Polyamine Metabolism in Arabidopsis: Transgenic Manipulation and Gene Expression Rajtilak Majumdar University of New Hampshire, Durham

University of New Hampshire University of New Hampshire Scholars' Repository

Doctoral Dissertations Student Scholarship

Winter 2011 Polyamine metabolism in Arabidopsis: Transgenic manipulation and gene expression Rajtilak Majumdar University of New Hampshire, Durham

Follow this and additional works at: https://scholars.unh.edu/dissertation

Recommended Citation Majumdar, Rajtilak, "Polyamine metabolism in Arabidopsis: Transgenic manipulation and gene expression" (2011). Doctoral Dissertations. 645. https://scholars.unh.edu/dissertation/645

This Dissertation is brought to you for free and open access by the Student Scholarship at University of New Hampshire Scholars' Repository. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of University of New Hampshire Scholars' Repository. For more information, please contact [email protected]. POLYAMINE METABOLISM IN ARABIDOPSIS: TRANSGENIC

MANIPULATION AND GENE EXPRESSION

RAJTILAK MAJUMDAR

B.S. Uttarbanga Krishi Viswavidyalaya, Pundibari, India, 2001

M.S. Bidhan Chandra Krishi Viswavidyalaya, Mohanpur, India, 2003

DISSERTATION

Submitted To the University of New Hampshire in Partial Fulfillment of the Requirements for the Degree of

Doctor of Philosophy

Plant Biology

December, 2011 UMI Number: 3500791

INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.

In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. UMT Dissertation Publishing

ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 This dissertation has been examined and approved,

Dissertation Director, Dr. Subhash C. Minocha Professor of Plant Biology and Genetics

£W— itou^ Dr. Rakesh Minocha Research Scientist, USDA-Forest Service Affiliate Professor of Plant Biology and Natural Resources, UNH

Dr. Estelle M. Hrabak Associate Professor of Genetics

L^x^^r^Lyit Dr. Leland S. Jahrike Professor of Plant Biology

Dr. Andrew P. Laudano Associate Professor of Biochemistry and Molecular Biology

Date wfe^£/- <3 ? , iWy

ii DEDICATION

This dissertation is dedicated to my family: my father late Sarojaksha Majumdar, my parents, my uncle, my aunt, my wife, my sisters and brother in-laws, my cousins, and my in-laws. I would also like to dedicate this dissertation to the memory of late Prof. Edward Herbst, a pioneering polyamine researcher at the University of New Hampshire.

iii ACKNOWLEDGEMENTS

Mere words are inadequate to express the sense of gratitude and indebtedness to those whose assistance was indispensable for the completion of my Ph. D. Dissertation. This is my proud prerogative of expressing my fathomless regard and gratefulness to my dissertation director, Dr. Subhash C. Minocha and my (almost) dissertation co-director, Dr. Rakesh Minocha for providing me the opportunity to conduct this research and for their constant generous and affectionate guidance, support, patience, inexhaustible encouragement and moral support at tough times during this journey as a Ph.D. student. I feel proud to be a part of this research team. I pay my tribute to Dr. Edward Herbst who pioneered earlier work on poly amines and that was carried forward by Minocha lab. I would like to express my special thanks to Dr. Estelle Hrabak for her valuable technical advice with my research, her courses that helped me better understand my research and make me self-dependent to carry this research. I would also like to acknowledge the assistance of other members of my dissertation committee, Dr. Leland S. Jahnke and Dr. Andrew P. Laudano for their guidance, feedback and constant support during this entire period of my stay at UNH. In addition I thank with all my heart, members of Dr. Rakesh Minocha's lab at the USDA-Forest Service, particulalrly, Stephanie Long, Gloria Quigley, Jane Hislop, and Jeffrey Merriam for their technical support and sample analyses. I express my immense gratitude and indebtedness to the past and present members of the Minocha lab at UNH for all of their help over the years; and reading drafts of my papers and thesis. They include, among others: Amanda Kuzmick, Alyssa Birt, Charles Rice, Dr. Sridev Mohapatra, Dr. Andrew Page, Smita (Singh) Cherry, Aakriti Joshi, Natalija Ulemek, Sarah Espinal, Michael Sellarole, Leslee Morrow, Alyssa Mixon, Lin Shao, Sarah Greenberg, Ashley Matthews, Dr. Swathi Turlapati, Karen Sweeney, Katherine Lantz, Ryan Lougee, Woodrow Wetherbee, Boubker Barchi, Caroline Wuest, Carolynn Madden, Emily Lantz, Jon Fogel, Michael Gagnon, Myles Johnson and others whose names may not have been recorded. I thank Swati Manocha for her last minute help with thesis organization.

iv I heartily acknowledge Graduate School and especially Dr. Cari Moorhead and Dr. Harry Richards for their continued support and funding (Summer TA Fellowships, Dissertation Fellowship, travel awards and UNH Best TA award, etc.) for my research and present my results at the national and international conferences. Words are of little avail to pay my gratitude to them for the moral support received from them at tough times. Special thanks to Megan Thompson for her technical advice, constant help with my research and being a good friend. I would also like to acknowledge Dr. Christopher Neefus for his constant support with funding, recommendations at several times, and technical advice with the statistical analysis of the data. Thanks to Dr. Carl Vaughan for his constant support and encouragement while I served as TA for biology labs. Thanks to the Dept. of Plant Biology and Dept. of Biological Sciences and College of Life Sciences and Agriculture for their continued funding for research and providing a great support system. Special thanks to Jobriah Anderson and other staff at the UNH Hubbard Genome Centre for their technical assistance with the sequencing and analysis. Special thanks to Dr. Anthony Tagliaferro and Dr. Dennis Mathews for their moral support at tough times. I specially thank Pamela Wildes, Charlotte Cooper, Diane Lavalliere, Meg Coburn and to all other graduate students and faculty members in Rudman and Spaulding Halls for their help and sharing such a wonderful fellowship during this entire journey of my Ph. D. I would specially like to acknowledge Father Andrew Cryans, Roberta MacBride, Barbara Farrington for all of their prayers and best wishes during this entire period of my journey. At this glorious moment I remember Baba, Maa, Mom, Dad, Mary Pace, Peter Pace, Ranga Kaka, Kakima, Pisemosai, Bordi, Himadrida, Mejdi, Samirda, Sejdi, Ajoyda, Chordi, Lalda, Ritu, Pol, Ankit, Indra, Partha, Jhunki, Dodo, Zico, Bubki, Arka, Titas, Archak, Thakuma, Dadu and Subodh Jethu who always believed in me that I can do it. Their constant infinitum of love, sacrifice, prayers and well wishes have always been the biggest source of strength, inspiration and hope in my life. Last but not the least; I want to specially acknowledge my wife Kathryn ('Meghna') Majumdar from the core of my heart for all of her love, constant support and inspiration in my life anything I do. This research was co-funded by USDA-NRI, USDA-Forest Service, Dept. of Plant Biology, Dept. of Biological Sciences and Agricultural Experimental Station, UNH.

v TABLE OF CONTENTS

Page number DEDICATION iii ACKNOWLEDGEMENTS iv LIST OF TABLES ix LIST OF FIGURES xi ABBREVIATIONS xvi ABSTRACT xvii INTRODUCTION Manipulation of polyamine metabolism in plants via mutants 5 Manipulation of polyamine metabolism in plants via transgene expression 9 Polyamines and the related biochemical pathways 18 S-Adenosylmethionine decarboxylase: a brief background 20 Structure and biochemical properties of SAMDCs 23 Genomic organization of SAMDC genes 26 Mutants of S-adenosylmethionine decarboxylase 32 Transgenic manipulation of polyamines via S-adenosylmethionine decarboxylase... 3 4 Expression patterns of S-adenosylmethionine decarboxylase genes in plants 40

MATERIALS AND METHODS Bacterial culture and plasmid isolation 52 Genomic DNA isolation 53 Polymerase Chain Reaction (PCR) 53 Restriction digestion and agarose gel electrophoresis 54 DNA sequencing and sequence analysis 56 Electroporation 56 Glycerol stocks 56 Cloning of mODC and AtSAMDC promoter regions 57 Plant transformation 58 Transient expression in poplar 58 Screening for homozygous transgenic lines 59 Qualitative assay of P-Glucuronidase (GUS) during Development 59

vi Seed sterilization and growth 60 Plant growth in soil 61 Incorporation of labeled precursors 62 Quantification of polyamines 62 Amino acid analysis 64 Total soluble protein measurement 64 Chlorophyll analysis 65 Total percent carbon and nitrogen 65 RNA isolation and cDNA synthesis 66 Quantitative Reverse Transcriptase Polymerase Chain Reaction (QRT-PCR) 67 Statistical analyses 67 Analysis of cis elements , 68 RESULTS Objective 1 Inducible expression of mODC: Associated biochemical changes 75 Inducible expression of mODC: Changes in polyamine content 76 Inducible expression of mODC: Changes in amino acids 78 Inducible expression of mODC: Uptake and incorporation of l4C into PAs 90 Constitutive expression of mODC: Polyamines and amino acids in seedlings 91 Constitutive expression ofmODC: Polyamines and amino acids in mature plants 98 Exogenous supply of polyamines: Polyamines and amino acids 107 Constitutive expression ofmODC: Extra nitrogen and carbon in the medium 112 Objective 2

Cloning of promoter regions 126 Transient expression 130 Expression profiles of AtSAMDC3, AtSAMDC4 and AtSAMDCS in seedlings 135 Expression of AtSAMDCS, AtSAMDC4 and AtSAMDC5 in mature vegetative organs... 142 Expression of AtSAMDC3, AtSAMDC4 and AtSAMDC5 in reproductive parts 144 Bioinformatics analysis of regulatory motifs in the promoter regions of AtSAMDCs... 151 Comparison of 5'UTR among different SAMDC genes in Arabidopsis 158 QRT-PCR of AtSAMDC gene expression 158

vii DISCUSSION Objective 1 Transgenic manipulation of PAs 161 Phenotypic changes in mODC transgenic plants 168 Ornithine as the key player in controlling polyamine, Pro and GABA biosynthesis.... 169 Changes in other amino acids 174 Total cellular C and N in relation to increase in polyamines 176 Conclusions and future perspectives- Objective 1 179 Objective 2 Expression of AtSAMDC genes 180 Defining the promoter 182 Transient expression vs. in vivo expression 183 Expression during early development 184 Mature plants 187 Conclusions- Objective 2 191 REFERENCES 192 SUPPLEMENTAL MATERIAL I

viii LIST OF TABLES

Table 1 The principle polyamine biosynthetic genes annotated in the Arabidopsis thaliana genomic databases 4

Table 2 Characterization of Arabidopsis mutants of ADC, SAMDC, SPDS and SPMS 6

Table 3A. Genetic manipulations of ODC in plants 13

Table 3B. Genetic manipulations of ADC gene in plants 14

Table 3C. Genetic manipulations of SAMDC, SPDS and SPMS genes in plants 15

Table 4. Details of SAMDC genes annotated in Arabidopsis 22

Table 5. Comparison of the sequence identities of different paralogues of Arabidopsis SAMDC gene family 22

Table 6. Conserved sequences of different members of Arabidopsis SAMDC genes 25

Table 7. Genomic organization of SAMDC genes from different plant species 28

Table 8. Primers used for cloning, sequencing and(Q)RT-PCR 55

Table 9A. Contents of amino acids at 12 h post induction in 12 d old seedlings of mODC-10-1 in different media 82

Table 9B. Contents of amino acids at 24 h post induction in 12 d old seedlings of mODC-10-1 in different media 83

Table 10. Contents of amino acids in 14 d old seedlings of WT, mODC-1-7, and mODC- 18-2 grown in GM medium 97

Table 11. Contents of amino acids in different tissues of 6 week old WT and mODCl-7 plants grown in pots 104

Table 12. Contents of amino acids in 7 d old WT seedlings grown in control (C), 1 mM Put, 1 mMSpdand0.5 mM Spm treated GM medium 113

Table 13. Putative cis elements in the AtSAMDCl promoter sequence 152

Table 14. Putative cis elements in the AtSAMDC2 promoter sequence 152

IX Table 15. Putative cis elements in the AtSAMDCS promoter sequence 153

Table 16. Putative cis elements in the AtSAMDC4 promoter sequence 155

Table 17. Putative cis elements in the AtSAMDC5 promoter sequence 156

Table SI. Typical retention times of dansyl-amino acids eluted in HPLC system Ill

x LIST OF FIGURES

Figure 1. Pathway for the biosynthesis of polyamines and amino acids 2

Figure 2. Plasmid maps and gel analysis results of inducible mODC construct 70

Figure 3. Plasmid maps and gel analysis results of constitutive mODC construct 71

Figure 4. Plasmid maps and gel analysis results of inducible GUS construct 72

Figure 5. Estradiol inducible transgenic seedlings containing GUS seedlings; (a) un- induced and (b) 24 h after induction 73

Figure 6. PCR screening of T2 inducible mODC (a) and 35S-mODC (b) plants 74

Figure 7. Cellular contents of PC A soluble polyamines in 12 h and 24 h induced (E) and un-induced mODC-10-1 transgenic plants with 0.1 mM Orn, 0.5 mM Arg, 1 mM Glu 77

Figure 8. Cellular contents of amino acids (a) glutamic acid, (b) glutamine, (c) proline, (d) histidine, (e) combined amount of arginine, threonine and glycine, (f) ornithine, (g) GABA, (h) Cys + cystine and (i) serine in 12 h and 24 h induced (E) and un-induced mODC-10-1 transgenic plants with 0.1 mM Orn, 0.5 mM Arg, 1 mM Glu 79

Figure 9. Cellular contents of (a) phenylalanine and (b) leucine + tryptophan in 12 h and 24 h induced (E) and un-induced mODC-10-1 transgenic plants with or without 0.1 mM Orn, 0.5 mM Arg, 1 mM Glu 86

Figure 10. Cellular contents of (a) alanine, (b) valine and (c) isoleucine in 12 h and 24 h induced (E) and un-induced mODC-10-1 transgenic plants with or without 0.1 mM Orn, 0.5 mM Arg, 1 mM Glu 87

Figure 11. Cellular contents of (a) lysine and (b) methionine in 12 h and 24 h induced (E) and un-induced mODC-10-1 transgenic plants with or without 0.1 mM Orn, 0.5 mM Arg, ImMGlu 88

Figure 12. Cellular contents of total PC A soluble amino acids in 12 h and 24 h induced (E) and un-induced mODC-10-1 transgenic plants with or without 0.1 mM Orn, 0.5 mM Arg, ImMGlu 89

Figure 13. Incorporation of U14C-Orn or U14C-Arg into polyamines in mODC-10-1 Arabidopsis transgenics upon ODC induction 92

xi Figure 14. Cellular contents of PCA soluble polyamines (a) putrescine, (b) spermidine, (c) spermine and (d) total polyamines in 14 d old WT and 35S::mODC transgenic plants grown in solid MS medium 93

Figure 15. Cellular contents of (a) glutamic acid, (b) glutamine, (c) ornithine, (d) proline, (e) histidine, (f) arginine, (g) GABA, (h) serine, (i) glycine and (j) Cys + cystine in 14 d old WT and 35S::mODC transgenic plants grown in solid MS medium 95

Figure 16. Cellular contents of (a) methionine, (b) lysine, (c) phenylalanine, (d) tryptophan, (e) alanine, (f) isoleucine, (g) valine, (h) leucine, (i) threonine, in 14 d old WT and 35S::mODC transgenic plants grown in solid MS medium 96

Figure 17. Total soluble amino acids in 14 d old WT and mODC transgenic plants 97

Figure 18. Progression of flowering (a, b, and c) in wild type (WT) and three independent over-expression lines of 35S::mODC plants 4..99

Figure 19. Comparison of different phenotypic parameters between WT and mODC transgenic plants 100

Figure 20. Cellular contents of chlorophyll (chl) in rosette leaves of 4 week old WT and mODC transgenic plants grown in pots 101

Figure 21. Cellular contents of carbon (C) and nitrogen (N) in 4 week old WT and mODC transgenic plants grown in pots 101

Figure 22. Cellular contents of PCA soluble polyamines (a) putrescine, (b) spermidine, (c) spermine, (d) cadaverine and (e) total polyamines in different organs of 6 week old WT and mODC transgenic plants 102

Figure 23. Cellular contents of amino acids in mature organs of 6 week old WT and mODC-1 -7 transgenic plants 105

Figure 24. Cellular contents of amino acids in mature organs of 6 week old WT and mODC-1 -7 transgenic plants 106

Figure 25. Total soluble amino acids in different tissues of 6 week old WT and mODC transgenic plants 108

Figure 26. Cellular contents of PCA soluble polyamines (a) putrescine, (b) spermidine and (c) spermine in 7 d old wild type (WT) Arabidopsis plants grown in solid GM medium without any treatment (control; C) and GM media supplemented with exogenous 1 mM putrescine, 1 mM spermidine and 0.5 mM Spm 109

xii Figure 27. Cellular contents of (a) glutamic acid, (b) glutamine, (c) ornithine, (d) histidine, (e) proline, (f) combined amount of arginine, threonine and glycine, (g) serine, (h) cys + cystine and (i) GABA in 7 d old WT seedlings grown in control (C), 1 mM Put, 1 mM Spd and 0.5 mM Spm treated solid GM medium 110

Figure 28. Cellular contents of (a) phenylalanine, (b) tryptophan, (c) alanine, (d) isoleucine, (e) valine, (f) leucine, (g) methionine and (h) lysine in 7 d old WT seedlings grown in control (C), 1 mM Put, 1 mM Spd and 0.5 mM Spm treated solid GM medium Ill

Figure 29. Total soluble amino acids in 7 d old WT seedlings grown in control (C), 1 mM Put, 1 mM Spd and 0.5 mM Spm treated solid GM medium 114

Figure 30. Representative samples of 12 d old WT seedlings grown in GM medium (C), MS medium supplemented with 50 mM sucrose and GM medium without N (w/o N) 115

Figure 31. Changes in fresh weight (FW; a), dry weight (DW; b) and DW as % of FW in 12 d old WT and mODCl-7 transgenic seedlings in response to varying concentrations of sucrose and nitrate 116

Figure 32. Effects of varying concentrations of nitrate and sucrose on PCA soluble Put (a and b), Spd (c and d) and Spm (e and f) contents in 12 d old WT and mODC Arabidopsis seedlings grown in solid GM medium 118

Figure 33A. Changes in amino acids in response to varying concentrations of sucrose and nitrate in 12 d old seedlings of WT and mODC-1-7 121

Figure 33B. Changes in amino acids in response to varying concentrations of sucrose and nitrate in 12 d old seedlings of WT and mODC-1-7 122

Figure 34A. Changes in amino acids in response to varying concentrations of sucrose and nitrate in 12 d old seedlings of WT and mODC-1-7 124

Figure 34B. Changes in amino acids in response to varying concentrations of sucrose and nitrate in 12 d old seedlings of WT and mODC-1-7 125

Figure 35. Different constructs of AtSAMDC3, AtSAMDC4 and AtSAMDCS made for analysis of gene expression 127

Figure 36. Plasmid maps and gel analysis results of SAMDC3-A construct 128

Figure 37. Plasmid maps and gel analysis results of SAMDC3-B construct 128

Figure 38. Plasmid maps and gel analysis results of SAMDC3-C construct 129

xiii Figure 39. Plasmid maps and gel analysis results of SAMDC3-D construct 129

Figure 40. Plasmid maps and gel analysis results of SAMDC4-A construct 131

Figure 41. Plasmid maps and gel analysis results of SAMDC4-B construct 131

Figure 42. Plasmid maps and gel analysis results of SAMDC4-C construct 132

Figure 43. Plasmid maps and gel analysis results of SAMDC4-D construct 132

Figure 44. Plasmid maps and gel analysis results of SAMDC5-A construct 133

Figure 45. Plasmid maps and gel analysis results of SAMDC5-B construct 133

Figure 46. Plasmid maps and gel analysis results of SAMDC5-C PCR product 134

Figure 47. Transient expression of different constructs of AtSAMDC3, AtSAMDC4 and AtSAMDCS: pCAM-35S as control in poplar cells (C) 134

Figure 48. Activity of GUS at early germination stages (24 h and 48 h from the time of sowing) in different constructs of AtSAMDC3, AtSAMDC4 and AtSAMDC5 transgenic Arabidopsis seeds 137

Figure 49. Activity, of GUS at 1 d (A1-A4), 3 d (B1-B4), 7 d (C1-C4) and 11 d (D1-D4) old seedlings of SAMDC3-A, SAMDC3-B, SAMDC3-C and SAMDC3-D plants 138

Figure 50. Activity of GUS at 1 d (A1-A4), 3 d (B1-B4), 7 d (C1-C4) and 11 d (D1-D4) old seedlings of SAMDC4-A, SAMDC4-B, SAMDC4-C and SAMDC4-D plants 140

Figure 51. Activity of GUS at 1 d (A1-A3), 3 d (B1-B3), 7 d (C1-C3) and 11 d (D1-D3) old seedlings of SAMDC5-A, SAMDC5-B and SAMDC5-C plants 141

Figure 52. Activity of GUS in 5 week old vegetative tissues of SAMDC3-A, SAMDC3-B, SAMDC3-C and SAMDC3-D transgenic Arabidopsis plants 143

Figure 53. Activity of GUS in 5 week old vegetative tissues of SAMDC4- A, SAMDC4-B, SAMDC4-C and SAMDC4-D transgenic Arabidopsis plants 145

Figure 54. Activity of GUS in 5 week old vegetative tissues of SAMDC5-A, SAMDC5-B and SAMDC5-C transgenic Arabidopsis plants 146

Figure 55. Activity of GUS in reproductive parts of SAMDC3-A, SAMDC3-B, SAMDC3- C and SAMDC3-D plants 147

Figure 56. Activity of GUS in reproductive parts of SAMDC4-A, SAMDC4-B, SAMDC4- C and SAMDC4-D plants 149

xiv Figure 57. Activity of GUS in reproductive parts of SAMDC5-A, SAMDC5-B and SAMDC5-C plants 150

Figure 58. Relative gene expression (QRT-PCR) AtSAMDCl, AtSAMDC2, AtSAMDC3 and AtSAMDC4 genes in WT Arabidopsis 160

Figure SI. Representative HPLC chromatograms of WT (a) and mODCl-7 (b) plants showing separation of dansyl-polyamines I

Figure S2. A representative HPLC chromatogram of dansylated amino acids II

xv ABBREVIATIONS

ABA= abscisic acid; Ala= alanine; Arg= arginine; Asp= aspartate; Cad= cadaverine; cDNA= complementary DNA; Cys= cysteine; dcSAM= decarboxylated S- adenosylmethionine; DW= dry weight; EDTA= ethylenediamine tetraacetic acid; FW= fresh weight; GABA= y-aminobutyric acid; Gln= glutamine; Glu= glutamate, Gly= glycine; h= hour; His= histidine; HPLC= high performance liquid chromatography; Ile= isoleucine; Leu= leucine; Lys= lysine; Met= methionine; mRNA= messenger RNA; MS= murashige and skoog; NADP= nicotinamide adenine dinucleotide phosphate; Orn= ornithine; PAO= polyamine oxidase; PCA= perchloric acid; Phe= phenylalanine; Pro= proline; RNA= ribonucleic acid; SAM= S-adenosyl methionine; SE= standard error; Ser= serine, TCA= tricarboxylic acid; Thr= threonine; Trp= tryptophan; tSPMS= thermospermine synthase; Val= valine; WT= wild type.

xvi ABSTRACT

POLYAMINE METABOLISM IN ARABIDOPSIS: TRANSGENIC MANIPULATION AND GENE EXPRESSION

By Rajtilak Majumdar University of New Hampshire; December 2011

The metabolism of polyamines (Putrescine, Spermidine and Spermine) in wild type and transgenic Arabidopsis thaliana (Col 0 ecotype) plants was studied using the techniques of transgenic manipulation and gene expression. Two specific objectives were: 1. To study the effects of inducible and constitutive transgenic manipulation of polyamines via a mouse ornithine decarboxylase (mODC) gene on plant metabolism. 2. To analyze the spatial and temporal expression patterns of Arabidopsis thaliana S-adenosylmethionine decarboxylase genes (AtSAMDC3, AtSAMDC4 and AtSAMDCS) during its life cycle. The major findings are: (i) Orn becomes a limiting substrate for Put biosynthesis in transgenic Arabidopsis expressing mODC gene, (ii) Put over-production cause delayed flowering, increased FW and DW, higher silique number and higher chlorophyll content, (iii) the cellular contents of several amino acids change under constitutive as well as short term induction of vnODC, (iv) there is a greater utilization and assimilation of carbon and nitrogen into polyamines and amino acids by the mODC-transgenic plants, (v) different members of the AtSAMDC gene family are expressed differently in different tissues/organs during development (vi) expression of AtSAMDC4 is much higher than AtSAMDC3 and AtSAMDC5, (vii) the promoter regions of all AtSAMDC genes contain common cw-regulatory elements that are associated with stress responses, developmental regulation, and hormone responses.

xv INTRODUCTION

Polyamines (PAs; putrescine - Put, spermidine - Spd, and spermine - Spm) are organic polycations found in all living organisms. They are implicated in many physiological phenomena in plants relating to growth and development, stress responses and are involved in a multitude of cellular functions, e.g. regulation of transcription and translation, nucleic acid and membrane stabilization, and regulation of reduced N pool in cells (Minocha and Minocha 1995; Bouchereau et al. 1999; Hyvonen et al. 2006;

Peremarti et al. 2009; Landau et al. 2010; Mattoo et al. 2010a; Mohapatra et al. 2010a;

Quinet et al. 2010). The diamine Put, is synthesized either by direct decarboxylation of ornithine (Orn) by Orn decarboxylase (ODC; EC 4.1.1.17) or indirectly from arginine

(Arg) by Arg decarboxylase (ADC; EC 4.1.1.19). The product of ADC (Agmatine -

Agm) is then converted into Put via one or two steps (Fig. 1). Putrescine is sequentially converted into Spd and Spm by combined actions of S-adenosylmethionine decarboxylase (SAMDC; EC 4.1.1.50) and two different aminopropyltransferases (APTs;

Spd synthase - SPDS; EC 2.5.1.16 and Spm synthase - SPMS; EC 2.5.1.16).

Involvement of PAs in the process of somatic embryogenesis has been well known

(Minocha and Minocha 1995; Minocha et al. 1995) and still remains a topic of interest

(Meskaoui and Trembaly 2009). Their involvement has been demonstrated by a variety of experimental approaches; e.g. showing changes in PAs during embryogenesis, inducing embryogenesis by exogenous application of PAs, inhibiting embryogenesis using inhibitors, and inducing embryogenesis via genetic manipulation of PAs. There still remains the question of the mechanism(s) by which PAs help regulate and promote

1 Urea

dcSAM

Figure 1. Pathway for the biosynthesis of polyamines and amino acids (adapted from Mohapatra et al. 2010b); Abbreviations (PA enzymes): ODC= ornithine decarboxylase; ADC= Arginine decarboxylase; SAMDC= S-adenosylmethionine decarboxylase; SPDS= spermidine synthase; SPMS= spermine synthase. Dashed lines= multiple steps.

2 somatic embryogenesis in numerous plant species. Unfortunately, little progress has been made in this direction in recent years.

In addition to developmental roles of PAs, the relationship of PAs with abiotic stress has a long history of discussion and reviews (Kumar et al. 1997; Bouchereau et al. 1999;

Kasukabe et al. 2004; Duan et al. 2008; Ozawa et al. 2009; Chai et al. 2010; Ding et al.

2010; Shevyakova et al. 2010; Quinet et al. 2010; Alsokari 2011; Hussain et al. 2011).

Due to their physiological importance and the diversity of roles in cellular processes, there is widespread interest in understanding the regulation of PA metabolism at the level of gene expression as well as enzymatic reactions. The latter is especially important since the key enzymes involved in PA biosynthesis are often short-lived, and precursors of their biosynthesis are involved in several key metabolic pathways (Cohen 1998).

Although many enzymes, and hence genes, participate in PA metabolism, the activities of

ADC, ODC, SAMDC, and diamine/PA oxidases (DAO/ PAO) are considered crucial for homeostatic regulation of the PA metabolic pathway and the steady state of cellular contents. While most plants have multiple copies of genes for each enzyme, including

Arabidopsis thaliana (Table 1), there apparently is no ODC gene in this species (Hanfrey et al. 2001); hence Put biosynthesis in Arabidopsis occurs entirely by ADC pathway.

Application of exogenous PAs and the use of PA biosynthetic inhibitors have been common approaches to analyze some of the developmental roles of PAs in plants

(Mengoli et al. 1989; Minocha and Minocha 1995; Minocha et al. 1995; Rajyalakshmi et al. 1995; Bagni and Tassoni 2001; Couee et al. 2004). Some recent examples of exogenous PA applications to study physiological and biochemical processes in plants under normal conditions and under different abiotic and biotic stresses include: Khan et

3 Table 1. The principle polyamine biosynthetic genes annotated in the Arabidopsis thaliana genomic databases (TAIR and NCBI)

Gene Locus E.C. Accession #

AtADCl At2g 16500 4.1.1.19 NM_127204 AtADC2 At4g34710 4.1.1.19 NM_119637 ODC Not applicable Not applicable Not applicable AtSAMDCl At3g02470 4.1.1.50 NMJ11114 AtSAMDC2 At5gl5950 4.1.1.50 NMJ21600 AtSAMDC3 At3g25570 4.1.1.50 NM_113454 AtSAMDC4 At5gl8930 4.1.1.50 NMJ21898 AtSAMDC5 At3gl7715 4.1.1.50 Not available AtSPDSl Atlg23820 2.5.1.16 NM_102230 AtSPDS2 Atlg70310 2.5.1.16 NM_105699 AtSPMS At5g53120 2.5.1.16 NM_124691 AtACL5 At5gl9530 2.5.1.16 NMJ21958 (tSPMS)

4 al. (2008); Khosroshahi and Esna-Ashari (2008); Khan and Singh (2010); Bibi et al.

(2010). Two types of genetic approaches that have been used to experimentally alter PA metabolism in plants in addition to physiological manipulations using PA biosynthesis inhibitors are mutants and genetic engineering. The former approach was tested first by

Malmberg and Mclndoo (1983), and since been used with almost all PA biosynthetic genes to manipulate PA metabolism in plants more so than in animals.

Manipulation of polyamine metabolism in plants via mutants

Several mutants of PA biosynthetic genes are reported in plants. Mutants of AtADCl and AtADC2 in A. thaliana have been well characterized and their phenotypes are summarized in Table 2. Watson et al. (1998) reported ADC-deficient mutants in

Arabidopsis generated through ethylmethane sulfonate (EMS) mutagenesis. Reduced activities of ADC were observed in the add {spel; 23-36% reduction of ADC activity) and adc2 (spe2; 39-50% reduction of ADC activity) mutant plants. Double mutants

(spel-l/spe2-l) showed somewhat higher reduction in ADC activity than either of the single mutants; this was accompanied by reduced Put and Spb contents in the roots and shoots as in spe2-l alone. The single mutants exhibited higher lateral root number and root growth as compared to the WT plants, whereas the double mutants exhibited a highly kinked and compact root pattern. The single mutants did not show any change in whole plant morphology except for a few lines with occasional increase in the numbers of sepals and petals in the flowers. The spel-l/spe2-l plants showed narrow and twisted leaves, narrow sepals and petals, and delayed flowering (by a week) as compared to the

WT or the single mutant plants.

5 Table 2. Characterization of Arabidopsis mutants of ADC, SAMDC, SPDS, SPMS and ACL5 genes.

Gene Mutant Mutagen Mutation loci/type Phenotype/Biochemical References alteration Arginine spe1-1, spe2-1, spel- Ethylmethane ADC-deficient mutant Decrease in Put and Spd; Watson et al. decarboxylase 1/spe2-1 sulfonate single mutant had higher 1998 lateral root initiation and growth; double mutants were viable with kinked and compact roots adc2 En-1 insertion Insertion at 1508 bpof Lower ADC activity with no Soyka and Heyer, intron-less coding region phenotype; little induction of 1999 ADC in the transgenic plants under osmotic stress in comparison to WT plants add-1, adc2-2 and T-DNA insertion Insertion at 1141 bp Lower Put and Spd. Double Urano et al. 2005 add-1/adc2-2 (add-1) and 1364 bp mutants showed narrow and (adc2-2) of coding regions twisted leaves, narrow sepals, petals, delay in flowering and embryo lethality S-adenosyl bud2-1, samdd-1 and T-DNA insertion Insertion at coding region Bushy and dwarf with Ge et al. 2006 methionine bud2-1/samdc1-1 of bud2-1 and at 3'UTR of increased lateral roots in decarboxylase samdd-1 bud2-1; samdd-1 similar to bud2-1 but even severer; bud2-1/samdd-1 was embryo lethal Spermidine spds1-1 T-DNA insertion Insertion in exon 7 No phenotypic change, no Imai et al. 2004b synthase alteration of PAs spds2-1 T-DNA insertion Insertion in intron 3 Same as spds1-1 Imai et al. 2004b Spermidine spds2-2 T-DNA insertion Insertion in exon 7 Same as spds1-1 Imai et al. 2004b synthase spds1-1/spds2-1 T-DNA insertion See spds1-1 and spds2-1 Embryo lethal; greatly Imai et al. 2004b increased Put, decreased Spd and Spm Spermine spms-1 T-DNA insertion Insertion in intron 1 No phenotypic change; Imai et al. 2004a synthase increased Spd, decreased Spm Acaulis 5 acl5-1 Methane- 1 bp substitution in exon 4 Dwarf inflorescence stems, Hanzawa et al. sulfonate incomplete xylem 2000; Imai et al. development; 2004a; Kakehi et Lack of tSpd higher Put, Spd al. 2008; Rambia and Spm etal. 2010 acl5-3 Ds insertion Insertion in intron 6 Dwarfism phenotype same as Hanzawa et al. acl5-1 2000 acl5-4 Ds insertion Large deletion from the Dwarfism phenotype same as Hanzawa et al. excision of acl5-3 Ds acl5-1 2000; Mufiiz et al. transposon (2008) Spermine spms-1/acl5-1 T-DNA insertion See spms-1 and acl5-1 Dwarfism phenotype same as Imai et al. 2004a; synthase and and Methane- acl5-1, hypersensitive to Yamaguchi et al. acaulis 5 sulfonate salinity and drought; Lack of 2006, 2007; tSpm, decreased Spm, Rambia et al. increased Spd 2010 Acaulis 5 Thickvein Diepoxybutane 1 bp deletion in exon 7 of Dwarfism, thicker veins, Clay and Nelson ACL5 disruption of auxin polar 2005 transport Soyka and Heyer (1999) reported Arabidopsis adc2 mutant generated through insertion of a maize transposable element En-1. The mutant plants showed no detectable

AtADC2 transcripts in different organs and a 44% reduction in ADC activity with no obvious phenotypic changes. In a detached leaf assay under osmotic stress, WT plants showed 18-fold induction of ADC activity whereas the mutant showed only a 2-fold induction of ADC activity vs. their corresponding controls. In another study involving T-

DNA insertion mutants of add and adc2, there was a 70% reduction in Put and 35% reduction in Spd in the latter with no significant change in PAs in the former (Urano et al.

2005). The ADC double mutant (adcl/adc2) showed embryo lethality, while adcl+/'

/adc2~/~ or adcl'/7adc2+/' mutants showed abnormal seeds in the developing siliques.

Several mutants of ADC have also been used to study stress responses in relation to reduced level of Put. In a study with adc2 mutant of Arabidopsis, Urano et al. (2004) saw a decrease in Put content and reduced tolerance to salt stress. Up-regulation of Put biosynthesis under low temperature and the role of Put in alleviating cold stress in concert with ABA have also been implicated in plants. Arabidopsis mutants (adcl-3 and adc2-3) with lower Put levels, showed less tolerance to low temperature (Cuevas et al.

2008). There was also a down-regulation of NCED3 expression (a key gene involved in

ABA biosynthesis) and other ABA-related genes, as well as lower ABA content.

Complementation and reciprocal complementation of adc and aba2-3 mutants with ABA and Put, respectively, restored cold tolerance in the mutants. Transgenic expression of a

Poncirus trifoliata ADC {PtADC) under 35S promoter in adcl-1 resulted in higher Put content (in the transgenic mutant lines) with a recovery of stomatal frequency (i.e. stomata/unit leaf area comparable to the WT plants; Wang et al. (2011). Transgenic

8 plants showed greater tolerance to drought, high osmoticum, and low temperature stresses in comparison to WT and adcl-1 plants. Mutant transgenic plants showed longer roots under normal as well as stress conditions, greater cell number in roots, longer root meristematic zone, and displayed less accumulation of reactive oxygen species under stress conditions compared to WT plants.

Changes in gene expression and associated metabolic changes in mutants of PA biosynthetic enzymes have also been reported occasionally but not studied systematically. For example, microarray analysis of SPDS and Spm oxidase double mutant {k.spe3Afmsl) in yeast showed differential responses to exogenous Spd or Spm vs. the WT (Chattopadhyay et al. 2009); Spd affected a higher number of genes. Other mutants of SAMDC, SPDS, SPMS and tSPMS are described by Shao et al. (2011) and summarized in Table 2. No ODC mutant has been reported in plants.

Manipulation of polyamine metabolism in plants via transgene expression

Manipulations of PA metabolism through transgenic expression (genetic engineering) of ODC, ADC, SAMDC, SPDS and PAO have often been reported in plants and most studies have used constitutive expression (Thu-Hang et al. 2002; Mayer and Michael

2003; Rea et al. 2004; Alcazar et al. 2005; Wen et al. 2008; Nolke et al. 2008). In some cases, the transgenic plants have also been tested for the roles of PAs in developmental and stress responses. The first report of transgenic manipulation of Put involved the expression of a yeast ODC gene under the control of Cauliflower Mosaic Virus 35S promoter (CaMV35S; henceforth called 35S) which caused a significant increase in ODC activity and Put content (by 2-fold), accompanied by a 2-fold increase in Put-derived alkaloid nicotine in transgenic tobacco (Nicotiana rustica) root cultures (Hamill et al.

9 1990). In a later study with N. tabacum, DeScenzo and Minocha (1993) expressed a mouse ODC (mODC) under 35S promoter, achieving a 2.2-fold increase in Put in the leaves with the accompanying phenotype of male sterility in mature plants. Further studies with wild carrot (Daucus carota var. Queen Anne's Lace) using the same gene- promoter combination found 4- to 12-fold higher Put accumulation and a promotion of somatic embryogenesis in transgenic suspension cultures (Bastola and Minocha 1995).

The transgenic cells were able to produce somatic embryos even in the presence of difluoromethylarginine (DFMA - an inhibitor of ADC), showing that Put produced by mODC substituted for native ADC function. It was further shown that ADC activity was not affected by increased ODC production, and higher Put production was accompanied by higher rate of Put conversion into Spd and Spm with increased catabolism of Put in the cells (Andersen et al. 1998).

Kumria and Rajam (2002) also reported increased Put production in tobacco using the same mODC cDNA as used by the Minocha lab. Regeneration efficiency of the transgenic plants correlated with Put to Spd ratio; e.g. low Put to Spd ratio in the transgenic plants resulted in lower responses to the regeneration medium and vice versa.

Transgenic lines with elevated Put showed higher germination rates and overall seedling performance under salt stress. Transgenic expression of a human ODC (hODC) under the control of maize Ubi-1 promoter in rice while causing a ~2 to 6-fold increase in Put also resulted in significant increases in Spd and Spm (Lepri et al. 2001). Mayer and Michael

(2003) reported that transgenic expression of a Datura stramonium ODC (DsODQ cDNA in tobacco under 35S promoter resulted in 25-fold higher ODC activity in leaves and a five-fold increase in flower buds but there was <2-fold increase in Put in these

10 tissues. There was no significant change in Spd, Spm and soluble or insoluble hydroxycinnamic acid-conjugated PAs. Feeding of 10 mM Orn to cell cultures derived from control and transgenic plants showed 1.5 to 2.5-fold increase in Put after 7 h.

A transgenic (mODC gene under 2x35S promoter) cell line of poplar (Populus nigra x maximowiczii) in our lab showed 3- to 7-fold increase in Put content with a small

increase in Spd and a decrease in Spm; increased biosynthesis of Put was accompanied by a parallel increase in its catabolism (Bhatnagar et al. 2001, 2002). Contrary to the expectation of feedback regulation, there actually was an increase in the relative expression of ADC in the high Put (called HP) cell line. Further, the expression of three

SAMDCs and two SPDSs was affected differently (Page et al. 2007). Total soluble protein (g"1 FW) was significantly higher in the HP cells. Increased production of Put was accompanied by a significant reduction in Glu with accompanying pleiotropic effects on several other amino acids, changes in the oxidative state of the cells, and altered carbon

(C) and nitrogen (N) balance in the transgenic cells (Mohapatra et al. 2009, 2010b). It was later shown (Page et al. 2010) that the expression of Glu-Orn-Arg pathway genes was highly coordinated and their expression was not affected by the increased flux of metabolites through this pathway due to increased utilization of Orn by mODC.

Inhibition of ODC activity through RNAi in hairy root cultures of N. tabacum showed down-regulation of both ODC transcripts and ODC activity (DeBoer et al. 2011). A slight increase of ADC transcripts and increase in ADC activity were also seen. Decreased ODC activity altered alkaloid composition in the transgenic plants where major alkaloid nicotine decreased, with a concomitant increase in anatabine both in the roots and leaves as well as hairy root cultures. Methyl jasmonate (MeJ), which typically stimulates

11 nicotine biosynthesis in tobacco, did not have any effect in the ODC RNAi plants; however, there was a further increase in anatabine content upon MeJ treatment. Several other studies on genetic manipulation of Put in plants through transgenic expression of

ODC are summarized in Table 3 A.

There are several examples of genetic manipulation of Put via transgenic expression of ADC in plants (Table 3B). In contrast to ODC over-expression, in most cases small only changes in PAs are often seen. Most studies targeting Put overproduction have found that increased Put production/accumulation is not accompanied by parallel increases in either Spd or Spm, suggesting that the cellular contents of these PAs are more tightly regulated than the diamine Put. A part of the explanation may lie in the fact that SAMDC, whose product decarboxylated SAM (dcSAM) is a co-substrate for APTs, is a highly regulated enzyme of the pathway (Pegg et al. 1986; Slocum 1991). Also, the added complexity of APT requirement also contributes to limiting the production of higher PAs. The third factor that could prohibit parallel increases in Spd and Spm would be the PAOs, which catabolize these PAs. Thus there have been attempts to directly manipulate cellular Spd and Spm through genetic manipulation of SAMDC and/or SPDS in plants (Table 3C). A summary of information on SAMDC expression, its regulation, its genetic manipulation, and responses to abiotic stresses and phytohormones in plants is covered in the SAMDC section of this thesis. The current status of research on plants genetically manipulated with APTs has been reviewed by Shao et al. (2011). Rarely, if ever, have more than two-to-three-fold increases in Spd and Spm have been achieved. On the other hand, even with these relatively small increases, the stress tolerance of these plants has been variously demonstrated (Shao et al. 2011 and references therein).

12 Table 3A. Genetic manipulations of ODC activity in plants.

Plant Transgene Approach Biochemical alteration/ Phenotype if any Reference source Nicotiana rustica Yeast ODC 35S promoter High ODC activity, high Put and Put-derived Hamill et al. alkaloid nicotine in root culture 1990 Nicotiana tabacum Mouse ODC 35S promoter Increase in Put in the leaves with accompanying DeScenzo male sterility and Minocha 1993 Daucus carota Mouse ODC 35S promoter High Put content and a decrease in Spm with a Bastola and promotion of somatic embryogenesis Minocha 1995 Daucus carota Mouse ODC 35S promoter Increased Put content via ODC, while ADC Andersen et activity not changed; higher Put catabolism and al. 1998 conversion to Spd and Spm Populus nigra x Mouse ODC 35S promoter Higher Put content, with a small increase in Spd Bhatnagar et maximowiczii and decrease in Spm al. 2001 Oryza sativa Human ODC Maize Ubi-1 promoter Higher Put, Spd and Spm in the leaves, seeds Lepri et al. and roots 2001 Nicotiana tabacum Mouse ODC 35S promoter Higher ODC activity, increase in Put and Spd Kumria and contents; greater tolerance to salt stress Rajam 2002 Nicotiana tabacum Datura ODC 35S promoter Higher activity of ODC in leaves and flower buds; Mayer et al. small increase in Put; no morphological 2003 phenotype Nicotiana tabacum Human ODC Cytosolic and apoplastic Increase in ODC activity and Put content; no Nolke et al. expression via N-terminal change in Spd and Spm 2008 signal peptide; 35S promoter Datura innoxia Mouse ODC 35S promoter Increase in PAs and the alkaloid scopolamine Singh et al. 2011 N. tabacum N. glauca RNAi Lower ODC activity; lower nicotine and increase DeBoer et al. ODC in anatabine 2011 Table 3B. Genetic manipulations of ADC activity in plants.

