A Novel Mutation and Large Size Polymorphism Affecting the V2

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector ORIGINAL ARTICLE

A Novel Mutation and Large Size Polymorphism Affecting the V2 Domain of Keratin 1 in an African-American Family with Severe, Diffuse Palmoplantar Keratoderma of the Ichthyosis Hystrix Curth–Macklin Type Elizabeth S. Richardson1, Jason B. Lee1, Patricia H. Hyde1 and Gabriele Richard1

Keratin gene mutations affecting nonhelical head and tail domains are not usually associated with prominent skin blistering and keratin filament clumping. Instead, they have been associated with several distinct clinical phenotypes, such as epidermolysis bullosa simplex with mottled pigmentation (mutation P25L in the V1 domain of keratin 5), epidermolysis bullosa simplex with migratory circinate erythema (frameshift mutation c1649delG in the V2 domain of keratin 5), striate palmoplantar keratoderma (PPK), and ichthyosis hystrix Curth–Macklin (different frameshift mutations in the V2 domain of keratin 1 (K1)). We have studied a family with severe, diffuse, nonepidermolytic PPK and verrucous hyperkeratotic plaques over the joints and in flexures and identified a new KRT1 gene mutation that is predicted to completely alter the K1 tail domain. In addition, a new K1 size polymorphism has been detected, which is especially prevalent among the African-American population. These results further emphasize the functional importance of the nonhelical tail domain in keratin molecules despite the obvious variability in the number of glycine loop motifs and underscore the broad phenotypic spectrum of disorders due to dominant keratin tail mutations. Journal of Investigative Dermatology (2006) 126, 79–84. doi:10.1038/sj.jid.5700025

INTRODUCTION and formation of perinuclear filamentous shells formed by Ichthyosis hystrix is a descriptive name for extensive and very feathery, entangled keratin intermediate filaments (KIF). Two severe, spiky or verrucous hyperkeratosis. It is often a clinical large families with autosomal dominant inheritance and feature of epidermolytic hyperkeratosis or other disorders of several sporadic cases of IHCM have been reported since its cornification, such as erythrokeratodermia variabilis. Ichthyo- first description in 1954 (Ollendorff Curth and Macklin, sis hystrix of Curth–Macklin (IHCM, OMIM (Online Mende- 1954; Ollendorff-Curth et al., 1972; Kanerva et al., 1984; lian Inheritance of Man) 146590) is a distinct autosomal Niemi et al., 1990). Sprecher et al. (2001) studied a three- dominant disorder characterized by severe, fissuring and generation African-American family with IHCM with mas- mutilating palmoplantar keratoderma (PPK) and dark hyper- sive, mutilating PPK and variable involvement of other body keratotic plaques over knuckles, knees, and elbows. In some surfaces. All affected family members were found to harbor a patients, symmetrically distributed verrucous plaques may heterozygous mutation in the KRT1 gene, substituting two cover almost the entire body, as described and depicted by guanine bases for an adenine base (c.1609GG-A). This Ollendorff Curth and Macklin (1954) and Ollendorff-Curth frameshift mutation occurred in a sequence encoding the et al. (1972). Structural and ultrastructural hallmarks of this variable (V2) domain of keratin 1 (K1) and was shown to genodermatosis are compact orthokeratotic hyperkeratosis, produce an aberrant and truncated protein tail of 77 residues, hypergranulosis with perinuclear edema, binucleated cells, which lacked seven out of 10 glycine loops. The results of protein modeling of mutant K1, in vitro assembly of mutant 1Department of Dermatology and Cutaneous Biology, The Jefferson Institute K1/K10 intermediate filaments, and observed intracellular of Molecular Medicine, Jefferson Medical College, Philadelphia, misdistribution of loricrin suggested novel functions for the Pennsylvania, USA V2 domain of K1 in KIF bundling and KIF interactions with Correspondence: Dr Gabriele Richard, GeneDx Inc., 207 Perry Parkway, nuclear envelope proteins and loricrin (Sprecher et al., 2001). Gaithersburg, Maryland 20877, USA. E-mail: [email protected] Interestingly, a different single nucleotide deletion of KRT1 Abbreviations: IHCM, ichthyosis hystrix Curth–Macklin; K1, keratin 1; KIF, keratin intermediate filament; KRT1, keratin 1 gene; PPK, palmoplantar (c.1628delG) with almost similar consequences on the keratoderma; V1,V2, variable domains protein level has been reported in a four-generation British Received 20 June 2005; revised 15 August 2005; accepted 7 September 2005 family with striate PPK (Whittock et al., 2002). In contrast to

