................................................................................................1 PRINCIPLE OF THE ASSAY ...................................................................................................................................................2 LIMITATIONS OF THE PROCEDURE .................................................................................................................................2 TECHNICAL HINTS .................................................................................................................................................................2 MATERIALS PROVIDED & STORAGE CONDITIONS ...................................................................................................3 OTHER SUPPLIES REQUIRED .............................................................................................................................................3 PRECAUTIONS .........................................................................................................................................................................4 SAMPLE COLLECTION & STORAGE
    [Show full text]