Plant Transgene Approach Biochemical alteration/ Phenotype if any Reference source Nicotiana tabacum Avena sativa 35S promoter Higher ADC activity and Agm content without change in Burtin and ADC Put, Spd and Spm; no phenotypic change observed Michael 1997

Nicotiana tabacum Avena sativa tetracycle inducible Higher Put and Spd, short internodes, thin stems and Masgrau et al. ADC promoter leaves, leaf chlorosis and necrosis, reduced root growth 1997

Oryza sativa Avena sativa 35S promoter Higher Put with a small decrease in Spm in calli and Capell et al. ADC regenerated plants; lower regeneration efficiency 1998 Oryza sativa Avena sativa maize Ubi-1 promoter Higher ADC activity with high or low Put, Spd and Spm Bassie et al. ADC based on developmental stages of calli 2000 Oryza sativa Avena sativa maize Ubi-1 promoter Small increase in Put, Spd and Spm in the leaves Noury et al. ADC without much change in the seeds 2000 Oryza sativa Avena sativa ABA-inducible promoter Increased Put in the leaves, increased biomass and Roy and Wu ADC greater salt tolerance 2001

Oryza sativa Datura 35S promoter Increase in Put and Spd, little delay in flowering and Capell et al. stramonium greater tolerance to drought 2004 ADC Arabidopsis thaliana A. thaliana 35S promoter Put content increased in the leaves, dwarf and late Alcazar et al. ADC2 flowering that was restored by GA3 2005

Nicotiana tabacum Nicotiana Antisense - 35S promoter Decrease in nicotine and increase in anatabine Chintapakorn tabacum contents in hairy root cultures and Hamill ADC 2007 Solanum melongena Avena sativa 35S promoter Increase in ADC and ODC activities, increase in Put Prabhavathi ADC and Spd; greater tolerance to abiotic stresses and and Rajam Fusarium wilt disease 2007 Arabidopsis thaliana Avena Sativa pRD29A promoter Increased Put content under low temperature and Alet et al. ADC dehydration stresses; greater tolerance 2011 Arabidopsis thaliana Poncirus 35S promoter Higher Put content in the mutant, restoration of normal Wang et al. adcl-1 mutant trifoliate ADC stomatal frequency (comparable to WT) in the mutant 2011 Table 3C. Genetic manipulations of SAMDC, SPDS and SPMS genes in plants.

Nicotiana tabacum Human 35S promoter Transgenic leaf discs produced shoots in the CIM; no Noh and SAMDC phenotypic changes in mature plants Minocha 1994 Solanum tuberosum Solanum 35S promoter High SAMDC activity with high Put, Spd and Spm in the Kumar et al. tuberosum leaves. Transgenic plants failed to regenerate from callus 1996 SAMDC Solanum tuberosum Solanum Antisense SAMDC - Decrease in SAMDC activity accompanied by a decrease Kumar et al. tuberosum 35S promoter in Put, Spd and Spm contents; stunted growth, higher 1996 SAMDC branching, smaller leaves, poor root growth and early senescence Solanum tuberosum Solanum tuber specific patatin High SAMDC activity and increased Spd content in the Pedros et al. tuberosum promoter tubers, larger numbers of smaller tubers at maturity stage 1999 SAMDC in transgenic plants Lycopersicon Yeast SAMDC tomato fruit ripening High Spd and Spm in ripe fruits, high lycopene content in Mehta et al. esculentum specific E8 promoter the juice and increased vine life of the fruits 2002 Oryza sativa Tritordeum ABA-inducible Increase in Spd and Spm contents and decrease in shoot Roy and Wu SAMDC promoter length and fresh weight upon salt stress vs. WT plants 2002 Oryza sativa Datura maize Ubi promoter High Spd content in the leaves and increase in Spd and Thu-Hang et stramonium Spm contents in the seeds with no phenotypic changes in al. 2002 SAMDC mature plants Daucus carota Human 35S promoter Increased SAMDC activity along with higher Spd; higher Bastola 1994 SAMDC no of somatic embryos and morphologically stouter l embryos Nicotiana tabacum Human 35S promoter Increase in Spd and Put contents; delayed regeneration, Waie and SAMDC slower growth and shorter internode without any Rajam 2003 abnormalities in flowers and fruits Nicotiana tabacum Datura Antisense SAMDC Decreased SAMDC activity with an increase of Put to Spd Torrigiani et stramonium 35S promoter ratio. Decrease in rhizogenic potential of leaf explants al. 2005 SAMDC from transgenic plants Nicotiana tabacum Dianthus Over-expression Increase in total PAs, total seed number and seed weight, Wi et al. 2006 caryophyllus under 35S promoter net photosynthetic rate and greater tolerance to salt and SAMDC oxidative stresses Nicotiana tabacum Nicotiana RNAi Lower SAMDC activity accompanied by a decrease in Put, Moschou et tabacum Spd and Spm; greater susceptibility to salt stress and al. 2008b decreased biomass upon salt treatment Lycopersicon Yeast SAMDC 35S promoter Increase in Spd and Spm; greater tolerance to high Cheng et al. esculentum temperature stress 2009

Lycopersicon Yeast SAMDC tomato fruit ripening Increased Omega-3 fatty acids in the fruits; changes in Kolotilin et al. esculentum specific E8 promoter gene expression associated with carbohydrate, amino 2011 acid and protein metabolism, and up-regulation of stress related genes in the fruit

Nicotiana tabacum Datura 35S promoter Lower Put/Spd; with no change in Spm and total PAs. Franceschetti stramonium SPDS and SAMDC activity increased in leaves; plants et al. 2004 SPDS were shorter with fewer internodes; delayed flowering Arabidopsis thaliana Antisense A. Antisense AtSPDSI No PA or phenotypic change in WT background. Imai et al. thaliana 35S promoter Resembled spds1-1/spds2-1 double mutant phenotype 2004b SPDS1 (seen in table 2) when expressed in spds2 mutant. Arabidopsis thaliana Cucurbita 35S promoter Increased SPDS activity, Spd and Spm in leaves; Kasukabe et ficifolia SPDS enhanced tolerance to low temperature, salinity, hyper- al. 2004 osmosis, drought and oxidative stresses Ipomoea batatas Cucurbita 35S promoter Increased Spd content in leaves and storage roots; less Kasukabe et ficifolia SPDS affected by salinity, drought and week light, less damaged al. 2006 to photosynthesis by chilling and heat stresses Pyrus communis L. Malus 35S promoter Reduced shoot heights of seedlings, elevated Spd; He et al. 'Ballad' sylvestris var. enhanced tolerance to salt, osmosis and heavy metal 2008; Wen et domestica stresses along with increased antioxidant activity al. 2008, SPDS 2009,2010 Arabidopsis thaliana Arabidopsis Heat shock- inducible Restore the dwarfism phenotype of acl5 mutant, produced Hanzawa et acl5 mutant thaliana ACL5 promoter detectable tSpm absent in mutant al. 2000; Kakechi et al. 2008 Arabidopsis thaliana A. thaliana 35S promoter Increased susceptibility to cyst nematode H. schachtii Hewezi et al. SPDS2 infection 2010 Solanum Malus 35S promoter Higher Put, Spd and Spm in fruits; higher carotenoid Neily et al. lycopersicum sylvestris var. contents especially lycopene. Primary metabolism altered. 2010 domestica) SPDS

Solanum Yeast SPDS 35S promoter Increased Spd, decreased Put and Spm in leaves and Nambeesan lycopersicum developing fruits; fruits had higher lycopene content, etal. 2010 delayed ripening, longer shelf life and reduced shriveling.

Solanum Yeast SPDS fruit-ripening specific Increased Spd, Spm in developing fruits; fruits had Nambeesan lycopersicum promoter E8 increased lycopene content, delayed ripening, longer shelf etal. 2010 life and reduced shriveling.

Marsilea vestita (M. vestita) RNAi by double Reduction of Spd, development arrest at cell division Deeb et al. SPDS stranded RNA in male stage, defects in microtubules, base bodies and spermatid 2010 gametophyte chromatin condensation In several cases, the effects of genetic manipulation of PAs on the expression of other genes have also been reported; e.g. down-regulation of GA oxidases in ADC2 over- expressing lines of Arabidopsis (Alcazar et al. 2005). These changes were accompanied by delayed flowering in the transgenic plants, which was overcome by GA3 treatment.

Expression of AtGA2oxl was higher in the transgenic lines as compared to the WT plants. In Arabidopsis expressing the Cucurbita ficifolia SPDS (Kasukabe et al. 2004), under low temperature stress conditions, there was an up-regulation of 33 genes (0.24% of total 13,704 genes analyzed by cDNA microarrays) in the leaves of transgenic plants as compared to the WT plants. The genes that were up-regulated in response to low temperature treatment in the transgenic plants were those encoding WRKY transcription factors, DREB2B, MYB, and NAC domain proteins, NAM proteins, B-box zinc finger proteins, low-temperature induced protein 78 (LTI78), calmodulin-related proteins, cytochrome P450, peroxidases and protein kinases.

Transgenic expression of PAOs has also been studied in plants since these enzymes play a significant role in the catabolism of PAs (Rea et al. 2004; Moschou et al. 2008a,

2008b). A review by Cona et al. (2006) has covered this aspect nicely.

Polyamines and the related biochemical pathways

Transgenic expression of PA biosynthetic genes often results in elevated cellular concentrations of PAs in transgenic plants and cells, yet the regulation of the homeostatic levels of PAs in the transgenic (as well as the WT) cells, the metabolic (and other) limits on their flux rates, effects on their catabolism, and the metabolic adjustments that the transgenic cells have to make to elevated PAs are poorly understood. The role of substrates of the transgene products (i.e. the enzymes) in controlling metabolic fluxes of

18 PAs, the related amino acids, the organic acids, and the assimilated N on one side, and the need for substrates like Orn and SAM have rarely been studied. For example, Orn is often present in plant cells in extremely low quantities but may be overutilized in transgenics by an enzyme like ODC. Some progress in analyzing the biochemical impacts of genetic manipulation in plant cells has been made in our lab using transgenic cells of poplar (Populus nigra x maximowiczii). In summary, the results show that:

• Transgenic expression ofmODC showed 3-10 fold increase in Put content with a

small increase in Spd and a decrease in Spm contents (Bhatnagar et al. 2001).

• Increased Put biosynthesis in the HP (high Put) cells was accompanied by

increased rate of its catabolism without a major change in DAO activity

(Bhatnagar et al. 2002).

• The HP cells and the control (GC/iS-transformed) cells had similar levels of ACC

and produced similar amounts of ethylene (Quan et al. 2002)

• Up-regulation of Put biosynthesis in the HP cell line up-regulated the expressions

of ADC, SAMDC2 and SPDS2 genes, while the other paralogues of these genes

were down-regulated (Page et al. 2007).

• Put over-production in the HP cell line increased H2O2 production, increased the

activities of oxidative stress related enzymes (e.g. glutathione reductase and

monodehydroascorbate reductase), and negatively affected the oxidative state of

the transgenic cells (Mohapatra et al. 2009).

• Increased production of Put in the HP cells was accompanied by an increase in

GABA and significant reduction in Glu, Gin, His, Arg, Ser, Gly, Phe, Tip, Asp,

19 Lys, Leu, Cys, and Met, and already low Orn; carbon (C) and nitrogen (N)

balance in the transgenic cells was also altered (Mohapatra et al. 2010b).

• Higher accumulation of Put in the HP cells increased ROS production and

compromised their tolerance to low Ca (Mohapatra et al. 2010a).

• Increased utilization of Orn by mODC, which would have resulted in increased

flux rate through the Glu-Orn-Arg pathway, occurred without major changes in

the expression of the genes of this pathway (Page et al. 2010).

• Metabolome and transcriptome analyses of the HP cell line showed significant

increase in carbohydrates and other related metabolites (e.g. organic acids and

amines) along with changes in expressions of the genes associated with 'C and

'N' metabolism (unpublished by our lab).

S-Adenosylmethionine decarboxylase: a brief background

S-adenosylmethionine decarboxylase (SAMDC, a.k.a AdoMetDC) is a multigene family in most angiosperms encoding the enzyme SAMDC (Franceschetti et al. 2001; Hu et al. 2005a, 2005b; Hao et al. 2005; Tassoni et al. 2007). The enzyme carries out the important rate-limiting step of the biosynthesis of dcSAM (Greenburg and Cohen 1985;

Slocum 1991), which serves as donor of the aminopropyl moiety for the biosynthesis of

Spd and Spm by the enzymes Spd synthase and Spm synthase, respectively (Fig. 1).

Arabidopsis thaliana (A. thaliana) apparently has five SAMDC genes (Table 1 and Table

4), which show a high degree of sequence similarity amongst them (Table 5). The two commonly studied paralogues of AtSAMDC, i.e. AtSAMDCl and AtSAMDC2, have been well characterized with respect to their expression as well as the regulation of their

20 translation via 5' untranslated region (5'UTR) sequences. In each case, the 5'UTR

contains within it two upstream open reading frames (uORFs) which are translated in PA-

dependent manner and they (or their products) control SAMDC mRNA translation

(Franceschetti et al. 2001; Hanfrey et al. 2005; Ivanov et al. 2010). No information is available on the role of 5'UTR in regulation of AtSAMDC3, AtSAMDC4 and AtSAMDC5

mRNA translation.

The transcripts of AtSAMDCl, AtSAMDC2, AtSAMDC3 and AtSAMDC4 have been detected (using northern blots, RT-PCR and microarrays) in vegetative as well as in the reproductive organs (Franceschetti et al. 2001; Urano et al. 2003; Ge et al. 2006; Jumtee et al. 2008). However, the studies are limited in the number of developmental stages that were analyzed (except those using microarrays), and no information is available on characterization of the promoters of these paralogues in regulating spatial and temporal pattern of gene expression during development, and in response to phytohormones or other abiotic stresses. No data are currently available on the expression and the role of

AtSAMDC5, which was believed to be transcriptionally inactive (Franceschetti et al.

2001). The published information on the biochemical properties of SAMDC, genomic organization of its genes, loss-of-function mutants, transgenic manipulation of PAs via

SAMDC, the expression of SAMDC during development and in responses to abiotic stresses and phytohormones in plants is summarized here.

21 Table 4. Details of the SAMDC genes annotated in the Arabidopsis thaliana database (www.arabidopsis.org).

Gene ESTs 5'UTR ORF (bp) 3'UTR (bp)

AtSAMDCl 1247 1-1106 Introns: 284- 1107-2207 2208-2445 (238) 680, 837-931 (1101)

AtSAMDC2 83 1-837 Introns: 103- 838-1926 1927-2119(193) 215,286-541 (1089) AtSAMDC3 6 1-876 Introns: 90-187, 877-1926 1927-2106(180) 258-423,612-723 (1050) AtSAMDC4 1 1-108 109-1152 1153-1599(447) (1044) AtSAMDC5 6 1-12 13-1176 1177-1228(52) (1164)

Table 5. Comparison of the % sequence identities among different members of Arabidopsis SAMDC gene family (sequences analyzed by BioEdit software).

Genes Promoter 5'UTR Coding 3'UTR Genomic compared sequence (5'UTR+ORF+3'UTR) AtSAMDCl/ 46.2 46.5 78.1 44.1 61.6 AtSAMDC2 AtSAMDC3/ 44.0 7.2 57.5 25.4 33.7 AtSAMDC4 AtSAMDCl/ 49.0 47.4 63.1 46.5 54.3 AtSAMDC3

AtSAMDCl/ 42.4 48.2 63.9 49.2 57.9 AtSAMDC3 AtSAMDCl/ 42.7 6.1 53.4 30.4 31.5 AtSAMDC4 AtSAMDC2/ 44.9 7.9 52.9 25.5 35.3 AtSAMDC4 AtSAMDCl/ 48.2 0.8 50.8 18.6 27.9 AtSAMDC5

AtSAMDCl/ 39.1 1.0 50.2 22.0 32.6 AtSAMDC5

AtSAMDC3/ 50.3 1.1 45.6 24.8 33.1 AtSAMDC5

AtSAMDC4/ 42.1 7.4 48.3 10.3 43.1 AtSAMDC5

22 Structure and biochemical properties of SAMDCs

Plants as well as mammalian SAMDCs are characterized by the presence of several highly conserved amino acid sequences related to the pro-enzyme cleavage, rapid

'turnover of the enzyme, and Put activation of the SAMDC pro-enzyme. It should be pointed out that plant SAMDCs are not activated by Put in majority of cases except for a few (Suresh and Adiga 1977; Yang and Cho 1991; Stanley et al. 1994; Xiong et al.

1997). Several plant SAMDCs including potato, spinach, Tritordeum (amphiploid between Hordeum chilense and Triticum turgidum var. durum), carnation, rice, wheat,

Arabidopsis, soybean, carrot, grapevine and others have been characterized to varying degrees (Mad Arif et al. 1994; Bolle et al. 1995; Dresselhaus et al. 1996; Lee et al. 1997;

Li and Chen 2000a, 2000b; Franceschetti et al. 2001; Tian et al. 2004; Varma 2003;

Tassoni et al. 2007).

Cloning and characterization of a full length spinach (Spinacia Oleracea) SAMDC cDNA (Bolle et al. 1995) revealed the presence of certain signature sequences that are specific to SAMDC, e.g. putative PEST sequence (TIHITPEGFSYASFE) required for rapid turnover of the enzyme found at residues 243-258, pro-enzyme cleavage site

(LSESSLFI) at residues 66-73 and catalytic site having residues Glu9, Glu 12, Cys83, besides other conserved sequences observed in yeast or mammalian SAMDC (Pajunen et al. 1988; Kashiwagi et al. 1990; Bale and Ealick 2010). A comparison of potato SAMDC amino acid sequences with human, golden hamster and bovine showed sequence identities ranging between 35-36% only. However, several highly conserved regions including pro-enzyme cleavage site (LSESSMFV), and putative PEST sequence were identified by the authors (Mad Arif et al. 1994). The Km value of carnation (Dianthus

23 caryophyllus) SAMDC for SAM was found to be 26.3 uM (Lee et al. 1997). The optimum temperature and pH for this enzyme are 35°C and 8.0, respectively. The Km values reported for other SAMDCs e.g. corn, Chinese cabbage, soybean SAMDC 1 and

SAMDC2 are 5 uM, 38 uM, 8.1 yM and 16.0 uM, respectively (Suzuki and Hirasawa

1980; Yamonoha and Cohen 1985; Yang and Cho 1991; Choi and Cho 1994).

Arabidopsis SAMDC 1, a heterotetramer (012P2) with a molecular mass of 40.3 kDa, is comprised of 366 residues (Park and Cho 1999). The observed Km value for SAM was

23.1 uM and Ks for methylglyoxal bis-guanylhydrazone (MGBG; an inhibitor of

SAMDC) was 0.15 uM. A comparison of all AtSAMDC proteins in relation to location of different residues responsible for their processing and functionality is given in Table 6.

Two wild carrot (Daucus carota - Queen Anne's Lace) SAMDCs that have been cloned and sequenced show 98% identity of nucleotides and 100% identity of amino acids with a molecular mass of 40 kDa (Varma 2003). The residues 1-70 constitute the small subunit (P) and residues 71-361 form the large subunit (a) in the DcSAMDC. Three dimensional modeling (Sayle 1995; http://molvis.sdsc.edu/protexpl/frntdoor.htm) of

DcSAMDC shows it to be a monomeric enzyme just like the potato SAMDC. The active site of the enzyme includes residues Glull, Glul4, Ser71, Cys85, Ser234 and His247 as per the report of Xiong et al. (1997) and Tolbert et al. (2001), who showed that these residues were critical for catalytic activity of human SAMDC. The derived sequence of

DcSAMDC showed the presence of highly conserved motifs, including the residues

YVLSEJ.SS (position 66-72), which is considered to be a signature pattern for SAMDC and is the putative cleavage site for processing. The highly conserved PEST sequence was found at residues 245-260 in carrot.

24 Table 6. Conserved sequences of different members of Arabidopsis thaliana SAMDC gene family.

SAMDCs PEST site (bp in Putative Catalytic Putative active parenthesis indicate cleavage site site cleft residues corresponding ORF (bp in conserved sequence) parenthesis residue indicate corresponding ORF sequence) AtSAMDCl TIHVTPEDGFSYASFE YVLSEjSS Glu9, Phe8, Glu9, (244-259 bp) (64-70 bp) Glu12, Glu12, Leu66, Cys83 Glu68, Ser69, Ser70, Cys83, Phe227, Cys230, Ser233, His246, Thr248, Glu250 AtSAMDC2 TIHVTPEDGFSYASFE YVLSEjSS Glu9, Phe8, Glu9, (243-258 bp) (64-70 bp) Glu12, Glu12, Leu66, Cys83 Glu68, Ser69, Ser70, Cys83, Phe226, Cys229, Ser232, His245, Thr247 and Glu249 AtSAMDC3 TIHVTPEDGFSYASFE YVLSEjSS Glu9, Phe8, Glu9, (246-261 bp) (64-70 bp) Glu12, Glu12, Leu66, Cys83 Glu68, Ser69, Ser70, Cys83, Phe229, Cys232, Ser235, His248, Thr250 and Glu252 AtSAMDC4 TIHVTPEDGFSYASFE YVLSEjSS Glu7, Phe6, Glu7, (248-263 bp) (62-68 bp) Glu10, Glu10, Leu64, Cys81 Glu66, Ser67, Ser68, Cys81, Phe231, Cys234, Ser237, His250, Thr252 and Glu254 AtSAMDC5 none YLLSAjSS Glu9, none (56-62 bp) Glu12, Cys83

25 Four substitutions in potato vs. hSAMDC (Argl8/Leul3, Argll4/Phelll,

Vall81/Aspl74 and His294/Phe285) and carrot vs. hSAMDC (Argl6/Leul3,

Argll2/Phelll, Val 179/Aspl74 and Gln292/Phe285) were observed. Several highly conserved residues (PhelO, Glull, Glul4, Leu68, Glu70, Ser71, Ser72, Cys85, Phe228,

Cys231, Ser234, His247, Thr249 and Glu251) were identified in the protein structure model of DcSAMDC at the active site. Other conserved residues (Aspl74, Glul78 and

Glu256) involved in Put binding in hSAMDC (Stanley and Pegg 1991) were also found in DcSAMDC, e.g. Asp 177, Glu 183 and Glu260.

The two different apple SAMDCs (MdSAMDCl and MdSAMDC2) are 39.8 kDa and

40.7 kDa molecular mass proteins and share 70% similarity in amino acid sequences

(Hao et al. 2005). Several conserved sequences associated with turnover, processing and catalytic activity of SAMDC are conserved in MdSAMDCs. High degree of sequence identities and similarities in SAMDC structure and presence of conserved amino acid sequences were also observed in a study of Vitis SAMDC by Tassoni et al. (2007).

Current status of research on microbial and animal SAMDCs is summarized by Bale and Ealick (2010).

Genomic organization of SAMDC genes

Most plants contain multiple copies of SAMDC genes, whose coding sequences show a high degree of homology with each other, but little is known about their expression in various tissues/cells in the plant and about the regulation of their expression, translation of their mRNAs, and turnover of these proteins. A major difference in gene organization between mammalian and plant SAMDCs is the presence of introns in the former and their absence in the latter (Larsson and Rasmuson-Lestander 1997; Nishimura et al. 1999).

26 The length of 5'UTRs (based on genomic sequences) in plant SAMDCs varies

between 366 and 1570 bp with a few exceptions where a very small 5'UTR was

discernible (Table 7). The longest 5'UTR for a plant SAMDC reported is 1570 bp in

potato, the smallest being 12 bp in spinach (Spinacia oleracea) and AtSAMDCS. The

ORFs of different SAMDCs show a high degree of sequence identities at DNA level as

well as in the sequences of amino acids (Franceschetti et al. 2001; Hao et al. 2005;

Tassoni et al. 2007). The length of the 3'UTR varies between 117-304 bp in majority of the plant species studied, except for a few where relatively small 3'UTRs were observed without any ORF (Table 7).

Overlapping highly conserved 'small' and 'tiny' upstream ORFs (uORFs) have been

considered as characteristic components of 5'UTRs in most plant SAMDCs (Table 7) and are presumed to regulate the translation of SAMDC mRNAs, and perhaps also the expression of SAMDC genes in plants. Presence of an uORF has also been observed in the 5'UTR of mammalian SAMDCs that is apparently involved in the regulation of its mRNA translation in response to elevated levels of PAs. Unlike plants, mammalian

SAMDC has only one uORF that is located close (14 bp downstream) to the 5' cap and encodes for a hexapeptide MAGDIS (Law et al. 2001). Similar uORFs have also been reported from other organisms including metazoa, Pezizomycotina fungi and

Chlamydomonas but not observed in Chlorella and prasinophyte algae (Ivanov et al.

2010). The authors also reported the presence of longer tiny uORF in the green algae with a greater overlap (as compared to higher plants) with the small uORF and lack of terminal Pro residue in case of mammalian and sea squirt SAMDC.

27 Table 7. Genomic organization of SAMDC genes from different plant species those are phylogenetically related to Arabidopsis thaliana SAMDC (Urano et al. 2003; Tassoni et al. 2008). Abbreviations used: At= Arabidopsis thaliana; Os= Oryza sativa; St= Solanum tuberosum; Dc= Daucus carota; Zm= Zea mays; Bj= Brassica juncea; Dec= Dendrobium crumenatum; Ps = Pisum sativum; Vf= Viciafaba; So= Spinacia olerecia; Die = Dianthus caryophyllus; Gm - Glycine max; Hv= Hordeum vulgare.

Genus 5'UTR Tiny uORF (bp) Small uORF (bp) ORF 3'UTR (bp) (bp) (bp)

AtSAMDCl 1106 691-702 (12) 702-865(156) 1101 238

AtSAMDCl 837 553-564 (12) 564-719(156) 1089 193

AtSAMDC3 876 none 468-635 (168) 1050 180

AtSAMDC4 108 none none 1044 447

AtSAMDC5 12 none none 1164 52

OsSAMDCI 539 197-205(9) 205-360(156) 1197 300

OsSAMDCl 536 212-220 (9) 220-378(156) 1188 247

StSAMDC 1570 1105-113(9) 1113-1248, 1354- 1083 251 1374(156)

DcSAMDC 466 142-150(9) 150-311 (162) 1086 209

ZmSAMDC 366 38-46 (9) 46-198(153) 1203 304

BJSAMDC1 397 139-150(12) 150-305(156) 1107 149

BjSAMDCl 411 129-140(12) 140-298(159) 1110 155

DecSAMDC 538 216-224 (9) 224-376(153) 1110 246

PsSAMDC 548 194-202 (9) 202-366 (165) 1062 219

VfSAMDC 562 210-218(9) 218-382(165) 1062 171

SoSAMDC 6 none none 1092 81

DicSAMDCI 472 144-152(9) 152-316(165) 1146 117

Die SAMDC2 502 148-156(9) 156-314(159) 1134 193

GmSAMDC 556 213-221 (9) 221-382 (162) 1068 200

HvSAMDC 512 187-195(9) 195-344(150) 1182 199

28 Analysis of cDNA sequences of plant and human SAMDCs shows the presence of an extended C-terminus of the monocot enzyme as compared to the dicot and the human

SAMDCs. Sequence analyses of the 5'UTRs of SAMDCs from different plant species reveal that the lengths of the tiny and small uORF vary between 9-12 bp and 150-168 bp, respectively. Distribution of tiny and small uORFs can range from 38-865 bp upstream of the translation start site among different species depending on the lengths of 5'UTRs. The tiny uORF codes for a peptide of 2-3 amino acids whereas the small uORF codes for a protein 48-55 amino acids long (Franceschetti et al. 2001). The last base of the tiny uORF overlaps with the first base of the small uORF.

Phylogenetic analysis (based on Urano et al. 2003; Tassoni et al. 2007; Wang et al.

2010) of Arabidopsis SAMDC gene family and its closest homologues reveals that the length of the SAMDC 5'UTRs in Arabidopsis varies between 12 to 1106 bp (Table 7).

While AtSAMDCl, AtSAMDC2 and AtSAMDC3 have relatively long 5'UTRs (876 to

1106 bp), MSAMDC4 has a much shorter 5'UTR (108 bp) and AtSAMDCS has the smallest 5'UTR of 12 bp. While AtSAMDC3 contains only the small uORF, AtSAMDC4 and AtSAMDCS do not have any uORFs in their 5'UTRs. The length of 3'UTRs of

AtSAMDCl, AtSAMDC2 and AtSAMDC3 ranges from 180 to 238 bp, whereas

AtSAMDC4 has a 3'UTR of 446 bp and AtSAMDCS has the shortest 3'UTR (68 bp).

In Arabidopsis, the involvement of SAMDC 5'UTR uORFs in translational regulation of SAMDC was experimentally demonstrated by Hanfrey et al. (2005) and confirmed later by Ivanov et al. (2010). The translational control of the main ORF of SAMDC by tiny and small uORFs of 5'UTR is PA dependent. Under low PA conditions, the AUG of the tiny uORF is recognized by scanning 43S pre-initiation complex, which results in

29 ribosome binding at this site and its translation. After the translation termination, 43S pre-initiation complex can reinitiate translation of the main ORF of the SAMDC mRNA, thus up-regulating the cellular PAs. Under higher cellular PA concentration, the scanning

43S pre-initiation complex skips the AUG of the tiny uORF and binds to the AUG of the small uORF. Translation of the small uORF in turn represses the translation of the main

SAMDC ORF; this results in down regulation of SAMDC production and cellular PAs.

The role of introns within the 5'UTR in the regulation of SAMDC gene expression and its post transcriptional modification have been demonstrated in Arabidopsis transformed with different mutation or deletion constructs of Brassica juncea (BJSAMDC2) 5'UTR fused with the reporter gene 35S::GUS gene (Hu et al. 2005b). Absence of introns in the

5'UTR negatively affected GUS transcripts as well as GUS activity, and differentially regulated GUS in response to exogenous PAs and abiotic stresses. The role of introns in regulating gene expression for other plant genes has been reported by other workers, and it is believed that the introns are involved in RNA processing and escape of mRNA from translational repression pathway in the nucleus (Braddock et al. 1994; Jeong et al. 2008;

Rose 2008). Deletion of 5'UTR of BjSAMDC'2 increased GUS transcripts as well as the presence of GUS activity in transgenic Arabidopsis using the native BjSAMDC2 promoter. Particularly, mutation of the tiny uORF within the 5'UTR abolished translational repression of GUS. Recent sequence analysis of a wide range of organisms having uORF in their 5'UTR reveal that the tiny uORF most likely originated from chlorophytan algae where such uORFs are longer and have greater overlaps with small uORFs (Ivanov et al. 2010). Deletion of tiny uORF was also shown to increase SAMDC

30 activity significantly, resulting in disruption of PA homeostasis affecting plant growth and development (Hanfrey et al. 2002; Franceschetti et al. 2004; Tassoni et al. 2007).

The uORFs in the 5'UTR of eukaryotic mRNA can also play an important role in posttranscriptional gene regulation. Many eukaryotic mRNAs (20-40%) have been found to have uORF (Hayden and Bosco 2008; Tran et al. 2008) and can negatively regulate the expression of the main ORF either directly inhibiting translation or transcript destabilization. The uORF can also act in nonsense-mediated decay (NMD) of aberrant mRNAs containing premature termination codons (Muhlemann 2008; Rebbapragada and

Lykke-Anderson 2009; Silva and Romao 2009); the induction of NMD by uORFs is dependent on the size of the uORF; >50 amino acids is more active (Nyiko et al. 2009).

The length of the promoter region necessary to drive the expression of different members of the AtSAMDC gene family in relation to development or stress responses is not fully understood. No direct studies have been reported on the characterization of the

AtSAMDC promoters, while bio informatics information about the presence of regulatory motifs of different types has been discussed (Urano et al. 2003). Based on the genomic map of Arabidopsis available from NCBI or TAIR, the neighboring genes ofAtSAMDCl,

AtSAMDC2 and AtSAMDC4 are close to 700-800 bp upstream. For AtSAMDC3 and

AtSAMDCS these genes are >3 kb bp upstream of the transcription start site.

In other plants, only a few studies have been published about the sequences that constitute a functional SAMDC promoter or its regulation during development. A 2322 bp sequence (upstream of transcription initiation site) including the putative promoter region and the 5'UTR of BjSAMDC2 fused with the reporter gene GUS showed moderate expression of GUS in the rosette leaves of 3 week old Arabidopsis plants (Hu et al.

31 2005b). These authors did not define the precise length of the promoter. In carnation

(Dianthus caryophyllus), the SAMDC promoter has been studied extensively in relation to developmental expression and also in response to diurnal changes. When an 1821 bp upstream (of transcription start site) promoter sequence + 5'UTR was fused with GUS and used to transform tobacco (N. tabacum), transgenic plants showed high activity of

GUS in different flower parts including stamens, pollen, stigma and petals (Kim et al.

2004). Several c/s-regulatory elements (e.g. ABA, GA, auxin-responsive elements and others associated with abiotic and biotic stresses) located upstream region around -273 and -158 bp were identified in the promoter for pollen specific expression. Analysis of this region also showed presence of other putative cw-regulatory elements related to hormonal responses. In another study, Kim et al. (2006) showed that the promoter region of carnation SAMDC contains certain sequences e.g. 'GGTAAT' (GT-1 consensus sequence), 'CAACTTCATC that positively regulates and the sequence 'TAATAATTA'

(located between -754 and -274 bp upstream of transcription start site) that negatively regulates the circadian expression of carnation SAMDC. In tobacco, a 1824 bp upstream promoter + 5'UTR sequence of SAMDC fused with GUS showed low level of GUS activity throughout the (4-week-old) transgenic seedlings, but was highly induced in the roots and leaves upon exposure to salt and acidic stresses (Wi et al. 2006).

Mutants of S-adenosylmethionine decarboxylase

Mutants are useful tools to study physiological and developmental roles of genes in plants and other organisms. In this regard while the mutants of ADC and APS have been well characterized, those of SAMDC have not been well studied in plants. A part of the reason may be the number of genes that encode a functional SAMDC enzyme. Reported

32 information on a few SAMDC mutants is presented in Table 2; the relevant work on

Arabidopsis is summarized here.

An Arabidopsis SAMDC4 mutant called bud.2 was identified by Ge et al. (2006) that had somewhat higher Put and lower Spd and Spm than the WT plants. Besides altered PA homeostasis, the mutant had bushy and dwarf phenotype with curly leaves in seedlings, altered petiole length, and higher number of lateral roots. Enlarged vasculature was also observed in the roots, petioles and inflorescences with higher lignin deposition. The bud2 mutant plants exhibited altered hypocotyl elongation and lateral bud outgrowth as compared to the WT plants; this was explained later as an effect of altered auxin- mediated response in this mutant (Cui et al. 2010). A knockdown mutant of AtSAMDCl showed similar phenotype to that of samdc4; whereas the phenotype was more severe, there was a compensatory increase in the expression of AtSAMDC4 and vice versa (Ge et al. 2006). Although knockdown mutant of either samdc4 or samdcl individually did not result in embryo lethality; double mutant samdc4lsamdcl was embryo lethal.

Several other mutants show altered SAMDC activity but are not direct mutants of

SAMDC. For example, a tobacco mutant cell line resistant to SAMDC inhibitor MGBG was produced by Malmberg and Mclndoo (1983). Regenerated plants produced from this cell line showed significantly higher Spd (4.7-fold) and Spm (~7-fold) contents along with a small increase in Put content in the leaves. The flowers of these plants though had morphology to WT lacked pollen grains in the anther and showed male sterility; the gynoecia were fertile. In a later analysis of a male sterile stamenless-2 (sl-2/sl-2) mutant of tomato, higher activity of SAMDC was observed in sepals, petals and stamens as compared to the WT plants (Rastogi and Sawhney 1990). In both lines, SAMDC activity

33 was higher in the stamens in comparison to other floral parts. Polyamine contents varied among different floral organs within the same line and among control and the mutant in different organs. Highest amount of Put was observed in the gynoecium for both WT and mutant plants. A T-DNA insertion mutants of MGBG-resistant tobacco cell lines showed significantly higher SAMDC activity (by 100-138%) and higher Put (2-fold) and Spd

(~1.5-fold) in regenerated plants vs. the WT plants (Fritze et al. 1995). Plantlets regenerated from the MGBG resistant calli showed shorter internodes, reduced petal numbers, and altered petal shape of the flowers; and they were male sterile.

Transgenic manipulation of polyamines via S-adenosylmethionine decarboxylase

While mutants provide a useful tool to study physiological and developmental roles of genes in plants and other organisms; they generally do not allow experimental manipulations under the investigator's control. Moreover, most mutants involve down- regulation of a step; few being the up-regulation type. In this regard, genetic manipulation involving constitutive or inducible/tissue-specific promoters provides complementary approach to regulate specific steps in metabolism and correlate them with a phenotype. Several attempts have been made over the years to genetically manipulate

PA metabolism in plants using homologous or heterologous SAMDC genes under the control of both constitutive and inducible promoters (see summary in Table 3C). It should however be kept in mind that any change in PAs in response to SAMDC up or down regulation must depend upon the activity of APTs, which in most of these studies was not experimentally measured or manipulated. Furthermore, most studies targeting Put overproduction do not show parallel increases in either Spd or Spm, suggesting that the cellular contents of these PAs are more tightly regulated than that of the diamine Put. A

34 part of the explanation may lie in the fact that SAMDC itself is a highly regulated enzyme of the PA biosynthetic pathway.

Transgenic expression of a human SAMDC (hSAMDC) under 35S promoter in tobacco showed 2- to 4-fold increase in SAMDC activity accompanied by a 2- to 3-fold increase in Spd with a concomitant reduction in Put in the transgenic plants (Noh and Minocha

1994). Leaf discs of the transgenic plants produced shoots in addition to callus when cultured in a callus induction medium containing 0.5 uM BA + 0.5 uM NAA, which was not observed in WT plants. Mature plants had no noticeable change in phenotype. Later studies with carrot (Daucus carota) using the same promoter::bSAMDC gene combination showed that the transgenic cell cultures had significantly higher SAMDC activity (6- to 15-fold) and Spd content (by 1.5- to 2.0-fold) accompanied by a slightly elevated Put level without any significant change in Spm content (Bastola 1994). The frequency of somatic embryogenesis in transgenic cells was much higher than the control cells, and the transgenic somatic embryos were morphologically stouter (thicker hypocotyl and cotyledons) than the WT controls; several of them developed into normal plants that produced viable seeds.

Transgenic expression of a homologous StSAMDC cDNA under the control of 35S promoter in antisense orientation in potato (Solanum tuberosum) showed reduction of

SAMDC activity by 10-28% accompanied by a decrease in Put, Spd, and Spm contents in the transgenic plants. Transgenic plants displayed abnormal phenotypes which included stunted growth, more branching, smaller leaves, poor root growth, and early senescence both in vitro and under glass house conditions (Kumar et al. 1996). An increase in ethylene production was also observed in these plants. In potato leaf explants, induction

35 of StSAMDC with tetracycline-inducible promoter showed 2- to 6-fold increase in

SAMDC transcripts upon induction with a concomitant increase in SAMDC activity and the contents of Spd, Spm, and Put (Kumar et al. 1996). Transgenic leaf explants over- expressing the same gene under 35S promoter failed to regenerate plantlets, while antisense lines regenerated a few plants with severe abnormalities (Kumar et al. 1996).

Over-expression of the same potato SAMDC under the control of a tuber-specific

(patatin) promoter showed increase in SAMDC transcripts, SAMDC activity, and Spd content (by 85%) in the transgenic potato tubers (Pedros et al. 1999). Larger numbers of smaller tubers were observed in the transgenic lines at maturity stage as compared to the

WT plants. Antisense expression of SAMDC under the same promoter showed reduced

SAMDC transcripts and SAMDC enzyme activity accompanied by a decrease in total PAs

(by 30-40%) in the tubers without any phenotypic changes in the plants and tubers.

Heterologous expression of a Datura stramonium SAMDC (DsSAMDC) cDNA under the control of maize Ubi-1 promoter in rice (Oryza sativa) resulted in small (1.5- to 2.5- fold) increase in Spd concentration in the leaves, with no apparent phenotypic changes

(Thu-Hang et al. 2002). A maximum increase of 3-fold activity of SAMDC was observed in the transgenic plants. The native transcripts of rice SAMDC or SPDS maintained a steady-state level, indicating the lack of feedback regulation of SAMDC expression in rice leaves; the seeds also accumulated more Spd (2.5-fold) and Spm (2-fold) without any observed change in phenotype in the transgenic plants compared to WT plants.

Tomato (Lycopersicon esculentum) plants have been the target of several studies on transgenic expression of a heterologous SAMDC under different promoters in order to analyze both metabolic and developmental changes in the plants and their fruits. Mehta et

36 al. (2002) found that transgenic expression of yeast SAMDC under fruit specific promoter

E8 resulted in higher accumulation of Spd and Spm in the ripened fruits whereas all three

PAs (Put, Spd and Spm) decreased in the ripened WT fruits. Transgenic fruits showed a considerable increase in lycopene content, prolonged vine life, and an overall improvement in juice quality vs. the WT fruits.

In another study using E8 promoter and yeast SAMDC, Mattoo et al. (2006) observed a greater accumulation of Spd and Spm and several other metabolites (such as Gin, Asn, choline, citrate, fumarate, malate, etc.) in transgenic tomato fruits ripened off the vines as compared to the WT red fruits that ripened on the vine. A significant decrease in Val,

Asp, sucrose and glucose was observed in the vine-ripened fruits vs. the WT fruits at the same ripening stage. A positive correlation (p>0.8) was observed between intracellular concentrations of Spd-Spm and several metabolites including Gin, Asn, Ala, Thr, He, choline, citrate, fumarate and malate. Alternatively, intracellular Put showed a negative correlation (p<0.8) with these metabolites in the transgenic fruits (Handa and Mattoo

2010). Put positively affected the activity of ACC oxidase, whereas Spd-Spm had negative effect on this enzyme that was reflected accordingly at the transcript level.

Several heat-shock proteins showed a positive correlation with Spd-Spm and a negative correlation with Put, which was similar at the transcript level. An overall activation of

N:C sensing/signaling genes, e.g. NADP-dependent isocitrate dehydrogenase and phosphoenolpyruvate carboxylase, were observed concomitant with higher Spd and Spm in the transgenic fruits in comparison to the WT fruits.

In a more recent study in transgenic tomato with E8 promoter:-.SAMDC combination

(same as Mehta et al. 2002), alterations of fatty acid metabolism with a significant

37 increase in omega-3 fatty acids at the expense of other lipids in the ripening transgenic fruits was reported (Kolotilin et al. 2011). Transcript analysis of the fruits revealed significant changes in gene expression mainly associated with carbohydrate, amino acid, and protein metabolism. This observation was similar to what was observed by Mattoo et al. (2006). Other stress related genes were also up-regulated in the transgenic fruits.

Cheng et al. (2009) used the same yeast SAMDC gene but constitutively expressed it under 35S promoter in tomato and found a 2.4-fold higher content of Spd and 1.7-fold higher Spm in the leaves of transgenic plants. When subjected to high temperature (38°C) stress, transgenic plants showed greater resistance than the WT plants.

Waie and Rajam (2003) reported heterologous expression of a hSAMDC gene under

35S promoter in tobacco (N. tabacum). Transgenic plants showed a significant increase in total SAMDC activity (50-200%), 21-240% increase of Spd in the conjugated fraction

(with a small but significant increase in free Spd only in a few lines) and 50-360% increase of Put in free, conjugated and bound fractions of leaf samples. Regeneration of shoots from leaf explants in the transgenics showed a 40-45 d delay as compared to the untransformed control plants and an overall slow growth with phenotypic abnormalities including shorter internode was observed in the transgenic plants. When subjected to 200 mM NaCl stress, transgenic plants showed higher germination percentage and better seedling growth compared to the WT plants.

In a more recent study, transgenic tobacco plants expressing an antisense cDNA of

DsSAMDC (Torrigiani et al. 2005) under 35S promoter showed a decrease in SAMDC activity in the shoots with increased ratio of Put to Spd in the Tl transformants. A significant decrease in rhizogenic potential of leaf explants obtained from antisense

38 plants was observed as compared to the WT plants. Wi et al. (2006) reported a 2- to 3-

fold increase in total PAs in response to transgenic expression of a carnation SAMDC

(under 35S promoter) in tobacco; total number of seeds and seed weight, and net photosynthetic rates were higher in the transgenic plants. Whereas there were no morphological changes, the transgenic plants showed greater tolerance to salt and oxidative stresses; also, APX, manganese superoxide dismutase (Mn-SOD) and glutathione S-transferase (GST) genes were highly up regulated in response to oxidative stress. In mature plants, 200 mM NaCl treatment for 8 wk caused severe reduction in the size of leaves accompanied by leaf chlorosis and overall growth inhibition in WT tobacco plants. Higher net leaf photosynthesis was observed in the transgenic plants in the presence of NaCl. At higher concentration of salt (400 mM), WT plants died, whereas transgenic plants survived but their overall health was severely affected. Cold treatment

(4°C) for 24 h followed by subsequent recovery showed greater chilling tolerance in the transgenic plants vs. the WT plants.