& 2006 The Society for Investigative Dermatology www.jidonline.org 79 ES Richardson et al. Keratin 1 Mutation in Ichthyosis Hystrix Curth–Macklin

IHCM, the clinical phenotype was much less severe and RESULTS ultrastructural studies did not demonstrate faulty KIF packa- The proband was a 44-year-old African-American male with ging or shell formation as seen in IHCM. Transfection of a medical history of hypertension, hyperlipidemia, and HaCaT cells with wild-type K10 and four different mutants of progressively worsening PPK. He showed no evidence of K1-GFP (green fluorescent protein) with variable truncation hearing loss or involvement of other ectodermal tissues. The of the V2 tail demonstrated the aberrant nuclear localization family history revealed an autosomal dominant segregation of of the KIF due to the loss of the wild-type V2 domain rather diffuse PPK in his family, with his father, sister, and daughter than the presence of a mutant peptide (Whittock et al., 2002). being affected. The PPK was most severe in the proband’s In a Chinese proband with an atypical variant of daughter, who also had hyperkeratotic plaques over all large epidermolytic hyperkeratosis/ichthyosis bullosa of Siemens, joints and in flexural areas. Sprecher et al. (2003) identified a third de novo mutation Dermatological examination revealed markedly hyperker- (c.1752insG) in exon 9 of KRT1, also resulting in an aberrant atotic, rough and thickened palms and soles with numerous 69 amino-acid long K1 tail and partially disrupting the deep, painful, and bleeding fissures and cracks (Figure 1a and recurrent terminal glycine loops. Collectively, these observa- c). The keratoderma was diffuse with well-defined borders tions illustrate the puzzling phenotypic heterogeneity among without erythema, and extended to the dorsal surface of K1 disorders due to an abnormal tail domain, suggesting the fingers and knuckles. In addition, there were sharply existence of distinct pathogenetic pathways. demarcated hyperkeratotic plaques over elbows and knees In this study, we report a KRT1 mutation that completely (Figure 1e and f) as well as disseminated small, flat alters the K1 tail domain in a patient with clinical features of hyperkeratotic papules on the midline area of the back. A IHCM. In addition, we characterize a new size polymorphism punch biopsy from the left palm revealed papillomatosis, of the KRT1 gene, which is especially prevalent among the striking hypergranulosis, and massive, compact hyperkera- African-American population. These results further empha- tosis of the epidermis (Figure 1h). There were a few size the functional importance of the nonhelical tail domains binucleated cells, and multiple granular cells showed a of keratin molecules. perinuclear halo as previously reported in IHCM. Based on

Figure 1. Clinical features. (a) Proband with massive, diffuse hyperkeratosis and deep fissures on the soles of both feet. (b) Soles almost completely cleared after treatment with 40% urea cream under occlusion and mechanical filing. Thickened and fissured palms (c) before and (d) after treatment with acitretin. (e) Keratotic plaques over the dorsae of both hands. Keratotic plaques over elbows before (f) and after (g) treatment with acitretin. (h) A punch biopsy from the left palm revealed a papillomatous epidermis with hypergranulosis and marked hyperkeratosis. The insets (bottom) show perinuclear halos (asterisks) and binucleated cells (arrow) in the granular layer.

