DOCSLIB.ORG

Novel Mutations in the Guanosine Triphosphate Cyclohydrolase 1 Gene Associated with DYT5 Dystonia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Novel Mutations in the Guanosine Triphosphate Cyclohydrolase 1 Gene Associated with DYT5 Dystonia ORIGINAL CONTRIBUTION Novel Mutations in the Guanosine Triphosphate Cyclohydrolase 1 Gene Associated With DYT5 Dystonia Etsuro Ohta; Manabu Funayama, PhD; Hiroshi Ichinose, PhD; Itaru Toyoshima, MD; Fumi Urano; Mitsuhiro Matsuo, MD; Nishida Tomoko, MD; Konishi Yukihiko, MD; Syuji Yoshino, MD; Hiroyuki Yokoyama, MD; Hideki Shimazu, MD; Koji Maeda, MD; Kazuko Hasegawa, MD; Fumiya Obata, PhD Objectives: To better understand the relationship be- helix structure of the enzyme. In the third patient, we tween mutation of the guanosine triphosphate cyclohy- found a new mutation (a 15–base pair nucleotide dele- drolase I (GCH1) gene and the etiology of DYT5 dysto- tion) in exon 5 that may cause a frameshift involving the nia and to accumulate data on the mutation in the Japanese active site. In the fourth patient, we detected a known population for genetic diagnosis of the disease. nucleotide GϾA substitution in the splice site of intron Setting: Japanese population. 5, which has been reported to produce exon 5–skipped messenger RNA. The concentrations of both neopterin Patients: Eight Japanese patients with suspected DYT5 and biopterin in the cerebrospinal fluid of the third and dystonia were analyzed. fourth patients were markedly lower than the normal range, indicating that the GCH1 enzyme was function- Intervention: Direct genomic sequencing of 6 exons of GCH1 was performed. ally abnormal in these mutations. Gene dosage analysis showed that the fifth patient had a deletion of both exon Main Outcome Measures: For patients who did not 3 and exon 4, whereas the sixth patient had a deletion of exhibit any abnormality in the sequence analysis, the pos- exon 3. sibility of exon deletions was examined. In cases for which cerebrospinal fluid was available, the concentrations of Conclusions: We found several novel, as well as known, neopterin and biopterin were measured as an index of GCH1 mutations in Japanese patients with DYT5 dysto- GCH1 enzyme activity. nia. In some of them, the GCH1 enzyme activity was proved to be impaired. Results: In 2 patients, we found a new T106I mutation in exon 1 of GCH1, a position involved in the helix-turn- Arch Neurol. 2006;63:1605-1610 YT5 DYSTONIA (SEGAWA The human GCH1 gene is composed of disease) is an autosomal 6 exons spanning approximately 30 kilo- dominant hereditary pro- bases.9 Todate,varioustypesofmutationhave gressive dystonia with been found throughout the 6 exons, as well marked diurnal fluctua- as introns, of the GCH1 gene, including mis- Dtion, characterized by bilateral foot dysto- sense and nonsense mutations, large and nia that becomes apparent in childhood or small deletions and insertions, and splice site adolescence.1 Molecular genetic studies have mutations3,4,10-16 (Figure 1). The reason why revealed that DYT5 dystonia is caused by suchavarietyofmutationsoccurintheGCH1 mutations of the guanosine triphosphate cy- gene remains unknown. Patients with DYT5 clohydrolase I (GCH1) gene located in dystonia in each pedigree, but not in differ- 14q22.1-22.2.2-4 This enzyme catalyzes the ent pedigrees, have identical mutations. It is rate-limiting step of tetrahydrobiopterin bio- not known how the single GCH1 gene is as- synthesis.5 Tetrahydrobiopterin is a cofac- sociated with 2 distinct diseases, DYT5 dys- tor for tyrosine hydroxylase, which is in- toniaandhyperphenylalaninemia.Inourpre- volved in the production of dopamine.6 It viousshortreport,wedescribedanovelT106I remains to be clarified, however, how a low mutation found in exon 1 of the