Down-regulating the expression of SAMDC InN. tabacum via SAMDC-KNAi resulted in a >10-fold decrease in the expression and activity of SAMDC (Moschou et al. 2008b).

This was accompanied by a significant increase in ADC activity and reduction of Put (5-

30%), Spd (33-73%) and Spm (65-100%). The SAMDC-BNAi plants when grown in vitro and supplemented with 200 mM NaCl showed lesser tolerance and decreased biomass as compared to the WT plants. No significant changes were observed in the catabolic activity of PAs or the levels of Spd in the apoplast upon salt stress.

39 Besides plants, transgenic animals over-expressing homologous or heterologous

SAMDC have also been produced to study the regulation and role of higher PAs in

metabolic and developmental regulation (reviewed in Alhonen et al. 2009).

Expression patterns of S-adenosylmethionine decarboxylase genes in plants

Organ and tissue specific expression

Five different approaches, namely northern hybridization, reverse transcriptase- polymerase chain reaction (RT-PCR), quantitative reverse transcriptase-polymerase chain reaction (QRT-PCR), in situ hybridization, and promoter-reporter fusion have been employed to study gene expression of the four AtSAMDC genes in Arabidopsis. Each shows different level of specificity for expression at tissue, organ and cell levels. In addition, microarray data on the expression of some of these genes are available. Still, the information is quite sporadic and inconsistent, thus leading to inconclusive assessment of their role during development or in response to stress. A part of the problem lies in the high degree of sequence similarity among the AtSAMDC family members (Table 5).

Northern blot analysis of StSAMDC transcripts in potato showed highest level of transcripts in the younger and actively dividing tissues as compared to the mature and non-dividing vegetative and reproductive tissues (Mad Arif et al. 1994). Higher SAMDC transcripts were also observed in petals and stems of carnation plants (Lee et al. 1997). In pea (Pisum sativum) plants, northern blot analysis of SAMDC transcripts showed higher accumulation in young seedlings in comparison to its lower level in older senescing tissues (Marco and Carrasco 2002).

Expression of SAMDC and the role of higher PAs in somatic embryogenesis was studied in our lab using carrot (D. carota) suspension cultures by QRT-PCR. Higher

40 expression was observed in cultures undergoing somatic embryogenesis (Chretien 2003); moreover, the expression was greater at early stages of embryo development vs. the later stages. When embryos at different stages of development collected from the same culture at day 24 were analyzed for DcSAMDCl and DcSAMDC2 transcripts, both genes were expressed similarly. The late stage embryos (larger than 1.7 mm size) showed a decline in

SAMDC expression. The relative amount of ADC transcripts was lower than SAMDC transcripts at all stages of embryo development; in the mature plants, the highest levels of

DcSAMDC transcripts were found in the leaves and the lowest in the callus.

Using the approach of promoter: ^(VS fusion, Kim et al. (2004) showed that a 1821-bp upstream promoter region and 5'UTR sequence of carnation SAMDC showed moderate

GUS activity in the stems and cotyledonary veins of young tobacco seedlings. In mature plants, high activity of GUS was observed in the stamens, pollen, stigma and petals of open flowers besides moderate expression in the ovaries. Several pollen-specific regulatory elements e.g. AGAAA and GTGA located in the promoter region between -

273 bp and -158 bp upstream of transcription start site were identified; also some putative intron sequences present in the 5'UTR of the gene were suggested to regulate pollen- specific expression of GUS. Other features of the promoter region and their role are described above by Kim et al. (2006) and Wi et al. (2006).

The expression of the two known apple [Malus sylvestris (L.) Mill. var. domestica]

SAMDCs (MdSAMDCs) in all tissues was studied by RNA gel blot analysis with higher expression being seen in reproductive organs vs. the vegetative organs (samples collected between 19-174 days after flowering) of mature plants (Hao et al. 2005). Expression of

MdSAMDCl was higher in the leaves as compared to MdSAMDC2; similar was the case

41 in fruits at early developmental stages. It was also reported that MdSAMDCl expression was differentially regulated on different days of suspension cultures. In another study in bean (Phaseolus vulgaris), high level of SAMDC transcripts were observed ubiquitously in mature and young leaves, stems, and roots with relatively lower expressions in petals, stigma and filaments, and least in anthers and ovaries as seen by semi-quantitative RT-

PCR (Jimenez-Bremont et al. 2006).

Expression of three members of the poplar (Populus nigra x maximowiczii) pSAMDC gene family was studied by QRT-PCR in our lab (Page et al. 2007) in two transgenic cell lines; one constitutively over-expressing a mODC gene and the other a GUS gene. While pSAMDCl and pSAMDC3 were down regulated, expression of SAMDC2 showed up- regulation in the high putrescine (HP) cells as compared to the GiVS-transformed control cells. Overall activity of SAMDC was also lower in HP cells vs. the control cells.

More recently, the potential role of SAMDC in flower and early fruit development in olive (Olea europaea) was studied by Gomez-Jimenez (2010a); open flowers showed 8- fold higher level of SAMDC transcripts as compared to the closed ones. Leaves and shoots showed similar levels of transcripts as in fruits. A positive correlation was found between OeSAMDC gene expression and cell division. Fluorescence in situ hybridization showed high expression of OeSAMDC in gynoecial tissue with no significant signal being seen in sepals, petals or stamens. Integuments, nucellus and inner epidermal tissues of ovules had higher OeSAMDC transcripts. High level of OeSAMDC and OeSPDS transcripts were found to be co-localized in cells of fruit mesocarp and exocarp, irrespective of the fruit developmental stages, whereas no significant signal was detected in the endocarp or vascular bundles at any stage of fruit development. OeSAMDC and

42 OeSPDS genes showed similar pattern of spatial and temporal expressions, although

expression of OeSAMDC was relatively higher. High activities of SAMDC and ADC

were also observed in open flowers followed by gradual decline after pollination;

SAMDC activity was positively correlated with OeSAMDC transcripts. No significant

change in SAMDC activity was observed at the early fruit development in the abscission zone (AZ) but SAMDC activity increased significantly in the AZ at later stage of fruit development. Activity of ODC was highest in the AZ of early fruit as compared to ADC or SAMDC, and ODC and ADC activities gradually declined at later stages (Gomez-

Jimenez et al. 2010b). The content of free Put and Spd was higher in open flowers as vs. the closed ones; Spd being the highest in open flowers followed by Put and Spd. Changes in expressions of the SAMDC genes in GA3-induced fruit development has been studied in citrus (Citrus Clementina) by Trenor et al. (2010); the expression of different members

CcSAMDC gene family varied during the 21 d period of fruit development.

In Arabidopsis thaliana, the expression of AtSAMDCl and AtSAMDC2 was first reported by Franceschetti et al. (2001). Semi-quantitative RT-PCR analysis showed high ubiquitous expression of AtSAMDCl in all organs of mature plants, whereas expression of AtSAMDC2 was much lower compared to AtSAMDCl, and was mainly localized in the inflorescences and leaves of mature plants. Later, Urano et al. (2003), using semi-QRT-

PCR showed high ubiquitous expression of AtSAMDCl in all organs, whereas expression of AtSAMDC2 was mainly localized in the flowers, roots and cauline leaves. Semi quantitative analysis of AtSAMDC genes through RNA gel blot analysis showed spatial variations in the expression of different members of the AtSAMDC gene family in mature plants (Ge et al. 2006). Ubiquitous expression of AtSAMDCl was seen in all organs of

43 mature plants with relatively higher expression in the siliques. Expression of AtSAMDC2 was high in roots, leaves and flowers. Whereas AtSAMDC3 showed weaker expressions in almost all organs except for the siliques; expression of AtSAMDC4 was ubiquitous in all organs but at lower level than other AtSAMDCs.

Microarray data (Genevestigator - www.genevestigator.com') mostly corroborate the constitutive presence of AtSAMDCl transcripts in all organs and tissues of Arabidopsis with relatively higher expression in the roots and cotyledons of younger seedlings and in siliques; the highest expression is seen in flowers, especially in the pollen. Overall expression of AtSAMDC2 was relatively lower as compared to AtSAMDCl; with highest expression in the pollen besides the cotyledons. On the other hand, expression of

AtSAMDC3 seems to be much lower as compared to AtSAMDCl and AtSAMDC2 with relatively higher expression in the stamens and cotyledons. AtSAMDC4 appears to be ubiquitously expressed, with higher expression in roots, pedicel and vascular tissues of rosette leaves but the signal intensities are much lower as compared to AtSAMDCl and

AtSAMDC2. No data are available on the expression of AtSAMDCS in the database.

Expression of SAMDC in response to abiotic stress and phytohormones

The expression of SAMDC has been shown to be regulated by different environmental stimuli. Light mediated up-regulation of PnSAMDC was seen in the seedlings of

Pharbitis nil (Yoshida et al. 1998). Seedlings grown in dark when exposed to light showed up-regulation of SAMDC expression within 15 min, reaching a peak by 45 min and gradually declining after 60 min. Further analysis showed similar results on exposure

(from dark) to blue, green, red and UV light but not to far-red (FR) light (Yoshida et al.

1999). Expression of SAMDC was also affected by blue and red light in the seedlings in

44 the presence of inhibitors associated with signaling pathways (Yoshida et al. 2002).

Northern blot analysis showed up-regulation of PnSAMDC by Ca+2 and calmodulin in red

light whereas in blue light it was down-regulated. Changes in expression of PA

biosynthetic genes in response to FR have also been studied by Jumtee et al. (2008) in

phytochrome 'A' (phyA) mutant plants. The different AtSAMDCs showed differential

responses upon exposure to FR in WT and the mutant plants. Expression of AtSAMDC2

significantly increased upon exposure to FR at 6 h with gradual decline thereafter,

whereas phyA plants did not show any change in AtSAMDC2 expression. On the other

hand, expression of AtSAMDC4 decreased upon exposure to FR in WT and phyA plants

without change in the expression of AtSAMDCl and AtSAMDC3.

Song et al. (2001) reported high activity of SAMDC during pollen germination in tomato (Lycopersicon esculentum) at 25°C which was significantly inhibited at 38°C

(Song et al. 2002). On the other hand, activity of ADC increased at initial pollen germination stage but remained unaltered at higher temperature. Among the soluble PAs,

Put content increased during the first 2 h of pollen germination and remained high thereafter; Spd and Spm also showed transient increments during the first hour of incubation. Elevated temperature did not affect Put content, but Spd and Spm content did not increase in either case. Conjugated PAs remained unaltered between control and high temperature treatments. Exogenous application of Spd and Spm were partially able to recover pollen germination and tube growth at 38°C, whereas Put was ineffective.

Application of transcription inhibitor actinomycin D did not affect SAMDC activity or pollen germination, but cycloheximide (translation inhibitor) significantly inhibited

SAMDC activity, pollen germination and tube growth. These findings demonstrate an

45 active synthesis of SAMDC during pollen germination. Reduction of pollen viability in tomato upon long term storage at -30°C has been suggested to be due to reduced activities of SAMDC and ADC (Song and Tachibana 2007) and lower PA biosynthesis.

Low temperature induction of SAMDC activity and cold tolerance has been reported in cucumber (Cucumis sativus) by Shen et al. (2000), more so in the chilling tolerant (T) cultivar at 12 h after chilling treatment. Activity of ADC was slightly induced at 12 h in the 'T' variety as compared to the chilling sensitive (S) cultivar where a small increase in

ODC was observed at 12 h after stress. Upon rewarming, activities of ADC and ODC were higher in the 'T' variety without major changes in the 'S' variety. Cellular Spd increased upon chilling and Spd and Put upon rewarming in the 'T' variety without any significant changes in PA contents in the 'S' variety under similar treatments.

Positive effects of low temperature (4°C) and salt-induced up-regulation of SAMDC transcripts were also observed in in-vitro grown apple shoot cultures by Hao et al. (2005).

RNA gel blot analysis of apple MdSAMDCl showed up-regulation within 6 h of low temperature treatment and a gradual decrease thereafter exhibiting lower expression than control at 24 h to 120 h of treatment. Induction of MdSAMDC'2 by low temperature was much greater than that of MdSAMDCl. At elevated temperature (37°C), both

MdSAMDCl and MdSAMDC2 transcripts were down regulated.

QRT-PCR analysis of SAMDC transcripts in Theobroma cacao exhibited higher expression in mature leaves and open flowers in response to drought (Bae et al. 2008).

Induction of SAMDC was also seen in the roots of seedlings at 7 d after drought that reached the peak at 10 d. Induction of ODC showed a similar pattern, whereas ADC reached near maximum by 7 d. Induction of SPDS and SPMS on the other hand was

46 faster than other PA genes, and showed increase immediately after water was withheld; there was a positive correlation with leaf water potential. Expression of SPDS and SPMS was unaltered in response to drought stress in the leaves. Intracellular concentrations of

Put and Spd significantly increased in the leaves upon drought stress, with a small increase in Spm. Expression of SAMDC was also up-regulated by ABA.

Arabidopsis samdc4 mutant, bud2, exhibits altered hypocotyl elongation and lateral bud outgrowth as an effect of altered auxin-mediated response in the mutant line vs. the

WT plants (Cui et al. 2010). Application of exogenous IAA showed a rapid accumulation of BUD2 transcripts within 30 min reaching a maximum level by 2 h in the WT seedlings. Furthermore, a 2.5-fold increase in the expression of this gene was observed in response to exogenous IAA treatment along with AtSAMDC2 and AtSAMDC3, but not

AtSAMDCl. On the other hand, cytokinin did not cause any significant change in the expression of BUD2. Altered PA biosynthesis in the bud2 mutant resulted in altered levels of endogenous cytokinins, among which some were increased and some decreased.

The bud2 plants exhibited hypersensitivity to exogenous cytokinin treatment. Callus induction in bud2 hypocotyl explants was better than the WT plants; the best results were obtained from low cytokinin and high auxin concentrations. These results together show complicated effects of bud2 mutation on alteration of PA levels through imbalance of auxin and cytokinin homeostasis in plants resulting in morphological changes.

Another plant hormone methyl jasmonate (MeJ), which is mainly associated with wounding and pathogenesis, has been shown to affect the expression of SAMDC and other PA biosynthetic genes in different plant species. In tobacco BY-2 cells where ADC and ODC were induced by MeJ, there was also an increase in Put content concomitant

47 with an increase in nicotine (Imanishi et al. 1998). In contrast Arabidopsis did not show any change in SAMDC and SPDS expression when subjected to Mej treatment (Perez-

Amador et al. 2002). In 2 month old rice (Oryza sativa) plants, exogenous spraying of

200 uM Mej resulted in a reduction of both rice ADC (OsADQ and SAMDC

(OsSAMDQ mRNAs (semi-QRT-PCR) in the leaves of WT type as well as transgenic plants expressing D. stramonium ADC cDNA under Ubi promoter (Peremarti et al. 2010).

A 75% reduction in Put content of WT plants was observed in the leaves but no change in

Spd or Spm content was observed in the WT in response to Mej treatment.

The transcripts of AtSAMDC2 were up regulated by ABA treatment (Urano et al.

2003). As mentioned earlier, Wi et al. (2006) had seen higher expression of

SAMDC: :GUS in response to exogenous ABA treatment in transgenic tobacco. Urano et al. (2009) have also reported increased expressions of PA biosynthetic genes and increased contents of PAs and other metabolites in ABA-treated Arabidopsis plants.

In grape vine (Vitis vinifera) leaf disc assay, exogenous treatment with 10 uM ABA showed a significant increase in the activities of SAMDC, ADC and ODC by 15-, 30- and 10-fold, respectively, at 3 h in the drought tolerant (T) genotype (Toumi et al. 2010).

In the drought sensitive (S) genotype, changes in the activities of these enzymes were seen only at 24 h post-treatment. A 2- and 4-fold increase in Put and Spm contents was observed in the T genotype at 1 h post-treatment. In the S genotype, Put and Spm were elevated after longer treatment (at least 6 h); cellular Spm decreased in both T and S genotypes. Increases in the activities of DAO and PAO were observed in both T and S genotypes in response to exogenous ABA treatment, although the peak activities and magnitude were higher and attained sooner in the T vs. the S genotype. In intact plants,

48 activities of SAMDC and ODC were induced and doubled at 8 d post-drought in the T genotype, whereas SAMDC and ODC were reduced in the S genotype. Total PAs were 2- fold higher in the S than the T genotype but the trend was reverse in total PAs (a 7- and

3- fold increase in Put and Spd contents in the T genotype) when subjected to drought.

Effects of abiotic stresses on the expression of SAMDC and associated changes in PAs have been extensively studied in ,4. thaliana. In the rosette leaves of 4 week-old unbolted plants, AtSAMDC2 transcripts were up-regulated by 10 h after treatment with 250 mM

NaCl, whereas expression of AtSAMDCl remained unchanged (Urano et al. 2003). The same authors reported that 4°C treatment of the same age plants showed significant up- regulation of AtSAMDC2 in the rosette leaves at 5 h; the induced level of expression was seen up to 24 h (semi-QRT-PCR). Analysis of PAs upon salt stress treatments showed a

~2-fold increase in Put content and a ~3-fold increase in Spm content with only a small increase in Spd at 10 h. On the other hand, low temperature reduced Spm without significant changes in Put and Spd. In another study, Bagni et al. (2006) showed induced expression of AtSAMDCl by salt (75 mM NaCl) stress was higher than AtSAMDC2; their expression remained almost unchanged in rosette leaves at vegetative stage but at reproductive stage the same leaves had increased (by 40-50%) expression of AtSAMDCl but not AtSAMDC2. Expression of both AtADCl and AtADC2 was highly induced in the rosette leaves by NaCl stress both at vegetative and reproductive stages; AtADC2 showed higher expression than AtADCl. Expression of AtSPDS genes in the rosette leaves was induced by salt only at vegetative stage, and the expression of AtSPDSl was higher than

AtSPDS2. Expression of AtSPMS was also induced both at vegetative and reproductive stages. The activities of SAMDC and other PA biosynthetic enzymes showed

49 corresponding increases in response to salt stress at different stages studied. With respect to soluble PAs, Put did not show any significant change upon NaCl stress in the rosette leaves whereas Spd was lower (76%) and Spm increased by small (14%) amount. Similar trend of changes in PA levels was observed upon 75 mM NaCl stress at reproductive stage. This study was later followed by a study by Tassoni et al. (2008) in Arabidopsis flowers in plants subjected to NaCl stress. Expression of AtSAMDCl was higher than

AtSAMDC2 in the flowers under normal conditions; NaCl treatment (75 mM) showed a slight increase in the expression of both genes. Among other PA genes, the expression of

AtADC2 was higher than AtADCl and both of them were induced upon exposure to salt.

The AtSPDS, AtSPMS and AtACLS genes were highly induced by salt. Among different

PAs, Spd and Spm showed <10% increase whereas Put showed a similar decrease.

In summary, a comprehensive analysis of expression of different members of the

SAMDC gene family using a common experimental approach is lacking in any plant species. In most cases, data on correlations among transcripts, enzyme activity, and the amounts of PAs produced by the action of SAMDC are lacking. In addition, the regulation of promoters of the different SAMDC gene family members with respect to their functional redundancy or unique functions is not known. A part of my research was thus focused on a comprehensive analysis of gene expression of three members of the

SAMDC gene family (AtSAMDC3, AtSAMDC4 and AtSAMDC5) that have thus far not been studied in details. Careful analysis of the current status of research involving transgenic manipulation of PAs in Arabidopsis and in other plant species reveals that there is a lack of information on the role of substrates; i.e. Orn, Arg and Glu in regulating metabolic fluxes of PAs. The pleiotropic effects of PA manipulation on other associated

50 pathways that share common substrates with the PA biosynthetic pathway, especially

amino acid metabolism have not been thoroughly analyzed in any intact plant. Similarly

effects of altered PA metabolism on amino acid metabolism in relation to increased C and

N availability have not been analyzed. With respect to the regulation of gene expression

of the five AtSAMDC genes, bio informatics analyses of their promoters and the 5'UTRs

have not been reported. Taking advantage of recent advances in genomic, transcriptomic and proteomic research with A. thaliana, and the previous work on the expression analysis of AtSAMDCl and AtSAMDC2 in our lab, I undertook the present study with the goals of (1) analyzing the biochemical consequences of genetic manipulation of PAs and

(2) comprehensively analyzing the expression of the three remaining AtSAMDC genes, in this model species. The specific objectives of my research were:

1. To study the effects of inducible and constitutive transgenic manipulation of PAs

via a mouse ornithine decarboxylase (mODC) gene on plant development and

metabolism.

2. To analyze the spatial and temporal expression patterns of Arabidopsis thaliana

S-adenosylmethionine decarboxylase genes (AtSAMDC3, AtSAMDC4 and

• AtSAMDCS) during its life cycle.

51 MATERIALS AND METHODS

Bacterial culture and plasmid isolation

Liquid cultures of Escherichia coli (E. coli) and Agrobacterium tumefaciens were grown in Luria Broth medium (10 g L"1 Bacto Tryptone, 5 g L'1 Bacto Yeast Extract, and

10 g L"1 NaCl - Maniatis et al. 1982) containing appropriate antibiotics (ampicillin 100 u.g mL"1 or spectinomycin 100 ug mL"1 or kanamycin 50 ug mL"1 or gentamycin 50 ug mL"1). Sterile pipette tips or applicators were used to start a 3 mL liquid culture of E. coli or 200 mL liquid culture of Agrobacterium from glycerol stocks or plates. For solid cultures, 1.3% Bacto agar was added to the medium before autoclaving. Solid or liquid cultures ofE. coli and A. tumefaciens were incubated at 37°C for 18 h and 28°C for 24 to

48 h, respectively. Liquid cultures were grown on a shaker at 250 rpm.

Plasmid DNA was isolated from E. coli using Zyppy™ Plasmid Miniprep Kit from

Zymo Research (Irvine, CA, #D4020), 3 ml liquid culture (grown overnight at 37°C) was pelleted at 10,000 xg for 30 s in a 1.5 mL microcentrifuge tube. The pellet was resuspended in sterile water followed by the addition of 100 uL of Lysis Buffer and 350 uL of Neutralization Buffer, sequentially. The tubes were inverted to mix thoroughly and centrifuged for 4 min at 14,000 xg. The supernatant was then transferred into the Zymo-

Spin™ column attached to a collection tube. The column assembly was centrifuged for

15 s and the flow-through was discarded. This was followed by two washes, each of 200 uL of Endo-Wash Buffer for 15 s and 400 uL of Zyppy™ Wash Buffer for 30 s, respectively (by spinning at 14,000 xg). The column was then transferred into a clean 1.5 mL microcentrifuge tube, 30 uL of Zyppy™ Elution Buffer was added to the column

52 matrix and the tubes were let stand for one minute at room temperature. The plasmid

DNA was eluted by centrifugation for 15 s at 14,000 xg, quantuified with Nanodrop spectrometer (Fisher Scientific), and was stored at -20°C. Alternate kits were used occasionally following the manufacturer's protocols.

Genomic DNA isolation

Genomic DNA was isolated from plant tissues using modified Murray and Thompson

(1980) protocol. Approximately 100-150 mg of plant tissue was ground in liquid nitrogen with 500 uL of pre-heated (60°C) CTAB buffer [2% (w/v) Hexadecyltrimethylammonium bromide (Sigma, H6269), 1.4 M NaCl, 20 mM EDTA, 100 mM Tris-HCl, pH 8.0, and 0.2%

(w/v) p-mercaptoethanol added just before use] in a microcentrifuge tube. The ground tissue was incubated for 30 min at 60°C with gentle agitation, followed by addition of equal volume of chloroform: isoamyl alcohol (Fisher, A 393-500) (24:1). The sample was centrifuged for 5 min at 14,000 xg, the upper aqueous phase removed into a new tube, followed by addition of equal volume of cold isopropanol. The tubes were incubated for

30 min at -20°C. The DNA was pelleted by centrifugation for 15 min at 14,000 xg at 4°C.

The pellet was washed with 70% ethanol containing 10 mM ammonium acetate (Sigma,

A1542) by centrifugation. The pellet was vacuum-dried in a Speed-Vac and resuspended in 30 uL of TE buffer (10 mM Tris pH 8.0, 1 mM EDTA). Nucleic acid was quantified spectrophotometrically (Nano-drop) and its quality assessed by A260/A280 ratio (> 1.8).

Polymerase Chain Reaction (PCR)

A typical PCR was performed using Takara Ex Taq™ Polymerase (Takara Bio Inc.,

#TAK RROOIA). A 50 uL PCR was performed that contained total 1.25 units of Takara

Ex Taq DNA polymerase, IX final concentration of buffer (Mg2+), 200 uM final 53 concentration of dNTP mix, 0.2 uM final concentration each of the forward and the reverse primers, and 100 ng of total plasmid DNA or 100-150 ng of genomic DNA.

Reactions were run in a PTC™ 100 Programmable Thermal Controller (MJ Research

Inc., Waltham, MA). The PCR conditions were activation at 94°C for 1 min, followed by

30 cycles of denaturation at 94°C for 30 sec, variable annealing temperatures (Table 8) for 1 min and elongation at 72°C, followed by a final extension at 72°C for 2 min. The reaction tubes were stored at 4°C. Other Taq polymerases and thermocyclers were also used with similar reaction conditions.

Restriction Digestion and Agarose Gel Electrophoresis

Typical restriction digestion was performed using enzymes from New England

Biolabs (Ipswich, MA). A 10 uL reaction mix contained a final concentration of lx buffer, lx bovine serum albumin (if required), 2 units/ug DNA of the enzyme, 150-200 ng of template DNA' all brought to the volume by sterile distilled water. The reaction was incubated for 2 h at specified temperature according to the manufacturer's recommendation and used immediately or stored at -20°C before gel electrophoresis.

Agarose gel electrophoresis was performed to analyze DNA using a 1% Seakem GTG

(Lonza, #50070) or LE agarose (Lonza, #50000) dissolved in lx TAE buffer (40 mM

Tris-acetate, 1 mM EDTA). Prior to loading, samples were mixed with 6x loading dye and then electrophoresed at 5 V/cm for 1 h along with appropriate DNA size standards

(e.g. NEB 2-log DNA Ladder or 1 kb DNA Ladder or Low Molecular Weight DNA

Ladder). Electrophoresis was followed by staining of the gel for 15 min in 0.5 ug mL"1 of ethidium bromide and subsequent destaining for 10 min in distilled water. The gel was visualized and photographed using Nucleotech gel-documentation system (Nucleotech,

54 Table 8. Primers used for cloning, sequencing and (Q)RT-PCR.; the (Q)RT-PCR primers are adapted from Jumtee et al. 2008.

Constructs Forward (5'-3') Reverse (5'-3') Td (°C) 35S-mODC GAACCATGGGCAGCTTTAC CTACTACATGGCTCTGGA 60.0 inducible-mODC CACCATGAGCAGCTTTACTAAGGA CTACTACATGGCTCTGGA 56.0 SAMDC3-A CTTGCTTGCCATAACTGCGA GAACCCAAGAGTAGATTTTGGTGA 62.0 SAMDC3-B CTTGCTTGCCATAACTGCGA TTTTCAAAAGGCGAAGAGACT 59.0 SAMDC3-C TCTACATTAATAATAACCTCTAATG TGAAGAACAGAGCAATAAAAAG 54.6 SAMDC3-D GTTCAATCTAATAAAGGGTAAATC TGAAGAACAGAGCAATAAAAAG 54.6 SAMDC4-A AIGAI IGGIAGCI 1 1 IGAAGCGA TTTCCGACGAGGCGTGAAGG 63.6 SAMDC4-B ATGATTGGTAGCTTTTGAAGCGA TGCAAAGATCAGAAGAAGATGTTATG 63.0 SAMDC4-C AIGAI IGGIAGCI 1 1 IGAAGCGA TGCAAAGATCAGAAGAAGATGTT 59.0 SAMDC4-D CTCTCACATACACAGATACATACAC TGCAAAGATCAGAAGAAGATGTT 54.0 SAMDC5-A GAGCACTTTTGGAGCAGTAAT GACAGCCAAGAATGTAAAAAA 55.5 SAMDC5-B GAGCACTTTTGGAGCAGTAAT TGGAATTGAATTAGAGAGAAA 52.0 SAMDC5-C AATTAACCGGTCGGGTCG AGAGAGAAACGAGAGAGATAGATT 58.5 Inducible-GL/S CACCATGTTACGTCCTGTAGAAACC TCATTGTTTGCCTCCCTGCTG 55.0 pCR8.0 TOPO GTTGCAACAAATTGATGAGCAATGC GTTGCAACAAATTGATGAGCAATTA 50.0 (sequencing) AtSAMDCl TCGAGCCCAAGCAATTCTCT CAAATGTCCTCTCTCTGCACCC 60.0 (QRT-PCR) AtSAMDC2 ACCATTCCCTCACCGCAACTT GGI 1 ICAICGICAI IGCCCAI 60.0 (QRT-PCR) AtSAMDC3 ACCCCGGAAGATGGTTTTAGC GCCAATACCTCGGTTCCAAGA 60.0 (QRT-PCR) AtSAMDC4 ACAACCACGAGGTGACTAAGCG GGCGTGAAGGACTGATAAACGA 60.0 (QRT-PCR) San Mateo, CA) or Fotodyne gel-documentation system (Fotodyne Incorporated,

Hartland, WI). The DNA fragmentswer e analyzed with reference to an appropriate DNA size standard.

DNA sequencing and sequence analysis

A 6 u.L sequencing reaction was performed that contained total 300 ng of DNA and 5 pmol of either forward or the reverse sequencing primer. The sequencing was done at

UNH Hubbard Genome Centre using a ABI 3130 DNA Analyzer (Foster City, CA) and the results obtained from sequencing were aligned and analyzed with the target sequences using BioEdit Sequence Alignment Editor (Hall 1999).

Electroporation

Electroporation of TOP10 E. coli (Invitrogen, Carlsbad, CA, #C404003) and GV3101

A. tumefaciens was performed using an Eppendorf model 2510 electroporator. A 1-2 uL

LR clonase product was added to 50 uL aliquot of competent bacterial cells thawed on ice. The mixture was transferred to prechilled cuvettes (1 mm gap) and electroporated at

1800 V. This was followed by addition of fresh LB and incubation at 37°C for 1 h for E. coli and 28°C for 2 h for A. tumefaciens. The cells were plated on solid LB medium with appropriate antibiotic and incubated overnight. The resulting colonies were screened by plasmid isolation, restriction analyses and sequencing or PCR.

Glycerol stocks

Liquid cultures (3 mL) in LB medium with appropriate antibiotics from desired colonies were grown overnight at 37°C or 28°C and 250 rpm. Glycerol stocks were made by mixing thoroughly 85% of the bacterial culture with 15% of sterile glycerol (by

56 volume) in cryo-vials. The stocks were incubated in dry ice for 15 min and cryo- preserved at -80°C.

Cloning of mODC and AtSAMDC promoter regions

A 1190 bp sequence representing the ORF of mouse ODC (mODC) gene (Accession

#M10624 Kahana and Nathans 1985)) was PCR amplified from pCW\22-ODC

(Bhatnagar et al. 2001) using sequence specific primers (Table 8). The amplified PCR product was cloned into pENTR™/D-TOPO® vector (Invitrogen, Carlsbad, CA, #45-

0218), confirmed through restriction digestion, electrophoresis and sequencing of the

TOPO clone and subsequently transferred into estradiol inducible Gateway compatible pMDC7 destination vector (Curtis and Grossniklaus 2003) using LR clonase reaction according to the manufacturer's protocol (Invitrogen, Carlsbad, CA, #11791-020). For constitutive over-expression studies, mODC was cloned into pCR8.0/GW/TOPO vector

(Invitrogen, Carlsbad, CA, #45-0642), confirmed through restriction digestion, electrophoresis and sequencing of the clone and then transferred into pMDC32 destination vector (Curtis and Grossniklaus 2003) containing double 35S CaMV promoter using LR clonase reaction. For promoter analyses (using GUS reporter gene), respective fragments of SAMDC constructs (summarized in Fig. 36 and described in results section) representing the putative promoter regions were PCR amplified from A. thaliana (Col 0) genomic DNA (gDNA) and cloned into pCR8.0/GW/TOPO vector

(Invitrogen, Carlsbad, CA, #45-0642). Following confirmation through restriction digestion, gel electrophoresis and sequencing of the TOPO clones, the PCR fragments were then moved into the final destination vector pMDC163 (Curtis and Grossniklaus

2003) containing GUS, through LR clonase reaction.

57 Plant transformation

Arabidopsis thaliana (ecotype Columbia-0 - Col-0) plants were transformed by

Agrobacterium tumefaciens (strain GV3101) using modified floral dip method (Clough and Bent 1998). For each transformation, 3 pots were prepared one week prior to dipping by clipping the primary bolt to encourage synchrony in branching and flowering. A 500 mL culture of Agrobacterium was started in LB with kanamycin (50 ug mL"1) and gentamycin (50 ug mL"1) and grown for 24 h at 28°C on a 250 rpm shaker. The entire culture was pelleted at 5,000 xg for 10 min and the pellet was resuspended in 50 ml of

5% (w/v) sucrose. This culture was further diluted with 5% (w/v) sucrose containing

0.05% final concentration of L-77 Silwet (Lehle Seeds, TX #VIS-02) to adjust the OD60o to 0.8±0.2 before dipping. The unopened flower buds along with flowers (4-5 week old plants) were dipped into this bacterial suspension for 8-10 s avoiding contact with the basal leaves and soil. The pots were laid overnight on their sides on a flat and covered with a clear plastic to prevent dessication. The next morning, dipped plants were rinsed thoroughly under cold water and moved to their normal growth conditions. The same plants were re-dipped in a similar way after a week. Tl seeds were harvested from each pot separately after the siliques matured. Seeds were desiccated at room temperature for

5-7 d followed by sterilization and storage at 4°C.

Transient expression in poplar

The biolistics bombardment protocol for transient GUS activity in poplar (Populus nigra x maximowiczii) cells was as described in Bhatnagar et al. (2001). The plasmid

DNA (approximately 1.5 ug DNA/mg gold particles) was coated onto 1.5-3 urn gold particles (Aldrich, Milwaukee, WI) in the presence of 1.0 M CaCl2 and 16.7 mM Spd and

58 bombarded by Bio-Rad (Hercules, CA) PDS 1000/He gene gun, with either 1100 or 1350 psi rupture discs. Approximately 48 h after bombardment, the cells were treated with X-

Gluc (Jefferson et al. 1986), incubated overnight at 37° C, and numbers of blue cells

(showing GUS activity) were counted.

Screening for homozygous transgenic lines

Transgenic lines (for mODQ from pre-screened (tolerant to hygromycin 70 ug mL"1 or kanamycin 50 ug mL"1) Tl generation were reconfirmed by PCR for the presence of mODC or the desired gene sequence, depending on the construct. Confirmed Tl plants were grown to obtain T2 generation seeds. Five independent T2 transgenic lines were selected that had a single insertion of the mODC gene (tested by observing 3:1 segregation of live:dead plants on hygromycin plates) and showed significantly higher amount of Put either under inducible or constitutive conditions as compared to the WT controls; these lines were grown to obtain T3 generation seeds/plants. For most experiments T3 or T4 generation plants have been used. For screening of transgenic GUS plants, plant parts were subjected to GUS staining and plants that showed blue color were used for subsequent studies. Screened independent 3-5 homozygous T3 lines were used for all of our subsequent experiments.

Qualitative Assay of P-Glucuronidase (GUS) during Development

Histochemical assay of GUS was performed using GUS reaction mix containing 1 mM of 5-bromo-4-chloro-3-indonyl-P-D-glucuronide (X-Gluc; Research Products

International Corp.; #16831), 1 mM potassium ferricyanide, 1 mM potassium ferrocyanide, 100 mM sodium phosphate buffer pH 7.0, 5 mM EDTA, 0.1% Triton X-

100, and 20% methanol. Plant samples collected at different developmental stages were 59 submerged in GUS reaction mix and vacuum infiltrated for 5 min. Following incubation at 37°C for 18-24 h, the reaction mix was removed and the samples were stored in 70% ethanol (for decolorization of chlorophyll background) at 4°C until analysis and photography (Martin et al. 1992). Representative photographs were taken using an

Olympus C650 digital camera (www.olympusamerica.com) mounted on a Olympus

SZX9 dissecting microscope.

Seed sterilization and growth

Seeds of Arabidopsis were surface-sterilized in microfuge tubes. Approximately 40 mg of seeds were mixed with 1 mL of 70% ethanol and a drop of 10% Triton X-100 (v/v) and gently agitated for 5 min. Following brief centrifugation, the supernatant was removed and 1 mL of 100% ethanol with one drop of 10% Triton X-100 (v/v) was added with another 5 min of incubation and gentle agitation. This was followed by another wash with 100% ethanol for 5 min. The seeds were dried in the laminar flow hood for 7-8 h and plated on solid germination medium or GM (4.3 gL"1 MS salts, 0.5 gL"1 MES, 1 gL"1 sucrose, and 0.8% type A agar; pH adjusted to 5.7 by 4 M KOH). The plates were covered with aluminum foil and the seeds were stratified for 48 h in dark at 4°C.

Following that, the foil was removed and the plates moved to a growth chamber.

Arabidopsis seedlings were typically grown at 25±1°C under 12 h photoperiod (80±10 uE.m"2.s_1). For gene induction experiments, batches of 8-10 seedlings (12-d old) grown in solid GM were transferred into liquid GM in 12 well plates; each well contained 1 mL of the medium. Each treatment was assigned 4 wells where samples from each well were considered as one replicate. A final concentration of 5 uM estradiol (Sigma, #E2758; from a stock of 10 mM of estradiol in dimethyl sulfoxide) solution with or without 0.1

60 mM L-Orn or 1 mM Glu or 0.5 mM Arg (final concentration) were applied in the liquid medium; the medium without treatment is called control. The plates were then left in the growth chamber (conditions described above) and samples were collected at 12 h and 24 h, soaked dry to remove excess medium, and collected for PA and amino acid analyses.

To study the effects of exogenous PAs, WT seedlings were grown for 7 d in solid GM supplemented with 1.0 mM of Put or Spd or 0.5 mM Spm or no PAs (control). For PA and amino acid analyses of 35S-mODC lines and WT plants, seedlings were typically grown in lx solid MS medium for 14 d before collection. Amino acid and PA analyses were also performed in different tissues collected from 5 week old mature plants grown in pots. For extra N and sucrose treatments, seeds were germinated in GM containing either 30 mM or 60 mM KNO3 or N-free medium (PhytoTechnology Laboratories,

#M531) and sucrose (0, 50 mM, 100 mM). The seedlings were collected for fresh weight, dry weight, PA and amino acid analyses. Seedlings from different treatments, lines and also tissues from mature plants were collected in 5% HCIO4 (v/v from a stock of 60%; approx. 0.77N) and stored at -20°C prior to analysis of PAs and amino acids. The ratio of plant material to HC104 was typically 1:9 (i.e. 100 mg FW tissue in 900 uL 5% HC104).

Plant growth in soil

Arabidopsis seeds were sown in moist soil mix containing 3 parts Scott's 360 Metro-

Mix (Scotts Company, Marysville, OH) and 1 part perlite in 3" pots. In each pot, 10-15 seeds were sown and the pots were placed on a flat covered with a clear plastic lid; the flats were kept for 48 h in dark at 4°C. Thereafter, the flats were moved to growth chamber at 21°C under 18 h photoperiod (80±10uE.m"2.s"'). The plastic lid remained on for 7 d followed by a 3 d hardening off period after which the lid was removed. After 10

61 to 12 d of germination the pots were thinned with 4-5 plants/pot. Plants were watered on

alternate days and fertilized with XA strength Miracle-Gro (Scotts Company) synthetic

fertilizer applied with irrigation water every 5th day. For recovery of transgenic plants

selected on antibiotics, 12-14 d old seedlings were transferred to the pots using forceps.

Incorporation of labeled precursors

For incorporation of labeled precursors, two-week old inducible mODC transgenic

seedlings grown in solid GM were transferred to 50 mL conical flasks containing 10 mL

of liquid GM. The flasks were incubated at 25°±1°C on a gyratory shaker at 150 rpm.

Inducer (5 uM estradiol - final concentration) was added to the liquid GM immediately

after transfer of the seedlings. Two hours later, 0.5 uCi of either L-[U-14C]Orn (specific

activity 257 mCi/mmol, Amersham Pharmacia Biotech) along with 0.1 mM cold Orn

(final cone.) or 0.5 uCi L-[U-14C]Arg (specific activity 272 mCi/mmol, Moravek

Biochemicals, St. Louis, MO) along with 0.5 mM cold Arg (final cone.) were added to

each flask and incubated for 8 h. Samples were washed 3 times either with 2 mM cold

Orn or 10 mM cold Arg, followed by 3 consecutive washes of de-ionized water. The

samples were collected in 5% PCA and stored at -20°C before processing to determine

14C incorporation into PAs. Following 3 cycles of freezing and thawing, the samples were dansylated (Bhatnagar et al. 2001) and 300 uL aliquot of toluene and 50 uL of the aqueous phase were counted for radioactivity in 10 mL Scintilene (Fisher Scientific, Lot

#980805) in a LSC-6000 liquid scintillation counter (Beckman, Fullerton, CA).

Quantification of polyamines

Wild type and transgenic seedlings were grown in solid GM for the number of days specified for each experiment. Seedlings were collected in 9x volume of 5% HCIO4 and 62 frozen and thawed 3x before dansylation and quantification of PAs by HPLC (Bhatnagar et al. 2001; Mohapatra et al. 2010b). The thawed samples were vortexed for 5 min, centrifuged (13,000 xg) for 10-15 min, and 100 uL of the supernatant was used for dansylation. For standards, a 100 uL mixture of 3 PAs (0.004 mM Put, 0.002 mM Spd or

Spm, 0.08 mM Put, and 0.04 mM Spd and Spm); heptanediamine was used as internal standard. To 100 uL of either the sample or the standard mix, 20 pL of 0.1 mM heptanediamine (Sigma, #D3266) was added. This was followed by the addition of 100 uL of saturated Na2C03 solution and 100 uL of 20 mg mL"1 (in acetone) dansyl chloride

(Fluka, Milwaukee, WI, #39220). The mixture was vortexed for 30 s and incubated for 1 h at 60°C. Then 20 uL of 20 mg mL"1 L-asparagine was added to the samples and the standards, and the tubes were vortexed for 30 s. Following incubated for 30 min at 60°C, acetone was vacuum evaporated for 5 min in a Speed-Vac (Savant Instruments Inc.,

Farmingdale, NY) and dansyl-PAs were recovered in 400 uL of toluene (Phortex grade;

Fisher, #9456-03). Following toluene addition, the samples and the standards were vortexed for 1 min, left undisturbed for 5 min to separate the organic and the aqueous phases, and centrifuged for 1 min at 13,000 xg. An aliquot of 200 pL of the toluene phase was transferred to a new microfuge tube and vacuum dried in Speedvac. The dansyl-PAs were reconstituted in 500 uL of methanol by vortexing for 2 min, followed by centrifugation for 2 min. A 250 uL aliquot of methanol extracts was transferred to autosampler vials for analysis of PAs using a gradient of acetonitrile (Fisher, #75-05-8) and 10 mM heptanesulfonic acid (Fisher, #300111), pH 2.8 on a reverse phase column

(4.6 x 33 mm, 3 pm) using Perkin-Elmer (PE) HPLC system (Bhatnagar et al. 2001). The system consisted of a PE series 200 autosampler fitted with a 200 uL loop (10 uL of

63 sample volume injected) and a series 200 gradient pump at a flow rate of 2.5 mL min" . A series 200a fluorescencedetecto r (Perkin Elmer) set at 340 nm and 515 nm for excitation and emission, respectively, was used for detection and quantitation of PAs. The PE

TotalChrom software (Version 328 6.2.1) was used to integrate data, and a multiplication factor incorporated into the software was used to obtain the amounts as nmol mL"1 PCA or nmol g"1 FW.

Amino acid analysis

The aqueous fraction from toluene partitioning (described above) of the dansylated samples was used for amino acid analysis by HPLC (Minocha and Long 2004). A 135 uL aliquot of the aqueous fraction along with 135 pL of 2.9 M acetic acid was added to 730 pL of methanol. The tubes with the solution mixture were left open for 10-12 min to remove excess CO2 and the mixture was filtered through a 0.45 p nylon syringe filter

(Pall-Gelman Labs. Ann Arbor, MI). A mixture of 22 amino acids (20 L-amino acids +

GABA - Sigma, #A5835 + Orn - Sigma, #02375) was used to make a standard curve for quantitation of amino acids. A Hydro-RP, 4 pm particles, 100 mm x 4.6 mm i.d. column

(Phenomenex, Torrance, CA) and a Ci8 security guard column (5 pm, 4 mm x 3 mm i.d.;

Phenomenex) in a column heater (Bio-Rad labs, Hercules, CA) set at 40°C were used for amino acid separation. The amino acids were analyzed at the USDA Forest Service

(NRS) Laboratory, Durham, NH.