80 Journal of Investigative Dermatology (2006), Volume 126 ES Richardson et al. Keratin 1 Mutation in Ichthyosis Hystrix Curth–Macklin

clinical and histological findings, which closely resembled a C1 C2 C3 C4 Pt the IHCM phenotype reported by Sprecher et al. (2001), IIII I II II I II I II epidermolytic PPK was excluded and a clinical diagnosis of 300 bp 279 bp IHCM was made, although an additional skin biopsy for 252 bp electron microscopic confirmation could not be obtained. 170 bp The patient was treated with oral acitretin, initially with 143 bp 25 mg per day and later with 50 mg per day. After 3 months, a significant reduction of hyperkeratosis was noted on the b S G G S R palms, elbows, and knees (Figure 1d and f), underscoring the G G G S good therapeutic effect of acitretin in this disorder. Never- G G G G G theless, there was little improvement of the plantar kerato- R G G G derma. With the occurrence of significant body hair loss, S G G G G S G G G G S S retinoid therapy was discontinued after 1 year. Subsequent G G G G G G G H G G G G S C S S S G G G topical application of 40% urea cream under occlusion and S G G S G S G S R S H2 I Y Y Y Y Y Y Y Y I V K S G S V F S T S V R mechanical debridement of the horn material yielded a domain S G S S K V T Y G T COOH G S G S G S G G G G dramatic improvement within 2 months (Figure 1b), and is S S S G S S S G G G G G G R G G continued as needed. S G S R S G G S S G S S To determine the molecular basis of the proband’s 27 bp deletion G G G G disorder, we analyzed the KRT1 gene. Sequence analysis of 21 bp deletion exons 1–8 of KRT1 revealed three known polymorphisms, (Modified from Korge et al., 1992) which are of no known clinical significance. In exon 2, we c G G detected a common homozygous third-base substitution in G G arginine codon 240 (R240R). In exon 7, the patient was G G R G S heterozygous for two silent mutations, a C to T transition at S S G G S S G S position c.1436 (R463R) and a C to A transversion at position G G G G G S R S c.1460 (T471T). On gel electrophoresis of exon 9 amplicons, G C S S S G G G S S G S G G G G I Y Y Y Y Y I V K S G S V F S T S V R two distinct bands with a size difference of approximately H2 S G S S K V T Y G T COOH 50 bp were noted (Figure 2a, Pt, lane I). Each band was domain G S G S R G S G S G G S purified and sequenced separately. The slower migrating G R G H G S G G G G S G band was found to have a wild-type sequence, with no G G G G G G G G G S evidence for a mutation or polymorphism. In the faster G G migrating band, we identified three distinct sequence G G G S aberrations: a deletion of a single guanine at position G G c.1556 (c.1556delG), an in-frame deletion of 27 bp at S R S G G position c.1569 (c.1569del27) (Figure 3a and c), and another 21 bp in-frame deletion at position c.1656 (c.1656del21) Figure 2. Analysis of two different size polymorphisms in KRT1. (a) Agarose (Figure 3b and c). Together, these three deletions produce a gel electrophoresis. For each individual, PCR amplicons in lane (I) encompass KRT1 gene 49 bp shorter than the wild-type KRT1 and lead to a 300 bp segment of wild-type DNA spanning across the 21 and 27 bp a frameshift and a premature termination codon 237 bp deletions. The products in lane (II) represent a region of KRT1 that includes only the 27 bp deletion. Four combinations of the size polymorphisms were downstream of the mutation site. These deletions occur in the detected in controls: control sample 1 (C1) is homozygous wild-type (300 bp; V2 domain of K1 and are predicted to result in a frameshift 170 bp); control 2 (C2) is heterozygous for the 21 bp deletion (300 bp; 279 bp; and translation of an aberrant and truncated protein tail of 79 170 bp); control 3 (C3) is homozygous for the 21 bp deletion (279 bp; 170 bp); residues, 48 residues shorter than the wild-type protein control 4 (C4) is heterozygous for the 21 bp deletion and the 21 bp deletion (Figure 3d and e). Deletion c.1556delG was not detected in plus 27 bp deletion (300 bp; 252 bp; 170 bp; 143 bp). The patient (Pt) is 30 chromosomes of African-American control individuals, heterozygous for deletions 1556delG, 1656del21, and 1569del27, all on the same mutant allele. (b, c) Schematic depiction of wild-type and mutant K1. (b) thus providing further support for the pathogenicity of this The two-dimensional model of the carboxy-terminal tail domain of wild-type mutation. K1 protein predicts 10 glycine loops. Black circles highlight those amino-acid The detected 21 bp deletion is a known size polymorph- residues that are lost owing to size polymorphisms c.1569del27 and ism in KRT1, resulting in deletion of one of the 10 glycine c.1656del21. (c) Predicted glycine loop structure in the presence of both loop motifs (Figure 2b). Its allele frequency in 40 individuals deletions. of different ethnic origin was reported as 0.39, but specific population groups were not investigated (Korge et al., 1992). and c.1656del21 on the same allele, as confirmed by To determine the allele frequencies of this deletion and of the sequence analysis. These data corresponded with an allele newly identified 27 bp deletion, we used two sets of primers frequency of 0.53 for the 21 bp polymorphism and 0.029 for to amplify either across both deletions or only across the the 27 bp polymorphism. In contrast, none of 218 alleles of 27 bp deletion in exon 9 of KRT1, as exemplified in Figure 2a. white control individuals of European ancestry was found to Of 102 African-American alleles tested, 48 were wild type, harbor the c.1569del27 deletion. Based on these results, it 51 harbored c.1656del21, and three showed c.1569del27 appears that the 27 bp polymorphism has arisen on the