GCH1 gene dopamine level results in the onset of this in patients with DYT5 dystonia.17 In the disease. Tetrahydrobiopterin is also a co- present article, we provide further details of factor for phenylalanine hydroxylase, and this mutation. In addition, analysis of other defective activity of this enzyme causes hy- patients revealed a novel small deletion and Author Affiliations are listed at perphenylalaninemia, which is clinically dis- a new type of exon deletion, as well as the the end of this article. tinct from DYT5 dystonia.7,8 known splice site mutation. (REPRINTED) ARCH NEUROL / VOL 63, NOV 2006 WWW.ARCHNEUROL.COM 1605 ©2006 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 M1X R88P E2fs R88Q89del Q182X A8X H210X Q89X R184H P23L M211I Q89 – P95del R184H Q48X M211V G90V R184C P49fs M211fs L91R L185R E56X M213V T94K T186K E61X M213T W96X I189X E65X R216X M102K V191I P69L V218fs M102R S196A N70fs M221T M102fs P199A L71Q S223R Q103P P199L A74V K224R ins106F G201E Y75X L117X K224X G201R S76X T106I D134V V226A V202I S77–L82del G108D I135K I171X F234S G203R L79P G108V M137R S176T R241W V204I G83A Q110fs F138fs R178S E242fs V205E Q87P Q110X C141R H153P R178G E243fs V205G R88G S114X C141W N159X Q180X R249S –22C>T R88W D115N H144P L163R Q180R V206fs X251R –39C>T/ –132C>T Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6 IVS1–1G>A IVS2+1G>C IVS3+1G>T IVS4+1G>C IVS5+1G>A IVS1–2A>G IVS2 – 2A>G IVS3–2G>A IVS4+1G>A IVS5+5G>A Deletion Exon 1 IVS5+3insT Deletion Exons 1-3 Deletion Exons 1-4 Deletion Exons 1-6 Deletion Exon 3 Deletion Exons 3-4 Figure 1. Cumulative mutations of the guanosine triphosphate cyclohydrolase I (GCH1) gene detected in patients with DYT5 dystonia or hyperphenylalaninemia. The Figure has been modified from that of Blau and Thony (http://www.bh4.org) (2003) by including additional mutations. The mutations found in this study are indicated by arrows. Mutations associated with hyperphenylalaninemia are underlined. fs indicates frameshift; del, deletion; and x, stop codon. Table 1. Clinical Characteristics and GCH1 Mutations of 8 Patients Analyzed in This Study Patient/ Family History Levodopa/DCI Sex/Age, y GCH1 Mutation Site of Onset Clinical Signs of Dystonia Effective Dose, mg/d P1/F/8 T106I Leg Foot dystonia Not known 100 P2/F/30 T106I Arm Writer’s cramp; foot dystonia Yes 200 P3/F/7 V206fs Arm, leg, neck Cervix rotation Yes Data unavailable P4/F/4 IVS5 ϩ 1GϾA Unknown Foot dystonia Not known 400-600 P5/F/8 Exons 3-4 deletion Arm Dystonia of lower and upper limbs Yes 300 P6/M/8 Exon 3 deletion Leg Foot dystonia Not known Data unavailable P7/F/20 Not detected Trunk Anteversion posture Not known Data unavailable P8/F/18 Not detected Leg Tremor Not known 500 METHODS HAPLOTYPE ANALYSIS Five microsatellite loci (D14S288, D14S978, D14S991, D14S1057, POLYMERASE CHAIN REACTION and D14S980) around the GCH1 gene of patients P1 and P2 were DIRECT SEQUENCING amplified by PCR using fluorescence-labeled primers for each lo- cus. Allele frequencies in the Japanese population at each locus Genomic DNA was isolated from peripheral blood leukocytes were obtained by genotyping 54 Japanese volunteers. of 7 female patients (P1, P2, P3, P4, P5, P7, and P8) and 1 male patient (P6) with clinically suspected DYT5 dystonia (Table 1) ANALYSIS OF 15–BASE PAIR DELETION and 100 healthy control individuals, with the informed con- IN THE NORMAL POPULATION sent of the donors. The 6 exons of the GCH1 gene were am- plified by polymerase chain reaction (PCR) using the primers The exon 5 genomic sequence around a 15–base pair (bp) de- reported by Ichinose et al3 and subjected to sequence analysis. letion in 100 normal individuals was amplified using fluores- (REPRINTED) ARCH NEUROL / VOL 63, NOV 2006 WWW.ARCHNEUROL.COM 1606 ©2006 