Total soluble protein measurement

Total soluble protein was measured using Bradford method (1976) using the Biorad protein assay dye (Biorad Labs). Whole seedlings or plant leaves (20-25 mg) were collected in 100 pL of K-Pi buffer (0.1 M KH2P04; 0.1 M K2HP04), pH 7.0. Samples 64 were frozen and thawed once, vortexed and centrifuged for 5 min at 16,000 xg. A 10 pL of plant extract diluted 4x with k-Pi buffer was mixed with 1.5 mL of diluted Bio-Rad protein assay dye. Following incubation in the dark for 15 min, A595 was measured in a

Spectronic® 20 Genesys ™ spectrophotometer (Spectronic Instruments Inc., Rochester,

NY). Known concentrations of bovine serum albumin (Sigma, #A4503) were used for a standard curve which was used to calculate the protein concentration in the extract.

Chlorophyll analysis

Chlorophyll analysis was performed using modified protocol from Gitelson et al.

(2009). Two to three oldest rosette leaves of 4 week-old-plants were used for pigment extraction. About 200-250 mg FW of leaf lamina were ground using a mortar and pestle with 200 pL of methanol mg"1 FW of leaf tissue. A pinch of CaC03 was added to the samples while grinding to prevent pheophytization of chlorophyll. Homogenates were centrifuged for 5 min at 10,000 xg and the A665 and A652 values of the supernatants were measured using a Spectronic® 20 Genesys ™ spectrometer Total chlorophyll was calculated using as per Lichtenthaler and Buschmann (1987) [chlorophyll a; ca (pg/ml) =

16.72A665.2-9.16A652.4 and chlorophyll b; Cb (pg/ml) = 34.09A652.4-15.28A665.2]

Total percent carbon and nitrogen

For total C and N contents, individual plants were collected separately, dried at 70°C and analyzed by a CHNS analyzer (Thermo Scientific CE Elantech Flash EA1112 Soil) at the USDA Forest Service Lab. National Institute of Standards and Technology (NIST,

Gaithersburg, MD, USA) samples 1515 (Apple Std) and 1547 (Peach Std) were used for procedure verification (Mohapatra et al. 2010b).

65 RNA isolation and cDNA synthesis

Plant samples stored at -80°C were used for total RNA extraction using the ZR Plant

RNA MiniPrep™ Kit (Irvine, CA, #R2024). Frozen samples were removed from liquid nitrogen, ground quickly in 800 pi of RNA lysis buffer, and centrifuged for 1 min at

12,000 xg. The supernatant (400 pi) was transferred to Zymo-Spin™ IIIC column in a collection tube and centrifuged for 30 s at 8,000 xg. This was followed by addition of 0.8 volume of 100% ethanol to the flow-through, transfer of the mixture to a Zymo-Spin™

IIC column, and centrifugation for 30 s at 12,000 xg. The flow-through was discarded and in-column DNase treatment was performed using RQ1 RNase-Free DNase (Promega,

Madison, WI, #M610A), and incubation at 37°C for 20 min. The column was centrifuged for 30 s at 12,000 xg, washed 2x with 400 pi of RNA Prep buffer for 60 s, and 800 pi of

RNA wash buffer for 30 s by centrifugation (12,000 xg). The RNA wash buffer step was repeated and the column was transferred to a DNase/RNase-free collection tube.

DNase/RNase-free water (25 pi) was added to the column matrix and the column was let stand at room temperature for 30 s. RNA was eluted by centrifugation for 30 s at 10,000 xg and cDNA synthesized immediately from the RNA.

RNA samples were reverse transcribed to first strand cDNA using qScript™ cDNA

SuperMix kit (Quanta Biosciences, Gaithersburg, MD, #95048-100). A 20 pi cDNA synthesis reaction mix was made to contain a final concentration of IX cDNA SuperMix,

1 pg of total RNA, and RNase/DNase-free water. The reaction was run in a PTC™ 100

Programmable Thermal Controller. The reaction conditions were 5 min at 25°C, 30 min at 42°C and 5 min at 85°C. The resultant cDNA was stored at -20°C before QRT-PCR.

66 Quantitative Reverse Transcriptase Polymerase Chain Reaction (QRT-PCR)

Relative gene expression was quantified by SYBR-green dye based assay. A 20 pi

reaction mix containing IX final concentration SYBR-Green FastMix, Low ROX

(Quanta Biosciences, Gaithersburg, MD, #95074-250) was set up with a final

concentration of 50 nmole each of the forward and reverse gene specific primers (Table

8) and an appropriate amount of cDNA (up to 500 ng). The reactions were run in

MicroAmp™ Fast Optical 96-Well reaction Plate (Applied Biosystems, Foster City, CA,

#4346906) in Applied Biosystems 7500- Fast Real-Time PCR machine (Applied

Biosystems, Foster City, CA). The cycle conditions included a pre-incubation at 50°C for

2 min, dye activation at 96"C for 15 s, primer annealing at 55°C for 30 s, and extension at

72°C for 1 min. A dissociation curve around 60°C to 95°C confirmed that majority of the

signal was due to the interaction between SYBR-green and the specific amplicon, and not

due to the primer dimers. A standard curve was prepared from serial dilutions of cDNA;

the value for specific gene expression was extrapolated from the standard curve and

expressed as a ratio of the value of the gene of interest to the internal control gene TIP-41

(At4g34270) (Czechowski et al. 2005; Page et al. 2007).

Statistical analyses

For all experiments three to six replicates were used for each treatment. Each experiment was repeated at least twice and data from a single representative experiment are presented here in most cases. The data were subjected to analysis of variance

(ANOVA) using SYSTAT version 10.2. Significance at P< 0.05 was determined using

Tukey's t-test. Specific analyses are described in the Figure and Table legends, where applicable.

67 Analysis of cis elements

For analysis of putative cis elements in the promoter regions Athena promoter analysis software was used (www.bioinformatics2.wsu.edu/cgi-bin/Athena/; O'Connor et al.

2005). The locus IDs of different SAMDC genes of Arabidopsis were used to obtain the putative cis elements available in the promoter regions.

68 RESULTS

OBJECTIVE 1. Transgenic manipulation of PAs

The mODC ORF (1190 bp) gene without PEST sequence (responsible for fast turnover) was PCR amplified from the pCW122-mODC plasmid (Bhatnagar et al. 2001) and cloned into pENTR™/D-TOPO® (for induction) and pCR8.0/GW/TOPO (for constitutive expression) vectors. The cloned vaODC in the TOPO vectors was then transferred into vector pMDC7 (estradiol inducible promoter) and pMDC32 (constitutive promoter), by LR clonase reaction (see materials and methods), and tested by PCR and sequencing for accuracy. The primers used for the cloning ofmODC are listed in Table 8.

The different steps, including maps of the plasmids, PCR amplification, confirmation through restriction digestion and gel electrophoresis of the entry clones and final destination vectors, are shown in Figs. 2 and 3. Finally, they were transferred into

Agrobacterium tumefaciens GV3101 in two formats - one constitutive (35S) and the other inducible by estradiol as per the guidelines from Curtis and Grossniklaus (2003).

Parallel' to the mODC vectors, an inducible GUS gene vector was also created (Fig. 4).

This served as a control for testing the inducibility of the gene by estradiol. The results indicated that 5 pM of estradiol was sufficient to induce the GUS gene (Fig. 5). There was no visible GUS expression without estradiol treatment.

Using these vectors for floral dip transformation, several Tl transgenic lines (both inducible and constitutive) of Arabidopsis were selected on hygromycin and grown to obtain T2 seeds. Individual T2 lines were tested for the presence of the transgene by PCR

(Fig. 6) using mODC specific primers; 4 lines were found to be PCR positive in the case

69 RV 102 CAT'AT C Hpal 3S1 GTT'AAC If col- 113*- C*CATC_C fincll- *01 CTy'rAC Hpal- 501 GTT'AAC

#-ol - 2877 - CCAT C_G

MVol-4262- C*CATC_G :dlll- 1421 - VAGCT_T -i,»cU 1652 CTy'rAC ^35 CTT'iAC Ssal 1^0* GCTCT CnWiui^ v.-KV 2283 - CAT'ATC 1 I9f4 C'CATG_C

10.0 kb 3.0 kb 3.0 kb 1.2 kb 2.0 kb 1.0 kb 0.5 kb

Figure 2. Plasmid maps (A and B) and gel analysis results (C) of inducible mODC constructs (i) PCR product, (ii) pENTR™/D-TOPO® digests (Hindi; 1051 bp, 2805 bp) with mODC insert, and (iii) pMDC7 digests (Ncol; 1739 bp, 2648 bp, 8599 bp) with mODC insert. NEB 2-Log DNA ladder.

70 A B Ned-11034 -CCATG_G An* -10788 - GGTCTCn'mum Hittm - 10S01 - A'AGCT_T, .Styt -10332 -AATATT II 581-GTy'rAC JI 501 GTT'AAC 5,-^RI 67!- CJAATT_C

&gi - 3592 - AATATT

ft-M1H 141* VAGCTJT

•II 1M* GTyVAC

'thai - 2J10 - T'CT VG_A 5/11 - 1921 GCCn.nw.'nGGC Bsd - 5160 - GCTCTCa'imna ft.-RV 21»4 GAT'ATC ^vl I<»48 C'CATG^C KI 2076 G*AATT_C

•10 kb

2kb •1.5 kb

Figure 3. Plasmid maps (A, B) and gel analysis results (C) of constitutive mODC construct (i) PCR product, (ii) pCR8.0/GW/TOPO digests (Hindi; 1051 bp, 2805 bp) with mODC insert, and (iii) pMDC32 digests (Hindlll; 1598 bp, 9913 bp) with mODC insert. NEB 2-Log ladder except for the PCR product where 1 kb DNA ladder was used.

71 - IB- BAT ATE 511 CTj-'rAC 591 CTT-\AC r.H 673 CC.CCCC

IcoWi II** CAT ATC r»I 313* \AT'ATT &«<1\ 12*4 CTyYAC VL.a 1J18 TGG'CCA

RV 1477 CAI'ATC

E«RV «» GAT'ATC Ss-BI 17*2 TT'CC_AA AsJ 25W CC'CCCG_€C WweH 1*2* CTy-rAC SAY-4BL - CATAIC Sspl 195* AAT'ATT CATATC

4kb

0.3 kb-

Figure 4. Plasmid maps (A, B) and gel analysis results (C) of inducible GUS construct (i) PCR product, (ii) pENTR™/D-TOPO® digests (Hindi; 534 bp, 793 bp, 3065 bp) with GUS insert, and (iii) pMDC7 digests (EcoRV; 231 bp, 4719 bp, 8465 bp) with GUS insert. NEB 2-Log DNA ladder.

72 Figure 5. Estradiol inducible transgenic seedlings containing GUS; (a) un-induced and (b) 24 h after induction by 5 pM estradiol.

73 1 2 8 10 WT 1 23456789 10 18 21 WT

1.2 kb 1.2 kb-

Figure 6. PCR screening of T2 inducible mODC (a) and 35S-mODC (b) plants. NEB 2- Log DNA ladder (The numbers on the top denote individual plant lines).

74 of inducible mODC, and 10 lines were positive for the constitutive mODC transgene construct. Some of these T2 lines were used to produce T3 homozygous plants, which were tested for induction by estradiol at the seedling stage. Two lines (named mODC\0-l and mODC\-\4) that showed high Put upon induction were selected for further analysis at the biochemical level (for the induction work). Likewise three lines (1-7, 4-11, 18-2) of transgenic plants were selected for physiological and developmental analysis for the constitutive expression.

Inducible expression of mODC: Associated biochemical changes

As described above, a maximum increase in Put was often seen at 12 h after estradiol treatment, with only small increases being seen thereafter. Role of substrates, especially

Orn, Arg and Glu, in modulating PA and amino acid metabolism is not fully understood.

As Orn occupies a pivotal position for biosynthesis of Put, Arg or Pro, we have previously hypothesized (Mohapatra et al. 2009, 2010b; Page et al. 2010) that Orn (as the substrate ofmODC) rather than Glu could be a limiting factor for Put biosynthesis. We applied several treatments to further test this hypothesis. Note that Put is solely produced in WT Arabidopsis via Arg as it lacks a functional ODC gene; thus the mODC introduces a shunt to siphon away the cellular Orn and (potentially) depriving the pathway to make

Arg. Moreover, in Arabidopsis, as in most plants, the cellular contents of free Orn are very low, and it is a critical substrate for Arg biosynthesis. In order to test whether Orn in transgenic Arabidopsis seedlings could become limiting for additional production of Put by mODC, we added the three amino acids (Orn, Glu and Arg) during the period of induction ofmODC and monitored the PA contents at two different times after induction.

We also studied the contents of all soluble amino acids in these plants. Plants were also

75 fed with U14C-Orn and U14C-Arg with or without induction of mODC to test the

incorporation of 14C into PAs in response to induction ofmODC. The PA and amino acid

content of the WT and inducible mODC transgenic plants (in the absence of the inducer)

were similar, thus the inducible mODC lines without the inducer were treated as controls.

Inducible expression of mODC: Changes in polyamine content

The different PAs changed differently in response to induction in the presence of

exogenously supplied Orn, Arg and Glu in seedlings. At 12 h of induction ofmODC by

estradiol, Put content increased in plants by >10 fold (Fig. 7a). Addition of Orn

concomitant with induction caused a further 4-fold increase (total up to 39-fold), whereas the presence of Glu and Arg during the induction period had little positive effect.

Exogenous supply of Orn, Glu or Arg alone had no effect on Put content in the un-

induced (control) transgenic plants. Increased accumulation of Put continued at 24 h after

induction but not in the un-induced and untreated control plants, which only showed a

doubling of Put at 24 h as compared to 12 h. The corresponding numbers in estradiol +

Orn were >44-fold than time zero but only 5- to 6-fold higher with Glu and Arg.

Spermidine content was up slightly upon induction ofmODC at 12 h both in induced

(1.4-fold) and E+O (1.5-fold) plants and was comparable in un-induced plants treated

with Orn alone (Fig. 7b). At 24 h of induction, no significant change in Spd contents was observed among different treatments except for those supplemented with Arg.

Cellular content of Spm increased about 1.3-fold at 12 h in plants treated with exogenous Orn, with little effect of induction itself (Fig. 7c). At 24 h of induction, a small

increase was seen again. In no case was more than doubling of Spm seen. In seedlings treated with estradiol, a significant amount of Cad (Figs. 7d & SI) was seen in all cases

76 1800 r*j 24 h 1500 (a) 12 h 5 * Li 1200 en o 900 * E 600 * * * * •4-» 3 300 0. 0 ' _ n n n ,-, I I r~1 r—i r—1 C E Orn Glu Arg Om Glu Arg C E Om Glu Arg Om Glu Arg +E+E+E +E+E+E 600 (b) 12 24 h f 5 500 h u. 400 CO o 300 r] E 200 E, J c rJ r3 r, r£j i*i Ej r3 a 100 n n n n n fl n V)

C E Orn Glu Arg Orn Glu Arg C E Orn Glu Arg Orn Glu Arg + E +E +E +E +E +E

100 12 h 24 h 80 (C) ft ft 60 ft ft o r*i * * E 40 ¥ 20 CL

C E Orn Glu Arg Orn Glu Arg C E Om Glu Arg Orn Glu Arg + E +E + E +E +E +E 200 (d) 12 h 24 h 160

120 ft cn o 80 E •o 40 ft o

C E Orn Glu Arg Orn Glu Arg C E Orn Glu Arg Orn Glu Arg +E +E +E +E +E +E

Figure 7. Cellular contents of PCA soluble polyamines in 12 h and 24 h induced (+E) and un-induced mODC-10-1 transgenic plants with or without 0.1 mM Orn, 0.5 mM Arg or 1 mM Glu. N= 4; each replicate consists of 6-7 seedlings. * = P< 0.05 for significant difference between treatment and control at a given time.

77 within 12 h with or without the presence of Orn, Glu or Arg. The amount of Cad

increased further by 2- to 3-fold at 24 h with E+Arg, E+Glu and E as compared to their

12 h corresponding values with the highest effect being seen by estradiol treatment only.

Inducible expression ofmODC: Changes in amino acids

Since (i) the biosynthesis of PAs begins directly with the substrates Orn (by ODC) and

Arg (by ADC), (ii) these two amino acids are derived from Glu, and (iii) Glu serves as a

substrate for biosynthesis of most other amino acids (Fig. 1); it is logical to postulate that

increased utilization of Orn by mODC will affect the connencted pathways in which Orn,

Arg or Glu are involved. Thus we analyzed not only the contents of PAs in response to

induction and exogenous supply of Orn, Arg and Glu, but also the soluble amino acids in

the cells. The data are presented in Figures 8 to 12.

Glutamate is a key intermediate in cellular N metabolism being involved in N

assimilation, serving as substrate for biosynthesis of numerous metabolites including key

amino acids, and being involved in the biosynthesis of PAs. Its content was not affected

following induction by estradiol, nor was any other amino acid of this family (Fig. 8a-i).

However, in the presence of Orn, induced plants had more than twice the content of Glu

whether or not they were treated with estradiol (Fig. 8a). Exogenous Glu or Arg did not

cause a similar effect, showing that extra Glu was quickly utilized in other reactions.

Glutamine content was not affected either by induction or by exogenous supply of Orn,

Glu or Arg (Fig. 8b). Overall, Gin constituted about 50% of the total content of soluble

amino acids in the plants (Tables 9A, 9B). Among different treatments Glu, E+Arg and E produced small increases in Gin at 24 h corresponding to their respective 12 h values.

78 5000 (a) * 12 h A * 24h * 4000 ft 5 Li. 'o> 3000 & O E A 2000 i

o 1000

C E Om Glu Arg Om Glu Arg C E Om Glu Arg Om Glu Arg +E+E+E +E+E+E 42000 (b) 12 h 24 h , 35000 & 28000 ft

o 21000 rl r-i E 6 -h c 14000 * ii I ^\f\ O 7000

C E Om Glu Arg Orn Glu Arg C E Om Glu Arg Om Glu Arg +E+E+E +E+E+E

C E Orn Glu Arg Orn Glu Arg C E Orn Glu Arg Orn Glu Arg + E +E +E +E +E +E

Figure 8. Cellular contents of PCA soluble amino acids in induced (+E) and un-induced mODC-10-1 transgenic plants with or without 0.1 mM Orn, 0.5 mM Arg or 1 mM Glu. N= 4; each replicate consists of 6-7 seedlings. * = P< 0.05 for significant difference between treatment and control at a given time.

79 500 (d) 12 h 24 h ^ 400 4 T 5 LL. O) 300 ri flf O r]E . [ E S 200 f\ f w x 100

C E Om Glu Arg Om Glu Arg C E Om Glu Arg Om Glu Arg + E +E +E +E +E +E 15000 (e) 12li1 24 h * 12000 f T

E 9000 r3E i c_ >> rB 1 y - r] 0 6000 [9E j d Ei rJ + r3E i & f 3000 If + < C E Om Glu Arg Om Glu Arg C E Orn Glu Arg Om Glu Arg +E+E+E +E+E+E 800 (f) 12h 24 h

600

O) O 400 E E ft o 200 ii 5 Is! * C E Om Glu Arg Orn Glu Arg C E Om Glu Arg Om Glu Arg + E +E +E +E +E +E

Figure 8. Continued

80 450 (g) 12 h 24 h 5 360

™ 270 o i E i < 180 ft A A CO < ft i O 90

C E Om Glu Arg Om Glu Arg C E Orn Glu Arg Orn Glu Arg +E+E+E +E+E+E 300 (h) 12 h 24 h 240 "3 i A E 180 ft A & •2 120 ft * 10 >. O + 60 (>0 . o C E Om Glu Arg Om Glu Arg C E Om Glu Arg Om Glu Arg + E+E+E +E+E+E 1500 (i) 12 h 24 T 5l 1200 2 r] "i u. 900 1 r] o - a 600 r] E a 3 J I- i i a> ft V) 300

C E Orn Glu Arg Om Glu Arg C E Orn Glu Arg Om Glu Arg +E+E+E +E+E+E

Figure 8. Continued

81 Table 9A. Contents of individual amino acids at 12 h post induction (as % of total PCA-soluble amino acids) in 12 d old seedlings of mODC-10-1 grown in control (C), Induced (E), Om (0.1 mM) + E, Glu (1 mM) + E, Arg (0.5 mM) + E, Om (0.1 mM), Glu (1 mM) and Arg (0.5 mM) in liquid MS media. Numbers in red and blue (bold denotes >50% change and regular between <50% change) denote amino acids that are up-regulated and down-regulated respectively (N= 4 and each replicate consists of 6-7 seedlings). Amino acid C E E + Orn E + Glu E + Arg Orn Glu Arg

Glu 5.34 ±0.12 5.3610.13 10.5010.13 5.12 ±0.02 4.39 ±0.13 9.98 ± 0.26 5.18 ±0.14 4.5210.14 Gin 45.06±1.38 48.57 1 2.55 50.06 ± 0.66 50.43 ± 2.07 47.2U1.66 49.97 ± 0.48 50.49 ±1.46 47.7710.81 Ser 1.6610.10 1.5710.08 1.88 ±0.08 1.53 ±0.06 1.65 ±0.05 2.21 ±0.03 1.4210.06 1.5410.05

Arg, Thr, Gly 16.23 ±0.41 15.95 10.34 12.52 ±0.39 15.18 ±0.49 17.6 ±0.44 12.83 ±0.64 14.12 10.18 18.23 10.14 Ala 4.04 i 0.38 3.11 ±0.66 0.8410.15 2.69 ± 0.50 3.43 ± 0.37 0.73 ± 0.05 4.57 1 0.41 3.1610.42 Pro 0.29 ± 0.01 0.31 ±0.01 0.22 ± 0.01 0.29 ± 0.01 0.34 ± 0.01 0.21 ± 0.04 0.3310.01 0.26 1 0.00

Gaba 0.32 ± 0.01 0.44 ± 0.02 0.43 ± 0.01 0.52 ± 0.03 0.35 ± 0.02 0.34 ±0.06 0.60 1 0.03 0.29 1 0.02 Val 0.49 ± 0.02 0.45 ± 0.03 0.31 ±0.01 0.40 ± 0.03 0.49 ± 0.02 0 29 ±0 01 0.52 1 0.02 0.41 1 0.03 Met 0.07 ± 0.00 0.06 ± 0.00 0.06 ± 0.00 0.07 ± 0.01 0.07 ±0.01 0.06 ± 0.00 0.07 1 0.00 0.07 1 0.00

He 0.23 ± 0.02 0.26 ± 0.02 0.19 ±0.00 0.23 ± 0.02 0.29 ± 0.02 0.19 ±0.01 0.26 1 0.01 0.2510.01 Leu + Tip 21.47 ±0.77 19.12 ±1.53 19.37 ±0.12 19.53 ±1.10 20.19 ±1.37 18.65 ±0.46 18.18 10.76 19.69 10.60 Phe 2.3510.18 2.51 ±0.07 1.96 ±0.12 2.05 ±0.11 1.75 ±0.10 2.00 ± 0.37 1.7710.03 2.11 10.27

Cys 0.54 ± 0.03 0.61 ± 0.00 0 32 ±0 01 0.50 ± 0.05 0.45 ± 0.02 0 28 ± 0 02 0.44 1 0.04 0.46 1 0.03 Orn 0.59 1 0.02 0.44 ± 0.05 0.39 ± 0.05 0.39 ± 0.05 0.52 ± 0.02 1.43 ±0.21 0.6910.10 0 35 ± 0.06 Lys 0.43 ± 0.01 0.38 ± 0.05 0.26 ± 0.03 0.33 ± 0.03 0.36 ± 0.02 0.31 ± 0.02 0.49 1 0.05 0 26 l 0 03 His 0.88 ± 0.07 0.84 ±0.15 0.70 ± 0.03 0.74 ±0.14 0.90 ± 0.06 0.53 ± 0.03 0.87 1 0.07 0.63 1 0.08 Table 9B. Contents of individual amino acids at 24 h post induction (as % of total PCA-soluble amino acids) in 12 d old seedlings of mODC-10-1 grown in control (C), Induced (E), Om (0.1 mM) + E, Glu (1 mM) + E, Arg (0.5 mM) + E, Om (0.1 mM), Glu (1 mM) and Arg (0.5 mM) in liquid MS media. Numbers in red and blue (bold denotes >50% change and regular between <50% change) denote amino acids that are up-regulated and down-regulated respectively (N= 4 and each replicate consists of 6-7 seedlings).

Amino acid C E E + Orn E + Glu E + Arg Orn Glu Arg

Glu 4.93 ± 0.06 4.8710.13 10.9710.44 5.2510.18 4.38 ± 0.08 9.5010.17 5.09 1 0.05 5.98 ± 0.26

Gin 55.28 ±1.72 54.91 1 0.99 49.94± 0.71 53.4611.52 49.77±1.53 48.86 11.42 54.0911.07 40.63 ±2.10

Ser 1.53 ±0.08 1.8310.09 2.68 ± 0.07 1.69 ±0.08 1.54 ±0.09 2.91 1 0.05 1.6710.05 1.28 ±0.06 Arg+Thr+Gly 13.32 ±0.65 14.29 10.22 13.32 ±0.18 13.71±0.35 19.18 ±0.26 14.31 10.12 14.16±0.12 20.28 1 0.80

Ala 6.54 ± 0.57 7.39 1 0.99 2.08 10.14 7.60 ± 0.77 7.63 ± 0.68 1.0410.03 8.3U0.42 9.59 ±0.91

Pro 0.23 ±0.01 0.34 ±0.01 0.24 1 0.01 0.4610.12 0.37 ± 0.01 0.1910.03 0.34 1 0.01 0.46 1 0.01

Gaba 0.20 ± 0.01 0.33 ± 0.02 0.31 ± 0.02 0.47 ± 0.01 0.27 ± 0.00 0.37 1 0.08 0.44 ± 0.03 0.7310.15

Val 0.41 ±0.01 0.44 ± 0.01 0.32 1 0.00 0.45 ± 0.02 0.47 ± 0.02 0.26 1 0.02 0.47 ± 0.00 0.65 1 0.04 Met 0.05 ± 0.00 0.05 ± 0.00 0.06 1 0.00 0.05 ± 0.00 0.04 ± 0.00 0.07 1 0.02 0.05 ± 0.00 0.05 1 0.01

He 0.17 ±0.01 0.22 ± 0.01 0.1510.01 0.18 ±0.01 0.18 ±0.00 0.1610.00 0.15 ±0.01 0.35 1 0.04

Leu + Tip 14.08 ±0.43 12.48 ±0.35 17.22 10.42 13.76 ±0.90 13.41 ±0.75 17.89 11.38 11.81 ±0.66 16.1411.84

Phe 1.6310.24 1.50 ±0.10 1.3810.12 1.52 ±0.03 1.39 ±0.07 1.8610.34 1.75 ±0.05 1.9210.10 Cys 0.37 l 0.02 0.35 ± 0.02 0.29 1 0.02 0.31 ±0.03 0.38 ± 0.01 0.3010.03 0.39 ±0.01 0.42 1 0.04

Om 0.23 1 0.01 0.16 ±0.03 0.26 1 0.03 0.20 ± 0.02 0.20 ± 0.02 1.4310.23 0.34 ±0.03 0.4910.11

Lys 0.28 1 0.01 0.22 ± 0.03 0.2010.01 0.24 ± 0.01 0.19 ±0.02 0.29 1 0.04 0.31 ±0.02 0.32 1 0.03

His 0.74 1 0.06 0.63 ±0.11 0.59 1 0.09 0.66 ± 0.03 0.60 ± 0.06 0.56 1 0.09 0.64 ± 0.07 0.73 1 0.06 Proline and His contents did not change significantly during the 12 h period of the induction experiment; however, higher amounts of Pro were seen at 24 h in plants treated with E or E+Glu, and/or Arg alone (Fig. 8c,d). The peaks of Arg, Thr and Gly did not separate well in our HPLC system (Fig. S2 and Table SI); thus the combined values of these three amino acids are presented here. It should, however, be pointed out that the combined peak represents largely (>90%) of Arg (Data not shown). No significant changes were seen among different treatments except when exogenous Arg was supplied; in this case cellular Arg+Thr+Gly were significantly higher (Fig. 8e).

Ornithine is present in relatively small amounts (<0.5% of total soluble amino acids) as compared to Arg, Glu or Gin in these plants (Tables 9A, 9B). The presence of Orn in the medium did cause a significant increase in the accumulation of this amino acid under un-induced conditions (Fig. 8f). However, on induction of mODC, Orn did not accumulate in the plants, showing its continued utilization by mODC. Exogenous Arg or

Glu did not affect Orn accumulation in the cells even in control plants.

Non-protein amino acid GABA can be produced directly from Glu by GAD or from

Put by DAO (Fig. 1). The carbon skeleton of Glu and Put is recycled through the reactions of the GABA shunt via succinate and the TCA cycle. The cellular content of

GABA increased on induction ofmODC (Fig. 8g). Its content was also higher when the un-induced plants were supplied with exogenous Arg and Glu (at 24 h). The results indicate that Put overproduction may result in concomitant increase in its catabolism to produce additional GABA, which is not processed fast enough via the TCA cycle.

The cellular content of Cys (including cystine) was not affected (Fig. 8h) in a major way by any treatment, except that it was somewhat lower in the presence of Orn

84 (regardless of induction) vs. the other treatments both at 12 h and 24 h. Serine was higher at 24 h in plants treated with E, E+Orn, Om and Glu; the maximum difference was about a 40% increase over the control plants (Fig. 8i).

Neither Phe nor Tip (a small component close to the peak of Leu) was affected by any treatment; Tyr was not resolved in any of our samples by the HPLC method used here

(Fig. 9a, 9b). Of the three branched chain amino acids, Ala was about 8- to 10-fold higher than Val and 15- to 40-fold higher than He in the control plants (Fig. lOa-c). The content of Ala increased significantly during the experimental period of 12 to 24 h in most cases, except in the presence of Om. Even at 12 h, exogenous Om caused a reduction in Ala both in the induced and the un-induced plants. All other treatments showed similar amounts of Ala at a given time. Valine was also lower in the presence of Orn (plus or minus E) 12 h after induction, but higher in Glu and Arg treatments at 24 h; other treatments were not different (Fig. 10b). Isoleucine contents were significantly higher than controls in the presence of E or Arg (un-induced) at 24 h (Fig. 10c).

The Asp family contains six amino acids including lie (discussed above) that utilize

OAA as the C skeleton (Fig. 1); only four of them could be quantified here. Cellular Lys, while lower in the presence of Om (+E) or Arg (-E), showed a small increase in the presence of Glu; there was no major change over time between 12 h and 24 h (Fig. 11a).

Methionine, whose content was the lowest (<0.1% of total) among the PCA-soluble amino acids, did not change much either with time or with treatment (Fig. lib). Since

Asn was added to remove excess dansyl chloride in the dansylation reaction, it could not be correctly quantified; Asp did not get resolved and Thr was a part of the Arg peak.

85 1500 (a) 12 h 24 h 1200 5 i it 900 's) i o i i A E 600 * ft 0) 0. 300

C E Om Glu Arg Om Glu Arg C E Om Glu Arg Orn Glu Arg +E+E+E +E+E+E

10000 (b) 12 1i 24 h 8000 r3 |3 r3E , |3 3 3& r9 fi ri M E, I 1*1 •3= , (3 Eh O) i i O 6000 E c_ - Q! 4000

3 2000 0>

C E Orn Glu Arg Om Glu Arg C E Om Glu Arg Om Glu Arg +E+E+E +E+E+E

Figure 9. Cellular contents of PCA soluble amino acids in 12 h and 24 h induced (+E) and un-induced mODC-10-1 transgenic plants with or without 0.1 mM Orn, 0.5 mM Arg or 1 mM Glu. N= 4; each replicate consists of 6-7 seedlings. * = P< 0.05 for significant difference between treatment and control at a given time.

86 7500

6000

4500 o E 3000 c n < 1500

C E Orn Glu Arg Om Glu Arg C E Om Glu Arg Om Glu Arg +E+E+E +E+E+E

o> o E c_ "3 >

C E Orn Glu Arg Om Glu Arg C E Om Glu Arg Om Glu Arg +E+E+E +E+E+E 250 (c) 12 h 24 h 200 5 u. t 'o> 150 r3E o E 100 r3E i c r] r] A |3 riE i 1 ft ft r3 \ f Ei 50

C E Om Glu Arg Om Glu Arg C E Om Glu Arg Om Glu Arg + E +E +E +E +E +E

Figure 10. Cellular contents of PCA soluble amino acids in 12 h and 24 h induced (+E) and un-induced mODC-10-l transgenic plants with or without 0.1 mM Orn, 0.5 mM Arg or 1 mM Glu. N= 4; each replicate consists of 6-7 seedlings. * = P< 0.05 for significant difference between treatment and control at a given time.

87 250 (a) 12 h 24 h * 200 A 5 i Li 150 * ra i i * o ft E 100 * ft

C E Om Glu Arg Om Glu Arg C E Orn Glu Arg Om Glu Arg + E +E +E +E +E +E

35 (b) 12 h 24 h

^-> 28 ft 5 ft u. ft O) 21 o E 14 c

C E Om Glu Arg Orn Glu Arg C E Om Glu Arg Om Glu Arg + E +E +E +E +E +E

Figure 11. Cellular contents of (a) lysine and (b) methionine in 12 h and 24 h induced (E) and un-induced mODC-10-1 transgenic plants with or without 0.1 mM Orn, 0.5 mM Arg or 1 mM Glu. N= 4; each replicate consists of 6-7 seedlings. * = P< 0.05 for significant difference between treatment and control at a given time.

88 80000 12 h 24 h 70000 ft 60000 ft o E 50000 ft A... c 40000 i/) 4 ft •o 4 & ft "3 30000 £ h&h < o 20000 c £ 10000 < o C E Orn Glu Arg Om Glu Arg C E Om Glu Arg Om Glu Arg +E+E+E +E+E+E

Figure 12. Cellular contents of total PCA soluble amino acids in 12 h and 24 h induced (E) and un-induced mODC-10-1 transgenic plants with or without 0.1 mM Orn, 0.5 mM Arg or 1 mM Glu. N= 4; each replicate consists of 6-7 seedlings. * = P< 0.05 for significant difference between treatment and control at a given time.

89 Total soluble amino acids were slightly higher (1.2-fold) in the induced plants at 12 h of induction as compared to the control plants (Fig. 12). No significant changes were observed among different treatments and control plants at this time. At 24 h, induced plants maintained relatively higher (1.2-fold) amounts of total soluble amino acids as compared to the control. Interestingly, Arg-treated plants showed higher amounts of total soluble amino acids (1.3-fold), although Orn and E+Orn treated plants showed slightly lower amounts of soluble amino acids as compared to the control plants. On the basis of their abundance, the major amino acids in the PCA-soluble fraction were Gin, Arg (+Thr and Gly), Leu (+Trp), Glu, Phe and Ser; all others constituted less than 2% of the total fraction. Among those that varied with Orn treatment were Glu (which increased) and

Arg, Ala, Pro, Val, Cys, and Lys whose relative concentrations were lowered (Tables 9A and 9B). At 24 h, often the changes were more pronounced but showed the same trends.

Inducible expression of mODC: Uptake and incorporation of 14C into PAs

In order to directly measure the activity of mODC in the transgenic plants, and its possible compensatory effects on ADC activity, 14 d-old seedlings were induced with estradiol and immediately supplied with U14C-Orn or Ul4C-Arg, and the incorporation of

14C into the PAs was followed by dansylation and partitioning into toluene (Bhatnagar et al. 2001). The data in Fig. 13a clearly show that induction ofmODC had no effect on the incorporation of U14C-Arg into total PAs, indicating no reduction in Put biosynthesis via the ADC pathway. However, the incorporation of U14C-Orn was several-fold higher in the induced transgenic plants. Some of the isotope incorporation into Pu in the absence of induction is perhaps due to its entry into Put via its conversion into Arg and the ADC pathway. Figure 13b represents the amount of radioactivity retained in the aqueous

90 fraction, which includes unused C-Orn as well as that which may have been incorporated into amino acids, and its catabolic products. Radioactivity in this fraction was generally inversely related to its incorporation into the PA fraction.

While it may appear that in the absence of induction more U14C-Orn was taken up by the seedlings (Fig. 13c), it is also plausible that some of it was incorporated into PCA- insoluble fraction, which was not counted. This radioactivity could be in proteins or in

PA conjugates. No significant difference in radioactivity present in this fraction was observed for U14C-Arg in the induced vs. the un-induced plants.

Constitutive expression of mODC: Polyamines and amino acids in seedlings

The effect of Orn utilization and the accumulation of Put in transgenic plants constitutively expressing the mODC gene (under 35S promoter) were analyzed at the seedling stage as well as in different organs at maturity. Cellular Put content was significantly higher in different transgenic lines but to a variable extent (mQDC-1-7 by

~39-fold, mODC-4-11 by ~50-fold, and mODC-\%-2 by ~24-fold) as compared to the

WT seedlings at 14 d of growth (Fig. 14a). While Cad did not always separate well from

Put (Fig. SI), its peak was obvious in the transgenic plants; Fig. 14a includes combined amounts of Put + Cad. However, Put contributed > 80% of the total area of the Put+Cad peak. No Cad peak was observed in the WT seedlings. Spermidine content did not show a significant change in two of the three lines (Fig. 14b); it was somewhat lower in the third. Spermine was significantly higher (but to a much lesser extent than Put; up to 1.3- fold) in the line mODC-1-7 but lower in the line mODC-\%-2 as compared to the WT seedlings (Fig. 14c). A 7.3-fold and 4.8-fold increase in total PAs was observed in the lines mODC-l-7 and mODC-18-2, respectively vs. the WT seedlings (Fig. 14d).

91 150000 (a) 125000- Toluene fraction

g 100000

r CT 75000 E a. 50000 - •a 25000 -

0 c+Om E+Om C+Arg E+Arg

300000

240000

£ 180000

g 120000 a. •o

C+Orn E+Orn C+Arg E+Arg

600000 (c) PCAe xtra<: t 480000 >Ic 5 360000 u. a> E 240000 a •a 120000

C+Orn E+Om C+Arg E+Arg

Figure 13. Distribution of 14C into polyamines (a), the aqueous fraction (b), and the PCA extract (c) from U14C-Orn or U14C-Arg (given for 8 h following 2 h of induction) in 14 d old mODC-10-1 transgenic seedlings N= 3; each replicate consists of 12-14 plants. * = P< 0.05 for significant difference between un-induced (C) and induced (+E) samples.

92 7500 (a) * > 6000 * ™ 4500 O rfi | 3000 *

3 1500

mODC1-7 mODC4-11 mODC18-2

mODC1-7 mODC4-11 mODC18-2 (c) £ 400

S) 300 O E 200 *

100 * a. V) 0 WT mCOC1-7 mODC4-11 mODC18-2 7500 (d) * ^ 6000 * n » "• 4500 [tl O) * O o i H S 1500 n WT mODC1-7 mODC4-11 mODC18-2 Figure 14. Cellular contents of PCA soluble polyamines in 14 d old WT and 35S::m0ZX7 transgenic plants grown in solid germination medium N= 3; each replicate consists of 7- 8 seedlings. * = P< 0.05 for significant difference between WT and mODC transgenic plants; (a) Put+Cad in case ofmODC plants.

93 Glutamate was the third most abundant amino acid (after Gin and Arg) found in both the WT and the 35S::m<9£>C transgenic seedlings. Of the two transgenic lines analyzed,

Glu was somewhat lower (P=0.06) in the m mO.DC-18-2 vs. the WT seedlings (Fig. 15a), no significant difference was observed between the WT and those of transgenic line 1-7.

It should be pointed out that line 1-7 had 1.6-fold more Put than the line 18-2. Glutamine was the most abundant amino acid in the seedlings, and its content was relatively lower in both the transgenic lines (P= 0.07 for mODC-\-7 and P= 0.09 for mODC-18-2) as compared to the WT (Fig. 15b). Ornithine, which again was among the least abundant of the amino acids, was several-fold lower in both of the mODC transgenic seedlings vs. the

WT plants (Fig. 15c); cellular content of Pro was somewhat higher in the line 1-7 (Fig.

15d). No major differences in His and Arg contents were observed between WT and mODC transgenic seedlings; although both were slightly lower in the transgenic lines

(Figs. 15e, 15f). While the cellular concentration of GABA was significantly higher in the m mODC—\-l line (Fig. 15g) and Cys was generally lower, Ser and Gly were similar in all three genotypes (Fig. 15g-j). With the exception of Met (which was not detected in

WT - Fig. 16a), and Lys and Phe, which were lower in the transgenic plants (Fig. 16b,

16c); all other amino acids only showed minor differences between the transgenic and the

WT plants (Figs. 16d-i).

A small reduction (by -20%) in total soluble amino acids was observed in both of the transgenic lines (Fig. 17). In relative amounts, Gin constituted about 60% of the total soluble amino acid pool in both the WT and the transgenic seedlings, followed by Arg and Glu, respectively; Met and Trp were the least abundant (Table 10).

94 5000 (a) 4000

3000 r*l *

o 2000 E 1000 o 0 WT m0DC1-7 mODC1S-2 wr mCOC1-7 mODC18-2 3000 5 2500 (d) * U. T_ 2000 O E O 1500 c _C 1000 ft £ 500 a. WT m0CC1-7 mODC18-2 wr mODC1-7 mODC18-2 800 7000 700 (e)_ 3 6000 600 u. 500 - 5000 4000 400 — o 300 E 3000 200 •5. 2000 100 ^ 1000 0 0 WT mOOC1-7 mODC18-2 wr mODC1-7 mCOC18-2 2500

2000 (h) 5 rii u'o.> 1500

o 1000 E i. 500 V [ 500 40 20 5 0 o wr mODC1-7 mODC18-2 wr mCOC1-7 mOCC18-2

Figure 15. Cellular contents of PCA soluble amino acids in 14 d old WT and 35S::mODC transgenic plants grown in solid germination medium. Replicates and statistics are similar to Fig. 14.

95 5 300 4 (a) 250 (b) 200 3 * 150 2 100 r*i r*i a 1 50 S 0 n 0 wr mOOC1-7 mODC18-2 wr mOCC1-7 mCOC18-2 200 (c) 150 *

100

0 WT mOOC1-7 mOOC18-2 WT mODC1-7 mOOC18-2 1400 80 1200 (e) rt 3 70 (f) [Tl r3m 60 1000 u. r3 50 800 'oi ft 40 600 o E 30 400 c 20 200 10 0 0 WT mCOC1-7 mOrjC18-2 WT mODC1-7 mOOC18-2 300 300 250 (g) 250 (h) ft 200 r*i 200 [*l * 150 150 ft 100 100 50 50 0 0 WT mODC1-7 mODC18-2 WT mODC1-7 mODC18-2 700 600 (i) 500 r) 400 * [*i 300 200 100 0 WT mODC1-7 mODC18-2

Figure 16. Cellular contents of PCA soluble amino acids in 14 d old WT and 35S::mODC transgenic plants grown in solid germination medium. Replicates and statistics are similar to Fig. 14.

96 Table 10. Contents of different amino acids (as % of total PCA-soluble amino acids) in 14 d old seedlings of WT, mODC-l-7, and mODC-\S-2 grown in solid MS medium (N= 3; each replicate consists of 7-8 seedlings). Numbers (bold= >50% change, others^ 40- 50% change) denote amino acids that are up-regulated and down-regulated respectively.

Amino acid WT mODCl-1 m0DC18-2 Glu 7.09 ± 0.27 8.60 ± 0.95 7.46 ±0.10 Gin 64.41 ±3.17 58.20 ±7.16 62.47 ± 2.47 Ser 3.94 ±0.24 4.71 ±0.26 3.97 ± 0.02 Arg 10.68 ±1.48 9.20 ±1.04 10.16 ±0.58 Thr 0.85 ± 0.08 1.42 ± 0.08 1.15 ±0.04 Gly 2.92 ±0.51 4.93 ± 0.46 3.90 ±0.12 Ala 1.87 ±0.16 3.07 ± 0.26 2.67 ± 0.07 Pro 2.88 ± 0.74 5.03 ± 0.95 3.77 ±0.63 GABA 0.61 ± 0.09 1.23 ±0.11 0.92 ± 0.05 Val 0.41 ± 0.02 0.64 ± 0.04 0.55 ±0.01 Met 0.00 ± 0.00 2.79 ±1.13 0.93 ± 0.08 He 0.11 ±0.00 0.17 ±0.02 0.15 ±0.00 Leu 0.42 ± 0.02 0.54 ± 0.06 0.38 ±0.01 Trp 0.02 ± 0.02 0.01 ± 0.01 0.01 ± 0.01 Phe 0.34 ±0.01 0.38 ±0.01 0.33 ±0.01 Cys 0.25 ± 0.03 0.22 ± 0.03 0.20 ± 0.05 Orn 1.43 ±0.31 0.07 ± 0.01 0.31 ±0.05 Lys 0.41 ± 0.08 0.30 ±0.02 0.29 ±0.02 His 1.35 ±0.14 1.29 ±0.03 1.30 ±0.03

WT mODC17 mODC18-2

Figure 17. Total PCA soluble amino acids in 14 d old WT and 35S::mODC transgenic plants grown in germination medium. Replicates and statistics are similar to Fig. 14.