www.jidonline.org 81 ES Richardson et al. Keratin 1 Mutation in Ichthyosis Hystrix Curth–Macklin

abMutation Polymorphism Polymorphism 1556delG + 1569del27 1656del21 Patient

Control

c 1556 1569 1596 1656 1677 WT GAGGAGGTGGCGGCGGTGGCTACGGCTCTGGAGGTAGCAGCTATGGCTÉ50bpÉAGCTATGGCTCCGGAGGTAGCAGCTACGGC

Mut GAGAGGTGGCGGCGGTGGCTGGCTÉ50bpÉAGCTATGGC

d 514 GL1 GL2 GL3 GL4 GL5 GL6 GL7 WT GGGSRGGGGGGYGSGGSSYGSGGGSYGSGGGGGGGRGSYGSGGSSYGSGGGSYGSGGGGGGHGSYGS Mut GGGSREVAAVAPEVVAMVLEVAAAAAVAAMAPEVAAMALEVAAAAMAATAPEAAVGATEVALEAAAA GL8 GL9 GL10 645 WT GSSSGGYRGGSGGGGGGSSGGRGSGGGSSGGSIGGRGSSSGGVKSSGGSSSVRFVSTTYSGVTRStop Mut AALAAGALAAGALEAPStop

e 1556delG

H1 1A 1B 2A 2B H2

E1 V1 L1 L1,2 L2 V2 E2

Figure 3. Mutation and sequence variants of the KRT1 gene in the proband. (a, b) Sequence analysis of exon 9 of KRT1 in the proband reveals the presence of three different nucleotide deletions – c.1556delG (a), c.1569del27 (a), and c.1656del21 (b) – all on one allele of KRT1 (upper panels). The wild-type allele is shown for comparison in the lower panels. (c) The graphical view illustrates the DNA sequence of both the proband’s alleles across the critical region in exon 9 of KRT1. (d) Comparison of the amino-acid sequence of wild-type (WT) and mutant (Mut, underlined) K1 across the V2 domain, indicating also the position of 10 glycine loops (GL1–GL10). (e) The position of the frameshift mutation within the variable (V2) domain of K1 is indicated by the arrow and the resultant aberrant V2 tail is shown in red.