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 cence-labeled primers, and the PCR products were analyzed by GeneScan. T T C T T C A G C A A G G G C MEASUREMENT OF NEOPTERIN P1 C317C/T AND BIOPTERIN CONCENTRATIONS (Thr106Ile) Concentrations of neopterin and biopterin in cerebrospinal fluid T T C T T C A G C A A G G G C (CSF) were measured by high-performance liquid chromatog- P2 18 C317C/T raphy (HPLC) as described previously. In brief, the CSF was (Thr106Ile) oxidized in iodine solution. The oxidized samples were ana- lyzed by HPLC using an organized delivery system reverse- phase column (GL Sciences). T T C T T C A G C A A G G G C C317C GENE DOSAGE ANALYSIS Control Six exons of the GCH1 gene were subjected to real-time PCR analy- sis using SYBR Green PCR Master Mix (Applied Biosystems, Fos- Mutant GCCATGCAGTTCTTCATCAAGGGCTACCAGGAGACCATC ter City, Calif) and a PRISM 7700 Sequence Detection System A M Q F F I K G Y Q E T I Human GCCATGCAGTTCTTCACCAAGGGCTACCAGGAGACCATC (Applied Biosystems). The Ct value for each exon was normal- A M Q F F T K G Y Q E T I ized using those for the beta-globin gene. A ratio between 0.8 and Rat A M Q F F T K G Y Q E T I 1.2 was considered normal, and a ratio between 0.4 and 0.6 was Mouse A M Q F F T K G Y Q E T I considered to represent a heterozygous deletion. Chicken A M Q F F T K G Y Q E T I Xenopus A M Q F F T K G Y Q E T I RESULTS Figure 2. T106I mutation of exon 1 found in patients P1 and P2. The ANALYSIS OF PATIENTS nucleotide and amino acid change, as well as those of other species, are WITH A MISSENSE MUTATION shown in the lower part of the Figure. GenBank accession numbers are as follows: human, Z29434; rat, M58364; mouse, L09737; chicken, Z49267; and Xenopus, BC075602. Eight patients (P1, P2, P3, P4, P5, P6, P7, and P8) who had been suspected to have DYT5 dystonia from their le- vodopa responsiveness and clinical characteristics (Table 1) were analyzed.
Load more

Recommended publications
  • Diosynrhesis of Neopterin, Sepioprerin, Ond Diopterin in Rar Ond Humon Oculor Tissues
    768 INVESTIGATIVE OPHTHALMOLOGY b VISUAL SCIENCE / May 1985 Vol. 26 before and after the addition of beta-glucuronidase.4 ported by the Juvenile Diabetes Foundation and by the University In circumstances where the actual plasma free fluo- of London, Central Research Fund. The HPLC was purchased with an MRC grant to Dr. Michael J. Neal. Submitted for publi- rescein has not been measured, the term "plasma- cation: April 12, 1984. Reprint requests: Dr. P. S. Chahal, Depart- free fluorescence" should be quoted. It is then better ment of Medicine, Hammersmith Hospital, Du Cane Road, London to measure overall fluorescence (fluorescein and the W12 OHS, England. glucuronide metabolite) in protein-free plasma ultra- filtrate and the fluorescence appearing in the ocular References compartments using the same excitor and emission filters. 1. Araie M, Sawa M, Nagataki S, and Mishima S: Aqueous Fluorescein glucuronide is a potential source of humor dynamics in man as studied by oral fluorescein. Jpn J Ophthalmol 24:346, 1980. variability in studies of blood-ocular dynamics using 2. Zeimer RC, Blair NP, and Cunha-Vaz JG: Pharmacokinetic fluorescein. Its exact role has yet to be established. interpretation of vitreous fluorophotometry. Invest Ophthalmol VisSci 24:1374, 1983. Key words: Blood-ocular barriers, diabetes, plasma ultrafil- 3. Chen SC, Nakamura H, and Tamura Z: Studies on metabolite trate, fluorescein glucuronide, fluorescence, protein-binding of fluorescein in rabbit and human urine. Chem Pharmacol Acknowledgments. Technical assistance was given by Dr. Bull 28:1403, 1980. J. Cunningham, Ian Joy, and Margaret Foster. 4. Chen SC, Nakamura H, and Tamura Z: Determination of fluorescein and fluorescein monoglucuronide excreted in urine.