97 Constitutive expression of mODC: Polyamines and amino acids in mature plants

Constitutive transgenic lines over-producing Put showed delay in flowering as compared to the WT plants. A 7-8 day delay in flowering was observed in the lines 1-7 and 4-11 containing a relatively higher amount of Put, whereas line 18-2 with relatively lower Put content flowered at the same time as the WT plants (Fig. 18). While -90% of the WT and mQDC18-2 plants were flowering by the end of 4-5 weeks, less than 50% of the transgenic plants of the other two lines flowered at 5 weeks. The initial delay in flowering was overcome in the course of time and the transgenic lines 1-7 and 4-11 showed significant increase in vegetative as well as reproductive growth. Both fresh weight (FW) and dry weight (DW) per plant were significantly higher in the transgenic line 4-11 (Figs. 19a, 19b). Moisture (FW-DW) content was also higher in the transgenic lines as compared to the WT plants (Fig. 19a), still an increase in DW was still visible.

The height of the plant, the umber of siliques per plant, and the number of branches per plant were significantly greater in both 1-7 and 4-11 lines (Fig. 19c-e).

While significantly higher chlorophyll a and chlorophyll b contents per mg protein were observed in the line 1-7; a smaller increase (P= 0.07 for chlorophyll a P= 0.19 in chlorophyll b) was observed in the line 4-11 (Fig. 20). Small but significant (P<0.05) increases in total C as well as total N content per plant were observed in the line 4-11, but the differences were not statistically significant (Fig. 21).

Since mODC-l-7 line had higher amount of Put in the seedlings, the T3 plants of this line were grown to maturity and various plant organs were analyzed for their PA and amino acid contents. Whereas the cauline leaves and the siliques showed two-to-three fold higher amounts of Put in the transgenic plants (Fig. 22a), rosette leaves, flower buds

98 Figure 18. Progression of flowering with time in wild type (WT) and three different transgenic lines of 35S::mODC plants.

99 250

WT mODC1-7 mODC4-11 21 * 18 (b) DW 15 rh J. 12 HH c rh JH 9 - g|6 Q £ 3 0 wr mODC1-7 mODC4-11 60 * 50 (c) A a. 40 PH r-tn a(A> 30 |-E- 3 20 55 10 0 i/vr mODC1-7 rrODC4-11 40 E * o (d) i i i 30 1-1 r^E- r

D) 20 '35 10 - c 0 rrODC1-7 mDDC4-11 5 wr c . (e) « 4 a _ w 3 rh r^i a> sz 2 - o rh c 2 1 - m 0 WT mODC1-7 mODC4-11

Figure 19. Comparison of different phenotypic parameters between WT and mODC transgenic plants (a, b= 4 week old plants; c, d, e= 7 week old plants). * = P< 0.05 for significant difference between WT and mODC transgenic plants (N= 9-10).

100 300 D Chl a s 250 • Chi b 2 200 S3. 150 E 100

en 50

WT mODC1-7 mODC4-11

Figure 20. Cellular contents of chlorophyll a and b in rosette leaves of 4 wk-old WT and mODC transgenic plants grown in pots. N= 4; * = P< 0.05 for significant difference between WT and mODC transgenic plants.

7.0

i IT 6.0 - JDC • N 5.0

4.0 r-E-i

Q. 3.0 D) E 2.0 - * 1.0 0.0 m • m WT mODC1-7 mODC4-11 Figure 21. Cellular contents of total carbon (C) and nitrogen (N) in 4 wk-old WT and mODC transgenic plants grown in pots. N=10; * = P< 0.05 for significant difference between WT and transgenic plants.

101 Rosette Cauline Bud Flower Sillque 1600 g 1400 (b) OWT U. 1200 • m0DC1-7 TO 1000 O 800 ^ E 600 c 400 •o a 200 CO :nm ri Rosette Cauline Bud Flower Silique 600 500 * DWT u5. 400 O) O 300

c 200

E 100 Hm0DC1-7 Q. (0 J

Rosette Cauline Bud Flower Silique

Rosette Cauline Bud Rower Silique

Figure 22. Cellular contents of PCA soluble polyamines in different organs of 6 wk-old WT (I I) and mODC-l-7 (HI) transgenic plants. N= 3; each replicate consists of 2-3 individual plants. * = P< 0.05 for significant difference between WT and mODC transgenic plants.

102 and mature flowers did not show significant differences in their Put contents vs. the WT counterparts. Likewise, in most tissues, Spm was higher in the transgenic plants (vs. the

WT) but no difference in Spd was seen (Figs. 22b, 22c). All of the mature organs that were tested contained significant amounts of Cad, which was actually even higher than

Put in almost all organs (Fig. 22d); WT plants had no Cad in any organ Among the different organs, flower buds and mature flowers had the greatest amount of all four PAs, and the transgenic buds (P= 0.10), cauline leaves (P= 0.07), rosette leaves (P= 0.02), and flowers (P= 0.04) had significantly higher total PAs as compared to the WT plants.

Whereas the total soluble amino acid contents were comparable in the leaves, flowers and siliques of the WT and the transgenic plants, total amino acids pool of flower buds was greater in the latter. As with the seedlings, Gin was the most abundant amino acid in all organs but its relative content was generally <40% (Table 11). Glutamate made up almost twice the relative content vs. the seedlings; moreover, while Arg was reduced tremendously, Thr was much greater in mature parts than the seedlings.

The amino acids whose contents were different in transgenic vs. the WT plants in different organs are summarized in Figs. 23 and 24; they include increases in Glu, Gin,

Leu, Val and His in the buds, and Pro and He in the rosette leaves. On the other hand, Glu and Thr in the leaves, Ala in the buds, Orn in the flowers, and Arg, Orn, and His in the siliques were somewhat higher in the WT than the transgenic plants. Notably, Glu content was significantly higher in the buds of the transgenic plants vs. the buds of WT plants (Fig. 23a), but it was significantly lower (than WT) in rosette leaves and siliques of the transgenic plants. Also, while Orn was absent in many organs except siliques and flowers, His was not detected in the rosette leaves and buds of WT plants.

103 Table 11. Contents of amino acids (as % of total PCA-soluble amino acids) in different tissues of 6-week old WT and mODC\-7 plants grown in pots (N= 3; Each replicate consists of tissues from 2-3 plants). Numbers in bold denotes >50% change, and others 40- 50% change.

Amino WT mODC WT mODC WT (Buds) mODC WT mODC acids (Siliques) (Siliques) (Flowers) (Flowers) (Buds) (Rosette (Rosette leaves) Leaves^ Glu 20.47 ±2.31 19.09 ±1.72 11.91 ±1.32 11.17 ±0.33 18.07 ±0.50 13.12 ±0.85 32.35 ± 2.60 28.11 ±2.78 Gin 36.03 ± 4.22 37.43 ± 3.34 34.401 2.31 41.94 ±1.42 36.77 ± 2.55 52.38 ±0.73 16.57 ±1.41 16.76 ±3.59 Ser 6.01 ±1.35 6.94 ± 0.26 6.39 ± 0.46 5.35 ±0.14 6.06 ± 0.44 3.95 ± 0.22 11.14 ±3.04 21.22 ±1.79 Arg 2.68 ±1.40 0.12 ±0.07 0.71 ±0.36 1.44 ±0.07 0.80 ± 0.27 2.52 ±1.21 nd nd Tru 11.41 ±2.16 14.69 ±1.43 6.79 ± 0.33 6.38 ± 0.07 6.00 ± 0.36 3.70 ± 0.49 16.82 ±2.17 9.75 ±0.58 dy 1.57 ±0.28 2.31 ±0.37 5.47 ± 0.21 4.66 ± 0.20 2.51 ± 0.26 2.03 ±0.14 1.41 ±0.50 1.57 ±0.37 Ala 6.40 ± 0.99 7.35 ±0.41 8.72 ±1.41 7.48 ± 0.42 11.17 ±0.42 5.85 + 0.29 8.84 ±1.76 5.22 ±0.34 Pro 2.82 ± 0.56 1.78 ±0.30 6.75 ± 0.69 4.42 ± 0.34 7.29 ± 0.76 4.55 ± 0.67 1.88 ±0.39 3.78 ± 0.59 Gaba 2.11 ±0.73 3.09 ±0.17 3.87 ± 0.44 3.46 ± 0.42 4.51 ± 0.41 2.68 ±0 05 3.08 ± 0.50 2.21 ± 0.50 Val 2.81 ±0.23 2.61 ±0.33 3.51 ± 0.24 3.39 ± 0.04 2.51 ±0.16 2.32 ±0.15 1.89 ±0.48 3.0910.14 Met 0.06 ± 0.01 0.05 ± 0.00 0.14 ±0.04 0.12 ±0.02 0.08 ± 0.00 0.07 ± 0.02 nd nd He 1.79 ±0.22 1.59 ±0.37 2.32 ±0.17 2.24 ± 0.03 1.03 ±0.22 1.36 ±0.33 0.71 ±0.21 1.23 ±0.20 Leu 1.57 ±0.06 1.43 ±0.24 3.80 ± 0.23 3.44 ± 0.06 1.47 ±0.23 1.59 ±0.07 1.51 ±0.39 2.50 ± 0.32 Trp nd nd nd nd nd nd nd nd Phe 0.71 ±0.04 0.83 ± 0.06 1.20 ±0.08 1.23 ±0.07 0.85 ± 0.03 0.62 ± 0.02 2.93 ± 0.29 3.32 ±0.19 Orn 0.12 ±0.02 nd 0.17 ±0.04 nd 0.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.00 Lys 0.88 ± 0.02 0.69 ± 0.06 1.17 ±0.05 0.94 ± 0.08 0.85 ± 0.01 0.64 ± 0.05 1.07 ±0.07 1.22 ±0.11 His 3.86 ± 0.06 nd 3.47 ± 0.39 2.33 ± 0.22 0.00 ± 0.00 2.60 ± 0.44 nd nd 4000 20000 3 ^•^ 3000 16000 u. su. 'oi 12000 2000 o F 8000 1000 e c 4000 O (3 0 Rosette Bud Silique Flower Rosette Bud Silique Flower 1600 (c) (d) 80 5 u. u. 1200 'o> 60 O) o •5 800 E 40 E c c 400 f*l c 20 Iff X I O^ 0 fi 0 Rosette Bud Silique Flower Rosette Bud Silique Flower 3200 1200 (e) (f) u! 2400 900 'ui o 1600 o 600 E E f 800 * O) 300 I- I.! < J Rosette Bud Silique Flower Rosette Bud Silique Flower

Rosette Bud Silique Flower

Rosette Bud Silique Flower Figure 23. Cellular contents of amino acids in different organs of 6 wk-old WT (I I) and mODC-l-7 (^H) transgenic plants. N= 3; each replicate consists of 2-3 individual plants. * = P< 0.05 for significant difference between WT and mODC transgenic plants.

105 500 2700 ,*_*, (a) 400 sLi. 1800 'OJ 300 O o E 200 E c c 900 0 4 nil 0 Rosette Bud Silique Flower Rosette Bud Silique Flower

1600 2500 _^ (e) 2000 E 1200 U£L 'en O) 1500 o 800 o E * "H 1000 cE 3 400 500 t- ^* fl n 0 Rosette Bud Silique Flower Rosette Bud Silique Flower

450 ^••k LL 360 •^ O) 270 O E 180 c 10 90 _>l> 0 Rosette Bud Silique Flower Rosette Bud Silique Flower

Figure 24. Cellular contents of amino acids in different organs of 6 wk-old WT (I I) and mODC-l-7 (BH) transgenic plants. N= 3; each replicate consists of 2-3 individual plants. * = P< 0.05 for significant difference between WT and mODC transgenic plants.

106 Total soluble amino acids were higher in the reproductive organs among which flowers recorded the highest amount as compared to the rosette leaves (Fig. 25). No significant change in total soluble amino acids was observed among different organs except for the buds of mODC transgenic plants that showed significantly higher amount of total soluble amino acids as compared the WT buds.

Exogenous supply of polyamines: Polyamines and amino acids

Since significant differences in some amino acids were seen between the WT and the mODC transgenic plants, it was hypothesized that if the changes in amino acids were due to the presence of high Put, it should be possible to mimic these changes in WT plants by treatment with exogenous PAs. In other words, the question was: will exogenous PA treatments achieve the same effects as the metabolic up-regulation of Put via genetic manipulation? Seeds of WT plants were germinated in the presence of Put, Spd or Spm and seedlings collected after 7 d for analyses of PAs and amino acids.

As shown in Fig. 26a, exogenous Put was accumulated in the WT seedlings up to a level about 50% of that seen in mODC transgenic plants; however, there was no significant change in the cellular Spd content (Fig. 26b) and there was a small reduction in Spm content (Fig. 26c). Treatments with either exogenous Spd or Spm on the other hand resulted in the accuulation of not only the respetive PA but also higher Put was seen in the seedlings. Whether or not it was due to back-conversion of the higher PAs into Put or a reduction in the use of Put to make higher PAs was not investigated.

Among the amino acids in which differences were observed between the control and

Put treated seedlings were decreases in Pro, GABA, Phe and Ala and increases in Gin

(P= 0.10), Orn, Trp and to some extent in Cys+cystine (Figs. 27, 28). Exogenous Spd had

107 _ 40000 L? 35000 J 30000

in •a "o < o Ic < o

Rosette Rower Bud Silique

Figure 25. Total soluble amino acids in different organs of 6 wk-old WT (I I) and mO£>C-l-7 (IHi) transgenic plants. N= 3; each replicate consists of 2-3 individual plants. * = P< 0.05 for significant difference between WT and mODC transgenic plants.

108 1400 1200 (a) rh 1000 at o 800 E 600 c 400 * 200 * 0 n n 1mM Put 1mM Spd 0.5mM Spm 2000 * (b) r-E-i 1500 en O 1000 E •o * Q. 500 (0

1 1 . 1 1 , 1mM Put 1mM Spd 0.5mM Spm

o 1500 E 1000 E Q. 500 CO * * 0 1mM Put 1mM Spd 0.5mM Spm

Figure 26. Cellular contents of PCA soluble polyamines in 7 d old wild type (WT) Arabidopsis plants grown in solid germination medium without any treatment (control; C) and medium supplemented with exogenous 1 mM Put, 1 mM Spd or 0.5 mM Spm. N= 6 (pooled from two independent experiments); each replicate consists of 7-8 seedlings. * = P< 0.05 for significant difference between control and different treatments.

109 1600 5 1400 (a LL 1200 ffl O) 1000 O 800 r6 E 600 400 3 200 O 0 1mM 1mM 0.5m M Put Spd Spm ~. 250 U. 200 (0 D) 150 ± O E 100 rfi c_ c 50 L. O 0 1mM Put 1mM 0.5mM Spd Spm 300 5 250 (e ) * LL 1 'o> 200 Ei O 150 E c_ 100 2 50 a. 0 n 1mM 1mM 0.5m M Put Spd Spm 1600 1400 (g) 1200 ih O) 1000 o 800 E c 600 400 200 to 0 1mM 1mM 0.5m M Put Spd Spm 5 350 *• 300 (i ) K [•£• at 250 * O 200 | 150 ri- <"T 100 DO 50 2 o 1mM Put 1mM 0.5mM Spd Spm

Figure 27. Cellular contents of soluble amino acids in 7 d old wild type (WT) Arabidopsis plants grown in solid germination medium without any treatment (control; C) and medium supplemented with exogenous 1 mM Put, 1 mM Spd or 0.5 mM Spm. N= 3; each replicate consists of 7-8 seedlings. * = P< 0.05 for significant difference between control and different treatments.

110 100 -. 200 * 80 (b) 60 40 rin 20 r*i 0 ImMPut 1mM 0.5m M ImMPut 1mM 0.5m M Spd Spm Spd Spm

^^ 500 w I 400 r*i at 300 o F 200 c n 100 < 0 1mM ImM 0.5m M 0.5m M Put Spd Spm Spm

160 140 * LL (e ) 5 120 LL 'at 100 rt r) 'at o 80 o E 60 E S. 40 H 3 > 20 0) 0 ImMPut 1mM 0.5m M O.SmM Spd Spm Spm

100 80 (h) at 60 ffl O o •^- 40 (*i E E -E- (0 20 s 1mM Put 1mM 0.5mM 1mM Put 1mM 0.5m M Spd Spm Spd Spm

Figure 28. Cellular contents of soluble amino acids in 7 d old wild type (WT) Arabidopsis plants grown in solid germination medium without any treatment (control; C) and medium supplemented with exogenous 1 mM Put, 1 mM Spd or 0.5 mM Spm. N= 3; each replicate consists of 7-8 seedlings. * = P< 0.05 for significant difference between control and different treatments.

Ill little effect on most amino acids, except Orn, Arg+Thr+Gly and Val/Ile were higher in its presence. The effects of Spm were somewhat similar to those of Spd. Exogenous Put increased the amount of total amino acids by ~1.3-fold (FW basis; Fig. 29) whereas Spd and Spm did not have similar effects. As a percentage of the total amino acids content, exogenous Put increased Trp and decreased Pro and Phe (>50%), whereas exogenous

Spm increased the proportion (>50%) of Arg+Thr+Gly, Pro, Leu, Orn and Lys; Spd had a minimal effect on proportions of different amino acids (Table 12).

Constitutive expression of mODC: Extra nitrogen and carbon in the medium

As described earlier, it can be argued that Om is a limiting metabolite for the continued production of Put in the mOZ)C-transgenic plants. Since Orn is largely produced from Glu, whose production requires the continued supply/assimilation of N and C, the following question could be raised: "Will an increased supply of N and/or C in the growth medium allow extra Put to be produced in either the WT or the transgenic plants?" Furthermore, "Will the variation in either N or C availability affect the amino acids pool in the seedlings which are not fully photosynthetic?" Thus an experiment was set up in which both N and C was varied independently in the medium on which seeds of

WT and a transgenic (mODC-l-7) line were germinated and grown for 12 d, at which time the seedlings were collected and analyzed for PAs and soluble amino acids.

The seeds germinated and the seedlings grew quite well on all media except those growing without N in the medium where both the WT and the transgenic seedlings looked pale and weak. Seedlings grown in high sucrose concentrations were darker green as compared to the control seedlings (Fig. 30). The FW and DW of the seedlings were higher with increase in nitrate and sucrose in the medium for both genotypes (Figs. 31).

112 Table 12. Contents of amino acids (as % of total PCA-soluble amino acids) in 7-d old WT seedlings grown in control (C), 1 mM Put, 1 mM Spd and 0.5 mM Spm treated solid GM (N= 3; each replicate consists of 7-8 seedlings). Red= increased, blue= decreased, bold = >50% change.

Amino acid C 1 mM Put 1 mM Spd 0.5 mM Spm Glu 3.53 ± 0.20 2.74 ± 0.29 3.12 + 0.34 3.14 + 0.39 Gin 79.50 ±1.07 83.78 ± 7.95 74.99 ± 5.03 72.12 + 7.39 Ser 2.88 + 0.14 2.89 + 0.19 3.45 + 0.11 4.15 + 0.48 Arg+Thr+Gly 9.71+0.45 7.71+0.57 13.56 + 0.38 14.80+1.64 Ala 1.23 + 0.08 0.67 + 0.04 1.12 + 0.20 1.23 + 0.08 Pro 0.53 ± 0.03 0.13 + 0.01 0.63 ± 0.07 0.82 ± 0.06 GABA 0.62 ± 0.06 0.37 + 0.03 0.77 + 0.11 0.82 ± 0.04 Val 0.30 ± 0.00 0.22 ± 0.02 0.36 + 0.01 0.40 ± 0.03 Met 0.07 ± 0.00 0.05 ± 0.01 0.08 ± 0.01 0.07 ± 0.00 He 0.29 + 0.01 0.30 ± 0.03 0.38 + 0.01 0.40 ± 0.02 Leu 0.04 + 0.01 0.05 ± 0.02 0.05 + 0.01 0.07 ± 0.01 Tip 0.09 ± 0.01 0.16 + 0.01 0.09 + 0.01 0.06 ± 0.01 Phe 0.47 ± 0.03 0.21+0.03 0.42 ± 0.04 0.55 ± 0.03 Cys 0.20 ± 0.02 0.27 ± 0.06 0.22 ± 0.03 0.28 ± 0.08 Orn 0.18 + 0.01 0.18 + 0.01 0.37 ± 0.05 0.55 ± 0.09 Lys 0.13 + 0.01 0.07 + 0.00 0.16 + 0.01 0.22 ± 0.03 His 0.23 ± 0.03 0.19 + 0.03 0.22 ± 0.04 0.32 ± 0.04

113 g. 60000 -"l 50000 CD E 40000 -L I 1 2 30000 rE- * u g 20000

< 10000 3 o n 1mM Put 1mM Spd 0.5mM Spm

Figure 29. Total soluble amino acids in 7 d old WT seedlings grown in solid GM without any treatment (control; C) and GM supplemented with 1 mM Put, 1 mM Spd and 0.5 mM Spm. N= 3; each replicate consists of 7-8 seedlings. *=P< 0.05 for significant difference between control and different treatments.

114 Figure 30. Representative samples of 12 d old WT seedlings grown in GM (C), GM supplemented with 50 mM sucrose and GM without N (w/o N). Similar phenotypes were observed for mODC-l-7 transgenic line in different media.

115 ut E c w

w/o N 30mM 60mM w/o 50mM 100mM KN03 KN03 sucrose sucrose sucrose

0.80 (b) IQWT I D) 0.60 • mODC1-7 * * E

c 0.40 ** ** rm J2 Q. 5 a 0.20 0.00 In^nririri I w/o N 30mM 60mM w/o 50mM 100mM KN03 KN03 sucrose sucrose sucrose

c « a. a5

C w/o N 30mM 60m M w/o 50mM 100mM KN03 KN03 sucrose sucrose sucrose

Figure 31. Biomass (fresh weight - FW, dry weight - DW and DW as % of FW) parameters of 12 d old WT and mODC\-7 transgenic seedlings in response to different concentrations of sucrose and nitrate. *= P< 0.05 for significant difference between treatments and corresponding control within WT and mODC plants (N= 4; each replicate consists of 40-50 seedlings).

116 Sucrose had greater effect on DW than nitrate although the increment of DW (as % of

FW) was slightly higher in the mODC seedlings as compared to the WT seedlings (Fig.

31c). Nitrogen limitation significantly reduced FW and DW in both genotypes as compared to the corresponding controls (GM medium); the mODC seedlings had higher

FW and DW (P= 0.09) than the WT seedlings under N limitation.

As expected, the ODC transgenic line had almost 50-fold higher amount of Put with little change in Spd and Spm (Fig. 32). In the complete absence of N, Put was barely detectable, whereas, Spd and Spm were reduced only by about 50-60% each. Additional nitrate at 30 mM did not affect Put or Spm in the WT seedlings, while there was a significant reduction in Put as well as Spd in both genotypes at 60 mM nitrate; the effect being more pronounced in the transgenic plants. Spermine was either not altered (WT) or increased slightly (transgenics) with increasing N in the medium. In the absence of sucrose, Put was reduced only in the transgenic plants; other PAs showed just small changes if any. However, additional sucrose enhanced the accumulation of PAs in most cases, except at 100 mM in the transgenic seedlings where Put was reduced by >50%.

Significant differences were seen in the amino acids content of the WT and the transgenic plants on the control medium as well as in response to different treatments within each genotype. Among the abundant (>500 nmol.g"'FW) amino acids were Glu,

Gin, Arg, Ser, Ala, and Pro; the ones present in low amounts (<100 nmol.g"'FW) were

Leu, Met, Lys His, Tip, and Orn (Figs. 33A, 33B, 34A, 34B). Ornithine, which was always present in the WT plants, was conspicuously absent in the transgenic plants under almost all conditions. In the absence of N in the medium, most amino acids were present in very small amounts although many plants seemed to have been alive.

117 200

£ 150

CD o 100 E

3 0.

C w/oN 30m M 60m M w/o 10mM 50m M 100mM KNCO KN03 sue sue sue sue 7500 (b) 6000 mODC1-7 ^

4500 o E 3000 c 3 1500 o. I _QJiJ 600 w/oN 30m M 60m M w/o 10mM 50m M 100mM KN03 KNCO sue sue sue sue

460

o E 300 c •o 160 a. CO C w/o N 30mM 60mM w/o 10mM 50mM 100mM KN03 KN03 sue sue sue sue

(d) mODC1-7 LL 'o» O E 160 •o Q. CO l.iillll C w/oN 30m M 60m M w/o 10mM 60m M 100mM KN03 KN03 sue sue sue sue Figure 32. Effects of different concentrations of nitrate and sucrose on PCA soluble polyamines in 12 d old WT and mODC Arabidopsis seedlings grown in solid GM. N= 4; each replicate consists of 7-8 seedlings. * as in Fig. 27.

118 200

C w/oN 30mM 60mM w/o 10mM 50mM 100mM KN03 KN03 sue sue sue sue

200

C w/oN 30mM 60m M w/o 10mM 50mM 100mM KN03 KN03 sue sue sue sue

Figure 32 (continued).

119 As shown earlier, cellular concentrations of Glu and Gin were somewhat lower in the transgenic plants vs. the WT plants, but the differences were often not statistically significant. Higher nitrate in the medium increased Glu content in both genotypes; again the differences were not significant and the transgenic plants had lower Glu. On the other hand higher sucrose concentration in the medium significantly increased Glu and Gin content in the transgenic plants; in the absence of sucrose, a significant decrease in these amino acids was seen (Figs. 33A.a, 33A.b). Ornithine was often below detection limits in the transgenic plants, and changed erratically in the WT plants (up in one experiment and down in the other) with either extra nitrate or sucrose. Histidine was also very low and did not show a major change in response to various treatments (Fig. 33A.d). Cellular Pro, whose content was similar in the two genotypes grown in the control medium, increased with increasing concentrations of both nitrate and sucrose; its relative concentration was slightly higher in the mODC seedlings vs. their WT counterparts (Fig. 33B.a). Also, sucrose had a greater effect on Pro than nitrate especially in the transgenic seedlings.

Either N or sucrose limitation in the medium significantly reduced Pro in both genotypes.

The combined contents of Arg+Thr+Gly were comparable in the two genotypes and varied similarly in response to experimental treatments. While N limitation significantly reduced the amounts of these amino acids in both genotypes; 60 mM additional nitrate also caused a small reduction. Extra sucrose had no major effect on these amino acids except for a small increase in the WT plants. Reduced N and higher sucrose had similar effects on GABA and Ser contents, in that lower N reduced them and higher sucrose enhanced these amino acids in both genotypes (Figs. 33B.C, 33B.d).

120 **> ^ j& „. ^ w ^ > > ^ ^ ** •r # 4? •

at o E c O

at o E c

P* .^

• ^ Figure 33A. Effects of different concentrations of nitrate and sucrose on PCA soluble amino acids in 12 d old WT (•) and mODC-l-7 (•) plants. *= P< 0.05 for significant difference between treatments and control within WT and mODC plants; + represents P< 0.05 for significant difference between WT and mODC plants (N= 3; each replicate= 7-8 seedlings).

121 16000

4? <$£ ^ ^J* c>" .c>~ ^

& £ 4^ ^ / # / • Figure 33B. Effects of different concentrations of nitrate and sucrose on PCA soluble amino acids in 12 d old WT (I I) and mODC-l-7 (HH) plants. For explanation of statistics, see Fig. 33A.

122 Tryptophan was not detected in most cases except for a substantial amount in the 60 mM nitrate treatment in both genotypes (Fig. 34A.a). The presence of extra N in the medium significantly increased Phe content and its absence lowered it in both genotypes

(Fig. 34A.b); sucrose had little effect on this amino acid. Higher sucrose as well as nitrate in the medium significantly increased Ala and Val contents in both WT and mODC plants, and lower N negatively affected them (Figs. 34B.a, 34B.b). While Ala content was more than double in the mODC plants than the WT, and remained higher in all treatments; Val showed less difference between the two genotypes. Extra sucrose positively affected He in both genotypes (Fig. 34B.c). Cellular contents of Met, Lys and

Leu were generally low, and showed smaller variations among the treatments except that

Lys was always lower in the mODC plants (Figs. 34A.c, 34A.d, 34B.d).

123 (a) 5 400 fc LL o» 300 1 o E 200 c_ a 100 nd nd nd nd nd nd g nd nd nd nd nd o* • f f

•3* j3^ A ey tar ^ ^ «• 70 5 60 (C) LL 50 cn 40 o E 30 £_ 20 •** 0) 10 S nd nd nd nd nd nd nd 0 O* Jt & & f f ffSSJ• 225 5 LL 150 at o E »

c^ v^ v^

Figure 34A. See details for Fig. 33A

124

J* # #& cfi jf> ^

J*& #&~ #v A° JT

Figure 34B. See details for Fig. 33A

125 OBJECTIVE 2. The spatial and temporal expression patterns of AtSAMDCs

Cloning of promoter regions

In order to the identity the putative promoter region of each of the three AtSAMDCs, the expression profile of these genes, and the role of their 5'UTRs and ORFs in the regulation of their expression, the technique of promoter: :reporter gene fusion was used.

Three or four different promoterxGC/S fusion constructs were made for each gene that contained the promoter+5'UTR+ORF (translational fusion) or promoter+5'UTR

(transcriptional fusion) or just the promoter or its 5' truncated version of the promoter.

The length of the putative promoter sequence cloned for each gene varied and was based on the location of the neighboring genes upstream of the gene of interest. Selection of deletion at the 5' end of the putative promoter was guided by the presence of cis regulatory elements that were identified by bio informatics analysis of the putative promoter sequence (Table 15-17). For example, four different fragments of AtSAMDCl promoter, named SAMDC3-A, SAMDC3-B, SAMDC3-C and SAMDC3-D (Fig. 35), were

PCR amplified from A. thaliana gDNA using sequence specific primers (Table 8). The products were cloned into pCR8.0/GW/TOPO vector and the insertions were confirmed first by restriction digestion and gel electrophoresis and then by sequencing for correct orientation (Figs. 36-39). They were then moved into the destination vector pMDC163

(containing the reporter GUS gene) through LR clonase reaction (details under Materials and Methods). The final constructs in the destination vector were also confirmed similarly. Agrobacterium tumefaciens strain GV3101 was transformed with the selected plasmids for transformation of A. thaliana plants. Similarly four constructs for

AtSAMDC4 and three for AtSAMDC5 were prepared and analyzed before transformation

126 -2905 ATG SAMDC3-A

SAMDC3-B

SAMDC4-A

SAMDC4-B

SAMDC5-A

SAMDC5-B

SAMDC5-C

Promoter 5TJTR ORF

Figure 35. Different constructs of AtSAMDCS, AtSAMDC4 and AtSAMDCS promoter: :GUS fusion made for analysis of gene expression.

127 .YM-6902-CTCGA

XM-SM9-TCrAC_A £e<«V 5&B-GATATC

A-M-SBO-TCTAG^

5kb

Figure 36. Plasmid maps (A, B) and gel analysis results (C) of SAMDCS-A construct (i) PCR product, (ii) pCR8.0/GW/TOPO digests (Xbal; 719 bp, 6923 bp) with SAMDC3-A insert, and (iii) pMDC163 digests (Xbal; 538 bp, 15492 bp) with SAMDC3-A insert. NEB 2-Log DNA ladder.

^ci-JM-AA'CGJTT Sad-147lS-G_AGCTC

Yfcf-5858-CTCGA C

,iM-'T7ft5-rCrAC_A £aRV-4589-GArA -S«l-ia»7-G AGCTC

fl£ll-4178-AGATC T EaRV - 2632 - GATATC

3kb

Figure 37. Plasmid maps (A, B) and gel analysis results (C) of SAMDC3-B construct (i) PCR product, (ii) pCR8.0/GW/TOPO digests (Bgll+Bglll; 1516 bp, 5083 bp) with SAMDC3-B insert, and (iii) pMDC163 digests (Sad; 4148 bp, 10838 bp) with SAMDC3- B insert. NEB 2-Log DNA ladder.

128 Jad-11798-G_AGCrC Q

XM-1026-CTCGA C

XM-2120-CTCCA G Xkd »41-CT0GA_G

Bgi -Z"7 - C.CCB_™I'UCGC

Figure 38. Plasmid maps (A, B) and gel analysis results (C) of SAMDC3-C construct (i) PCR product, (ii) pCR8.0/GW/TOPO digests (Hpal; 819 bp, 2862 bp) with SAMDC3-C insert and (iii) pMDC163 digests (Hindlll+Xbal; 845 bp, 11224 bp) with SAMDC3-C insert. NEB 2-Log DNA ladder.

Jod-U318-G AGCTC

i/Atll-SM-GTyrAC

EaRl - 671 - © AATTt /fpl-9125-GTTAAC

Hdtll-SMO-GTy'rAC .S>*-8S74-C_CATG'C

Eam-1073-CAA1T C

10 kb 3kb

0.4 kb- 0.5 kb 0.5 kb

Figure 39. Plasmid maps (A, B) and gel analysis results (C) of SAMDC3-D construct (i) PCR product, (ii) pCR8.0/GW/TOPO digests (Hindi; 339 bp, 2862 bp) with SAMDC3-D insert, and (iii) pMDC163 digests (Hpal+Sphl; 551 bp, 11038 bp) with SAMDC3-D insert. NEB 2-Log DNA ladder.

129 of A. thaliana plants by A. tumefaciens; the details of these constructs and their confirmation results are shown in Figures Figs. 40-46. A summary of these constructs is shown in Fig. 35. Each of these plasmids was tested for transient expression of GUS in poplar (Populus nigra x maximowiczii) cells (Bhatnagar et al. 2001) to see if it would produce a functionally active GUS protein.

Follwoing transformation of A. thaliana, the Tl seeds were collected and the putative transformed seedlings selected on hygromycin before being transferred to pots.

Following GUS analysis in excised leaves, several independent T2 transgenic lines were tested for the presence of a single copy of the T-DNA insert (by observing 3:1 segregation of live : dead plants on hygromycin); five of these lines were selected for the production of T3 generation plants. Each line was further tested for homozygosity

(segregation analysis) before further experimental use.

Transient expression

All promoter::GUS constructs shown in Figure 35 along with pCAM-35S::Gf/5'

(CaMV35S::GL'5'; used as control) were tested for transient expression of GUS using biolistic bombardment (Bhatnagar et al. 2001) in poplar cells. The data summarized in

Fig. 47 show that SAMDC4-D plasmid, with the shortest putative promoter region of all constructs, showed the highest transient expression of GUS as compared to the other plasmids used in this experiment; its activity was only slightly less than the control 35S promoter. Overall, all SAMDC4::GUS constructs had higher activity than the other promoters. Activity of SAMDC3 promoter was lower than SAMDC4 promoter; but considerably higher than SAMDC5 promoter constructs.

130 c

Figure 40. Plasmid maps (A, B) and gel analysis results (C) of SAMDC4-A construct (i) PCR product, (ii) pCR8.0/GW/TOPO digests (EcoRV; 342 bp, 4488 bp) with SAMDC4- A insert, and (iii) pMDC163 digests (BgRl+Xhol; 1094 bp, 4699 bp, 7425 bp) with SAMDC4-A insert. NEB 2-Log DNA ladder.

Figure 41. Plasmid maps (A, B) and gel analysis results (C) of SAMDC4-B construct (i) PCR product, (ii) pCR8.0/GW/TOPO digests (Bgll+Bglll; 1625 bp, 2164 bp) with SAMDC4-B insert, and (iii) pMDC163 digests (Bsal; 4490 bp, 7687 bp) with SAMDC4-B insert. NEB 2-Log DNA ladder.

131 5ad-ll7W-G_A(X7TC XM-1026-CTCGA G

,VM-SS92-T"CTAG_A X-M-HM-CTCGA G YM -2«1-CTOGA_C Bgll - 9545 - A'GATC T

Sil-2T"-G«iij«i'BGOC

*gH-1260-A'GATC_T

EaRV-1672- GAT ATC Xbd -1788 - TCTAG_A Q

3kb- .5kb- 1 kb 1.2 kb

Figure 42. Plasmid maps (A, B) and gel analysis results (C) of SAMDC4-C construct (i) PCR product, (ii) pCR8.0/GW/TOPO (Bgtl+BgRl; 1517 bp, 2164 bp) with SAMDC4-C insert, and (iii) pMDC163 digests (Bglll+Xhol; 1094 bp, 3550 bp, 7425 bp) with SAMDC4-C insert. NEB 2-Log DNA ladder.

///irll-SOl-GTy'rAC «p<-501-GTrAAC XM-93U-TCTAC A

&td-W-GGTCIl*'ii*

flffl-2196 COO^nnn'iiCWX: £c<*I-972-G'AATT C

Xbd-1207 TCTAG A Bee -1762 - TGATC A - dam mahjlattd! Bs

Figure 43. Plasmid maps (A, B) and gel analysis results (C) of SAMDC4-D construct (i) PCR product and (ii) pMDC163 digests (Bsal; 3909 bp, 7579 bp) with SAMDC4-D insert. NEB 2-Log DNA ladder. The pCR8.0/GW/TOPO insert did not have appropriate sites for orientation check, hence was confirmed by sequencing.

132 Sad-14092-C AGCTC

Bgl - 5071 - CCQJMII'BCGC,

.Sodl - 2644 - OCCCGG ipJ-1208A'CTAG_1

yat 1525- CCATC_G

«6dUl - 18S - A'AGCT.T iVcd -

Sp*-8S74-G_CATG'C c

2kb 3kb-

Figure 44. Plasmid maps (A, B) and gel analysis results (C) of SAMDC5-A construct (i) PCR product, (ii) pCR8.0/GW/TOPO digests (BgH+Ncol; 2429 bp, 3546 bp) with SAMDC5-A insert, and (iii) pMDC163 digests (Hpal+Sphl; 1044 bp, 13319 bp) with SAMDCS-A insert. NEB 2-Log DNA ladder except for iii, where it is 1 kb DNA ladder.

XM-4090-CTCGA G

Xbd-2937-TCTAG A

2kb

Figure 45. Plasmid maps (A, B) and gel analysis results (C) of SAMDC5-B construct (i) PCR product, (ii) pCR8.0/GW/TOPO digests (Xbal; 1703 bp, 3127 bp) with SAMDC5-B insert and (iii) pMDC163 digests (Spel+Sphl; 919 bp, 12299 bp) with SAMDCS-B insert. NEB 2-Log DNA ladder except for iii, where it is 1 kb ladder.

133 XM-1026-CTCGA G

//ucn-501-GTy'rAC tfpJ-501-GTTAAC XM-9412-rCTAG A XM-2120-CTCGA G Pud-685-TTA ATT.U XM - 2461 - CTCGA G

EaR\-1192- GAT ATC XM-1308-TCTAG A

Figure 46. Plasmid maps (A, B) and gel analysis (C) of SAMDC5-C PCR product. The pCR8.0/GW/TOPO and pMDC163 vectors with SAMDC5-C insert did not have appropriate sites for orientation check, and were confirmed by sequencing. 1 kb ladder. 0.5 kb

U O 3 SX *^ o d z

& J> ^ tT ^ && & J> J>

Figure 47. Transient expression of different constructs of AtSAMDCS, AtSAMDC4 and AtSAMDCS: pCAM-35S as control in poplar cells (C). Each bar represents the Mean + SE number of blue cells from 6 different plates.

134 Within each promoter, different constructs having/missing different regions of the

promoter sequence show that the presence of the 5'UTR or the SAMDC-OKF had rather

variable effects in different promoters. For example, SAMDC4-D with the shortest

promoter sequence, showed maximum transient expression of GUS in poplar; and the

presence or absence of the 5'UTR and/or the SAMDC A ORF did not significantly affect transient expression. The expression under two segments of the SAMDC5 promoter was

very low as compared to the SAMDC4 promoter fragments. The absence of the ORF

increased GUS expression in both SAMDC3 and SAMDC5 and the absence of 5'UTR

increased expression in SAMDC3 promoter. The CaMV35S::G£/5' construct (used as a

control), showed the highest expression of all. Although the absolute numbers of blue

spots varied among plates; overall the relative expression of different constructs within a

promoter was consistent with GUS activity later seen in seedlings and mature plants.

Expression of AtSAMDC3, AtSAMDC4 and AtSAMDCS in seedlings

Five independently transformed (T3 generation) lines were selected for each construct

in order to compensate for the bias due to site of integration of T-DNA or any other

factors that may affect gene expression. Starting at germination, 10 seedlings grown on

GM from each of the 5 transformed lines (in some cases only 3 lines were used) were

collected on days 1, 2, 3, 5, 7, 9, 11, 13, and 15 d and assayed for GUS activity (staining); this provided a total of 30-50 samples for each construct for the first 15 days.

Different translational and transcriptional fusion plants of all three SAMDC genes were used to analyze for the presence of GUS activity at 24 h and 48 h of incubation.

While detailed photographs were taken on all days of analysis (in each case several plants were photographed), only representative pictures are shown here. At 24 h of incubation

135 of the seeds on GM plates in the dark at 4°C, no GUS activity was detected for SAMDC3-

A seeds (Fig. 48). On the other hand, SAMDC3-B seeds showed some GUS staining in the cotyledons at 24 h which spread throughout the germinating seedlings at 48 h except for the roots where only the basal half showed GUS activity. On the other hand, high activity of GUS was seen in SAMDC4-A seedlings (germinating embryos) at the root tip, emerging cotyledons and hypocotyls, and in the seed coat (around the area of radicle emergence) at 24 h (Fig. 48). By 48 h, staining for GUS activity was intense and spread throughout the entire root, cotyledonary veins and surrounding tissues, and also the entire hypocotyl. For SAMDC4-B construct, similar pattern (like SAMDC4-A) of GUS staining was observed at 24 h and a significant increase in GUS activity at 48 h throughout the seedlings without any activity in the root tips. For SAMDC5-A, no activity of GUS was observed at 24 h, although slight blue color was detected in the cotyledons of emerging seedlings at 48 h (Fig. 48). High activity of GUS was observed at 24 h in the seed coat, cotyledons and root vascular tissue with no expression at the root tips for both SAMDC5-

B and SAMDC5-C seedlings. The intensity of GUS staining was higher throughout the seedlings at 48 h for both SAMDC5-B and SAMDC5-C constructs (SAMDC5-B >

SAMDC5-C). Overall the activity of GUS was the highest for AtSAMDC4 translational fusion (SAMDC4-A) as compared to the translational fusions of AtSAMDC3 and

AtSAMDCS. High expression of GUS was seen for different transcriptional fusions for all

SAMDC promoters studied here, AtSAMDC3 showing the lowest activity.

In one-day old seedlings (actual emergence of the radicle at 25°C) of SAMDC3-A, low activity of GUS was localized in the cotyledon veins (Fig. 49). For this construct, the trend of GUS staining was similar during the 15 d growth period where localized activity

136 24 h 48 h

SAMDC 3-A

SAMDC 3-B

SAMDC 4-A

SAMDC 4-B

SAMDC 5-A

SAMDC S-B

SAMDC 5-C

Figure 48. Activity of GUS at early germination stages (24 h and 48 h) in different constructs of AtSAMDCS, AtSAMDC4 and AtSAMDCS transgenic Arabidopsis seeds.

137 SAMDC3-A SAMDC3-B SAMDC3-C SAMDC3-0

11 d

Figure 49. Activity of GUS in 1 d (A1-A4), 3 d (B1-B4), 7 d (C1-C4) and 11 d (D1-D4) old seedlings of SAMDC3-A, SAMDC3-B, SAMDC3-C and SAMDCS-D plants.

138 of GUS was detected mainly in the veins and petioles of the emerging leaves. Removal of

ORF fromth e SAMDC3-B promoter constructs significantly increased GUS activity in all organs except the roots that showed little or no activity throughtout the 15 days of analysis. Deletion of the 5'UTR, also deletion at the 5' end of the promoter, did not further affect GUS staining except that in SAMDC3-C the root vascular tissue showed significant staining.