c.1656del21 allele and is a population-specific polymorph- described previously (1628delG and 1609GG-A) occurred ism, preferentially found in African-Americans. in the third or fourth glycine loop of K1, respectively, resulting in a K1 protein with a minimum of two residual DISCUSSION glycine loops in the V2 domain. In contrast, the frameshift The clinical presentation of this African-American patient mutation c.1556delG interrupts the first glycine loop at the with severe, diffuse, fissuring, and transgradient PPK, fixed start of the V2 domain, thus completely eliminating the hyperkeratotic plaques over knees and elbows, and dissemi- characteristic glycine loop elements from the mutant K1 nated hyperkeratotic papules is remarkably similar to the molecule (Figures 2b and 3d). The postulated role for glycine disorder described in an African-American family with the loops in K1 is to form weak hydrophobic and hydrogen pathognomonic electron microscopic features of IHCM bonding interactions with K10, loricrin, and perhaps other (Sprecher et al., 2001). The clinical diagnosis of IHCM is proteins of the cornified cell envelope (such as corneodes- further supported by molecular genetic data, which revealed mosin), thus stabilizing and integrating the cell envelope with in this patient a heterozygous frameshift mutation in the last the KIF network (Steinert, 1993; Jonca et al., 2002). There- exon of KRT1. Similar to the previously reported small fore, the lack of all glycine loops in K1 can be expected to deletions or rearrangements in KRT1 in a family with IHCM prevent certain interactions between the cell envelope and and another with striate PPK (Sprecher et al., 2001; Whittock the KIF network. This notion is also supported by in vitro KIF et al., 2002), the single G deletion (c.1556delG) detected assembly and transfection studies of K5/K14 with an aberrant here encodes for an aberrant K1 tail shortened by 48 residues, and elongated K5 tail without glycine loops, which demon- in which the glycine residues are replaced with alanine strated shorter filaments with weaker visco-elastic properties residues (Figure 3d). Consequently, the biochemical proper- under strain (Gu and Coulombe, 2005). A KIF assembly assay ties of the variable (V2) domain are dramatically altered and of K1/K10 polymers with a truncated, alanine-rich K10 tail the end domain (E2) has been eliminated. The two mutations (comparable to the alanine-rich K1 tail due to mutation

82 Journal of Investigative Dermatology (2006), Volume 126 ES Richardson et al. Keratin 1 Mutation in Ichthyosis Hystrix Curth–Macklin