    [Show full text]
  • GCH1 Gene GTP Cyclohydrolase 1
    GCH1 gene GTP cyclohydrolase 1 Normal Function The GCH1 gene provides instructions for making an enzyme called GTP cyclohydrolase 1. This enzyme is involved in the first of three steps in the production of a molecule called tetrahydrobiopterin (BH4). Other enzymes help carry out the second and third steps in this process. Tetrahydrobiopterin plays a critical role in processing several protein building blocks ( amino acids) in the body. For example, it works with the enzyme phenylalanine hydroxylase to convert an amino acid called phenylalanine into another amino acid, tyrosine. Tetrahydrobiopterin is also involved in reactions that produce chemicals called neurotransmitters, which transmit signals between nerve cells in the brain. Specifically, tetrahydrobiopterin is involved in the production of two neurotransmitters called dopamine and serotonin. Among their many functions, dopamine transmits signals within the brain to produce smooth physical movements, and serotonin regulates mood, emotion, sleep, and appetite. Because it helps enzymes carry out chemical reactions, tetrahydrobiopterin is known as a cofactor. Health Conditions Related to Genetic Changes Dopa-responsive dystonia More than 140 mutations in the GCH1 gene have been found to cause dopa-responsive dystonia. This condition is characterized by a pattern of involuntary muscle contractions ( dystonia), tremors, and other uncontrolled movements and usually responds to treatment with a medication called L-Dopa. Dopa-responsive dystonia results when one copy of the GCH1 gene is mutated in each cell. Most GCH1 gene mutations that cause this condition change single amino acids in the GTP cyclohydrolase 1 enzyme. Researchers believe that the abnormal enzyme may interfere with the activity of the normal version of GTP cyclohydrolase 1 that is produced from the copy of the gene with no mutation.
    [Show full text]
  • 34Th International Winter Workshop Clinical, Chemical and Biochemical
    DOI 10.1515/pterid-2015-0007 Pteridines 2015; 26(3): 113–133 Abstracts*) 34th International Winter Workshop Clinical, Chemical and Biochemical Aspects of Pteridines and Related Topics Society for Exploitation of Education and Research in Immunology and Infectious Diseases, Innsbruck, Austria in collaboration with The International Society of Pteridinology and The Austrian Society of Laboratory Medicine and Clinical Chemistry Held in Innsbruck, Tyrol, Austria, February 24th–27th, 2015 Scientific committee: Dietmar Fuchs (Innsbruck), Andrea Griesmacher (Innsbruck), Bohuslav Melichar (Olomouc), Gilbert Reibnegger (Graz), Barbara Strasser (Hall), Guenter Weiss (Innsbruck) and Ernst R. Werner (Innsbruck) Organization: Dietmar Fuchs, Sektion für Biologische Chemie, Biozentrum, Medizinische Universität Innsbruck, Innrain 80, 6020 Innsbruck, Austria, e-mail: [email protected] *)These abstracts have been reproduced directly from the material supplied by the authors, without editorial alteration by the staff of this Journal. Insufficiencies of preparation, grammar, spelling, style, syntax, and usage are the authors’ responsibility. 114 34th International Winter Workshop Circulating neopterin and citrulline concentrations Influence of carbon nanotubes, ZnO and in patients with germ-cell tumors during gold-doped TiO2 nanoparticles on human PBMC chemotherapy in vitro Bartoušková M, Študentová H, Pejpková I, Zezulová M, Adam T, Becker K, Herlin N, Bouhadoun S, Gostner JM, Ueberall F, Schennach Melichar B H, Fuchs D Palacký University Medical School and Teaching Hospital, Olomouc, Divisions of Biological Chemistry and of Medical Biochemistry, Czech Republic Biocenter, Medical University, and Central Institute of Blood ([email protected]) Transfusion and Immunology, University Hospital, Innsbruck, Austria; Au Service des Photons, Atomes et Molécules - Laboratoire Francis Germ-cell tumors are relatively rare neoplasms that affect mostly Perrin, Gif-sur Yvette, France young adults.