High activity of GUS was observed in the cotyledons, hypocotyls and root vascular tissue except for root tips of 1 d old (Fig. 50) SAMDC4-A seedlings (translational fusion ofAtSAMDC4). Similar staining was seen during the first 7 d of growth which continued until day 15 d with relatively high expression also being seen in the emerging leaves and shoot apices, lower part of the roots, and secondary root junctions. Deletion of the ORF sequence in the SAMDC4 constructs lowered GUS activity mainly localizing it as patches in the cotyledons and hypocotyls without much activity in the roots (Figs. 50 A2, B2, C2,

D2). At later stages of growth, higher activity of GUS was observed mainly in the newly emerging leaves and secondary root junctions. Removal of the 5'UTR and further deletion of the 5' end of the putative promoter increased GUS activity throughout the seedlings (SAMDC4-C and SAMDC4-D plants), respectively; the activity was higher during the entire 15 d period of seedling growth.

Activity of GUS for AtSAMDC5 promoter low activity in the cotyledons at early stages with gradual increase in activity being localized in the newly emerging leaves, shoot apices, but little activity in the hypocotyls (particularly the upper half), and even less in the roots during the 15 d period of growth (Fig. 51). Removal of ORF (SAMDC5-

B) and 5' deletion of the promoter region (SAMDCS-C) exhibited higher GUS activity in

139 SAMDC4-A SAMDC4-B SAMDC4-C SAMDC4-D

11 dS

V-AO

Figure 50. Activity of GUS in 1 d (A1-A4), 3 d (B1-B4), 7 d (C1-C4) and 11 d (D1-D4) old seedlings of SAMDC4-A, SAMDC4-B, SAMDC4-C and SAMDC4-D plants.

140 SAMDC5-A SAMDC5-B SAMDC5-C

11 d

Figure 51. Activity of GUS in 1 d (A1-A3), 3 d (B1-B3), 7 d (C1-C3) and 11 d (D1-D3) old seedlings of SAMDC5-A, SAMDCS-B and SAMDC5-C plants.

141 the entire seedlings throughout the 15 d growth period. For translational fusion, while

AtSAMDC4 showed high activity of GUS throughout the seedlings, similar constructs of

AtSAMDC3 and AtSAMDCS showed lower activity; and it was mainly localized in the cotyledons and veins with little or no expression in the roots. Transcriptional fusions on the other hand had higher GUS activity in most cases except for AtSAMDC4. Deletion of the 5' regions of the promoters did not equally/similarly affect GUS activity in all cases at the seedling stage.

Expression of AtSAMDCS, AtSAMDC4 and AtSAMDC5 in mature vegetative organs

Typically different organs of mature plants at 5 weeks of age were analyzed for presence of GUS activity by reacting with X-Gluc reaction mix. At least three independently selected transgenic lines (with 4-5 plants from each line) per construct were used. Pictures of representative data are shown in Figs. 52-54.

In 5-week old transgenic SAMDC3-A plants, little or no GUS activity was observed in the roots, with low staining in the rosette or cauline leaves, which was largely restricted to the leaf or petiole vasculature (Fig. 52). However, there was relatively high GUS activity at the rosette junctions (Fig. 52 Bl). Relatively high staining for GUS activity was observed in majority of the organs of SAMDC 3-B plants, showing that the presence of the ORF had a negative effect on GUS expression/activity. Removal of the 5'UTR in

SAMDC3-C and SAMDC3-D (also partial deletion of the promoter sequence) resulted in substantial increase in GUS staining in the leaves besides high activity in the roots.

Rosette leaf junctions always had high GUS activity.

The SAMDC4-A::GUS plants showed high GUS activity in the rosette leaves

(particularly in the veins of both the lamina and the petioles), rosette leaf junctions, roots

142 Roots

Rosette junctioi

Rosette leaf

Cauline leaf

Figure 52. Activity of GUS in different vegetative organs of 5 wk old SAMDC3-A, SAMDCS-B, SAMDCS-C and SAMDC3-D transgenic plants.

143 and rather low activity in the cauline leaves (Fig. 53). The staining for GUS was

relatively low in the majority of the organs of SAMDC4-B plants as compared to

SAMDC4-A plants except for the cauline leaves where GUS activity was relatively higher

than SAMDC4-A cauline leaves. Removal of 5'UTR and partial deletion of the 5' end of

the promoter (SAMDC4-C and D) increased GUS activity in leaves and roots in addition

to high staining at the rosette junctions.

Activity of GUS in SAMDC5-A plants was low in the roots and none in the cauline

leaves; but staining was seen in the veins of rosette leaves (more so in the younger

leaves) and at the rosette junctions (Fig. 54). The staining of GUS was higher in all

organs (particularly in the roots for SAMDC5-B, and rosette leaves, petiole veins and

rosette junctions for both SAMDCS-B and SAMDCS-C plants; also some activity in the

cauline leaves) when 5'UTR and/or 5'UTR+ORF were deleted.

Expression of AtSAMDC3,AtSAMDC4 and AtSAMDCS in reproductive parts

The activity of GUS was very low in the SAMDC3-A flowers overall; it was mainly

localized in sepal veins, petals, the filaments and the receptacle (Fig. 55). In the flowers

of SAMDC3-B (plus 5'UTR but no ORF) plants GUS activity increased significantly in

the same organs, still with no expression in the anther sacs or the ovary wall. In

SAMDC3-C and SAMDC-D constructs, further (than SAMDC3-A and B) increase in GUS

staining was observed, again without change in the organ type. In the developing siliques,

GUS was mainly localized in the pedicel and valve junction of SAMDC3-A and

SAMDC3-D plants, whereas for SAMDC3-B and SAMDC3-C considerable GUS activity was seen in the valves and pedicels of developing siliques. No activity of GUS was detected in the developing embryos of SAMDC3-A and SAMDC3-D plants, whereas light

144 SAMDC4-A SAMDC4-B SAMDC4-C SAMDC4-D

Roots

Rosette junction

Rosette leaf

Cauline leaf

Figure 53. Activity of GUS in different vegetative organs of 5 wk old SAMDC4-A, SAMDC4-B, SAMDC4-C and SAMDC4-D transgenic plants.

145 SAMDC5-A SAMDC5-B SAMDCS-C

Roots

Rosette junction

Rosette leaf

Cauline leaf

Figure 54. Activity of GUS in different vegetative organs of 5 wk old SAMDC5-A, SAMDCS-B and SAMDC5-C transgenic plants.

146 SAMDC3-A SAMDC3-B SAMDC3-C SAMDC3-D k3

Silique

Flower /

Pollen

Embryo

Stigma

Figure 55. Activity of GUS in reproductive parts of SAMDC3-A, SAMDCS-B, SAMDC3- C and SAMDC3-D plants.

147 GUS staining was observed in the cotyledons of developing embryos. High GUS activity was also seen in the upper part of the ovary including the base of the stigma, except in

SAMDC3-A plants.

Reproductive tissues and organs showed high activity of GUS in the inflorescence stalks and unopened flower buds of AtSAMDC4::GUS plants. In SAMDC4-A mature flowers, the intensity of GUS staining was highest in the stamens particularly in the filaments (with only a little expression in the anther sacs/pollen) and in the sepals; (Fig.

56). Stigma and receptacle also showed higher GUS activity but ovary wall had little staining. In sepals, the vascular tissue stained darker than the surrounding cells; in contrast, very low activity of GUS was detected in the petal veins. In SAMDC4-B flowers high activity of GUS was observed in all flower parts with some activity being seen in the anther sac cells but not in pollen. Removal of 5'UTR increased overall GUS activity in

SAMDC4-B and SAMDC4-C flowers with the presence of GUS activity in the pollen grains/microspores. In the developing siliques, GUS activity was mainly localized in the valves and pedicels. High activity of GUS was observed for all SAMDC4 constructs throughout the developing embryos cotyledons. Overall, the GUS expression/activity for

SAMDC4::GUS constructs was relatively more pronounced and widespread than the

SAMDC3::GUS constructs.

Unlike the SAMDC4::GUS plants, the flowers of SAMDC5-A::GUS plants showed only a little or no GUS staining in any part (Fig. 57); the intensity of GUS staining was higher in the other two constructs of this promoter (SAMDCS-B and SAMDC5-C). The

SAMDCS-Bv.GUS and SAMDC5-C:\GUS flowers mainly showed staining in the sepals, filaments, stigma, petals and receptacle, with very little expression in the petals or pollen

148 SAMDC4-A SAMDC4-B SAMDC4-C SAMDC4-D

i2 A3 A4

Silique

Flower

Pollen

Embryo

Stigma

Figure 56. Activity of GUS in reproductive parts of SAMDC4-A, SAMDC4-B, SAMDC4- C and SAMDC4-D plants.

149 SAMDC5-A SAMDC5-B SAMDC5-C

Silique

Flower

Pollen

Embryo

Stigma

Figure 57. Activity of GUS in reproductive parts of SAMDCS-A, SAMDCS-B and SAMDC5-C plants.

150 grains. No activity of GUS was detected in the siliques or embryos of SAMDC5-A plants,

whereas relatively high activity was seen in the valves, receptacle as well as upper part of

the ovary and the base of stigma in SAMDCS-B and C plants. Low levels of GUS activity

were also seen in the developing embryos in SAMDC5-B and SAMDCS-C plants.

Bioinformatics analysis of regulatory motifs in the promoter regions of AtSAMDCs

Bioinformatics analysis of the cloned putative promoter regions of all five SAMDC

genes in Arabidopsis revealed the presence of several commonly recognized cis-

regulatory motifs (transcription factor binding sites) in most of them; the details of their

specific names, sequences of these motifs, location within the promoter region, and their

general regulatory functions are listed in Tables 13-17. The promoters of AtSAMDCl and

AtSAMDC2 (not studied for expression here) contained GAREAT and GADOWNAT

(GA responsive elements) motifs, CACGTG, MYB1AT and MYB4, and Box II motifs

(light responsive element). Presence of several common stress-response motifs; e.g.

ABRE-like, cold stress, and MYB1AT (dehydration response) were also found in these

genes. The unique motifs in AtSAMDCl promoter sequence are W box (pathogenic

response and wounding), Z box (developmental expression) and MYB binding site

(developmental and stress). On the other hand promoter sequences of AtSAMDCl shows

presence of CARGCW8GAT (AGL-15 site, regulating embryogenesis), I box (light response), RAV1-B (DNA-binding protein), MYCATERD1 (early response to dehydration) and AtMYC2 BS in RD22 (dehydration responsive element). Besides

sharing common motifs in the promoter regions associated with abiotic stresses and developmental regulations among different SAMDCs, AtSAMDC4 and AtSAMDCS showed presence of auxin binding site factors motif (ARF).

151 Table 13. Putative cis elements in the AtSAMDCl promoter sequence (analyzed using Athena promoter analysis software, O'Connor et al. 2005) showing consensus sequences, binding sites, and physiological responses of the identified elements.

Motif name Consensus Binding sites Physiological responses sequence ABRE-like binding site motif CACGTGTC -433 to -426 Dehydration, low temperature ACGTABREMOTIFA20SEM ACGTGTC -432 to -426 ABA responsive expression Boxll promoter motif GGTTAA -414 to -409 light activation CACGTGMOTIF CACGTG -433 to -428 essential for beta phaseolin gene expression during embryogenesis GADOWNAT ACGTGTC -432 to -426 GA down regulated expression during seed germination GAREAT TTTGTTA -282 to -276 GA induced seed germination MYB binding site promoter CACCTACC -230 to -223 Flower specific motif MYB1AT TGGTTA -415 to-410, drought responsive element -644 to -639 MYB4 binding site motif ACCTACC -229 to -223 drought, salt, cold, wounding TATA-box Motif TATAAA -127 to-122, Transcription -66 to-61,-384 to -379 W-box promoter motif GGTCAA -108 to-103, Wounding response -657 to -652 Z-box promoter motif ACACGTAT -449 to -442 light independent developmental expression

Table 14. Putative cis elements in the AtSAMDC2 promoter sequence (analyzed using Athena promoter analysis software, O'Connor et al. 2005) showing consensus sequences, binding sites, and physiological responses of the identified elements.

Motif name Consensus Binding sites Physiological responses sequence ABRE-like binding site motif CACGTGTA -458 to-451, dehydration, low temperature and -267 to -260, TCCACGTG -269 to -262 ACGTABREMOTIFA20SEM ACGTGTC -478 to -472, ABA responsive expression -288 to -282, -266 to -260 CACGTGMOTIF CACGTG -458 to -453, essential for beta phaseolin gene -267 to -262 expression during embryogenesis GADOWNAT ACGTGTC -478 to -472, GA down regulated expression -266 to -260 during seed germination GAREAT TAACAAG -665 to -659, GA induced seed germination -621 to-615 1 box promoter motif CTTATC -333 to -328 light regulated expression MYB1AT TGGTTA -729 to -724 dehydration MYB4 binding site motif ACCAAAC -687 to -681 drought, salt, cold, wounding RAV1-B binding site motif CACCTG -513 to-508 domain for DNA binding protein TATA-box Motif TATAAA -31 to -26 transcription

152 Table 15. Putative cis elements in the AtSAMDC3 promoter sequence (analyzed using Athena promoter analysis software, O'Connor et al. 2005) showing consensus sequences, binding sites, and physiological responses of the identified elements.

Motif name Consensus Binding sites Physiological sequence responses

AtMYB2 BS in RD22 CTAACCA -665 to-659 drought and ABA

MYB binding site AACCTAAC -2655 to -2648 flower specific motif promoter GTTTGGTT -238 to -231 SV40 core promoter CAATCCAC -503 to -496 enhancer motif CTAACCAC -665 to -658 MYB1AT TAACCA 664 to -659 drought responsive TGGTTT -715 to-710 element TGGTTA -1485 to-1480 TGGTTT -2376 to -2371 GAREAT TTTGTTATTTGTA -1195 to-1189 GA induced seed -2271 to -2265 germination TATA-box Motif TATAAA -2343 to -2338 transcription TATAAA -484 to -479 TTTATA -408 to-403 TTTATA -555 to -550 TTTATA -1336 to-1331 TTTATA -1840 to-1835 TTTATA -2692 to -2687 DREB1A/CBF3 GCCGACTT -2970 to -2963 drought response

MYB2AT TAACTG -2894 to -2889 drought responsive TAACTG -2310 to-2305 element CAGTTA -1473 to-1468 ATHB2 binding site TAATTATTA -1905 to-1897 environmental stresses motif TELO-box promoter AAACCCTAA -1328 to-1320 root specific expression motif TTAGGGTTT -127 to-119 TTAGGGTTT -161 to-153 CARGCW8GAT CAATAAAATGCTA -2571 to -2562 ABA- mediated TTATATGCTAATTT -975 to -966 inhibition of seed AAGCI ITT FA I IG -877 to-868 germination CI I II lATTGCTAA -25 to -16 TTTAAGCTATTAT -25 to -16 ATGCAATAAAATG -877 to -868 -975 to-966 -2571 to -2562 DRE core motif GCCGACGCCGAC -2970 to -2965 drought, salt and -1627 to-1622 freezing

153 Table 15. (continued)

Motif name Consensus sequence Binding sites Physiological responses MYB4 binding site ACCTAAC -2654 to -2648 drought, salt, cold, motif AACAAAC -1722 to-1716 wounding AACAAAC -1105 to-1099 AACAAAC -729 to -723 GTTTGTT -156 to-150 GTTTGGT -238 to -232 GTTTGTT -281 to -275 CCA1 motifl BS in TAGATTGTTT -563 to -554 phytochrome CAB1 regulation W-box promoter TTGACTAGTCAA -206 to -201 wounding response motif -2739 to -2734 CCA1 binding site AGATTGTTAGATTGTT -243 to -236 phytochrome motif -562 to -555 regulation L1-box promoter TAAATGTA -588 to -581 layer specific gene motif expression l-box promoter motif GATAAG -1408 to-1403 light regulated expression GCC-box promoter GCCGCC -1630 to-1625 dehydration and motif low temperature RY-repeat promoter CATGCATG -572 to -565 seed protein motif CATGCATG -572 to -565 related Hexamer promoter CCGTCGCGACGG -2975 to -2970 histone protein motif -2888 to -2883 related CACGTG-motif CACGTG -1206 to-1201 essential for beta phaseolin gene expression during embryogenesis

154 Table 16. Putative cis elements in the AtSAMDC4 promoter sequence (analyzed using Athena promoter analysis software, O'Connor et al. 2005) showing consensus sequences, binding sites, and physiological responses of the identified elements.

Motif name Consensus Binding sites Physiological sequence responses

ARF binding site GAGACA -720 to-715 auxin responsive motif GAGACA -843 to -838 element Boxll promoter TTAACC 182 to-177 Transcriptional motif TTAACC -361 to -356 activator MYB1AT AAACCA -980 to -975 drought responsive AAACCA -515 to-510 element TAACCA -360 to -355 MYB1LEPR AACTAAC -434 to -428 defense related gene expression MYB4 binding AACTAAC -434 to -428 drought, salt, cold, site motif wounding RAV1-B binding CACCTG -423 to-418 DNA binding site motif domain T-box promoter ACTTTG -564 to -559 transcriptional motif activator TATA-box Motif TATAAA 402 to -397 transcription TATAAA -139 to-134 TTTATA -684 to -679 W-box promoter AGTCAA -528 to -523 wound response motif

155 Table 17. Putative cis elements in the AtSAMDCS promoter sequence (analyzed using Athena promoter analysis software, O'Connor et al. 2005) showing consensus sequences, binding sites, and physiological responses of the identified elements.

Motif name Consensus Binding sites Physiological sequence responses

ARF binding site TGTCTC -531 to -526 auxin responsive motif element AtMYC2 BS in CATGTG -862 to -857 RD22 CATGTG -1359 to-1354 Boxll promoter GGTTAA -1672 to-1667 transcriptional motif GGTTAA -1354 to-1349 activator TTAACC -382 to -377 TTAACC -1352 to-1347 CARGCW8GAT CTATTTATTG -2222 to-2213 ABA- mediated CAAI I I I I IG -780 to -771 inhibition of seed CI I IIATAAG -96 to -87 germination CI I IIATAAG -96 to -87 CAAII I I I IG -780 to -771 CTATTTATTG -2222 to-2213 CCA1 binding site AAAAATCT -187 to-180 phytochrome motif regulation E2F binding site TTTCCCGC -933 to -926 cell cycle regulation motif GAREAT TAACAAA -877 to -871 GA induced seed CTTGTTA -899 to -893 germination

l-box promoter motif GATAAG -2354 to -2349 light regulated CTTATC -996 to -991 expression CTTATC -1209 to-1204 CTTATC -1383 to-1378 MYB binding site GTTAGGTG -493 to -486 flower specific motif promoter GTTTGGTG -2304 to -2297 MYB1AT TGGTTA -1355 to-1350 drought responsive TGGTTT -1644 to-1639 element TGGTTA -2104 to-2099 MYB1LEPR GTTAGTT -599 to -593 defense related gene expression MYB2AT TAACTG -2359 to -2354 drought responsive TAACTG -2030 to -2025 element MYB4 binding site GTTAGGT -493 to -487 drought, salt, cold, motif GTTAGTT -599 to -593 wounding GTTTGTT -1548 to-1542 GTTTGGT -2304 to -2298 MYCATERD1 CATGTG -1359 to-1354 signal transduction CATGTG -862 to -857 RAV1-B binding site CAGGTG -2205 to -2200 DNA-binding motif RY-repeat promoter CATGCATG -1363 to-1356 seed protein related motif CATGCATG -1363 to-1356

156 Table 17. (continued) Motif name Consensus Binding sites Physiological sequence responses

T-box promoter ACTTTG -702 to -697 transcriptional activator motif CAAAGT -553 to -548 CAAAGT -2456 to -2451 TATA-box Motif TATAAA -1251 to-1246 transcription TTTATA -94 to -89 W-box promoter AGTCAA -1614 to-1609 wound response motif

157 Comparison of 5'UTR among different SAMDC genes in Arabidopsis

Sequence analyses of Arabidopsis SAMDC cDNAs/genes show that AtSAMDCl,

AtSAMDC2 and AtSAMDC3 have relatively larger 5'UTR ranging from 876-1106 bp,

whereas AtSAMDC4 has shorter 5'UTR of 108 bp in length and AtSAMDCS has

extremely small 5'UTR of 12 bp long (Table 4). The presence of highly conserved

overlapping 'tiny' and 'small' uORFs, an important characteristic of plant SAMDCs

(Franceschetti et al. 2001; Hao et al. 2005; Tassoni et al. 2007; Wang et al. 2010), is seen

in the 5'UTRs of AtSAMDCl and AtSAMDC2; the last base of the stop codon of the tiny

uORF is the first base pair of the start codon of the small uORF (Franceschetti et al.

2001; Hanfrey et al. 2005). Sequence analyses of the 5'UTRs of different Arabidopsis

SAMDCs reveal that while the length of the tiny uORFs is 12 bp, and the small uORF

length varies from 156 to 168 bp (Table 7). The location of the tiny and small uORFs

varies between 553-865 bp downstream from the transcription start site in AtSAMDCl,

AtSAMDC2 and AtSAMDC3 genes. AtSAMDC3 contains only small uORF in its 5'UTR,

whereas AtSAMDC4 and AtSAMDCS do not have a uORF in their 5'UTRs. Although

AtSAMDC4 and AtSAMDCS promoters do not have a uORF, yet removal of 5'UTR

increased GUS expression by them.

QRT-PCR of AtSAMDC gene expression

In order to establish (1) if the promoter::GUS fusion results revealed a similarity with the actual transcript levels of the respective genes in the plants for various SAMDC genes, and (2) to select the construct(s) that would mimic the actual expression of a particular

SAMDC gene, QRT-PCR analysis was done for each gene in selected organs of WT plants. Relatively high and comparable levels of transcripts were observed in seedlings at

158 initial stages (e.g. 2 d after germination) for all four SAMDC genes (Fig. 58A); however by 10 d after germination, the seedlings started to show differences, particularly for the

AtSAMDCl gene, whose relative expression was about half that of the other three (Fig.

58B). In 5-week old plants, relatively high expression of AtSAMDCl was observed in all organs with slightly higher expression in the siliques and lower stems (Fig. 58C). The expression of AtSAMDC2 was also relatively high in the buds, siliques and lower part of the stem, and low in the upper part of the stem. The highest relative expression among the four genes was observed for AtSAMDC4 whose transcripts were 2 to 7-fold higher than other SAMDC genes, particularly in the root and the lower stem.

159 SAMDC 1 SAMDC2 SAMDC3 SAMDC4 2dpg old seedling

§1-4 (B) 8 1-2 i L a. ' s^il X > Illill "\m ^SM o 0.8 *

> ^SP•:« S ijgi € 0-2 re aw9 'SjffB £ o J 1 \v*^w SAMDC1 I5AMDC 2 SAMDC3 SAMDC4 10 dpg old seedling

8 T (C) - 0 SAMDC1 • SAMDC2 * DSAMDC3 - DSAMDC4 6

•2 B £ i

"NT .fwn.PkT ,T * .H ,01 ,11" RL CL Root Flowor Bud Silique LS US

Figure 58. Relative expression of the four AtSAMDC genes in WT Arabidopsis (A = 2 d, B = 10 d and C= 5 week) plants. The expression of target gene was normalized to AtTIP41. RL= rosette leaf, CL= cauline leaf, LS= lower stem, US= upper stem (N=4).

160 DISCUSSION

Objective 1 - Transgenic manipulation of PAs

Genetic manipulation of PA metabolism has often been targeted to understand their role in growth and development, and stress tolerance. Mutations (to some extent) as well as transgene expression (more often) have been used for this purpose. Most studies on transgene expression have used constitutive promoters. A major limitation in studies that employ constitutive over-expression of transgenes is that the metabolic system under investigation is often homoeostatically regulated even under elevated condition of the product, e.g. Put in the present case. Thus it is not feasible to analyze the impact of short- term metabolic perturbations, and responses of the cells to increased production of the metabolite. On the other hand, in most cases of natural responses of a plant to environmental or developmental stimuli, short-term changes are perhaps more common, and probably the most critical events in its life. In this regard inducible transgenic expression systems permit us to mimic turning on a gene as it would happen in nature; this control should provide us a deeper insight regarding the effect of transient (short term) expression of genes, and consequently, quick changes in cellular metabolic fluxes.

For example, over-expression of a number of heterologous genes encoding regulatory enzymes has been used to achieve genetic manipulation of plant metabolism with the assumption that their substrates may not be limiting (Galili and Hofgen 2002; Goff and

Klee 2006; Schnee et al. 2006, Bartels and Hussain 2008). With respect to PAs,

161 expression of ODC has often resulted in small (often <5 fold) increase in Put content in transgenic plants; rarely has it been considered that the results may be regulated more by the substrate (Orn) than the expression of the transgene. Moreover, we do not understand the regulation of Orn metabolism and its role in controlling the biosynthesis of PAs and other amino acids in plants, while a number of studies have been reported in animals

(Morris 2006, 2007). Since the PA biosynthetic pathway is intricately tied to amino acid biosynthesis, it can be argued that overutilization of Orn by transgenic ODC may have major effects on amino acids, particularly those whose biosynthesis depends upon Glu

(Page et al. 2010; Mohapatra et al. 2010b). Under these circumstances, the effects of short-term induction of ODC may be substantially different from those of constitutive overexpression due to homeostatic regulation of the amino acid biosynthetic pathways. A major objective of the current study was to examine the role of substrates like Orn and

Arg, and their precursor Glu, in regulating PA metabolism as well as the metabolism of amino acids. The effects of additional supply of C and N on PA and amino acid metabolism under conditions of constitutive ODC expression were also analyzed.

Up-regulation of Put biosynthesis through over-expression of ODC under 35S promoter has been reported in many plant species (Table 3A); another constitutive promoter that has been used for transgenic ODC or ADC expression is maize Ubi-1 promoter (Noury et al. 2000; Capell et al. 2004). In most cases ~2- to 3-fold increase in

Put content, with or without significant changes in Spd and Spm, were seen except for a

6- and 10-fold increase of Put in rice seeds (ODC and ADC expression, respectively), and a 4- to 12-fold increase in Arabidopsis with AtADCl overexpression. Masgrau et al.

(1997) demonstrated that transgenic expression of an oat ADC in tobacco under the

162 control of a tetracycline-inducible promoter increased cellular content of Put only by 16 to 46% upon induction, with little change in Spd and Spm. The induced plants showed leaf chlorosis and necrosis, short internodes, thinner stem, and reduced root growth. The severity in phenotype was correlated with the amount of Put accumulation upon ADC induction. On the other hand, in animals, inducible (tetracycline) transgenic expression of mODC in HEK293 embryonic kidney cells and LNCaP prostate cells showed > 100-fold increase in ODC activity in the latter, with > 10-fold increase in Put (Wilson et al. 2005).

Highest level of ODC induction was accompanied by a decrease in Spd and Spm levels with a concomitant increase of Spd/Spm N'-acetyltransferase (SSAT) activity by >40- fold. Growth of the cells was unaffected during the 12 h period of ODC induction. In the present study, up to 50-fold increase in Put was observed in the transgenic plants both under constitutive and inducible expression conditions. Surprisingly, no major phenotypic changes were observed except for a few discussed below.

Since A. thaliana does not have its own ODC gene (Hanfrey et al. 2001), one can hypothesize that Arg may be a limiting substrate for Put biosynthesis in this plant. The two ADCs (AtADCl and AtADCl) seem to contribute equally to the production of Put in different parts of the plant, except for a few situations where the expression of one is dominant over the other. However, my results clearly show that in the mODC transgenic plants, large amounts of Put are produced from Orn by mODC without impacting its production from Arg by ADC. Moreover, Orn is present in rather small amounts in the seedlings and quickly becomes limiting for still further increases in Put since exogenous supply of Orn stimulated Put accumulation. At the same time, it was found that Glu is not a limiting for Orn production, and its conversion (through Om) into Arg also continues to

163 occur unabated. Two additional metabolic revelations are that Put does not show a feedback inhibition of its biosynthesis via the native ADC pathway, and that the limitation of Arg itself is not responsible for low Put content in the normal life of the plant. These conclusions are consistent with earlier reports from our lab with mODC transgenic poplar cells (Bhatnagar et al. 2001; Mohapatra et al. 2010a,b). Overall, the elevation of cellular Put (which does not have concomitant effects on Spd and Spm accumulation) has rather small effects on plant morphology, development and flowering pattern (see discussion below). These observations show a remarkable homeostatic tolerance for high Put in Arabidopsis, and are in line with previous reports of similar tolerance for high Put in plants (Mayer and Michael 2003; Alcazar et al. 2005; Nolke et al. 2008). Bhatnagar et al. (2001) had reported that increased Put production via transgenic ODC in poplar cell cultures was accompanied by its increased catabolism

(Bhatnagar et al. 2002), which ultimately limited its infinite increase. A similar situation is envisioned for Arabidopsis although it has yet to be experimentally confirmed. In poplar cells also, (i) Orn was present in extremely low concentrations, (ii) ADC pathway was not negatively impacted by high Put, and (iii) neither Glu nor Arg were limiting for

Put production from Orn by ODC (Page et al. 2010, Mohapatra et al. 2010a, b).

The conclusion that Orn availability is the limiting factor as opposed to Arg or Glu is directly supported by the observed increase in Put production on induction and supply of

Orn, beyond induction alone; this was not the case for un-induced seedlings (Fig. 7) or for seedlings that were exogenously supplied with Arg or Glu. Similar increases were seen in the case of constitutive over-expression of mODC. The fact that increase in Put varied with developmental stages and organ type, shows that the amount of available Orn

164 may be different in different tissues/organs and or the transgene expression itself was tissue/organ dependent, even though it was regulated by a constitutive promoter. Under conditions of induction with estradiol, a ~10-fold increase in Put was seen, whereas up to a 40-fold increase in Put was seen in the presence of the inducer + Orn. The effect of Orn was more pronounced at 24 h than at 12 h after induction of mODC; this indicates the possibility of homeostatic upward adjustment in Orn production in the transgenic plants with time as the demand for Orn increased or its cellular content decreased. In addition, the transgenic plants always had substantial amounts of Cad both under constitutive and inducible expression. This observation further supports the argument that Orn is not available in sufficient quantities to tranegnic mODC, which then uses Lys as a substrate

(albeit it's high Km for Lys), which is well documented for mammalian ODC (Pegg and

McGill 1979). Further investigations involving the feeding of ,4C-Orn and 14C-Arg showed significant incorporation of 14C in PAs upon induction, leading us to deduce that the two substrates were being used independently by mODC and ,4fADC, respectively. It can further be argued that there is little conversion of Arg into Orn in Arabidopsis as was as was the case in poplar cells (Bhatnagar et al. 2001; Mohapatra et al. (2010b).

Constitutive as well as inducible expression ofmODC in seedlings showed significant increase in Spm (but rather low magnitude vs. that for Put) but no increase in Spd; actually it was often lower in the transgenic plants. This is quite intriguing but may be related more to a decreased catabolism of Spm (by a specific Spm oxidase) rather than its increased production; since Spd is an intermediate for Spm production and both are co- regulated by SAMDC and the APTs (Shao et al. 2011). Alternatively, lower Spd may

165 perhaps be due to its increased catabolism by Spd oxidase. It is also noteworthy that decrease in Spd in the transgenic plants was inversely related to increase in Put.

In mature transgenic plants with constitutive expression of mODC, the trend of changes in PAs (very high Put, somewhat higher Spm and slightly lower Spd) was similar to the seedlings but the magnitude of increase in Put was much smaller than in the seedlings, and was organ/tissue dependent. The Spm content was higher in vegetative tissues (>4-fold) but less so in the reproductive tissues (-1.8- to 2-fold). Cadaverine was also observed in all organs of mature plants, with the highest amount in the reproductive tissues. Overall, the reproductive organs had higher amounts of total PAs than the vegetative organs, both in the WT as well as in the transgenic plants; this is in agreement with the results of Urano et al. (2003). These results reflect developmental regulation of

PAs in different tissues/organs of both the WT and the transgenic plants, which is consistent with the previous reports from our lab as well as from other labs.

Exogenous supply of all three PAs to WT plants expectedly increased the corresponding PA level, while Spd and Spm also caused an increase in Put content; the latter could possibly be due to back-conversion of Spd or Spm to Put. There was little effect of exogenous Put on cellular Spd and Spm, again confirming a tighter regulation of of higher PAs in plant cells. Back conversion of PAs (from Spd to Put or Spm to Spd and

Put) through the actions of PAOs is common in animals (Seiler 2004; Zahedi et al. 2010), and has been shown in plants as well (Tavladoraki et al. 2006; Kamada-Nobusada et al.

2008; Moschou et al. 2008c; Fincato et al. 2011).

The presence of additional nitrate in the medium significantly reduced Put as well as

Spd contents in both the WT and the transgenic plants; the effects on Spm were different

166 in the two genotypes. While the transgenic plants had significantly higher Spm, the WT plants had lower Spm in the presence of high nitrate. These results are consistent with the earlier observation of Minocha et al. (2004), and show that N avaialability in the medium is not limiting in either case. Garnica et al. (2009) also found in wheat seedlings treated with ammonium, that there was a significant decrease in Put and an increase in Spd both in roots and shoots. In the present study, lack of N in the medium also affected Put more than the higher PAs, again showing a strong regulation of higher PA accumulation.

Absence of sucrose in the medium preferentially affected Put accumualtion in the transgenic plants, but the higher PAs were not affected in either case. These results indicate that while C may not be limiting in the WT plants (all plants are photosynthetic), its need in making Put in the transgenic plants (perhaps also in keeping up with increased biomass production in these plants - see later) is not met by photosynthesis alone.

However, the positive effects of increased sucrose availability in the medium on cellular

Put accumulation in both genotypes (transgenic and WT) show that C may actually be limiting for the production of Put even in the WT plants. It is worth noting that the lower concentration of sucrose in the medium produced a greater increase in Put in the transgenic plants, whereas Put in WT plants was not much affected at lower sucrose concentration. Higher concentration of sucrose showed completely an inverse trend for

Put accumulation in the two genotypes; while Put was higher in the WT plants, it was lower in the transgenic plants. A positive correlation between cellular Put and sucrose content was seen in transgenic tomato fruits with high PAs (Handa and Mattoo 2010). A similar positive effect of high sucrose (300 mM) on Put was also reported by Kim et al.

(2011) in lemon balm (Melissa officinalis).

167 Phenotypic changes in mODC transgenic plants

While the transgenic plants constitutively over-expressing mODC were phenotypically similar to the WT plants; there were subtle developmental differences between the two genotypes. The transgenic plants had higher fresh biomass as well as dry mass per plant just before bolting, which was delayed by at elast a week as compared to the WT plants.

Transgenic plants also had more branches per plant and siliques per plant. Similar effects of Put over-production (2- to 4-fold increase) on flowering (delay by 4-5 d) were reported in transgenic rice plants over-expressing D. stramonium ADC gene under Ubi-1 promoter

(Capell et al. 2004). My results are also consistent with a study of transgenic Arabidopsis plants constitutively over-expressing a native AtADC gene, where Alcazar et al. (2005) found that higher accumulation of Put (4- to 12-fold) was accompanied by a greater leaf number at the time of flowering, an overall dwarfism, shorter stamen length, and partial sterility. This phenotype was attributed to apparent alteration of GA metabolism, since it was reversed by external application of GA3. Effect of elevated Put on biomass increase is also reported in other plants; e.g. under salinity stress conditions (Roy and Wu 2001).

Ability of the mODC transgenic plants to maintain higher water content might be a useful trait against drought; elevated Put and greater tolerance to drought stress are often reported to co-occur in plants (Capell et al. 2004; Alcazar et al. 2010). Higher chlorophyll content in the transgenic plants, and greater number of branches and siliques, all seem to indicate positive effects of high Put production in the present study. These effects are consistent with the observed increase in total C and N in the transgenic plants (also seen in high putrescine producing poplar cells - Mohapatra et al. 2010b), which may be related to higher chlorophyll (photosynthesis?) in the leaves of these plants. The diamine

168 Put (vs. the higher PAs) has been shown to promote light reactions of photosynthesis through increased photophosphorylation (Ioannidis et al. 2006). Also, among the three major PAs, Put is the best stimulator of ATP synthesis as compared to Spd and Spm

(Ioannidis et al. 2007). Higher PA concentrations were also shown to restore the efficiency of photosystem II in the chloroplast membrane (Ioannidis et al. 2006, 2007).

Ornithine as a key player in controlling PA, Pro and GABA biosynthesis

Understanding the regulation of PA and amino acid metabolism remains a key interest both in plants and animals (Sinclair et al. 2004; Rees et al. 2009; Takahashi et al. 2010) as it occupies a central position in connecting with N metabolism, C fixation, and several pathways associated with secondary metabolism. In this regard, as mentioned above, we have argued that Orn plays a more important role than is recognized (in the literature) in regulating PA, Pro and GABA metabolism. Not only that, we have also demonstrated that metabolic flux through the interacting pathways of Glu-Arg-Pro-GABA biosynthesis affects most other amino acids in the cell. While Orn by itself is not used directly for Put biosynthesis in A. thaliana (since this species does not have an ODC gene); on the whole in the plant kingdom, Orn metabolism and its role deserve serious attention (Shargool et al. 1988; Slocum 2005). The data presented here and in earlier studies (Bhatnagar et al.

2001; Mohapatra et al. 2010b) with high-putrescine producing poplar cells clearly show that cellular Orn level is probably monitored very tightly since its biosynthesis is largely driven by its use (by ODC and perhaps other pathways) without significant accumulation at any time. How this monitoring and coordination is achieved in the plants can only be speculated at present. With respect to similar monitoring of Arg levels in animals, Morris

(2007) has implicated a key role for the ratio of charged to uncharged tRNA^8 and G-

169 protein-coupled receptor 6A (Wellendorph et al. 2005). A parallel mechanism for Orn monitoring via tRNA cannot however be envisioned because it is a non-protein amino acid; and the latter mechanism has not been investigated. Whatever the mechanism(s) of monitoring, there must exist a coordination of the pathway from Glu to Orn and a system to up regulate this pathway when demand for Om is increased. Mohapatra et al. (2010b) and Page et al. (2010) have suggested that this seems to occur more at the biochemical level by modulation of enzyme activity rather than by induction of genes (transcription) for the enzymes in the pathway. Regulation at the biochemical level (e.g. increased Orn production in response to its increased consumption) is analogous to the situation found for Lys biosynthesis by Zhu and Galili (2003).

Ornithine is present in very small quantities as compared to Arg, Pro and Glu; it is synthesized from Glu by the action of several enzymes (Slocum 2005). It is also involved

(directly or indirectly) in alkaloid biosynthesis in plants (reviewed by Shargool et al.

1988). The first (regulatory?) step in Orn biosynthesis in plants is from Glu via N-acetyl-

L-Glu synthase (NAGS); this is in contrast to animals where nutritional Arg is the primary source of Orn, and the reaction is controlled by arginase (Morris 2006, 2007).

Constitutive over-expression of a tomato NAGS1 gene in Arabidopsis led to higher accumulation of Orn and citrulline in the rosette leaves without significant increase in

Arg content (Kalamaki et al. 2009). Transgenic plants showed greater retention of chlorophyll under salt and drought stresses and higher tolerance against these stresses.

Accumulation of different protein and non-protein amino acids e.g. Ala, Arg, citrulline,

Gly, Leu, Orn, Pro, Ser, Val have been reported under salt stress conditions suggesting

170 possible link of these amino acids with salt tolerance in higher plants (Mansour 2000;

Ashraf and Harris 2004). Unfortunately, no data on PAs were reported in these studies.

Under conditions of its over-consumption in mODC transgenic plants, what turns on the Orn biosynthesis is not yet understood. In this regard the data presented here support the earlier hypothesis from our lab (Mohapatra et al. 2010b; Page et al. 2010) that Orn acts as a sensor molecule to regulate its own cellular content, and is involved in some (as yet unkown) signal transduction pathway that in turn activates (mostly biochemically) its biosynthesis from Glu. This would in turn reduce the availability of Glu and other associated amino acids (Fig. 1); however, due to the preferred biosynthesis of Glu, it does not become limiting unless N and/or C become limiting. This argument is supported by the data presented here as well as the earlier results with mODC transgenic poplar cells.

Further support for this argument comes from the observation that exogenous Orn allowed Glu content to stay high on short-term (12 h) induction ofmODC. We do not envision the increase in Glu to have happened by back conversion of Orn into Glu; rather we believe that it occurs via the regulatory role of Orn. There are two arguments that favor this idea: first the amount of Orn supplied in the medium was not sufficient to produce the amount of Glu seen/retained in the transgenic cells; second, large amount of

Put was still produced on induction (of mODC) from exogenous Orn (corroborated by data from 14C-Orn incorporation into PAs) that would directly utilize this substrate. The increase in Glu seen in response to exogenous Orn treatment in the un-induced plants was also perhaps due to underutilization of Glu to enter the Glu-Orn-Arg pathway rather than back conversion of Orn; again supporting the proposed regulatory role of Orn in controlling this pathway.

171 In animals, nutritional Arg is involved in the production of PAs, Orn, Pro and Glu, whereas in plants it is Glu that performs this role. Another important non-protein amino acid, GABA, is known to accumulate in higher amounts in response to cold, drought, salinity, hypoxia, hormonal changes, and pH change; it also plays an important role in N storage and development in plants (Kinnersley and Turano 2000; Mazzucotelli et al.

2006; Allan et al. 2008; Shi et al. 2010). Induction of ODC for 12 h slightly increased soluble Arg (+Thr+Gly) content (g"'FW), but decreased its relative content (as % of total soluble amino acid pool). Its relative content significantly increased (>50% of soluble pool) at 24 h when plants were supplied with exogenous Arg or E+Arg. The increase in

GABA in the induced plants (with or without Om) is understandable since it is a direct product of Put degradation (in addition to its biosynthesis from Glu by GAD). While cellular contents of GABA were typically higher in the transgenic plants, how much of it was being produced by GAD vs. by Put degradation by DAO has not been determined.

Application of exogenous Glu also resulted in a significant rise of the content of GABA, perhaps due to its direct conversion via GAD. This could be experimentally tested by designining experiments using stable and radio-isotopes of C and N to delineate the metabolic flux of Glu into GABA via the two pathways.

Proline biosynthesis from Orn in plants is not regulated by feedback inhibition as the enzymes involved in this pathway, (i.e. 5-OAT and pyrroline-5-carboxylate reductase -

P5CR), are not regulated by Pro (LaRosa et al. 1991). Induction of ODC resulted in up- regulation of Pro (as also seen in HP poplar cell by Mohapatra et al. 2010b) and further on supply of exogenous Glu or Arg. Also, in seedlings and in rosette leaves of mature plants, constitutively over-expressing mODC, there was increased Pro accumulation.

172 While exogenous Put had a completely reverse effect on Pro content (i.e. it caused a decrease); higher PAs, especially Spm caused an increase in Pro content (>53% of total soluble amino acids). Taken together, these data indicate a complex triangular relationship between PAs and Glu on one side and PAs and GABA on the other; there is a similar three-way relationship among Glu, Orn and Pro. Higher accumulation of GABA and Pro both under inducible and constitutive mODC expression conditions in the seedlings and mature plants indicate that these plants might be useful tools to study a wide a range of stress responses, although this was not done in the present case.

Sucrose affected Pro, GABA and Arg but the responses were different in the transgenic as compared to the WT seedlings. Higher concentration of sucrose in the medium significantly increased Pro content both types of seedlings, yet the fold increase in Pro was much higher in the transgenic seedlings. Sucrose limitation on the other hand negatively impacted Pro only in the WT plants without affecting transgenic plants that showed relatively higher amount of Pro than WT plants even in the control medium.

Higher sucrose concentration (100 mM) significantly increased cellular GABA accumulation. On the other hand Arg showed an increase only in the WT plants in response to lower concentration of sucrose (50 mM). Once again, these data reflect the complex interaction between C and N metabolism in plants.

Changes in other amino acids

Besides PA metabolism, I also investigated if the constitutive expression and the inducible expression of mODC in the presence or absence of Orn affected the cellular soluble amino acids pool in a similar way. In case the results were similar, it would indicate a homeostatic role for high Put biosynthesis from Orn and/or its accumulation on

173 the amino acids. Otherwise it could be argued that short-term changes in Orn availability or Put biosynthesis were different from those that involved homeostatic stabilization of

Orn to Put metabolism. Amino acids that changed significantly within 12/24 h in response to externally supplied Orn with (+E) or without induction of mODC are: Ala

(decreased -80%), Val (decreased -40%), and Cys (decreased 40-50%); Glu and GABA contents were almost doubled during (Tables 9A and 9B).. Exogenous supply of Put, on the other hand, had quite different consequences; i.e. Glu did not change, GABA, Phe and Pro were 50-70% lower, and Trp was somewhat higher (Table 10). Thus it appears that exogenous Put and metabolically synthesized Put have different effects on amino acids related to Glu and Orn. It should be kept in mind that the induction experiment was shorter in duration (12-24 h) than the constitutive expression experiment (7 d).