c.1556delG reported here) yielded KIF of apparently normal (Figure 1a and c). Reportedly, the proband’s father and sister were length and diameter. Nevertheless, there were periodic similarly affected but could not be contacted or declined participa- lateral protrusions visible, which likely represent the end tion, as is the case with his daughter. Only the proband gave domains, thus indicating that an abnormal KIF organization informed consent to participate in this study, which adheres to the might be responsible for the defective KIF bundling seen in Helsinki Guidelines and was approved by the Institutional Review IHCM (Sprecher et al., 2001). Board. Buccal swabs were collected and prepared for DNA analysis All three KRT1 mutations discussed here (c.1556delG, as previously described (Richards et al., 1993). Histological analysis c.1628delG, and c.1609GG-A) result in a similar shift of the of a skin biopsy from the left palm was performed following standard reading frame and are predicted to replace the glycine-rich procedures. V2 domain with a shortened alanine-rich carboxy-terminal peptide, which is highly similar in sequence and only differs Mutation analysis in length for each mutation. Whittock et al. (2002) elegantly The coding sequence and flanking intronic boundaries of the keratin demonstrated that the expression of K1 with such a mutant 1 gene (KRT1) were PCR-amplified from genomic DNA with Taq tail domain yields similar results to the expression of a tailless polymerase and 10% Q solution (Qiagen, Valencia, CA), using K1 protein, namely a partial nuclear localization of K1. previously published primer pairs (Chipev et al., 1992; Korge et al., Hence, the pathogenic effect of these KRT1 frameshift 1992) for exons 1–5, 8, and 9. For exons 6 and 7, new balanced mutations is not due to the presence of the mutant, alanine- primer pairs were selected with the Primer3 software: exon 6 rich peptide but rather due to the loss of the wild-type V2 (forward) 50-AGC ATC ATT GCT GAG GTC AA-30/(reverse) 50-GGG domain. The tail domains are highly variable in length and TTA CCC CCA TTC CAT AC-30 and exon 7 (forward) 50-CTC ATT primary structure across the family of keratin proteins ATT GGC CTC ACT GGA G-30/(reverse) 50-TCC TGC TCC GTG TAC (Steinert, 1993). Although some members are naturally TTT TCA T-30. PCR cycling conditions were as follows: 951C for tailless, such as K19 and phakinin, they are competent to 5 minutes followed by 35 cycles at 951C for 30 seconds, 58–601C for assemble into filaments (Bader et al., 1986; Merdes et al., 45 seconds, 721C for 90 seconds, and a final extension step at 721C 1993). There is also convincing experimental evidence from for 7 minutes. After agarose gel electrophoresis (1 TBE, 1.5–3%) studies of truncated K8, K18, K5, K14, and the hair keratin and gel purification with the QIAquick gel extraction kit (Qiagen), hHa1 that the tail domain of type I as well as type II keratins is PCR fragments were directly sequenced using the BigDye terminator dispensable for filament formation in vitro (Hatzfeld and sequencing system on an ABI Prism 377 sequencer (PE Applied Weber, 1990; Wilson et al., 1992; Winter et al., 1997; Biosystems, Foster City, CA) and the primers listed above, including Bousquet et al., 2001). However, other functions have been an additional primer for exon 1 (50-CTT GGT GGC AGT AAA AGC ascribed to the keratin tail, such as KIF stabilization owing to AT-30). DNA sequence aberrations were confirmed by bidirectional, low-affinity KIF binding and involvement in salt- and alkaline allele-specific sequencing and/or agarose gel electrophoresis. pH-induced filament bundling (Bousquet et al., 2001). The latter data are in line with the observation of reduced KRT1 size polymorphisms supramolecular KIF bundling in IHCM due to an altered and For analysis of the novel KRT1 in-frame size polymorphism, shortened K1 tail (Sprecher et al., 2001), and are likely to 1569del27 in exon 9, we developed three additional primer pairs: apply to the case presented here. exon 9a (forward) 50-TGG GCT GGA AAC GGA GTT GAG-30, exon In this study, besides the finding of a new pathogenic 9b (reverse) 50-ACC TCC AGA ACC ATA GCT A-30, and exon 9c KRT1 mutation associated with diffuse PPK and an IHCM-like (reverse) 5’-TAG CCC CCA CTG CTG CTT-30. Primers 9a/9b were phenotype, we also identified a novel size polymorphism in used to produce a 300 bp amplicon of exon 9 encompassing both the exon 9 of KRT1 (c.1569del27) in the African-American 21 and 27 bp deletions, while primers 9a/9c amplified a 170 bp population. This sequence variant was detected in 2.9% of segment spanning only across the 27 bp deletion (see Figure 2a). African-American alleles but not in white individuals, which Analysis of fragment sizes after agarose gel electrophoresis (1 TBE, were exclusively investigated in a previous study (Korge 2.5%) was used to determine the presence or absence of these size et al., 1992). As demonstrated here, the 27 bp deletion polymorphisms in KRT1 in the patient and in control individuals (51 polymorphism was found on the same allele as the of African-American and 109 of European origin). For the 9a/9b PCR c.1656del21 polymorphism, thus producing a V2 domain reaction, the presence of a 300 bp band indicated the wild-type with 16 fewer residues and seven glycine loops (Figure 2c) allele, a band of approximately 275 bp was found in the presence of instead of the 10 glycine loops (Figure 2b) found in the the 21 or 27 bp deletion, and a band of 252 bp showed the presence wild-type protein. These findings suggest a remarkable of both deletions. PCR 9a/9c allowed distinguishing between variability in the number of glycine loops across different presence (170 bp) and absence (143 bp) of the 27 bp deletion. human races. Electronic database information MATERIALS AND METHODS Accession numbers and URLs for data in the article are as follows: Patients and biological material OMIM: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=O We examined a 44-year-old African-American man and his 14-year- MIM (#146590 for ichthyosis hystrix Curth–Macklin) old daughter who presented to our clinic for the treatment of Primer3: http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi painfully fissured and thickened palms and soles. The father’s The Human Intermediate Filament Mutation Database: http:// keratoderma had progressively worsened over the past decades www.interfil.org/

www.jidonline.org 83 ES Richardson et al. Keratin 1 Mutation in Ichthyosis Hystrix Curth–Macklin

