Determination of Differential Gene Expression Profiles in Superficial and Deeper Zones of Mature Rat Articular Cartilage Using RNA Sequencing of Laser Microdissected Tissue Specimens
Total Page：16
File Type：pdf, Size：1020Kb
Biomedical Research (Tokyo) 35 (4) 263-270, 2014 Determination of differential gene expression profiles in superficial and deeper zones of mature rat articular cartilage using RNA sequencing of laser micro- dissected tissue specimens 1 2 1 1, 3 Yoshifumi MORI , Ung-il CHUNG , Sakae TANAKA , and Taku SAITO 1 Sensory & Motor System Medicine, 2 Center for Disease Biology and Integrative Medicine, Faculty of Medicine, 3 Bone and Cartilage Regenerative Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan (Received 16 May 2014; and accepted 27 May 2014) ABSTRACT Superficial zone (SFZ) cells, which are morphologically and functionally distinct from chondro- cytes in deeper zones, play important roles in the maintenance of articular cartilage. Here, we es- tablished an easy and reliable method for performance of laser microdissection (LMD) on cryosections of mature rat articular cartilage using an adhesive membrane. We further examined gene expression profiles in the SFZ and the deeper zones of articular cartilage by performing RNA sequencing (RNA-seq). We validated sample collection methods, RNA amplification and the RNA-seq data using real-time RT-PCR. The combined data provide comprehensive information re- garding genes specifically expressed in the SFZ or deeper zones, as well as a useful protocol for expression analysis of microsamples of hard tissues. Osteoarthritis (OA), a chronic degenerative joint dis- alignment in the deeper layers (2, 17). SFZ cells, order characterized by articular cartilage destruction, which also display parallel alignment, are smaller is a major public health issue, causing pain and dis- than chondrocytes in the deeper layers and exhibit ability of the elderly worldwide (5, 8). Although ef- characteristic flat morphology (10). SFZ cells pro- fective disease-modifying treatments for OA have duce lubricin, encoded by Proteoglycan4 (Prg4), for not been developed, its etiopathogenesis has been surface lubrication. An homozygous mutant of the addressed in recent clinical studies. Cartilage degen- human PRG4 gene causes the autosomal recessive eration is first observed at the articular surface in camptodactyly-arthropathy-coxa vara-pericarditis the form of fibrillation (24). Once the surface is dis- syndrome that shows congenital or early-onset rupted, deeper cartilage layers are subsequently de- camptodactyly and childhood-onset noninflammato- graded (24). ry arthropathy (1, 16). Mice lacking Prg4 (Prg4−/−) Articular cartilage (AC) is composed of three lay- exhibit early onset of osteoarthritis (25). In addition, ers: the superficial (SFZ), middle and deep zones. chondrocytes obtained from SFZ display higher pro- The SFZ, the outermost surface layer adjacent to the liferative activity than those from deeper AC zones, joint cavity, is histologically distinct from the deep- implying that SFZ might be the main cell source of er zones. In the SFZ, collagen fibers align parallel cartilage regeneration (32). Despite the potential to the articular surface, in contrast to their vertical roles of SFZ in the etiopathogenesis and pathophys- iology of OA, apart from the involvement of Wnt/ β-catenin signaling, TGF-β/BMP signaling and high Address correspondence to: Taku Saito, M.D., Ph.D., mobility group box 2 (HMGB2), molecular mecha- Associate Professor Bone and Cartilage Regenerative Medicine, Faculty of nisms regulating the differentiation and maintenance Medicine, University of Tokyo, Hongo 7-3-1, Bunkyo-ku, of SFZ are still unknown (12, 22, 28). This lack of Tokyo 113-8655, Japan data is mainly because comprehensive in vivo gene Tel: +81-3-3815-5411 (ext. 37369), Fax: +81-3-3818-4082 expression analysis of the SFZ is difficult due to its E-mail: [email protected] thinness, which makes it difficult to obtain SFZ-spe- 264 Y. Mori et al. cific samples. layer of liquid nitrogen until microdissection. To address this issue, we focused on a microsam- To prevent RNA degradation, frozen specimens pling technique based on laser microdissection (LMD). (prior to thawing) were immediately soaked in 80% LMD is an innovative technology that enables the ethanol for 30 s, then in 100% ethanol for 1 min isolation of a micro-area of tissue and has been (twice), then in xylene for 5 min at room tempera- widely used for a variety of biological research. Al- ture and subsequently they were dried for 5 min. though LMD from a frozen sample is the ideal Specimens were then placed in a Leica LMD6500 method for collection of RNA, preparation of a (Leica Microsystems). Microdissection of the sec- cryosection from hard tissue is difficult by conven- tion was performed using the following settings: tional methods. In the present study, we aimed to Power 50, Aperture 30 and Speed 5. Samples were establish an easy and reliable method for perfor- collected in the cap of a 200 μL tube pre-filled with mance of LMD on cryosections of mature rat articu- 50 