Differences in PCA-soluble amino acids were also observed betweenthe seedlings and the mature plants in the constitutive over-expression lines. Constitutive presence of ODC caused >50% increase in the proportions of Thr, Gly, Ala, Pro, Val, Met, He and GABA, and a similar decrease in the proportions of Trp and Orn in the soluble amino acid pool in seedling (Table 10). The trend of changes in amino acids as % of total soluble amino acid pool was similar in the transgenic line 18-2. Mature plants on the other hand showed tighter regulation of the amino acids; of course changes in Put biosynthesis and accumulation were also different in the young vs. the mature plants. This was also true in the reproductive organs where there were much greater changes in PAs. Effects of genetic manipulation of PAs (yeast SPDS under fruit specific promoter) on amino acids have also been studied in tomato fruits; the results were quite different in that case.

Whereas Put showed a negative correlation (p<0.8) with amino acids like Gin, Asn, Ala,

174 Thr, He; Spd-Spm showed a positive correlation (p>0.8) with the same amino acids

(Handa and Mattoo 2010; Mattoo et al. 2011). Changes in amino acid pool in response to mODC over-expression in poplar showed a decrease in relative concentrations in several amino acids including Gin, Leu, His, Glu, Arg, and Orn; there was an increase in Ala,

Thr, GABA, and occasionally Pro (Mohapatra et al. 2010b).

It was not surprising that the lack of N (nitrate) availability in the medium had greater effects on amino acids than the lack of C (sucrose) because the seedlings are photosynthetic; thus they have a source of C even in the absence of sucrose. Higher nitrate concentration in the medium increased cellular Pro, Trp, Phe, Ala, Val, and He, both in WT and mODC transgenic seedlings, showing that additional N was being sequestered into amino acids but not into PAs. Sucrose availability in the medium affected a greater number of amino acids that showed differential responses in WT and mODC transgenic seedlings, confirming postulated the interaction of PAs with amino acid biosynthesis. Higher concentration of sucrose (100 mM) significantly increased cellular Glu, Gin, Pro, Ser, Phe, Ala and Val, and lowered cellular Lys, more so in the

ODC transgenics than the WT seedlings (Figs. 33A, 33B, 34A, 34B). Almost a doubling of Lys at lower sucrose concentration was seen in the WT plants but a decrease was apparent in the mODC plants. The latter was perhaps due to the ability of mODC to use this amino acid as a substrate to make Cad. This is consistent with the proposed Orn deficiency syndrome in the transgenic plants. Ornithine increased significantly in the WT plants in response to low levels of additional sucrose (50 mM) but decreased at higher sucrose concentration; the transgenic plants did not show any change in Orn in response to sucrose supplementation in the medium. This is also consistent with a severe Orn

175 limitation in the transgenic plants, and further shows a link between available C and the regulation of cellular Orn. In lemon grass (Melissa officinalis), high sucrose supplementation (300 mM) significantly increased cellular contents of Pro and decreased

Glu, Ala, Arg, Gly, Asp, Asn, and Thr (Kim et al. 2011). The same amino acids that showed decrease in higher concentration of sucrose were significantly increased by 50 mM of sucrose.

Total cellular C and N in relation to increase in polyamines

The metabolism of C and N are inter-dependent in all organisms whether photosynthetic or not; however the interactions between the two are rather complicated. It

is well known that in plants either C or N can become limiting for growth/biomass in short term (e.g. day vs. night) as well as long term (young vs. old plants), and in an organ and developmental stage specific manner. Other factors such as temperature, O2 and CO2

supply, pathogens, and abiotic stress all affect the assimilation of C and N independently as well as coordinately. The effects of air pollution and climate change on the total biomass of individual plants as well as populations (e.g. aquatic systems, croplands and

forests), the mode of N assimilation (uptake vs. N fixation), the form of N (nitrate vs. ammonium), water supply, root morphology, etc. are complex and interactive (McCarthy et al. 2010; Melillo et al. 2011). With increased interest in biofuels and renewable energy,

in addition to food production, this interaction has taken on a new dimension.

In tobacco leaves, N assimilation has been linked to activation of specific enzymes

like phosphoenolpyruvate kinase (PEPC) and isocitrate dehydrogenase (ICDHc), and up- regulation of organic acids (Scheible et al. 2000). Roles of PEPC and other Krebs cycle enzymes in providing C skeletons in leaves in relation to assimilation of N has also been

176 discussed in other higher plants (Foyer and Noctor 2000). Transgenic expression of

PEPC in potato showed higher organic acids content along with Glu and Gin content

(Rademacher et al. 2002). Likewise, up-regulation of N:C indicator genes (e.g. PEPC and

ICDH) in transgenic tomato fruits having elevated level of Spd/Spm indicates PA mediated changes in C and N metabolism (Mattoo et al. 2006). In cell cultures, higher Put biosynthesis has been shown to increase total C and N (Mohapatra et al. 2010b).

In plant leaves Glu, Gin and Asn are the major form of storage N (Corruzi and Zhou

2001; Stitt et al. 2002). As discussed above, metabolic alterations have been reported in tomato fruit in response to fruit specific transgenic manipulation of higher PAs.

Transgenic expression of yeast SAMDC under the control of fruit ripening specific promoter in transgenic tomato fruit showed significant changes in Gin, Val, Asn, Asp and several TCA cycle metabolites including citrate, fumarate and malate. Significantly higher ratios of fructose to glucose, and organic acids to sugars

(glucose+fructose+sucrose) were observed in the transgenic fruits in response to higher levels of Spd/Spm (Mattoo et al. 2006). It is well known that the primary N assimilation in plants is controlled negatively by the total N status, but in a complex way involving soluble protein as well as total soluble amino acid pool (Foyer et al. 2003; Miller et al.

2007). Foyer et al. (2003) have also discussed possible roles of certain minor amino acids in regulating the soluble amino acid pool and N and C assimilation by the cells. Of course, changes in the levels of Gin, Asn and other abundant amino acids play a major role in determining N status in plants (Glass et al. 2002; Stitt et al. 2002). Metabolome analysis of high-Put poplar cells showed significant increases in soluble sugars and

177 organic acids, besides changes of other metabolites (unpublished data from Minocha lab) in response to the elevated level of the diamine Put.

Transgenic mODC plants with elevated Put (and Spm) in the current study not only showed increase in cellular contents of C as well as N on per plant basis; there also was increase in percentage C (conversely perhaps a decrease in % N) in the transgenic plants as compared to the WT plants. Increase in C and N on per plant basis was accompanied by an increase in DW of the plants, showing that the overall productivity of the plants was also increased in response to genetic manipulation of Put. A delay in flowering seen in these (transgenic) plants, which might be detrimental in some cases, could be construed as a positive feature for plants where biomass may be more important than its utility in organ-dependent food value (i.e. foliage vs. the seed or fruit). This is of particular value in light of the recent interests in developing high biomass plants for use in biofuel production.

In this regard it is difficult to decide whether this increase in DW is due to the direct effect (at physiological and biochemical level) of elevated levels of Put, Spm or both in the mODC transgenic plants in accumulating biomass or an indirect effect of PAs in regulating genes that are involved in C and N metabolism. As mentioned above, involvement of higher PAs in regulating genes associated with C and N metabolism has been suggested by Mattoo et al. (2010a). These results together highlight the importance of the diamine Put and the higher PAs, and their overlapping functions in coordinating genes that are involved in C metabolism via N assimilation in higher plants both in cell cultures as level as well as in mature plants.

178 Conclusions and future perspectives - Objective 1

Over the years, metabolic engineering in plants has gained a central focus in transgenic research to enhance the nutritional value of food/feed crops and to improve the abiotic stress tolerance of plants (Mattoo et al. 2010b; Hussain et al. 2011 and references therein). Metabolic engineering in plants has often been targeted to achieve different goals; some examples are: increase in plant volatiles for increased plant defense (Schnee et al. 2006), stress tolerance (Chen and Murata 2002; reviewed by Bartels and Hussain

2008), improved quality of flowers and fruits (Lucker et al. 2001; Goff and Klee 2006), increased production of secondary metabolites (Pilate et al. 2002; Verhoeyen et al. 2002), and increase in essential amino acids (Lys, Met, Trp etc.) in food and forage crops from a nutritional perspective (Galili and Hofgen 2002). Current advances in genomics, proteomics and metabolomics have opened up new avenues to precisely evaluate the impact of single step metabolic engineering on the entire cellular system. Various mechanisms have been postulated in controlling metabolic fluxes of connected pathways that share a common substrate (Palsson 2009; Allen et al. 2009; Griming et al. 2010). One mechanism of increasing certain metabolite contents without increases in transcription or translation of the related enzymes can be through increased demand of the product (Zhu and Galili 2003), i.e. the metabolic pull. While most studies have lacked experimental evidence involving detailed analysis of the pleiotropic effects of such metabolic manipulations, Mohapatra et al. (2010b) and Page et al. (2007, 2010, and AF Page, R

Minocha and SC Minocha, unpublished) have demonstrated that manipulation of a single step in the PA biosynthetic pathway (i.e. increased Put production via transgenic ODC) causes a major redirection of the cell's transcriptome and the metabolome. Results

179 presented here confirm the earlier conclusions of such a major metabolic shift in the overall cellular metabolism by mODC over-expression in cultured cells, and extend the evidence in support of this to intact plants. These results also caution us to carefully ascertain the pleiotropic effects of genetic engineering of a single metabolite on causing a disturbance in the homeostatic regulation of several key metabolites in plants. In many cases, such perturbations of a beneficial metabolite may actually result in a reduction in the overall nutritional value of the transgenic food/feed crops. On the other hand, cases where plant biomass is intended to be used for industrial purposes (e.g. bioenergy, biofuels, enzyme catalysts, etc.), such metabolic engineering may be totally acceptable.

In fact, the observed increase in N assimilation, and the resulting/accompanying C sequestration due to metabolic engineering of PAs, may provide a useful tool in not only producing greater biomass under the conditions of optimal growth but also under the conditions of stress because of the beneficial effects of higher PAs in improving the stress response of plants. In addition, of course, there is tremendous interest in regulating PA levels in human food because of the use of PA inhibitors for cancer and antiparasitic chemotherapy (Kalad and Krausova 2005; Kalac 2009).

Objective 2 - Expression of AtSAMDC genes

Microarrays, northern blots, in situ hybridization, and qualitative and quantitative or

Real Time (RT)-PCR, have all been used to assess gene expression, and they all have their pros and cons for such analyses. While providing reasonably reliable data on most genes in most tissues/organs, they are often unsuitable for obtaining precise information about the cell and tissue-specific expression of individual genes, particularly members of a gene family which have a high degree of sequence homology amongst them. This is

180 precisely the situation with the SAMDC gene family. Promoter: reporter fusion approach, in which the putative promoter region of a gene is fused with a reporter gene whose expression is then monitored in the transgenic plants carrying this construct, while having some of its own limitations (e.g. the assumption that an isolated promoter, which is not clearly defined, will behave the same way as the native gene promoter); nevertheless, offers two principal advantages over the other techniques: (1) the reporter gene expression is controlled by the promoter of the specific gene of interest, thus eliminating the problems associated with sequence similarity between two or more genes; and (2) the gene expression can be studied in vivo (even non-destructively, e.g. by using Green

Fluorescent Protein or luciferase), in all tissues and cells of the plant at the same time without cumbersome RNA preparations (Mantis and Tague 2000; Almoguera et al. 2002;

Curtis and Grossniklaus 2003; Martin et al. 2009; Xiao et al. 2010). It should, however, be pointed out that this approach shows the results of a combination of transcriptional plus translational regulation of gene expression, while the earlier-mentioned methods measure tramnscript levels only. The GUS reporter gene system has been employed routinely to study developmentally regulated gene expression, inducible gene expression, and to characterize different regulatory motifs in the promoter region of a gene (Godard et al. 2000; Curtis and Grossniklaus 2003; Malnoy et al. 2003, Furtado et al. 2009). In the present study, the expression of three SAMDC genes in the PA biosynthesis pathway, namely AXSAMDC3, AtSAMDC4 and AtSAMDC5 were profiled during the life cycle of

Arabidopsis. The expression of the other two SAMDC genes (viz. SAMDCl and

SAMDC2) has been studied previously in our lab (Mitchell 2004).

181 Defining the promoter

Numerous attempts have been made to define the promoter region of a gene

(Yamamoto and Obokata 2008; Smirnova et al. 2011; Yilmaz et al. 2011); none have given a precise definition of a promoter. In a recent article, Balasubramanian et al. (2009) reported that the promoter region of the majority of genes in the human genome contain a rather high degree of GC rich quadruplexes, which may aid in better defining a promoter.

While the 3' end of a promoter can be more easily defined (based on its proximity to the transcription initiation site), the 5' end is ill-defined in most cases. A common approach to isolate/clone the promoter sequences is to identify a fragment up to 2 kb or to the next known gene, if this information is available. We have used a combination of these two approaches (depending on the location of the neighboring gene at the 5' end of the putative promoter) to identify the promoters of the three SAMDC genes studied here.

The length of the promoter region necessary to drive sufficient expression of the different members of AtSAMDC gene family in relation to development or stress responses is not fully understood. No direct studies are reported on AtSAMDC promoter characterizations, while bioinformatics information about the presence of regulatory motifs of different types has been discussed (Urano et al. 2003). Based on the genomic map of Arabidopsis available from NCBI (www.ncbi.nlm.nih.gov) or TAIR

(www.arabidopsis.org), while the neighboring gene of AtSAMDC4 is -900 bp upstream; the neighboring genes in the case of AtSAMDC3 and AtSAMDCS are >3 kb bp upstream of their respective transcription start site; thus the precise length of promoter in each case

is a matter of speculation. We therefore cloned 864 bp fragment for the promoter of

AtSAMDC4, 2905 bp for AtSAMDC3, and 2001 bp in case of the AtSAMDCS promoter

182 (Fig. 35) with or without the inclusion of the 5'UTR and/or the ORF to obtain different transcriptional and translational fusions with GUS along with partial deletion of the 5' end of the promoter in each case. The goal was to study the role of the promoter in regulation of gene expression in coordination with the 5'UTR and/or the ORF in all three

SAMDCs. In order to check if the promoterxGL^ fusions represented the normal state of affairs for gene expression, we also tested the transcript levels of the four genes by qPCR.

Transient Expression vs. in vivo expression

A common approach to test the efficacy of a promoter, and in many cases to delineate the role of various c/s-regulatory elements within it, is to use otransient expression assays

in homologous (Schenk et al. 1999; Park et al. 1999; Zhang et al. 2002; Qu and Takaiwa

2004; Martin et al. 2009) or heterologous tissues (Agius et al. 2005; Zhang et al. 2008).

While often the results of transient and stable expression assays driven by a cloned promoter match with each other, in most cases the comparisons are never made. Most studies assume that the observed reporter gene expression is representative of the real gene expression without experimentally verifying it. We used transient expression of the various constructs not only to test that the promoter::GUS fusions produced a functional

GUS protein but also found a strong correlation between transient GUS expression in poplar cells and stable GUS expression in Arabidopsis. For example, the activity of GUS was much higher in the SAMDC4 translational fusion plasmids than SAMDC3 or

SAMDCS translational fusion plasmids. Activity of SAMDC3 promoter was lower than

SAMDC4 promoter; but considerably higher than SAMDC5 promoter constructs. We further tested if the promoter::GUS fusion assays were consistent with expression of the native gene and our expression data based on the two techniques (at the organ level) were

183 highly consistent with each other; so were the results from qPCR analysis of 2 d and 10 d old seedlings. It was also revealed by these assays that the minimal functional promoter in my experiments was 283 bp for SAMDC4, which showed very high activity both in transient as well as stable (integrated) gene expression assays. Studies on the responses of these constructs in the transgenic plants to various growth regulators and stress responses are currently underway. Preliminary studies on the response of promoter::GUS fusion transgenic plants to high osmoticum, low temperature and wounding show differential responses of the different constructs/gene promoters (data not included here).

Expression during early development

The expression data of the three AtSAMDC genes studied here, and the other two

AtSAMDC genes studied earlier in our lab, during early development show that there probably is a differential role of the various SAMDC gene family members in different tissues and organs. While all of them appear to be transcribed early in germination, their tissue/organ specificity of expression starts to differ as the seedlings grow older, and it gets maximized in the mature plants. Furthermore, the published data (and also preliminary data from our lab) on SAMDC expression in response to abiotic stress treatments confirms that not only they may play differential roles during development, they also respond differently to environmental factors. These conclusions are consistent with the evolutionary changes in different members of large gene families where they may have arisen from gene duplication and rearrangements (Flagel and Wendel 2009;

Lan et al. 2009). The greater differences in the sequences of the different promoters vs. the coding sequences further lead us to propose that the promoters perhaps evolved faster than the genes, which maintained highly conserved sequences.

184 The different translational and transcriptional fusions give us a deeper insight into the regulation of SAMDC genes (in terms of the actual production of SAMDC protein) at different levels of gene expression and at different stages of development. Higher activity of GUS for the translational fusion of AtSAMDC4 was observed during the first 48 h of seed germination; this activity was present in the emerging radicle as well as the cotyledons. On the other hand, little or no GUS activity for AtSAMDC3::GUS was observed, and AtSAMDC5v.GUS showed only limited activity in the cotyledons. This might suggest a prominent role of native AtSAMDC4 enzyme at early stages of seedling development; and a differential regulation of its activity at the translational level by the

ORF. This is borne out from the observation that transcriptional fusions of all SAMDCs

showed higher activity of GUS throughout the germinating seedlings. Increased expression on deletion of the 5'UTRs in all three SAMDCs further confirms the

involvement of 5'UTR in translational regulation of the SAMDC genes studied earlier

(Hanfrey et al. 2002, 2003, 2005); even though the size of the 5'UTR varies considerably among them. The 5'UTRs of AtSAMDCl and AtSAMDC2 contain both tiny and small uORFs. It has been demonstrated that under low intracellular PA conditions, the tiny uORF is translated, which in turn allow the binding of ribosomes to the main SAMDC

ORF and augments its translation. In the presence of excess intracellular PAs, the tiny

uORF is not translated and the ribosomes bind to the main small 5'uORF; their binding to the main ORF is reduced and its translation is inhibited. Only one uORF in the 5'UTR of

AtSAMDC3 and no uORFs in the 5'UTRs of AtSAMDC4 and AtSAMDCS were observed.

While, our data show an overall consistency with the results of Franceschetti et al. (2001) and Hanfrey et al. (2002) on the role of uORFs within the SAMDC mRNAs; removal of

185 5'UTR and increased GUS activity in all three SAMDCs seen here provides further arguements for the importance of the 5'UTR regardless of the presence of uORFs.

High activity of GUS (in plants without the 5'UTR constructs) observed in the roots of

AtSAMDC3 and AtSAMDCS seedlings would suggest negative regulation of translation by the 5'UTR in the roots; again showing consistency with the role of uORFs and/or

UTRs in regulating gene transcription and/or translation. Deletion of a major 5' portion

(up to 80% in some cases) of the putative promoter in all three SAMDCs (down to 384 bp in case of AtSAMDC3 and AtSAMDCS and 283 bp in AtSAMDC4) did not negatively

impact GUS activity; rather it maintained high activity or enhanced the GUS activity both in vegetative and reproductive organs. This might suggest that the core promoters for all

SAMDCs are much smaller to drive sufficient spatio-temporal pattern of gene expression.

Thus the remaining 5' part of the promoter with several common motifs might be associated either with developmental and environmental responses or with fine-tuningo f gene expression in different cell types. The presence of GAREAT (GA Response

Element) motifs in the promoter of AtSAMDC3 and AtSAMDCS genes and their higher expression in the transcriptional fusions is consistent with the role of GA in seed

germination. Although no such element was observed in the promoter of AtSAMDC4, yet higher expression both at translational and transcription level might suggest involvement

of other regulatory elements present either in the promoter or the ORF itself stabilizing the expression. The expression data during early development for AtSAMDCl and

AtSAMDC4 are consistent with the reported patterns through microarray analysis

(Genevestigator- www.genevestigator.com). No expression data are available on

186 AtSAMDCS; as stated as earlier, and confirmed by the lack of its ESTs, it is possible that this gene might not be transcriptionally or translationally active.

This study shows for the first time that the AtSAMDCS promoter is transcriptionally active; however, however, its activeity could be low due to its extremely short 5'UTR (12 bp) or the ORF negatively effecting translation; removing the 5'UTR increased GUS expression. The GUS expression with AtSAMDCl and AtSAMDC2 promoters also show that there is a differential role of these two genes in different tissues during development, although both are expressed often in the same tissues (Mitchell 2004). For example, the expression of AtSAMDCl started at the root tip of germinating seedlings and gradually proceeded towards the cotyledons; the reverse was the case for AtSAMDCl during seed germination. No AtSAMDC2 expression was seen in the root tips where AtSAMDCl was strongly expressed. Their promoter sequences reveal the presence of specific regulatory motifs (e.g. ABRE, WRKY elements) that might explain this differential expression pattern during development, and also in relation to different hormonal signals in the root tip vs. the base of the root and the hypocotyl. The AtSMADC3 promoter has root-specific regulatory motifs in its 5' region, which is consistent with its high expression in the roots.

Higher degree of sequence identities with respect to ORF of all the SAMDC genes as compared to their promoters might explain that the promoters might have evolved independently than their coding regions, and the functional diversity of the different members of this gene family is due to the diversification of the promoters.

Mature plants

High activity of GUS was observed in the vascular tissues of leaves, roots and rosette junctions in translational fusion of AtSAMDC4, whereas AtSAMDC3 and AtSAMDCS

187 fusions showed very low GUS activity which was localized in the vascular tissues. Again at the organ levels, the results are in agreement with the earlier reports on the expression of at least three AtSAMDCs (Franceschetti et al. 2001, Urano et al. 2003, Ge et al. 2006) and the microarray data (except for AtSAMDC5) for several organs in A. thaliana.

Together these data are also consistent with the situation of other genes with multiple family members. Transcriptional fusions showed higher GUS activity in AtSAMDC3 and

AtSAMDCS promoter::G*7S fusions but lower activity of GUS in AtSAMDC4::GUS fusions; this observation suggests the involvement of regulatory elements in the SAMDC-

ORF in positively affecting the expression of this gene. Removal of the 5'UTR, on the other hand, significantly increased GUS activity in the leaves; this again points to a negative control of the gene product, most likely via translational regualtion.

In mature plants, constitutively high GUS activity was observed in the leaves for

AtSAMDCl promoter; the veins and the hydathodes staining darker than the surrounding tissues. In contrast, AtSAMDC2 promoter showed localized GUS expression, limited largely to leaf veins and hydathodes. As with the vegetative organs, GUS activity profiles for both AtSAMDCl and AtSAMDC2 (Mitchell 2004) in flowers are consistent with the available microarray data, where highest signal values were obtained for pollen followed by sepals, petals, stigma and ovary, respectively, for both these genes; and, overall expression of AtSAMDClv.GUS was much greater than AtSAMDC2::GUS. The GUS analyses data are also in line with earlier observations of Franceschetti et al. (2001) and

Urano et al. (2003), where high ubiquitous expression of AtSAMDCl was observed in all organs (with highest expression in flowers) of mature plants. Expression of AtSAMDC2

188 (as seen by GUS activity) was much lower compared to AtSAMDCl, and was mainly localized in the inflorescences and leaves of mature plants.

The present study, combined with the earlier study by Mitchell (2004) provides the most comprehensive analyses for expression of all five members of the AtSAMDC gene family in terms of tissue specificity during flower development. For example: (1) within the stamens, high expression was mainly localized in the pollen and less so in the anther sac cells; (2) in the filament, expression was localized more in vascular tissues than the rest of the filament; (3) higher expression in the sepal and petal veins as compared to the lamina; and (4) restricted expression in the peduncle, receptacle and sepal junctions and not the entire ovary. Such details, as mentioned above, are not discernible from studies using other techniques for gene expression. The data also show a stronger expression

AtSAMDCl compared with AtSAMDC2 during the entire flower development process.

The lack of GUS activity in parts of the developing ovary and the siliques might suggest that PAs required for these tissues either are transported from neighboring cells; laternatively, this could be due to poor infiltration of the GUS stain in these tissues. High activity of GUS in developing embryos of AtSAMDCl, AtSAMDC2 and AtSAMDC4 when isolated but no visual GUS staining in the developing seeds within the siliques in vivo again could be due to poor infiltration of the stain.

In contrast to AtSAMDCl and AXSAMDC2, no activity of GUS for AtSAMDC3,

AtSAMDC4 and AtSAMDCS was detected in the pollen which clearly points to the differential role of different members of this gene family in flower parts. High level of expression of SAMDC genes in the vascular tissue perhaps is related to intense cell division activity associated with this tissue. It is quite possible that large amounts of PAs

189 are actually produced in the vascular tissue and transported to many cells/tissues that do not show SAMDC expression. This argument is consistent with the notion that all living cells require PAs to perform necessary functions, including transcription and translation

(Cohen 1998). On the other hand, most of the published studies on promoter::GUS fusions often show high expression in the vascular tissue.

A role of PAs in plant vasculature development is implicated in several plant species.

High concentrations of PAs were seen in the xylem sap of mungbean, sunflower and orange (Friedman et al. 1986). Such correlations among PA concentrations in the plant axis and the size and age of tissues have also been reported in other plants (Paschalidis and Roubelakis-Angelakis 2005). A possible explanation for PA role in vasculature differentiation and ligification is through the production of H2O2 via PA oxidation by

DAOs and PAOs (Cona et al. 2003; Passardi et al. 2005). The involvement of SAMDC in the development of proper vasculature was demonstrated in bud2 (a samdc4 mutant), which had limited dcSAM availability and showed increased vascular bundle size (Ge et

al. 2006). A mutant of Spm/tSPM synthase (aclS), which is deficient in tSpm, had a

severe phenotype including defective stem elongation, smaller mature leaves and

enlarged xylem vessels in the inflorescence stalks; this mutation could not be rescued by common plant hormones (Hanzawa et al. 1997; Muniz et al. 2008). Higher activity of

GUS in the roots of AtSAMDC4 translational fusion (in comparison to AtSAMDC3 and

AtSAMDCS) also supports the study with bud2 mutant that showed altered seedling root

growth with higher number of lateral roots, enlarged vasculature, and higher lignin deposition (Ge et al. 2006). Altered hypocotyl elongation and lateral bud growth in budl was later explained as an effect of altered auxin-mediated response in this mutant (Cui et

190 al. 2010). Bioinformatics analyses of the promoters of all SAMDC genes further reinforce the role of auxin involvement (Cui et al. 2010) with AtSAMDC4, as AtSAMDC4 and

AtSAMDC5 promoters show auxin responsive elements in their promoter regions.

Conclusions - Objective 2

The results of this part of the study confirm the differential role of different SAMDCs during development, and perhaps in response to different environmental conditions. It is envisioned that the different cw-regualtory elements in the promoter region regulate the expression of these genes through involvement of different signal transduction pathways, many of which include plant hormones. The presence of several stress, hormone, and

ABA-response elements in the promoters of various SAMDC genes, and the repeated demonstration of changes in cellular PAs and the expression of PA-biosynthetic genes during development and stress response, re-enforce the suggested role of PAs in almost all aspects of plant life. My study specifically reveals that AtSAMDCS is transcriptionally active as opposed to previous assumption that it is not transcribed or translated.

Having covered almost all organs of A. thaliana for the expression of all five members of the SAMDC gene family, it is evident that there is no organ/tissue where at least one of these five genes is not expressed, showing the indispensability of dcSAM production in almost every plant cell. On the contrary, several cells/tissues appear to express several if not all members of this gene family, confirming an enormous degree of redundancy in the expression of these genes. This observation also leads us to conclude that the SAMDC enzyme is very critical for cell's survival, and the functional redundancy has been a selective feature for plants during evolution.

191 LITERATURE CITED

Agius F, Amaya I, Botella MA, Valpuesta V (2005) Functional analysis of homologous and heterologous promoters in strawberry fruits using transient expression. J Exp Bot 56:37- 46. Alcazar R, Garcia-Martinez JL, Cuevas JC, Tiburcio AF, Altabella T (2005) Overexpression of ADC2 in Arabidopsis induces dwarfism and late-flowering through GA deficiency. Plant J 43:425-436. Alcazar R, Planas J, Saxena T, Zarza X, Bortolotti C, Cuevas J, Bitrian M, Tiburcio AF, Altabella T (2010) Putrescine accumulation confers drought tolerance in transgenic Arabidopsis plants over-expressing the homologous Arginine decarboxylase 2 gene. Plant Physiol Biochem 48:547-552. Alet Al, Sanchez DH, Cuevas JC, Del Valle S, Altabella T, Tiburcio AF, Marco F, Ferrando A, Espasandin FD, Gonzalez ME, Ruiz OA, Carrasco P (2011) Putrescine accumulation in Arabidopsis thaliana transgenic lines enhances tolerance to dehydration and freezing stress. Plant Signal Behav 6:278-286. Alhonen L, Uimari A, Pietila M, Hyvonen MT, Pirinen E, Keinanen TA (2009) Transgenic animals modelling polyamine metabolism-related diseases. Essays Biochem 46:125-144. Allan WL, Simpson JP, Clark SM, Shelp BJ (2008) Gamma-hydroxybutyrate accumulation in Arabidopsis and tobacco plants is a general response to abiotic stress: putative regulation by redox balance and glyoxylate reductase isoforms. J Exp Bot 59:2555-2564. Allen DK, Libourel IGL, Shachar-Hill Y (2009) Metabolic flux analysis in plants: coping with complexity. Plant cell Env 32:1241-1257. Almoguera C, Rojas A, Diaz-Martin J, Prieto-Dapena P, Carranco R, Jordano J (2002) A seed- specific heat-shock transcription factor involved in developmental regulation during embryogenesis in sunflower. J Biol Chem 277:43866-43872. Alsokari SS (2011) Synergistic effect of kinetin and spermine on some physiological aspects of seawater stressed Vigna sinensis plants. Saudi J Biol Sci 18:37-44. Andersen SE, Bastola DR, Minocha SC (1998) Metabolism of Polyamines in Transgenic Cells of Carrot Expressing a Mouse Ornithine Decarboxylase cDNA. Plant Physiol 116:299-307. Ashraf M, Harris PJC (2004) Potential biochemical indicators of salinity tolerance in plants. Plant Sci 166:3-16. Bae H, Kim SH, Kim MS, Sicher RC, Lary D, Strem MD, Natarajan S, Bailey BA (2008) The drought response of Theobroma cacao (cacao) and the regulation of genes involved in polyamine biosynthesis by drought and other stresses. Plant Physiol Biochem 46:174- 188. Bagni N, Ruiz-Carrasco K, Franceschetti M, Fornale S, Fornasiero RB, Tassoni A (2006) Polyamine metabolism and biosynthetic gene expression in Arabidopsis thaliana under salt stress. Plant Physiol Biochem 44:776-786. Bagni N, Tassoni A (2001) Biosynthesis, oxidation and conjugation of aliphatic polyamines in higher plants. Amino Acids 20:301-317. Balasubramanian S, Laurence H. Hurley LL, Neidle S (2011) Targeting G-quadruplexes in gene promoters: a novel anticancer strategy? Nat Rev Drug Discov 10:261-275. Bale S, Ealick SE (2010) Structural Biology of S-Adenosylmethionine Decarboxylase. Amino Acids 38:451-460. Bartels D, Hussain SS (2008) Current status and implications of engineering drought tolerance in plants using transgenic approaches. CAB Rev: Perspect Agric Vet Sci Nutr Nat Resour 3:17. Bassie L, Noury M, Lepri O, Lahaye T, Christou P, Capell T (2000) Promoter strength influences polyamine metabolism and morphogenic capacity in transgenic rice tissues expressing the oat adc cDNA constitutively. Transgenic Res 9:33-42. Bastola DR (1994) Genetic engineering of the polyamine biosynthetic pathway and somatic embryogenesis in carrot {Daucus carota L.). Dissertation, University of New Hampshire. Bastola DR, Minocha SC (1995) Increased Putrescine Biosynthesis through Transfer of Mouse

192 Ornithine Decarboxylase cDNA in Carrot Promotes Somatic Embryogenesis. Plant Physiol 109:63-71. Bhatnagar P, Glasheen BM, Bains SK, Long SL, Minocha R, Walter C, Minocha SC (2001) Transgenic manipulation of the metabolism of polyamines in poplar cells. Plant Physiol 125:2139-2153. Bhatnagar P, Minocha R, Minocha SC (2002) Genetic manipulation of the metabolism of polyamines in poplar cells. The regulation of putrescine catabolism. Plant Physiol 128:1455-1469. Bibi AC, Oosterhuis DM, Gonias ED (2010) Exogenous Application of Putrescine Ameliorates the Effect of High Temperature in Gossypium hirsutum L. Flowers and Fruit Development. J Agron Crop Sci. doi:10.1111/j.1439-037X.2009.00414.x. Bolle C, Herrmann RG, Oelmuller R (1995) A spinach cDNA with homology to S- Adenosylmethionine decarboxylase. Plant Physiol 107:1461-1462. Bouchereau A, Aziz A, Larher F, Martin-Tanguy J (1999) Polyamines and environmental challenges: recent development. Plant Sci 140:103-125. Braddock M, Muckenthaler M, White MR, Thorbum AM, Sommerville J, Kingsman AJ, Kingsman SM (1994) Intron-less RNA injected into the nucleus of Xenopus oocytes accesses a regulated translation control pathway. Nucleic Acids Res 22:5255-5264. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-254. Burtin D, Michael AJ (1997) Overexpression of arginine decarboxylase in transgenic plants. Biochem J 325:331-337. Capell T, Bassie L, Christou P (2004) Modulation of the polyamine biosynthetic pathway in transgenic rice confers tolerance to drought stress. Proc Natl Acad Sci U S A 101:9909- 9914. Capell T, Escobar C, Liu H, Burtin D, Lepri O, Christou P (1998) Over-expression of the oat arginine decraboxylase cDNA in transgenic rice (Oryza sativa L.) affects normal development patterns in vitro and results in putrescine accumulation in transgenic plants. Theor Appl Genet 97:246-254. Chai YY, Jiang CD, Shi L, T.S. Shi TS, Gu WB (2010) Effects of exogenous spermine on sweet sorghum during germination under salinity. Biol Plant 54:145-148. Chattopadhyay MK, Chen W, Poy G, Cam M, Stiles D, Tabor H (2009) Microarray studies on the genes responsive to the addition of spermidine or spermine to a Saccharomyces cerevisiae spermidine synthase mutant. Yeast 26:531-544. Chen THH, Murata N (2002) Enhancement of tolerance of abiotic stress by metabolic engineering of betaines and other compatible solutes. Curr Opin Plant Biol 5:250-257. Cheng L, Zou Y, Ding S, Zhang J, Yu X, Cao J, Lu G (2009) Polyamine Accumulation in Transgenic Tomato Enhances the Tolerance to High Temperature Stress. J Integrative Plant Biol, doi: 10.1111/J.1744-7909.2009.00816.X. Chintapakorn Y, Hamill JD (2007) Antisense-mediated reduction in ADC activity causes minor alterations in the alkaloid profile of cultured hairy roots and regenerated transgenic plants of Nicotiana tabacum. Phytochemistry 68:2465-2479. Choi YS, Cho YD (1994) A new S-adenosylmethionine decarboxylase from soybean axes. Biochim Biophys Acta 1201:466-472. Chretien RL (2003) Characterization of S-adenosylmethionine decarboxylase (samdc) and arginine decarboxylase (adc) genes from Daucus carota and their expression during somatic embryogenesis. Master's thesis, University of New Hampshire. Clay NK, Nelson T (2005) Arabidopsis thickvein mutation affects vein thickness and organ vascularization, and resides in a provascular cell-specific spermine synthase involved in vein definition and in polar auxin transport. Plant Physiol 138:767-777. Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16:694-698. Cohen SS (1998) A Guide to Polyamines. Oxford University Press, New York. Cona A, Cenci F, Cervelli M, Federico R, Mariottini P, Moreno S, Angelini R (2003) Polyamine oxidase, a hydrogen peroxide-producing enzyme, is up-regulated by light and down- regulated by auxin in the outer tissues of the maize mesocotyl. PlantPhysiol 131:803-813.

193 Cona A, Rea G, Angelini R, Federico R, Tavladoraki P (2006) Functions of amine oxidases in plant development and defence. Trends Plant Sci 11:80-88. Corruzi GM, Zhou L (2001) Carbon and nitrogen sensing and signaling in plants: emerging 'matrix effects'. Curr Opin Plant Biol 4:247-253. Couee I, Hummel I, Sulmon C, Gouesbet G, Amrani AE (2004) Involvement of polyamines in root development. Plant Cell Tiss Org Cult 76:1-10. Cuevas JC, Lopez-Cobollo R, Alcazar R, Zarza X, Koncz C, Altabella T, Salinas J, Tiburcio AF, Ferrando A (2008) Putrescine is involved in Arabidopsis freezing tolerance and cold acclimation by regulating abscisic acid levels in response to low temperature. Plant Physiol 148:1094-1105. Cui X, Ge C, Wang R, Wang H, Chen W, Fu Z, Jiang X, Li J, Wang Y (2010) The BUD2 mutation affects plant architecture through altering cytokinin and auxin responses in Arabidopsis. Cell Res 20:576-586. Curtis MD, Grossniklaus U (2003) A Gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol 133:462-469. Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible WR (2005) Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol 139:5-17. DeBoer KD, Dalton HL, Edward FJ, Hamill JD (2011) RNAi-mediated down-regulation of ornithine decarboxylase (ODC) leads to reduced nicotine and increased anatabine levels in transgenic Nicotiana tabacum L. Phytochemistry 72:344-355. Deeb F, van der Weele CM, Wolniak SM (2010) Spermidine is a morphogenetic determinant for cell fate specification in the male gametophyte of the water fern Marsilea vestita. Plant Cell 22:3678-3691. DeScenzo RA, Minocha SC (1993) Modulation of cellular polyamines in tobacco by transfer and expression of mouse ornithine decarboxylase cDNA. Plant Mol Biol 22:113-127. Ding C, Shi G, Xu X, Yang H, Xu Y (2010) Effect of exogenous spermidine on polyamine metabolism in water hyacinth leaves under mercury stress. Plant Growth Regul 60:61- 67. Dresselhaus T, Barcelo P, Hagel C, Lorz H, Humbeck K (1996) Isolation and characterization of a Tritordeum cDNA encoding S-adenosylmethionine decarboxylase that is circadian-clock- regulated. Plant Mol Biol 30:1021-1033. Duan JJ, Li J, Guo SR, Kang YY (2008) Exogenous spermidine affects polyamine metabolism in salinity-stressed Cucumis sativus roots and enhances short-term salinity tolerance. J Plant Physiol 165:1620-1635. Fincato P, Moschou PN, Spedaletti V, Tavazza R, Angelini R, Federico R, Roubelakis-Angelakis KA, Tavladoraki P (2011) Functional diversity inside the Arabidopsis polyamine oxidase gene family. J Exp Bot 62:1155-1168. Flagel LE, Wendel JF (2009) Gene duplication and evolutionary novelty in plants. New Phytol 183:557-564. Foyer CH, Noctor G (2000) Oxygen processing in photosynthesis: regulation and signalling. New Phytol 146:359-388. Foyer CH, Parry M, Noctor G (2003) Markers and signals associated with nitrogen assimilation in higher plants. J Exp Bot 54:585-593. Franceschetti M, Fornale S, Tassonia A, Zuccherelli K, Mayer MJ, Bagni N (2004) Effects of spermidine synthase overexpression on polyamine biosynthetic pathway in tobacco plants. J Plant Physiol 161:989-1001. Franceschetti M, Hanfrey C, Scaramagli S, Torrigiani P, Bagni N, Burtin D, Michael AJ (2001) Characterization of monocot and dicot plant S-adenosyl-l-methionine decarboxylase gene families including identification in the mRNA of a highly conserved pair of upstream overlapping open reading frames. Biochem J 353:403-409. Friedman R, Levin N, Altman A (1986), Presence and identification of polyamines in xylem and phloem exudates of plants. Plant Physiol 82:1154-1157. Fritze K, Czaja I, Walden R (1995) T-DNA tagging of genes influencing polyamine metabolism: isolation of mutant plant lines and rescue of DNA promoting growth in the presence of a polyamine biosynthetic inhibitor. Plant J 7:261-271.

194 Furtado A, Henry RJ, Pellegrineschi A (2009) Analysis of promoters in transgenic barley and wheat. Plant Biotechnol J 7:240-253. Galili G, Hofgen R (2002) Metabolic engineering of amino acids and storage proteins in plants. MetabEng 4:3-11. Garnica M, Houdusse F, Yvin JC, Garcia-Mina JM (2009) Nitrate supply induces changes in polyamine content and ethylene production in wheat plants grown with ammonium. J Plant Physiol 166:363-374. Ge C, Cui X, Wang Y, Hu Y, Fu Z, Zhang D, Cheng Z, Li J (2006) BUD2, encoding an S- adenosylmethionine decarboxylase, is required for Arabidopsis growth and development. Cell Res 16:446-456. Gitelson AA, Chivkunova OB, Merzlyak MN (2009) Nondestructive estimation of anthocyanins and chlorophylls in anthocyanic leaves. Am J Bot 96:1861-1868. Glass ADM, Britto DT, Kaiser BN, Kinghorn JR, Kronzucker HJ, Kumar A, Okamoto M, Rawat S, Siddiqi MY, Unkles SE, Vidmar JJ (2002) The regulation of nitrate and ammonium transport systems in plants. J Exp Bot 53:855-864. Godard F, Lummerzheim M, Saindrenan P, Balague C, Roby D (2000). Hxc-2, an Arabidopsis mutant with altered hypersensitive response to Xanthomonas campestris pv. campestris. Plant J 24:749-762. Goff SA, Klee HJ (2006) Plant volatile compounds: sensory cues for health and nutritional value? Science 311:815-819. Gomez-Jimenez MC, Paredes MA, Gallardo M, Fernandez-Garcia N, Olmos E, Sanchez-Calle IM (2010a) Tissue-specific expression of olive S-adenosyl methionine decarboxylase and spermidine synthase genes and polyamine metabolism during flower opening and early fruit development. Planta 232:629-647. Gomez-Jimenez MC, Paredes MA, Gallardo M, Sanchez-Calle IM (2010b) Mature fruit abscission is associated with up-regulation of polyamine metabolism in the olive abscission zone. J Plant Physiol 167:1432-1441. Greenberg M, Cohen S (1985) Dicyclohexylamine-induced shift of biosynthesis from spermidine to spermine. Plant Physiol 78:568-575. Gruning N-M, Lehrauch H, Raiser M (2010) Regulatory crosstalk of the metabolic network. Trends Biochem Sci 35:220-227. Hall TA (1999) Bioedit: a user friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser: 95-98. Hamill JD, Robins RJ, Parr AJ, Evans DM, Furze JM, Rhodes MJ (1990) Over-expressing a yeast ornithine decarboxylase gene in transgenic roots of Nicotiana rustica can lead to enhanced nicotine accumulation. Plant Mol Biol 15:27-38. Handa AK, Mattoo AK Differential and functional interactions emphasize the multiple roles of polyamines in plants. Plant Physiol Biochem 48:540-546. Hanfrey C, Elliott KA, Franceschetti M, Mayer MJ, lllingworth C, Michael AJ (2005) A dual upstream open reading frame-based autoregulatory circuit controlling polyamine- responsive translation. J Biol Chem 280:39229-39237. Hanfrey C, Franceschetti M, Mayer MJ, lllingworth C, Elliott K, Collier M, Thompson B, Perry B, Michael AJ (2003) Translational regulation of the plant S-adenosylmethionine decarboxylase. Biochem Soc Trans 31:424-427. Hanfrey C, Franceschetti M, Mayer MJ, lllingworth C, Michael AJ (2002) Abrogation of upstream open reading frame-mediated translational control of a plant S-adenosylmethionine decarboxylase results in polyamine disruption and growth perturbations. J Biol Chem 277:44131-44139. Hanfrey C, Sommer S, Mayer MJ, Burtin D, Michael AJ (2001) Arabidopsis polyamine biosynthesis: absence of ornithine decarboxylase and the mechanism of arginine decarboxylase activity. Plant J 27:551-560. Hanzawa Y, Takahashi T, Komeda Y (1997) ACL5: an Arabidopsis gene required for internodal elongation after flowering. Plant J 12: 863-874. Hanzawa Y, Takahashi T, Michael AJ, Burtin D, Long D, Pineiro M, Coupland G, Komeda Y (2000) ACAULIS5, an Arabidopsis gene required for stem elongation, encodes a spermine synthase. EMBO J 19:4248-4256.