    [Show full text]
  • Ability of RBL2H3 Cells to Lower Environmental Tetrahydrobiopterin Concentration 121
    :-! Hasegawa et a/: Ability of RBL2H3 cells to lower environmental tetrahydrobiopterin concentration 121 Ptendines Vol. 11,2000, pp. 121 - 125 Ability of RBL2H3 Cells to Lower Environmental Tetrahydrobiopterin concen­ tration] 2 2 Hiroyuki Hasegawa ." Kazumasa Yamamoto2J, Yoshie Matsuhashi>, Takahumi Miyazawa , Nobuo Nakanishi., 2 :lnd Kazuya OgUI0 ., :Department of Biosciences and 'Biotechnology Research Center, Teikyo University of Science and Technology. Cenohara, Yamanashi 409-0193, and 'Department of Biochemistry, Meikai University School of Dentistry, Sakado, Saitama 350-0248, Japan This research was supported by the Japan Private School Promotion Foundation, and a Grant-in-Aid for Advanced Scientific Research for Bioscience/Biotechnology areas from the Ministry of Education, Science, Sports and Culture of Japan. Introduction outside the cells. These studies were made by measur­ ing serotonin release with RBL2H3 cells, of a mast Tetrahydrobiopterin works as a redox-cofactor cell-like neoplastic cell origin, and serotorun-loaded inside cells for phenylalanine hydroxylase (1), tyrosine PC-12 cells, of a pheochromocytoma origin, both hav­ hydroxylase (2), tryptophan hydroxylase (3, 4), and ni­ ing ability to release monoamines in response to phys­ tric oxide synthetase (5, 6). Other functions oftetrahy­ iological stimulation. These cells have been employed drobiopterin so far proposed are modulation of more in many studies to explore generic functions of mast complex cellular functions such as mitosis (7, 8), apo­ cells and sympathetic neurons. Between these cells, no ptosis (9··11), and exocytotic release of dopamine (12- essential differences were found with respect to the 14) and serotonin (15). Within them, the suggested BH4-response. Therefore, these observations suggest­ stimulation of monoamine release by BH4, first ed that BH4 might work as a signal mediator to regu­ demonstrated in the rat brain using a microdialysis late cellular functions of a wide variety of cells in tis­ technique by Dr.
    [Show full text]
  • The Nitric Oxide System in Peripheral Artery Disease: Connection with Oxidative Stress and Biopterins
    antioxidants Article The Nitric Oxide System in Peripheral Artery Disease: Connection with Oxidative Stress and Biopterins Ahmed Ismaeel 1, Evlampia Papoutsi 1, Dimitrios Miserlis 2 , Ramon Lavado 3 , Gleb Haynatzki 4, George P. Casale 5, William T. Bohannon 6, Robert S. Smith 6, Jack Leigh Eidson 6, Robert Brumberg 7, Aaron Hayson 7, Jeffrey S. Kirk 8, Carlos Castro 8, Ian Sawicki 6, Charalambos Konstantinou 9 , Luke P. Brewster 10, Iraklis I. Pipinos 5,11 and Panagiotis Koutakis 1,* 1 Department of Nutrition, Food and Exercise Sciences, Florida State University, Tallahassee, FL 32304, USA; [email protected] (A.I.); [email protected] (E.P.) 2 Department of Surgery, University of Texas Health Science Center San Antonio, San Antonio, TX 78229, USA; [email protected] 3 Department of Environmental Science, Baylor University, Waco, TX 76798, USA; [email protected] 4 Department of Biostatistics, University of Nebraska Medical Center, Omaha, NE 68198, USA; [email protected] 5 Department of Surgery, University of Nebraska Medical Center, Omaha, NE 68198, USA; [email protected] (G.P.C.); [email protected] (I.I.P.) 6 Department of Surgery, Baylor Scott & White Medical Center, Temple, TX 76508, USA; [email protected] (W.T.B.); [email protected] (R.S.S.); [email protected] (J.L.E.); [email protected] (I.S.) 7 Vascular Surgery Associates, Tallahassee, FL 32308, USA; rbrumberg@vsafl.com (R.B.); [email protected] (A.H.) 8 Department of Vascular Surgery, Capital Regional Medical Center, Tallahassee, FL 32308,
    [Show full text]
  • Neurological Aspects of Biopterin Metabolism