μL of XB buffer of the Arcturus Picopure RNA lar cartilage and for subsequent performance of isolation Kit (Thermo Fisher Scientific, Waltham, RNA sequencing (RNA-seq) to obtain gene expres- MA). SFZ and deeper AC samples from two slices sion profiles for both the SFZ and deeper AC zones. were obtained for each rat. Samples were stored at −80 °C until mRNA extraction. MATERIALS AND METHODS RNA extraction and amplification. RNA extraction Specimen preparation. All animal experiments were was performed using the Picopure RNA isolation undertaken according to the guidelines of the Ani- Kit according to the manufacturer’s protocol. RNA mal Care and Use Committee of the University of was collected in 11 μL of EB buffer, 1.5 μL of Tokyo. Ten-week-old male Sprague Dawley rats which were then used for checking RNA purity us- (Sankyo Laboratories, Tokyo, Japan) were sacrificed ing NanoDrop (Thermo Fisher Scientific). We then by cervical dislocation under anesthesia. A ring- amplified the remaining sample by two rounds of shaped skin incision was made at the height of the in-vitro transcription using the Arcturus RiboAmp rib cage, the skin was dragged distally and the distal HS PLUS kit (Thermo Fisher Scientific) according flap was inverted to expose the lower extremities. to the manufacturer’s protocol. Amplified RNA The left knee was then disarticulated, the medial (aRNA) was obtained in 30 μL of RNA elution buf- and lateral menisci were detached and the tibia was fer, 1.5 μL of which were again analyzed using cut at its shaft. The proximal tibia was immediately NanoDrop to check quantity and purity. and directly placed into liquid nitrogen. Frozen sec- tions were embedded in pre-cooled SCEM com- Real-time RT-PCR. One microgram of aRNA was pound (Section-lab, Hiroshima, Japan) and stored at reverse-transcribed using the QuantiTect Reverse- −80°C until further analysis. Transcription kit (Qiagen, Hilden, Germany) without For H&E staining, 10-μm paraffin-embedded sec- performing the genomic DNA elimination reaction. tions were prepared from 10-week-old Sprague The resultant 20 μL of cDNA solution was diluted to Dawley rats as described previously (18). H&E stain- 100 μL with distilled water. For real-time RT-PCR ing was performed according to a standard protocol. analysis, the quantity of DNA polymerase was in- creased versus the standard protocol to rapidly am- Laser microdissection (LMD). We performed LMD plify aRNAs with a small copy number (4). Reagents using frozen sections prepared by Kawamoto’s film were prepared as follows: FastStart Universal SYBR method (11, 20). Specimens were placed into a Leica Green Master (Roche Diagnostics, Basel, Switzer- CM3050S (Leica Microsystems, Wetzlar, Germany) land) 10 μL; FastStart Taq DNA Polymerase (5 U/ at −30°C and cut coarsely in a frontal plane until a μL, Roche) 0.4 μL; forward Primer (10 μM) 2 μL; desired surface was exposed. The adhesive surface Reverse Primer (10 μM) 2 μL; distilled water 3.6 μL, of Cryofilm Type IIC (Section-lab) was then attached aRNA solution 2 μL, and were run in triplicate on a to the specimen and 10-μm-thick sections were cut. Thermal Cycler Dice (Takara Bio, Otsu, Japan). The specimen with attached film was fixed to a met- Relative expression levels were calculated by the al frame using a double-sided tape (Nichiban, To- delta-delta CT method using Gapdh as an internal kyo, Japan). This metal frame was prepared from a control. Primer pairs used are shown in Table 1. membrane slide (PEN-membrane, 2.0 μm) whose PEN-membrane was removed prior to use. The fixed RNA sequencing (RNA-seq). A cDNA library was specimen and attached film were stored in the gas constructed according to the TrueSeq RNA Sample Gene expression in cartilage 265 Table 1 List of primers used for real-time RT-PCR Product Gene Forward primer Reverse primer size (bp) Gapdh TGCACCACCAACTGCTTAGC GGATGCAGGGATGATGTTCT 177 Col2a1 ATGACTTTCCTCCGTCTACTGTCC TGATGGTCTTGCCCCACTTAC 226 Prg4 AACCTGACTGGCAAAGAAGAATG TGGGAGGAAGAGGAGGAATAAATAG 232 Bmp7 GCCCTTCCTTTCCGTTCTATTT CATCCCTCACCGACCTCTTC 129 Tmem176a CGTCAGGCAGGAAGAAGACC GGTGGTGAAGGCAGAGGAGA 117 Wnt9a TGGCAGTGGACACACAAGG TCGCCACACAGTTGAGGTAGA 80 Frzb GGGAACTCATGGTGCCTTTT GGAATGAGACTTTTAGGTGATTGG 80 Ibsp CAAACATGAATACACGGTGTGAG TTATCTGTAGGGGAGGGGTTGT 93 Grem1 GATTATGCAGGCTATGACGGAAC GCCAAATTAGCTTCTATGAGACCA 85 Preparation V2 Guide Rev. C (Illumina, San Diego, Validation of accurate sampling by real-time RT- CA) and sequencing was performed using HiSeq PCR 2000 (Illumina) according to the manufacturer’s pro- After reverse-transcription of one μg aRNA, the ac- tocol. Then we normalized the sequence data by curacy of our sampling was validated by real-time trimmed mean of M values method (26). The raw RT-PCR. Previous studies showed that Prg4 is up- and processed data are available on GEO database regulated and Col2a1 is downregulated in the SFZ with accession number GSE57377. After changing compared to deeper AC (3, 21, 23, 25). Our real- the measured value less than one to one, we calcu- time RT-PCR results showed significant upregula- lated the fold change between SFZ and deeper AC.