195 Hao YJ, Zhang Z, Kitashiba H, Honda C, Ubi B, Kita M, Moriguchi T (2005) Molecular cloning and functional characterization of two apple S-adenosylmethionine decarboxylase genes and their different expression in fruit development, cell growth and stress responses. Gene 350:41-50. Hayden CA, Bosco G (2008) Comparative genomic analysis of novel conserved peptide upstream open reading frames in Drosophila melanogaster and other dipteran species. BMC Genomics 9:61. He L, Ban Y, Inoue H, Matsuda N, Liu J, Moriguchi T (2008) Enhancement of spermidine content and antioxidant capacity in transgenic pear shoots overexpressing apple spermidine synthase in response to salinity and hyperosmosis. Phytochemistry 69:2133-2141. Hewezi T, Howe PJ, Maier TR, Hussey RS, Mitchum MG, Davis EL, Baum TJ (2010) Arabidopsis spermidine synthase is targeted by an effector protein of the cyst nematode Heterodera schachtii. Plant Physiol 152:968-984. Hu WW, Gong H, Pua E-C (2005a) Molecular cloning and characterization of S-adenosyl methionine decarboxylase genes from mustard (Brassica juncea). Physiol Plant 124: 25- 40. Hu WW, Gong H, Pua EC (2005b) The pivotal roles of the plant S-adenosylmethionine decarboxylase 5' untranslated leader sequence in regulation of gene expression at the transcriptional and posttranscriptional levels. Plant Physiol 138:276-286. Hussain SS, Ali M, Ahmad M, Siddique KHM (2011) Polyamines: Natural and engineered abiotic and biotic stress tolerance in plants. Biotechnol Advances 29:300-311. Hyvonen MT, Uimari A, Keinanen TA, Heikkinen S, Pellinen R, Wahlfors T, Korhonen A, Narvanen A, Wahlfors J, Alhonen L, Janne J (2006) Polyamine-regulated unproductive splicing and translation of spermidine/spermine N1-acetyltransferase. RNA 12:1569- 1582. Imai A, Akiyama T, Kato T, Sato S, Tabata S, Yamamoto KT, Takahashi T (2004a) Spermine is not essential for survival of Arabidopsis. FEBS Lett 556:148-152. Imai A, Matsuyama T, Hanzawa Y, Akiyama T, Tamaoki M, Saji H, Shirano Y, Kato T, Hayashi H, Shibata D, Tabata S, Komeda Y, Takahashi T (2004b) Spermidine synthase genes are essential for survival of Arabidopsis. Plant Physiol 135:1565-1573. Imanishi S, Hashizume K, Nakakita M, Kojima H, Matsubayashi Y, Hashimoto T, Sakagami Y, Yamada Y, Nakamura K (1998) Differential induction by methyl jasmonate of genes encoding ornithine decarboxylase and other enzymes involved in nicotine biosynthesis in tobacco cell cultures. Plant Mol Biol 38:1101-1111. Ioannidis NE, Kotzabasis K (2007) Effects of polyamines on the functionality of photosynthetic membrane in vivo and in vitro. Biochim Biophys Acta 1767:1372-1382. Ioannidis NE, Sfichi L, Kotzabasis K (2006) Putrescine stimulates chemiosmotic ATP synthesis, Biochim Biophys Acta— Bioenerg 1757:821-828. Ivanov IP, Atkins JF, Michael AJ (2010) A profusion of upstream open reading frame mechanisms in polyamine-responsive translational regulation. Nucleic Acids Res 38:353-359. Jefferson RA, Burgess SM, Hirsh D (1986) Beta-Glucuronidase from Escherichia coli as a gene- fusion marker. Proc Natl Acad Sci USA 83:8447-8451. Jeong Y-M, Mun J-H, Lee I, Woo JC, Hong CB, Kim S-G (2008) Distinct Roles of the First Introns on the Expression of Arabidopsis Profilin Gene Family Members. Plant Physiol 140:196- 209. Jimenez-Bremont JF, Hernandez-Lucero E, Alpuche-Solis AG, Casas-Flores S, Barba de la Rosa AP (2006) Differential distribution of transcripts from genes involved in polyamine biosynthesis in bean plants. Biol Plant 50:551-558. Jumtee K, Bamba T, Okazawa A, Fukusaki E, Kobayashi A (2008) Integrated metabolite and gene expression profiling revealing phytochrome A regulation of polyamine biosynthesis of Arabidopsis thaliana. J Exp Bot 59:1187-1200. Kahana C, Nathans D (1985) Nucleotide sequence of murine ornithine decarboxylase. Proc Natl Acad Sci USA 82:1673-1677. Kakehi J, Kuwashiro Y, Niitsu M, Takahashi T (2008) Thermospermine is required for stem elongation in Arabidopsis thaliana. Plant Cell Physiol 49:1342-1349.

196 Kalac P (2009) Recent advances in the research on biological roles of dietary polyamines in man. J Appl Med 7:65-74. Kalac P, Krausova P (2005) A review of dietary polyamines: Formation, implications for growth and health and occurrence in foods. Food Chem 90:219-230. Kalamaki MS, Alexandrou D, Lazari D, Merkouropoulos G, Fotopoulos V, Pateraki I, Aggelis A, Carrillo-Lopez A, Rubio-Cabetas MJ, Kanellis AK (2009) Over-expression of a tomato N- acetyl-L-glutamate synthase gene (SINAGS1) in Arabidopsis thaliana results in high ornithine levels and increased tolerance in salt and drought stresses. J Exp Bot 60:1859- 1871. Kamada-Nobusada T, Hayashi M, Fukazawa M, Sakakibara H, Nishimura M (2008) A putative peroxisomal polyamine oxidase, AtPA04, is involved in polyamine catabolism in Arabidopsis thaliana. Plant Cell Physiol 49:1272-1282. Kashiwagi K, Taneja SK, Liu TY, Tabor CW, Tabor H (1990) Spermidine biosynthesis in Saccharomyces cerevisiae. Biosynthesis and processing of a proenzyme form of S- adenosylmethionine decarboxylase. J Biol Chem 265:22321-22328. Kasukabe Y, He L, Nada K, Misawa S, lhara I, Tachibana S (2004) Overexpression of spermidine synthase enhances tolerance to multiple environmental stresses and up-regulates the expression of various stress-regulated genes in transgenic Arabidopsis thaliana. Plant Cell Physiol 45:712-722. Kasukabe Y, He L, Watakabe Y, Otani M, Shimada T, Tachibana S (2006) Improvement of environmental stress tolerance of sweet potato by introduction of genes for spermidine synthase. Plant Biotechnol 23:75-83. Kawaguchi R, Bailey-Serres J (2005) mRNA sequence features that contribute to translational regulation in Arabidopsis. Nucleic Acids Res 33:955-965. Khan AS, Singh Z (2010) Pre-harvest Application of Putrescine Influences Japanese Plum Fruit Ripening and Quality. Food Sci Tech Int 16:53-64. Khan AS, Singh Z, Abbasi NA, Swinny EE (2008) Pre- or post-harvest applications of putrescine and low temperature storage affect fruit ripening and quality of 'Angelino' plum. J Sci Food Agric 88:1686-1695. Khosroshahi MRZ, Esna-Ashari M (2008) Effect of exogenous putrescine treatment on the quality and storage life of peach (Prunus persica L.) fruit. Int J Post Technol Innovation 1:278-287. Kim YJ, Kim Y-B, Lee SH, Park KY (2006) A 273-bp Promoter Region Is responsible for Orcadian Regulation of S-Adenosylmethionine Decarboxylase Gene Expression in Carnation. J Plant Biol 49: 303-308. Kim YJ, Lee SH, Park KY (2004) A leader intron and 115-bp promoter region necessary for expression of the carnation S-adenosylmethionine decarboxylase gene in the pollen of transgenic tobacco. FEBS Lett 578:229-235. Kim S, Shin MH, Hossain MA, Yun EJ, Lee H, Kim KH (2011) Metabolite profiling of sucrose effect on the metabolism of Melissa officinalis by gas chromatography-mass spectrometry. Anal Bioanal Chem 399:3519-3528. Kinnersley AM, Turano FJ (2000) Gamma aminobutyric acid (GABA) and plant responses to stress. Crit Rev Plant Sci 19:479-509. Kolotilin I, Koltai H, Bar-Or C, Chen L, Nahon S, Shlomo H, Levin I, Reuveni M (2011) Expressing yeast SAMdc gene confers broad changes in gene expression and alters fatty acid composition in tomato fruit. Physiol Plant 142:211-223. Kumar A, Altabella T, Taylor M, Tiburcio AF (1997) Recent advances in polyamine research. Trends Plant Sci 2:124-130. Kumar A, Taylor MA, Mad Arif SA, Davies HV (1996) Potato plants expressing antisense and sense S-adenosylmethionine decarboxylase transgenes show altered levels of polyamine and ethylene: antisense plants display abnormal phenotypes. Plant J 9:147-158. Kumria R, Rajam MV (2002) Ornithine decarboxylase transgene in tobacco affects polyamine metabolism, in vitro morphogenesis and response to salt stress. J Plant Physiol 159:983- 990.

197 Lan T, Yang Z-L, Yang X, Liu Y-J, Wang X-R, Zeng Q-Y (2009) Extensive functional diversification of the Populus glutathione transferase supergene family. Plant Cell 21:3749-3766. Landau G, Bercovich Z, Park MH, Kahana C (2010) The role of polyamines in supporting growth of mammalian cells is mediated through their requirement for translation initiation and elongation. J Biol Chem 285:12474-12481. Larsson J, Rasmuson-Lestander A (1997) Cloning, mapping and mutational analysis of the S- adenosylmethionine decarboxylase gene in Drosophila melanogaster. Mol Gen Genet 256:652-660. Law GL, Raney A, Heusner C, Morris DR (2001) Polyamine regulation of ribosome pausing at the upstream open reading frame of S-adenosylmethionine decarboxylase. J Biol Chem 276:38036-38043. LaRosa PC, Rhodes D, Rhodes JC, Bressan RA, Csonka LN (1991) Elevated accumulation of proline in NaCI-adapted tobacco cells is not due to altered A1-pyrroline-5-carboxylate reductase. Plant Physiol 96:245-50. Lee MM, Lee SH, Park KY (1997) Characterization and expression of two members of the S- adenosylmethionine decarboxylase gene family in carnation flower. Plant Mol Biol 34:371-382. Lepri O, Bassie L, Safwat G, Thu-Hang P, Trung-Nghia P, Holtta E, Christou P, Capell T (2001) Over-expression of a cDNA for human ornithine decarboxylase in transgenic rice plants alters the polyamine pool in a tissue-specific manner. Mol Genet Genomics 266:303-312. Li Z-Y, Chen, S-Y (2000a) Differential accumulation of the S-adenosylmethionine decarboxylase transcript in rice seedlings in response to salt and drought stresses. Theoret Appl Genet 100:782-788. Li Z-Y, Chen, S-Y (2000b) Isolation and characterization of a salt- and drought- inducible gene for S-adenosylmethionine decarboxylase from wheat (Triticum aestivum L). J Plant Physiol 156:386-93. Lichtenthaler HK, Buschmann C (1987) Chlorophylls and Carotenoids: Measurement UNIT F4.3 and Characterization by UV-VIS Spectroscopy. Curr Prot Food Anal Chem F4:3.1-3.8. LOcker J, Bouwmeester HJ, Schwab W, Blaas J, van der Plas, LHW, Verhoeven HA (2001) Expression of Clarkia S-linalool synthase in transgenic petunia plants results in the accumulation of S-linalyl-beta-D-glucopyranoside. Plant J 27:315-324. Mad Arif SA, Taylor MA, George LA, Butler AR, Burch LR, Davies HV, Stark MJ, Kumar A (1994) Characterisation of the S-adenosylmethionine decarboxylase (SAMDC) gene of potato. Plant Mol Biol 26:327-338. Malmberg RL, Mclndoo J (1983) Abnormal floral development of a tobacco mutant with elevated polyamine levels. Nature 305:623-625. Malnoy M, Venisse JS, Reynoird JP, Chevreau E (2003) Activation of three pathogen-inducible promoters of tobacco in transgenic pear (Pyrus communis L.) after abiotic and biotic elicitation. Planta 216:802-814. Maniatis T, Fritsch EF, Sambrook J (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Press, Cold Spring Harbor, NY. Mansour MMF (2000) Nitrogen containing compounds and adaptation of plants to salinity stress. Biol Plant 43:491-500. Mantis J, Tague BW (2000) Comparing the utility of (3-glucuronidase and green fluorescent protein for detection of weak promoter activity in Arabidopsis thaliana. Plant Mol Biol Rep 18:319-330. Marco F, Carrasco P (2002) Expression of the pea S-adenosylmethionine decarboxylase gene is involved in developmental and environmental responses. Planta 214:641-647. Martin K, Kopperud K, Chakrabarty R, Banerjee R, Brooks R, Goodin MM (2009) Transient expression in Nicotiana benthamiana fluorescent marker lines provides enhanced definition of protein localization, movement and interactions in planta. Plant J 59:150-162. Martin T, Wohner RV, Hummel S, Willmitzer L, Frommer WB (1992) The GUS reporter system as a tool to study gene expression. In Gallagher SR ed, GUS Protocols. Academic Press Inc, Boston, pp 23-43 Masgrau C, Altabella T, Farras R, Flores D, Thompson AJ, Besford RT, Tiburcio AF (1997)

198 Inducible overexpression of oat arginine decarboxylase in transgenic tobacco plants. Plant J 11:465-473. Mattoo AK, Minocha SC, Minocha R, Handa AK (2010a) Polyamines and cellular metabolism in plants: transgenic approaches reveal different responses to diamine putrescine versus higher polyamines spermidine and spermine. Amino Acids 38:405-413. Mattoo AK, Shukla V, Fatima T, Handa AK, Yachha SK (2010b) Genetic Engineering to Enhance Crop-Based Phytonutrients (Nutraceuticals) to Alleviate Diet-Related Diseases. In MT Giardi, G Rea, B Berra. Bio-Farms for Nutraceuticals: Functional Food and Safety Control by Biosensors. Landes Bioscience and Springer Science+Business Media. Mattoo AK, Sobolev AP, Neelam A, Goyal RK, Handa AK, Segre AL (2006) Nuclear magnetic resonance spectroscopy-based metabolite profiling of transgenic tomato fruit engineered to accumulate spermidine and spermine reveals enhanced anabolic and nitrogen-carbon interactions. Plant Physiol 142:1759-1770. Mayer MJ, Michael AJ (2003) Polyamine homeostasis in transgenic plants overexpressing ornithine decarboxylase includes ornithine limitation. J Biochem 134:765-772. Mazzucotelli E, Tartari A, Cattivelli L, Foriani G (2006) Metabolism of GABA during cold acclimation and freezing and its relationship to frost tolerance in barley and wheat. J Exp Bot 57:3755-3766. McCarthy HR, Oren R, Johnsen KH, Gallet-Budynek A, Pritchard SG, Cook CW, LaDeau SL, Jackson RB, Finzi AC (2010) Re-assessment of plant carbon dynamics at the Duke free- air C02 enrichment site: interactions of atmospheric [C02] with nitrogen and water availability over stand development. New Phytol 185:514-528. Mehta RA, Cassol T, Li N, Ali N, Handa AK, Mattoo AK (2002) Engineered polyamine accumulation in tomato enhances phytonutrient content, juice quality, and vine life. Nat Biotechnol 20:613-618. Melillo JM, Butler S, Johnson J, Mohan J, Steudler P, Lux H, Burrows E, Bowles F, Smith R, Scott L, Vario C, Hill T, Burton A, Zhou Y-M, Tang J (2011) Soil warming, carbon- nitrogen interactions, and forest carbon budgets. Proc Natl Acad Sci USA. doi/10.1073/pnas.1018189108. Mengoli M, Bagni N, Luccarini G, Nuti Ronchi V, Serafini-Fracassini D (1989) Daucus carota cell cultures: polyamines and effect of polyamine biosynthesis inhibitors in the pre- embryogenic phase and different embryo stages. J Plant Physiol 134:389-394. Meskaoui AE, Trembaly FM (2009) Effects of exogenous polyamines and inhibitors of polyamine biosynthesis on endogenous free polyamine contents and the maturation of white spruce somatic embryos. African J Biotechnol 8:6807-6816. Miller AJ, Fan X, Shen Q, Smith SJ (2007) Amino acids and nitrate as signals for the regulation of nitrogen acquisition. J Exp Bot 59:111-119. Minocha R, Lee JS, Long S, Bhatnagar P, Minocha SC (2004) Physiological responses of wild type and putrescine-overproducing transgenic cells of poplar to variations in the form and concentration of nitrogen in the medium. Tree Physiol 24:551-560. Minocha R, Long S (2004) Simultaneous separation and quantitation of amino acids and polyamines of forest tree tissues and cell cultures within a single high-performance liquid chromatography run using dansyl derivatization. J Chromatogr A 1035:63-73. Minocha R, Minocha SC, Simola LK (1995) Somatic embryogenesis and polyamines in woody plants. In SM Jain, PK Gupta, RJ Newton, eds, Somatic Embryogenesis in Woody Plants, Vol I. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 337-359. Minocha SC, Minocha R (1995) Role of polyamines in somatic embryogenesis. In: Y.P.S. Bajaj (ed.), Biotechnology in Agriculture and Forestry, Vol. 30, Somatic Embryogenesis and Synthetic Seed, Springer Verlag, Berlin, pp. 55-72. Mitchell JJ (2004) The expression of polyamine biosynthetic genes: arginine decarboxylase (ADC2) and S-adenosylmethionine decarboxylase (SAMDC1). Master's thesis, University of New Hampshire. Mohapatra S, Cherry S, Minocha R, Majumdar R, Thangavel P, Long S, Minocha SC (2010a) The response of high and low polyamine-producing cell lines to aluminum and calcium stress. Plant Physiol Biochem 48:612-620. Mohapatra S, Minocha R, Long S, Minocha SC (2010b) Transgenic manipulation of a single

199 polyamine in poplar cells affects the accumulation of all amino acids. Amino Acids 38:1117-1129. Mohapatra S, Minocha R, Long S, Minocha SC (2009) Putrescine overproduction negatively impacts the oxidative state of poplar cells in culture. Plant Physiol Biochem 47:262-271. Morris SM Jr (2006) Arginine: beyond protein. Am J Clin Nutr 83:508S-512S. Morris SM Jr (2007) Arginine metabolism: boundaries of our knowledge. J Nutr 137:1602S- 1609S. Moschou PN, Delis ID, Paschalidis KA, Roubelakis-Angelakis KA (2008a) Transgenic tobacco plants overexpressing polyamine oxidase are not able to cope with oxidative burst generated by abiotic factors. Physiol Plant 133:140-156. Moschou PN, Paschalidis KA, Delis ID, Andriopoulou AH, Lagiotis GD, Yakoumakis Dl, Roubelakis-Angelakis KA (2008b) Spermidine exodus and oxidation in the apoplast induced by abiotic stress is responsible for H202 signatures that direct tolerance responses in tobacco. Plant Cell 20:1708-1724. Moschou PN, Sanmartin M, Andriopoulou AH, Rojo E, Sanchez-Serrano JJ, Roubelakis- Angelakis KA (2008c) Bridging the gap between plant and mammalian polyamine catabolism: a novel peroxisomal polyamine oxidase responsible for a full back-conversion pathway in Arabidopsis. Plant Physiol 47:1845-1857. Muhlemann O (2008) Recognition of nonsense mRNA: towards a unified model. Biochem Soc Trans 36:497-501. Muniz L, Minguet EG, Singh SK, Pesquet E, Vera-Sirera F, Moreau-Courtois CL, Carbonell J, Blazquez MA, Tuominen H (2008) Acaulis5 controls Arabidopsis xylem specification through the prevention of premature cell death. Development 135:2573-2582. Murray MG, Thompson WF (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8:4321-4325. Nambeesan S, Datsenka T, Ferruzzi MG, Malladi A, Mattoo AK, Handa AK (2010) Overexpression of yeast spermidine synthase impacts ripening, senescence and decay symptoms in tomato. Plant J 63:836-847. Neily MH, Matsukura C, Maucourt M, Bernillon S, Deborde C, Moing A, Yin YG, Saito T, Mori K, Asamizu E, Rolin D, Moriguchi T, Ezura H (2010) Enhanced polyamine accumulation alters carotenoid metabolism at the transcriptional level in tomato fruit over-expressing spermidine synthase. J Plant Physiol 168:242-252. Nishimura K, Liisanantti M, Muta Y, Kashiwagi K, Shirahata A, Janne M, Kankare K, Janne OA, Igarashi K (1999) Structure and activity of mouse S-adenosylmethionine decarboxylase gene promoters and properties of the encoded proteins. Gene 238:343-350. Noh EW, Minocha SC (1994) Expression of a human S-adenosylmethionine decarboxylase cDNA in transgenic tobacco and its effects on polyamine biosynthesis. Transgenic Res 3:26-35. Nolke G, Schneider B, Agdour S, Drossard J, Fischer R, Schillberg S (2008) Modulation of polyamine biosynthesis in transformed tobacco plants by targeting ornithine decarboxylase to an atypical subcellular compartment. Open Biotechnol J 2:183-189. Noury M, Bassie L, Lepri O, Kurek I, Christou P, Capell T (2000) A transgenic rice cell lineage expressing the oat arginine decarboxylase (ADC) cDNA constitutively accumulates putrescine in callus and seeds but not in vegetative tissues. Plant Mol Biol 43:537-544. Nyiko T, Sonkoly B, Merai Z, Benkovics AH, Silhavy D (2009) Plant upstream ORFs can trigger nonsense-mediated mRNA decay in a size-dependent manner. Plant Mol Biol 71:367- 378. O'Connor TR, Dyreson C, Wyrick JJ (2005) Athena: a resource for rapid visualization and systematic analysis of Arabidopsis promoter sequences. Bioinformatics 21:4411-4413. Ozawa R, Bertea CM, Foti M, Narayana R, Arimura G-l, Muroi A, Horiuchi J-l, Nishioka T, Maffei ME, Junji Takabayashi J (2009) Exogenous Polyamines Elicit Herbivore-Induced Volatiles in Lima Bean Leaves: Involvement of Calcium, H202 and Jasmonic Acid. Plant Cell Physiol 50:2183-2199. Page AF, Minocha R, Minocha SC (2010) Living with high putrescine: expression of ornithine and arginine biosynthetic pathway genes in high and low putrescine producing poplar cells. Amino Acids. DOI 10.1007/s00726-010-0807-9.

200 Page AF, Mohapatra S, Minocha R, Minocha SC (2007) The effects of genetic manipulation of putrescine biosynthesis on transcription and activities of the other polyamine biosynthetic enzymes. Physiol Plant 129:707-724. Pajunen A, Crozat A, Janne OA, lhalainen R, Laitinen PH, Stanley B, Madhubala R, Pegg AE (1988) Structure and regulation of mammalian S-adenosylmethionine decarboxylase. J Biol Chem 263:17040-17049. Palsson B (2009) Metabolic systems biology. FEBS Lett 583:3900-3904. Park S-U, Johnson AG, Penzes-Yost C, Facchini PJ (1999) Analysis of promoters from tyrosine/dihydroxyphenylalanine decarboxylase and berberine bridge enzyme genes involved in benzylisoquinoline alkaloid biosynthesis in Opium poppy. Plant Mol Biol 40:121-131. Park SJ, Cho YD (1999) Identification of functionally important residues of Arabidopsis thaliana S- adenosylmethionine decarboxylase. J Biochem 126:996-1003. Paschalidis KA, Roubelakis-Angelakis KA (2005) Spatial and temporal distribution of polyamine levels and polyamine anabolism in different organs/tissues of the tobacco plant. Correlations with age, cell division/expansion, and differentiation. Plant Physiol 138:142- 152. Passardi F, Cosio C, Penel, Dunand C (2005) Peroxidases have more functions than a swiss army knife. Plant Cell Rep 24:255-265. Pedros AR, MacLeod MR, Ross HA, McRae D, Tiburcio AF, Davies HV, Taylor MA (1999) Manipulation of S-adenosylmethionine decarboxylase activity in potato tubers. An increase in activity leads to an increase in tuber number and a change in tuber size distribution. Planta 209:153-160. Pegg AE, McGill S (1979) Decarboxylation of ornithine and lysine in rat tissues. Biochim Biophys Acta 568:416-427. Pegg AE, Wechter RS, Clark RS, Wiest L, Erwin BG (1986) Acetylation of decarboxylated S- adenosylmethionine by mammalian cells. Biochemistry 25:379-384. Peremarti A, Bassie L, Christou P, Capell T (2009) Spermine facilitates recovery from drought but does not confer drought tolerance in transgenic rice plants expressing Datura stramonium S-adenosylmethionine decarboxylase. Plant Mol Biol 70:253-264. Peremarti A, Bassie L, Yuan D, Pelacho A, Christou P, Capell T (2010) Transcriptional regulation of the rice arginine decarboxylase (Add) and S-adenosylmethionine decarboxylase (Samdc) genes by methyl jasmonate. Plant Physiol Biochem 48:553-559. Perez-Amador MA, Leon J, Green PJ, Carbonell J (2002) Induction of the arginine decarboxylase ADC2 gene provides evidence for the involvement of polyamines in the wound response in Arabidopsis. Plant Physiol 130:1454-1463. Pilate G, Guiney E, Holt K, Petit-Conil M, Lapierre C, Leple JC, Pollet B, Mila I, Webster EA, Marstorp HG, et al (2002) Field and pulping performances of transgenic trees with altered lignification. Nat Biotechnol 20:607-612. Prabhavathi VR, Rajam MV (2007) Polyamine accumulation in transgenic eggplant enhances tolerance to multiple abiotic stresses and fungal resistance. Plant Biotechnol 24:273-282. Qu LQ, Takaiwa F (2004) Evaluation of tissue specificity and expression strength of rice seed component gene promoters in transgenic rice. Plant Biotechnol J 2:113-125. Quan Y, Minocha R, Minocha SC (2002) Genetic manipulation of polyamine metabolism in poplar II: effects on ethylene biosynthesis. Plant Physiol Biochem 40:929-937. Quinet M, Ndayiragije A, Lefevre I, Lambillotte B, Dupont-Gillain CC, Lutts S (2010) Putrescine differently influences the effect of salt stress on polyamine metabolism and ethylene synthesis in rice cultivars differing in salt resistance. J Exp Bot 61:2719-2733. Rademacher T, Hausler RE, Hirsch H-J, Zhang L, Lipka V, Weier D, Kreuzaler F, Peterhansel C (2002) An engineered phosphoenolpyruvate carboxylase redirects carbon and nitrogen flow in transgenic potato plants. Plant J 32:25-39. Rajyalakshmi K, Chowdhry CN, Maheshwari N, Maheshwari SC (1995) Anther culture response in some Indian wheat cultivars and the role of polyamines in induction of haploids. Phytomorphology 45:139-145. Rambia JL, Vera-Sirera F, Blazquez MA, Carbonell J, Granell A (2010) Quantitation of biogenic tetraamines in Arabidopsis thaliana. Anal Biochem 397:208-211.

201 Rastogi R, Sawhney VK (1990) Polyamines and Flower Development in the Male Sterile Stamenless-2 Mutant of Tomato (Lycopersicon esculentum Mill.): I. Level of Polyamines and Their Biosynthesis in Normal and Mutant Flowers. Plant Physiol 93:439-445. Rea G, de Pinto MC, Tavazza R, Biondi S, Gobbi V, Ferrante P, De Gara L, Federico R, Angelini R, Tavladoraki P (2004) Ectopic expression of maize polyamine oxidase and pea copper amine oxidase in the cell wall of tobacco plants. Plant Physiol 134:1414-1426. Rees JD, Ingle RA, Smith JAC (2009) Relative contributions of nine genes in the pathway of histidine biosynthesis to control of free histidine concentrations in Arabidopsis thaliana. Plant Biotechnol J 7:499-511. Rebbapragada I, Lykke-Andersen J (2009) Execution of nonsense-mediated mRNA decay: what defines a substrate? Curr Opin Cell Biol 21:394-402. Rose AB (2008) Nuclear pre-mRNA Processing in Plants. Curr Top Microbiol Immunol 326:277- 290. Roy M, Wu R (2001) Arginine decarboxylase transgene expression and analysis of environmental stress tolerance in transgenic rice. Plant Sci 160:869-875. Roy M, Wu R (2002) Overexpression of S-adenosylmethionine decarboxylase gene in rice increases polyamine level and enhances sodium chloride-stress tolerance. Plant Sci 163:987-992. Sayle R (1995) RasMol. Glaxo Wellcome Research and Development, Hertfordshire, UK. Scheible W-R, Krapp A, Stitt M (2000) Reciprocal changes of phosphenolpyruvate carboxylase and cytosolic pyruvate kinase, citrate synthase and NADP-isocitrate dehydrogenase expression regulate organic acid metabolism during nitrate assimilation in tobacco leaves. Plant Cell Env 23:1155-1167. Schenk PM, Sagi L, Remans T, Dietzgen RG, Bernard MJ, Graham MW, Manners JM (1999) A promoter from sugarcane bacilliform badnavirus drives transgene expression in banana and other monocot and dicot plants. Plant Mol Biol 39:1221-1230. Schnee C, Kollner TG, Held M, Turlings TCJ, Gershenzon J, Degenhardt J (2006) The products of a single maize sesquiterpene synthase form a volatile defense signal that attracts natural enemies of maize herbivores. Proc Natl Acad Sci USA 103:1129-1134. Seiler N (2004) Catabolism of polyamines. Amino Acids 26:217-233. Shao L, Majumdar R, Minocha SC (2011) Profiling the aminopropyltransferases in plants: their structure, expression and manipulation. Amino Acids. doi:10.1007/s00726-011-0998-8. Shargool PD, Jain JC, McKay G (1988) Ornithine biosynthesis and arginine biosynthesis and degradation in plants cells. Phytochemistry 27:1571-1574. Shen W, Nada K, Tachibana S (2000) Involvement of polyamines in the chilling tolerance of cucumber cultivars. Plant Physiol 124:431-439. Shevyakova Nl, ll'ina EN, Stetsenko LA, Kuznetsov VIV (2010) Nickel accumulation in rape shoots (Brassica napus L.) increased by putrescine. Int J Phytoremediation. DOI:10.1080/15226514.2010.495147. Shi S-Q, Shi Z, Jiang Z-P, Qi L-W, Sun X-M, Li C-X, Liu J-F, Xiao W-F, Zhang S-G (2010) Effects of exogenous GABA on gene expression of Caragana intermedia roots under NaCi stress: regulatory roles for H202 and ethylene production. Plant Cell Env 33:149-162. Shibata M, Shinga J, Yasuhiko Y, Kai M, Miura K, Shimogori T, Kashiwagi K, Igarashi K, Shiokawa K (1998) Overexpression of S-adenosylmethionine decarboxylase (SAMDC) in early Xenopus embryos induces cell dissociation and inhibits transition from the blastula to gastrula stage. Int J Dev Biol 42:675-686. Silva AL, Romao L (2009) The mammalian nonsense-mediated mRNA decay pathway: to decay or not to decay! Which players make the decision? FEBS Lett 583:499-505. Sinclair TR, Purcell LC, Sneller CH (2004) Crop transformation and the challenge to increase yield potential. Trends Plant Sci 9:70-75. Singh A, Nirala NK, Das S, Narula A, Rajam MV, Srivastava PS (2011) Overexpression of ode (ornithine decarboxylase) in Datura innoxia enhances the yield of scopolamine. Acta Physiol Plant. DOI 10.1007/s11738-011-0787-8. Slocum RD (1991) Polyamine biosynthesis in plants. In RD Slocum, HE Flores, eds, Biochemistry and Physiology of Polyamines in Plants. CRC Press, Boca Raton, FL, pp 23-40.

202 Slocum RD (2005) Genes, enzymes and regulation of arginine biosynthesis in plants. Plant Physiol Biochem 43:729-745. Smirnova OG, Ibragimova SS, Kochetov AV (2011) Simple database to select promoters for plant transgenesis. Transgenic Res. doi 10.1007/s11248-011-9538-2. Song J, Nada K, Tachibana S (2001) The early increase of S-adenosylmethionine decarboxylase activity is essential for the normal germination and tube growth in tomato (Lycopersicon esculentum Mill.) pollen. Plant Sci. 161: 507-515 Song J, Nada K, Tachibana S (2002) Suppression of S-adenosylmethionine decarboxylase activity is a major cause for high-temperature inhibition of pollen germination and tube growth in tomato (Lycopersicon esculentum Mill.). Plant Cell Physiol 43:619-627. Song J, Tachibana S (2007) Loss of viability of tomato pollen during long-term dry storage is associated with reduced capacity for translating polyamine biosynthetic enzyme genes after rehydration. J Exp Bot 58:4235-4244. Soyka S, Heyer AG (1999) Arabidopsis knockout mutation of ADC2 gene reveals inducibility by osmotic stress. FEBS Lett 458:219-223. Stanley BA, Pegg AE (1991) Amino acid residues necessary for putrescine stimulation of human S-adenosylmethionine decarboxylase proenzyme processing and catalytic activity. J Biol Chem 266:18502-18506. Stanley BA, Shantz LM, Pegg AE (1994) Expression of mammalian S-adenosylmethionine decarboxylase in Escherichia coli. Determination of sites for putrescine activation of activity and processing. J Biol Chem 269:7901-7907. Stitt M, Muller C, Matt P, Gibon Y, Carillo P, Morcuende R, Scheible WR, Krapp A (2002) Steps towards an integrated view of nitrogen metabolism. J Exp Bot 53:959-970. Suresh MR, Adiga PR (1977) Putrescine-sensitive (artifactual) and insensitive (biosynthetic) S- adenosyl-L-methionine decarboxylase activities of Lathyrus sativus seedlings. Eur J Biochem 79:511-518. Suzuki Y, Hirasawa E (1980) S-adenosylmethionine decarboxylase of corn seedlings. Plant Physiol 66:1091-1094. Takahashi H, Takahara K, Hashida S-N, Hirabayashi T, Fujimori T, Kawai-Yamada M, Yamaya T, Yanagisawa S, Uchimiya H (2010) Pleiotropic Modulation of Carbon and Nitrogen Metabolism in Arabidopsis Plants Overexpressing the NAD kinase! Gene. Plant Physiol 151:100-113. Tassoni A, Franceschetti M, Bagni N (2008) Polyamines and salt stress response and tolerance in Arabidopsis thaliana flowers. Plant Physiol Biochem 46:607-613. Tassoni A, Franceschetti M, Tasco G, Casadio R, Bagni N (2007) Cloning, functional identification and structural modelling of Vitis vinifera S-adenosylmethionine decarboxylase. J Plant Physiol 164:1208-1219. Tavladoraki P, Rossi MN, Saccuti G, Perez-Amador MA, Polticelli F, Angelini R, Federico R (2006) Heterologous expression and biochemical characterization of a polyamine oxidase from Arabidopsis involved in polyamine back-conversion. Plant Physiol 141:1519-1532. Thu-Hang P, Bassie L, Safwat G, Trung-Nghia P, Christou P, Capell T (2002) Expression of a heterologous S-adenosylmethionine decarboxylase cDNA in plants demonstrates that changes in S-adenosyl-L-methionine decarboxylase activity determine levels of the higher polyamines spermidine and spermine. Plant Physiol 129:1744-1754. Tian AG, Zhao JY, Zhang JS, Gai JY, Chen SY (2004) Genomic characterization of the S- adenosylmethionine decarboxylase genes from soybean. Theor Appl Genet 108:842-850. Tolbert WD, Ekstrom JL, Mathews, II, Secrist JA, 3rd, Kapoor P, Pegg AE, Ealick SE (2001) The structural basis for substrate specificity and inhibition of human S-adenosylmethionine decarboxylase. Biochemistry 40:9484-9494. Torrigiani P, Scaramagli S, Ziosi V, Mayer M, Biondi S (2005) Expression of an antisense Datura stramonium S-adenosylmethionine decarboxylase cDNA in tobacco: changes in enzyme activity, putrescine-spermidine ratio, rhizogenic potential, and response to methyl jasmonate. J Plant Physiol 162:559-571. Toumi I, Moschou PN, Paschalidis KA, Bouamama B, Ben Salem-Fnayou A, Ghorbel AW, Mliki A, Roubelakis-Angelakis KA (2010) Abscisic acid signals reorientation of polyamine metabolism to orchestrate stress responses via the polyamine exodus pathway in

203 grapevine. J Plant Physiol 167:519-525. Tran MK, Schultz CJ, Baumann U (2008) Conserved upstream open reading frames in higher plants. BMC Genomics 9:361-377. Trenor M, Perez-Amador MA, Carbonell J, Blazquez MA (2010) Expression of polyamine biosynthesis genes during parthenocarpic fruit development in Citrus Clementina. Planta 231:1401-1411. Urano K, Hobo T, Shinozaki K (2005) Arabidopsis ADC genes involved in polyamine biosynthesis are essential for seed development. FEBS Lett 579:1557-1564. Urano K, Maruyama K, Ogata Y, Morishita Y, Takeda M, Sakurai N, Suzuki H, Saito K, Shibata D, Kobayashi M, Yamaguchi-Shinozaki K, Shinozaki K (2009) Characterization of the ABA- regulated global responses to dehydration in Arabidopsis by metabolomics. Plant J 57:1065-1078. Urano K, Yoshiba Y, Nanjo T, Igarashi Y, Seki M, Sekiguchi F, Yamaguchi-Shinozaki K, Shinozaki K (2003) Characterization of Arabidopsis genes involved in biosynthesis of polyamines in abiotic stress responses and developmental stages. Plant Cell Env 26:1917-1926. Urano K, Yoshiba Y, Nanjo T, Ito T, Yamaguchi-Shinozaki K, Shinozaki K (2004) Arabidopsis stress-inducible gene for arginine decarboxylase AtADC2 is required for accumulation of putrescine in salt tolerance. Biochem Biophys Res Commun 313:369-375. Varma SK (2003) Characterization of SAMDC (S-adenosylmethionine decarboxylase) and an ADC (arginine decarboxylase) gene from carrot (Daucus carota L.). Master's thesis, University of New Hampshire. Verhoeyen ME, Bovy A, Collins G, Muir S, Robinson S, de Vos CHR, Colliver S (2002) Increasing antioxidant levels in tomatoes through modification of the flavonoid biosynthetic pathway. J Exp Bot 53:2099-2106. Waie B, Rajam MV (2003) Effect of increased polyamine biosynthesis on stress responses in transgenic tobacco by introduction of human S-adenosylmethionine gene. Plant Sci 164:727-734. Wang J, Liu J-H, Kurosawa T, Nada K, Ban Y, Moriguchi T (2010) Cloning, biochemical identification, and expression analysis of a gene encoding S-adenosylmethionine decarboxylase in navel orange (Citrus sinensis Osbeck). J Hort Science Biotechnol 85:219-226. Wang J, Sun P-P, Chen C-L, Wang Y, Fu X-Z, Liu J-H (2011) An arginine decarboxylase gene PtADC from Poncirus trifoliata confers abiotic stress tolerance and promotes primary root growth in Arabidopsis. J Exp Bot. doi:10.1093/jxb/erq463. Watson MB, Emory KK, Platak RM, Malmberg RL (1998) Arginine decarboxylase (polyamine synthesis) mutants of Arabidopsis thaliana exhibit altered root growth. Plant J 13:231- 239. Wellendorph P, Hansen KB, Balsgaard A, Greenwood JR, Egebjerg J, Brauner-Osborne H (2005) Deorphanization of GPRC6A: a promiscuous L-alpha-amino acid receptor with preference for basic amino acids. Mol Pharmacol 67:589-597. Wen XP, Pang XM, Matsuda N, Kita M, Inoue H, Hao YJ, Honda C, Moriguchi T (2008) Over- expression of the apple spermidine synthase gene in pear confers multiple abiotic stress tolerance by altering polyamine titers. Transgenic Res 17:251-263. Wen XP, Ban Y, Inoue H, Matsuda N, Moriguchi T (2009) Aluminum tolerance in a spermidine synthase-overexpressing transgenic European pear is correlated with the enhanced level of spermidine via alleviating oxidative status. Environ Exp Bot 66:471-478. Wen XP, Ban Y, Inoue H, Matsuda N, Moriguchi T (2010) Spermidine levels are implicated in heavy metal tolerance in a spermidine synthase overexpressing transgenic European pear by exerting antioxidant activities. Transgenic Res 19:91-103. Wi SJ, Kim WT, Park KY (2006) Overexpression of carnation S-adenosylmethionine decarboxylase gene generates a broad-spectrum tolerance to abiotic stresses in transgenic tobacco plants. Plant Cell Rep 25:1111-1121. Wilson SM, Hawel L, Pastorian KE, Byus CV (2005) A stable, inducible, dose-responsive ODC overexpression system in human cell lines. Biochim Biophys Acta 1732:103-110.

204 Xiao Y-L, Redman JC, Monaghan EL, Zhuang J, Underwood BA, Moskai WA, Wang W, Wu HC, Town CD (2010) High throughput generation of promoter reporter (GFP) transgenic lines of low expressing genes in Arabidopsis and analysis of their expression patterns. Plant Methods 6:18-30. Xiong H, Stanley BA, Tekwani BL, Pegg AE (1997) Processing of mammalian and plant S- adenosylmethionine decarboxylase proenzymes. J Biol Chem 272:28342-28348. Yamaguchi K, Takahashi Y, Berberich T, Imai A, Miyazaki A, Takahashi T, Michael A, Kusano T (2006) The polyamine spermine protects against high salt stress in Arabidopsis thaliana. FEBS Lett 580:6783-6788. Yamaguchi K, Takahashi Y, Berberich T, Imai A, Takahashi T, Michael AJ, Kusano T (2007) A protective role for the polyamine spermine against drought stress in Arabidopsis. Biochem Biophys Res Commun 352:486-490. Yamamoto YY, Obokata J (2008) ppdb: a plant promoter database. Nucleic Acids Res 36:D977- D981. Yamanoha B, Cohen SS (1985) S-adenosylmethionine decarboxylase and spermidine synthase from Chinese cabbage. Plant Physiol 78:784-790. Yang YG, Cho YD (1991) Purification of S-adenosylmethionine decarboxylase from soybean. Biochem Biophys Res Commun 181:1181-1186. Yilmaz A, Mejia-Guerra MK, Kurz K, Liang X, Welch L, Grotewold E (2011) AGRIS: the arabidopsis gene regulatory information server, an update. Nucleic Acids Res 39:D1118— D1122. Yoshida I, Yamagata H, Hirasawa E (1998) Light-regulated gene expression of S- adenosylmethionine decarboxylase in Pharbitis nil. J Exp Bot 49:617-620. Yoshida I, Yamagata H, Hirasawa E (1999) Blue- and red-light regulation and circadian control of gene expression of S-adenosylmethionine decarboxylase in Pharbitis nil. J Exp Bot 50:319-326. Yoshida I, Yamagata H, Hirasawa E (2002) Signal transduction controlling the blue- and red-light mediated gene expression of S-adenosylmethionine decarboxylase in Pharbitis nil. J Exp Bot 53:1525-1529. Zahedi K, Barone S, Kramer DL, Amlal H, Alhonen L, Janne J, Porter CW, Soleimani M (2010) The role of spermidine/spermine N1-acetyltransferase in endotoxin-induced acute kidney injury. Am J Physiol Cell Physiol 299:C164-C174. Zhang S, Gu J, Yang N-S, Kao C, Gardner TA, Eble JN, Cheng L (2002) Relative promoter strenghts in four human prostate cancer cell lines evaluated by particle bombardment- mediated gene transfer. The Prostate 51: 286-292. Zhang Y, Yin H, Li D, Zhu W, Li Q (2008) Functional analysis of BADH gene promoter from Suaeda liaotungensis K. Plant Cell Rep 27:585-592. Zhu X, Galili G (2003) Increased lysine synthesis coupled with a knockout of its catabolism synergistically boosts lysine content and also transregulates the metabolism of other amino acids in Arabidopsis seeds. Plant Cell 15:845-853.

205 SUPPLEMENTAL MATERIAL

(a)

60^

> E, c(/) ao tn 8 20-

Figure SI. Representative HPLC chromatograms of WT (a) and m(9DCl-7 (b) plants showing separation of dansyl-polyamines. Heptanediamine (Hd) was used as an internal standard.

I Arg+Thr+Gly I A

i - >

%MIA ' /". $ r. I 1 , '"Vs r\> ; w\

1 V MVW %, niiF s I j f j^ r'^Tl fif -rFrrrr* ri T" TFI **•"* -^^^!^?'^ ^ ^y*^ ^^ y-fjjfjjmt r^ n n Tr-^ 5 * X "*2 3* $& *» 4.'

Figure S2. A representative HPLC chromatogram of dansylated amino acids. Note the lack of clear separation of Arg, Thr and Gly at retention time around 13.12 min. For retention times of other amino acids, see Table SI. Table SI. Typical Retention times of dansyl-amino acids eluted in the HPLC system.

Amino acid Retention time (min) Asp 7.06 Glu 7.40 Gin 11.06 Ser 12.12 Arg 12.92 Thr 13.57 Gly 13.90 Ala 14.89 Pro 16.93 GABA 17.89 Val 19.47 Met 20.26 lie 22.92 Leu 23.22 Trp 23.68 Phe 24.29 Cys 25.75 Orn 33.90 Lys 34.39 His 34.82