    Arch Dis Child: first published as 10.1136/adc.61.2.130 on 1 February 1986. Downloaded from Archives of Disease in Childhood, 1986, 61, 130-137 Neurological aspects of biopterin metabolism I SMITH, R J LEEMING, N P C CAVANAGH, AND K HYLAND Hospital for Sick Children and Institute of Child Health, London, and The General Hospital, Birmingham SUMMARY Plasma total biopterin concentration was measured by bioassay in 59 infants with hyperphenylalaninaemia and in 50 children with developmental regression and or movement disorder with normal plasma phenylalanine concentrations. In infants with raised phenylalanine concentrations plasma biopterin concentrations were significantly raised in proportion to the phenylalanine values. Five patients had plasma biopterin concentrations at the extremes of the range, and of these two had defective biopterin metabolism. One with low plasma biopterin concentration apparently had a partial defect of biopterin synthesis but died before investigations were complete. One with high plasma biopterin concentration, even when phenylalanine concentrations had fallen to the normal range, had dihydropteridine reductase deficiency. In this patient concentrations of homovanillic acid and 5-hydroxyindolacetic acid in the cerebrospinal fluid (CSF) were severely reduced. In children without hyperphenylalaninaemia plasma biopterin concentrations were normal. Twenty two patients were subjected to lumbar puncture, of whom six with developmental regression without movement disorder had normal CSF biopterin concentrations, and 11 withcopyright. movement disorder other than torsion dystonia had significantly lower CSF biopterin concentrations. Five patients with torsion dystonia had normal biopterin concentrations. Tetrahydrobiopterin is the essential cofactor for three hydroxylation reactions, the conversion of GTP http://adc.bmj.com/ phenylalanine to tyrosine, tyrosine to L-dopa, and tryptophan to 5-hydroxytryptophan.' These last two B, BH2 j reactions are the rate limiting steps of catecholamine Ne 2P3 --- NeH2 and serotonin synthesis.
    [Show full text]
  • GTP-Cyclohydrolase I Deficiency Presenting
    Dayasiri et al. BMC Pediatrics (2019) 19:199 https://doi.org/10.1186/s12887-019-1580-x CASE REPORT Open Access GTP-Cyclohydrolase I deficiency presenting as malignant hyperphenylalaninemia, recurrent hyperthermia and progressive neurological dysfunction in a South Asian child – a case report Kavinda Chandimal Dayasiri1*, Nayani Suraweera1, Deepal Nawarathne1, U. E. Senanayake2, B. K. T. P. Dayanath2, Eresha Jasinge1 and Kumudu Weerasekara1 Abstract Background: Tetrahydrobiopterin (BH4) deficiencies are disorders affecting phenylalanine homeostasis, and catecholamine and serotonin biosynthesis. GTP-Cyclohydrolase I deficiency (OMIM 600225) is an extremely rare variant of inborn error of BH4 synthesis which exists in recessive and dominant forms. The recessive form presents with complex neurological and autonomic dysfunction whilst the dominant form presents as Dopa-responsive dystonia. Case presentation: We describe a South Asian child who initially presented with neurological dysfunction and recurrent vomiting and later developed recurrent hyperthermia for several months. The child did not have screening for hyperphenylalaninemia at birth and was found to have marked hyperphenylalaninemia after clinical presentation at 5 months. Further evaluation revealed BH4 deficiency. GTP-Cyclohydrolase I deficiency (GTPCH) was identified based on normal dihydro pteridine reductase activity and markedly reduced neopterin in dried blood spot test. After institution of treatment and control of high phenylalanine levels, clinical deterioration decelerated yet with noticeable residual neurological dysfunction. Conclusion: To authors’ knowledge, this is first report of GTPCH deficiency in a South Asian child. The case highlights practical issues regarding diagnosis of GTPCH deficiency, especially in countries without broader universal newborn screening programs for early detection of inherited metabolic disorders. Testing for GTPCH deficiency should be considered for patients with unexplained neurological and autonomic symptoms following initial metabolic screen.