NCBI Entrez Nucleotide database: http://www.ncbi.nlm.nih.gov/ Merdes A, Gounari F, Georgatos SD (1993) The 47-kD lens-specific protein entrez/query.fcgi?db=Nucleotide phakinin is a tailless intermediate filament protein and an assembly partner of filensin. J Cell Biol 123:1507–16 (NM_006121.2 for KRT1) Niemi KM, Virtanen I, Kanerva L, Muttilainen M (1990) Altered keratin expression in ichthyosis hystrix Curth–Macklin. A light and electron CONFLICT OF INTEREST microscopic study. Arch Dermatol Res 282:227–33 The author states no conflict of interest. Ollendorff-Curth H, Allen Jr FH, Schnyder UW, Anton-Lamprecht I (1972) Follow-up of a family group suffering from ichthyosis hystrix type Curth–Macklin. Humangenetik 17:37–48 Ollendorff Curth H, Macklin MT (1954) The genetic basis of various types of REFERENCES ichthyosis in a family group. Am J Hum Genet 6:371–82 Bader BL, Magin TM, Hatzfeld M, Franke WW (1986) Amino acid sequence Richards B, Skoletsky J, Shuber AP, Balfour R, Stern RC, Dorkin HL and gene organization of cytokeratin no. 19, an exceptional taitless et al. (1993) Multiplex PCR amplification from the CFTR gene intermediate filament protein. EMBO J 5:1865–75 using DNA prepared from buccal brushes/swabs. Hum Mol Genet Bousquet O, Ma L, Yamada S, Gu C, Iei T, Takahashi K et al. (2001) The 2:159–63 nonhelical tail domain of keratin 14 promotes filament bundling and Sprecher E, Ishida-Yamamoto A, Becker OM, Marekov L, Miller CJ, Steinert enhances the mechanical properties of KIFs in vitro. J Cell Biol PM et al. (2001) Evidence for novel functions of the keratin tail emerging 155:747–53 from a mutation causing ichthyosis hystrix. J Invest Dermatol Chipev CC, Korge BP, Markova N, Bale SJ, DiGiovanna JJ, Compton JG et al. 116:511–19 (1992) A leucine–proline mutation in the H1 subdomain of keratin 1 Sprecher E, Yosipovitch G, Bergman R, Ciubutaro D, Indelman M, causes epidermolytic hyperkeratosis. Cell 70:821–8 Pfendner E et al. (2003) Epidermolytic hyperkeratosis and epidermo- Gu L-H, Coulombe PA (2005) Defining the properties of the nonhelical tail lysis bullosa simplex caused by frameshift mutations altering the domain in type II keratin 5: insight from a bullous disease-causing V2 tail domains of keratin 1 and keratin 5. J Invest Dermatol mutation. Mol Biol Cell 16:1427–38 120:623–6 Hatzfeld M, Weber K (1990) Tailless keratins assemble into regular Steinert PM (1993) Structure, function, and dynamics of keratin intermediate intermediate filaments in vitro. J Cell Sci 97:317–24 filaments. J Invest Dermatol 100:729–34 Jonca N, Guerrin M, Hadjiolova K, Caubet C, Gallinaro H, Simon M et al. Whittock NV, Smith FJ, Wan H, Mallipeddi R, Griffiths WA, Dopping- (2002) Corneodesmosin, a component of epidermal corneocyte Hepenstal P et al. (2002) Frameshift mutation in the V2 domain of desmosomes, displays homophilic adhesive properties. JBiolChem human keratin 1 results in striate palmoplantar keratoderma. J Invest 277:5024–9 Dermatol 118:838–44 Kanerva L, Karvonen J, Oikarinen A, Lauharanta J, Ruokonen A, Niemi KM Wilson AK, Coulombe PA, Fuchs E (1992) The roles of K5 and K14 head, tail, (1984) Ichthyosis hystrix (Curth–Macklin). Light and electron micro- and R/K L L E G E domains in keratin filament assembly in vitro. J Cell scopic studies performed before and after etretinate treatment. Arch Biol 119:401–14 Dermatol 120:1218–23 Winter H, Hofmann I, Langbein L, Rogers MA, Schweizer J (1997) A splice Korge BP, Compton JG, Steinert PM, Mischke D (1992) The two size alleles of site mutation in the gene of the human type I hair keratin hHa1 results human keratin 1 are due to a deletion in the glycine-rich carboxyl- in the expression of a tailless keratin isoform. J Biol Chem 272: terminal V2 subdomain. J Invest Dermatol 99:697–702 23345–52

84 Journal of Investigative Dermatology (2006), Volume 126