    [Show full text]
  • Tetrahydrobiopterin Is Present in High Quantity in Human Milk and Has a Vasorelaxing Effect on Newborn Rat Mesenteric Arteries
    0031-3998/11/6904-0325 Vol. 69, No. 4, 2011 PEDIATRIC RESEARCH Printed in U.S.A. Copyright © 2011 International Pediatric Research Foundation, Inc. Tetrahydrobiopterin Is Present in High Quantity in Human Milk and Has a Vasorelaxing Effect on Newborn Rat Mesenteric Arteries ANGELA WEINMANN, MARTIN POST, JINGYI PAN, MAHROUKH RAFII, DEBORAH L. O’CONNOR, SHARON UNGER, PAUL PENCHARZ, AND JAQUES BELIK Department of Pediatrics [A.W.], Santa Maria Federal University, Santa Maria, Rio Grande do Sul, 97.105-900, Brazil; Physiology and Experimental Medicine Program [M.P., J.P., M.R., D.O., P.P., J.B.], Department of Pediatrics [S.U., P.P., J.B.], The Hospital for Sick Children, Toronto, Ontario, M5G 1X8 Canada ABSTRACT: Breast milk reduces the incidence of necrotizing milk that contribute to its NEC preventive properties may enterocolitis (NEC). BH4 is a cofactor for endothelial NOS (eNOS). allow for the further refinement of infant formulas to attain Reduced BH4 levels, or its oxidation to dihydrobiopterin (BH2), similar beneficial effects as human milk. uncouple eNOS resulting in formation of reactive oxygen species Biopterins are present in breast milk and are previously (ROS) that have been implicated in the pathogenesis of NEC. We shown to enhance the mesenteric blood flow (5). Previous evaluated colostrum and mature breast milk, as well as infant for- reports suggest that when compared with bovine-derived for- mula, BH4 and BH2 content. In addition, we tested the BH4 effect on the newborn rat mesenteric arterial vascular tone. BH4 and BH2 mulas, breast milk has a higher content of total biopterins (6).
    [Show full text]
  • Defect in Pyruvoyl-Tetrahydropterin Synthase
    Defect in pyruvoyl-tetrahydropterin synthase Author: Professor Jean-Louis Dhondt1 Creation Date: April 2001 Updates: May 2003 February 2005 Scientific Editor: Professor Jean-Marie Saudubray 1Centre régional de dépistage néonatal, 68 Rue Sylvere Verhulst, 59000 Lille, France. [email protected] Abstract Keywords Disease name and synonyms Excluded diseases Diagnostic criteria/definition Differential diagnosis Prevalence Clinical description Management including treatment Diagnostic methods Genetic counseling Antenatal diagnosis References Abstract 6-pyruvoyl-tetrahydropterin synthase (PTPS) deficiency, an autosomal recessive genetic disorder, is one of the causes of malignant hyperphenylalaninemia due to tetrahydrobiopterin deficiency. Not only does tetrahydrobiopterin deficiency cause hyperphenylalaninemia, it is also responsible for defective neurotransmission of monoamines because of malfunctioning tyrosine and tryptophan hydroxylases, both tetrahydrobiopterin-dependent hydroxylases. PTPS deficiency should be suspected in all infants with a positive neonatal screening test for phenylketonuria, especially when hyperphenylalaninemia is moderate. The most effective way to diagnose the disorder is to measure pteridine levels in urine and to confirm the result by measuring neurotransmitters 5-hydroxyindolacetic acid (5-HIAA) and homovanillic acid (HVA) in cerebrospinal fluid and with by an oral tetrahydrobiopterin-loading test (20 mg/kg). When left untreated, the deficiency causes neurological signs at age 4 or 5 months, although clinical signs are often obvious from birth. The principal symptoms include psychomotor retardation, tonus disorders, convulsions, drowsiness, irritability, abnormal movements, hyperthermia, hypersalivation and difficulty swallowing. Treatment attempts to bring phenylalaninemia levels back to normal (diet with restricted phenylalanine intake or prescription of tetrahydrobiopterin) and to restore normal monoaminergic neurotransmission by administering precursors (L-dopa/carbidopa and 5-hydroxytryptophan).
    [Show full text]
  • Biopterin in Parkinson's Disease
    J Neurol Neurosurg Psychiatry: first published as 10.1136/jnnp.50.1.85 on 1 January 1987. Downloaded from Journal of Neurology, Neurosurgery, and Psychiatry 1987;50:85-87 Short report Biopterin in Parkinson's disease A P MOORE,* P 0 BEHAN,* W JACOBSON,t W L F ARMAREGOt From the Institute ofNeurological Sciences, Southern General Hospital, Glasgow,* Department ofPaediatrics, University ofCambridge, Addenbrooke's Hospital, Cambridge,t Department ofBiochemistry, John Curtin School ofMedical Research, The Australian National University,: Canberra, Australia SUMMARY Tetrahydrobiopterin is an essential co-factor in the natural synthesis of dopamine. Oral tetrahydrobiopterin was given in small doses to four patients with early Parkinson's disease but had no discernible effect. The major pathology identified in Parkinson's disease treated with dopamine. Other workers have also doc- is a loss of nigrostriatal dopamine cells and a decrease umented a similar mild and short-lived effect of tetra- in striatal dopamine.' The low dopamine levels can be hydrobiopterin.6 The therapeutic trials producing corrected by giving levodopa, which is converted to benefit used a single-shot oral regime in patients who Protected by copyright. dopamine in the brain, and its administration reverses had already been treated with conventional dopami- many of the clinical features of Parkinsonism. nergic preparations. Unfortunately, although this replacement therapy is In a randomised double-blind placebo controlled now conventional, there are many problems associ- crossover trial, we investigated the effects of repeated ated with its use so that it is important to consider small doses of tetrahydrobiopterin in Parkinsonian alternative approaches. patients who had received no previous dopaminergic Tetrahydrobiopterin is an essential co-factor of therapy.
    [Show full text]
  • Defect in GTP-Cyclohydrolase
    Defect in GTP-cyclohydrolase Author: Professor Jean-Louis Dhondt 1 Creation Date: April 2001 Updates: May 2003 February 2005 Scientific Editor: Professor Jean-Marie Saudubray 1Centre régional de dépistage néonatal, 68 Rue Sylvere Verhulst, 59000 Lille, France. [email protected] Abstract Keywords Disease name and synonyms Excluded diseases Diagnostic criteria/definition Differential diagnosis Prevalence Clinical description Management including treatment Diagnostic methods Genetic counseling Antenatal diagnosis References Abstract GTP-cyclohydrolase I deficiency, an autosomal recessive genetic disorder, is one of the causes of malignant hyperphenylalaninemia due to tetrahydrobiopterin deficiency. Not only does tetrahydrobiopterin deficiency cause hyperphenylalaninemia, it is also responsible for defective neurotransmission of monoamines because of malfunctioning tyrosine and tryptophan hydroxylases, both tetrahydrobiopterin- dependent hydroxylases. GTP-cyclohydrolase I deficiency should be suspected in all infants with a positive neonatal screening test for phenylketonuria, especially when hyperphenylalaninemia is moderate. The most effective way to diagnose the disorder is to measure pteridine levels in urine and to confirm the result by measuring neurotransmitters (5-hydroxyindolacetic acid, homovanillic acid) in cerebrospinal fluid and with an oral tetrahydrobiopterin-loading test (20 mg/kg). When left untreated, the deficiency causes neurological signs at age 4 or 5 months, although clinical signs are often obvious
    [Show full text]
  • Consensus Guideline for the Diagnosis and Treatment of Tetrahydrobiopterin
    Opladen et al. Orphanet Journal of Rare Diseases (2020) 15:126 https://doi.org/10.1186/s13023-020-01379-8 REVIEW Open Access Consensus guideline for the diagnosis and treatment of tetrahydrobiopterin (BH4) deficiencies Thomas Opladen1*†, Eduardo López-Laso2†, Elisenda Cortès-Saladelafont3,4†, Toni S. Pearson5, H. Serap Sivri6, Yilmaz Yildiz6, Birgit Assmann1, Manju A. Kurian7,8, Vincenzo Leuzzi9, Simon Heales10, Simon Pope10, Francesco Porta11, Angeles García-Cazorla3, Tomáš Honzík12, Roser Pons13, Luc Regal14, Helly Goez15, Rafael Artuch16, Georg F. Hoffmann1, Gabriella Horvath17, Beat Thöny18, Sabine Scholl-Bürgi19, Alberto Burlina20, Marcel M. Verbeek21, Mario Mastrangelo9, Jennifer Friedman22, Tessa Wassenberg14, Kathrin Jeltsch1†, Jan Kulhánek12*†, Oya Kuseyri Hübschmann1† and on behalf of the International Working Group on Neurotransmitter related Disorders (iNTD) Abstract Background: Tetrahydrobiopterin (BH4) deficiencies comprise a group of six rare neurometabolic disorders characterized by insufficient synthesis of the monoamine neurotransmitters dopamine and serotonin due to a disturbance of BH4 biosynthesis or recycling. Hyperphenylalaninemia (HPA) is the first diagnostic hallmark for most BH4 deficiencies, apart from autosomal dominant guanosine triphosphate cyclohydrolase I deficiency and sepiapterin reductase deficiency. Early supplementation of neurotransmitter precursors and where appropriate, treatment of HPA results in significant improvement of motor and cognitive function. Management approaches differ across the world
    [Show full text]