US009051382B2

(12) United States Patent (10) Patent No.: US 9,051,382 B2 Trentmann et al. (45) Date of Patent: Jun. 9, 2015

(54) HUMAN NIEUTROPHL (56) References Cited GELATINASE-ASSOCATED LIPOCALN (HNGAL) MUTEINS THAT BIND HEPCIDIN U.S. PATENT DOCUMENTS AND NUCLECACIDENCOOING SUCH 5,728,553 A 3/1998 Goodey et al. 6,177,074 B1 1/2001 Glue et al. (75) Inventors: Stefan Trentmann, Allershausen (DE); 6,403,564 B1 6/2002 Ganguly et al. 6,500,930 B2 12/2002 Adamson Gabriele Matschiner, Munich (DE); 6,620,413 B1 9/2003 De Sauvage et al. Arne Skerra, Freising (DE); Andreas 6,696,245 B2 2/2004 Winter et al. Hohlbaum, Paunzhausen (DE); Martin 7,250,297 B1 7/2007 Beste et al. Huelsmeyer, Wolfersdorf (DE): 2003, OO69395 A1 4/2003 Sato et al. Hendrik Gille, Munich (DE): Hans-Juergen Christian, Moosburg FOREIGN PATENT DOCUMENTS (DE); Kristian Jensen, Landshut (DE); EP O 33O 451 A2 8, 1989 Rachida Siham Bel Aiba, Munich (DE) EP O 361991 A2 4f1990 WO WO99, 16873 A1 4f1999 (73) Assignee: PIERIS AG, Freising-Wiehenstephan WO WO99.64O16 A1 12/1999 WO WOOOf753O8 A1 12/2000 (DE) WO WO 03/029462 A1 4/2003 WO WO 03/029463 A2 4/2003 (*) Notice: Subject to any disclaimer, the term of this WO WOO3,O294.71 A1 4/2003 patent is extended or adjusted under 35 WO WO 2005/O19254 A1 3, 2005 WO WO 2005/O19255 A1 3, 2005 U.S.C. 154(b) by 117 days. WO WO 2005/O19256 A2 3, 2005 WO WO 2006/056464 A2 6, 2006 (21) Appl. No.: 13/816,808 WO WO 2007/038619 A2 4/2007 WO WO 2008/O11158 A2 1, 2008 WO WO 2008/097461 A2 8, 2008 (22) PCT Fled: Aug. 16, 2011 WO WO 2009/058797 A1 5, 2009 WO WO 2009/094.551 A1 T 2009 PCT NO. PCT/EP2011/064086 WO WO 2009/139822 A1 11/2009 (86) WO WO 2010/017070 A1 2, 2010 S371 (c)(1), (2), (4) Date: May 24, 2013 OTHER PUBLICATIONS Wells, Biochemistry, 1990 vol. 29, pp. 8509-8517.* (87) PCT Pub. No.: WO2O12/O22742 Bork, Genome Research, 2000, vol. 10, pp. 398-400.* Skolnicket al., Trends in Biotech, 2000, vol. 18, No. 1, pp. 34-39.* PCT Pub. Date: Feb. 23, 2012 Doerks et al., Trends in Genetics, 1998, vol. 14, pp. 248-250.* Tokuriki and Tawflik. Current Opinion in Structural Biology, 2009, (65) Prior Publication Data vol. 19, pp. 596-604.* Hohlbaum et al., 53rd ASH Annual Meeting and Exposition Dec. US 2013/024.4955A1 Sep. 19, 2013 10-13, 2011.* Wang et al. (Nuc. Acids Res, 1999, vol. 27, pp. 4609-4618.* Kaufman et al Blood, 1999, vol. 94, pp. 3178-3184.* Related U.S. Application Data Malyszko et al. Kidney Blood Press Research; 2010; vol. 33, pp. 157-165* (60) Provisional application No. 61/374,199, filed on Aug. Altschulet al., “Gapped BLAST and PSI-BLAST: a new generation 16, 2010. of protein database search programs.” Nucl. Acids Res., 1997. 25(17):3389-3402. (51) Int. C. (Continued) CI2P2/06 (2006.01) C07K I4/435 (2006.01) Primary Examiner — Bridget E Bunner A6 IK38/6 (2006.01) Assistant Examiner — Fozia Hamud A6 IK38/17 (2006.01) C7H 2L/04 (2006.01) (74) Attorney, Agent, or Firm — Foley & Lardner, LLP C07K I4/47 (2006.01) (57) ABSTRACT C07K 6/26 (2006.01) CI2N 15/09 (2006.01) The present invention relates to novel, specific-binding thera CI2P 2 1/02 (2006.01) peutic and/or diagnostic proteins directed against Hepcidin, U.S. C. which proteins preferably are muteins of a lipocalin protein. (52) The invention also relates to nucleic acid molecules encoding CPC ...... C07K 14/435 (2013.01); C07K 14/47 Such proteins and to methods for generation and use of Such (2013.01); C07K 16/26 (2013.01); C07K proteins and nucleic acid molecules. Accordingly, the inven 2317/76 (2013.01); C07K 2317/92 (2013.01); tion also is directed to pharmaceutical and/or diagnostic com C07K 23 18/20 (2013.01) positions comprising Sucha lipocalin proteins, including uses (58) Field of Classification Search of these proteins. None See application file for complete search history. 13 Claims, 18 Drawing Sheets US 9,051,382 B2 Page 2

(56) References Cited Osborn et al., “Pharmacokinetic and Pharmacodynamic Studies of a Human Serum Albumin-Interferon-O. Fusion Protein in Cynomolgus OTHER PUBLICATIONS Monkeys.” J. Pharmacol. Exp. Ther. 2002, 303(2):540-548. “Pieris Announces Preclinical In Vitro and In Vivo Data for its Anticalin R PRS-080 Hepcidin Antagonist Drug Program.” Pieris Altuvia et al., “Ranking Potential Binding Peptides to MHC Mol AG:News and Events, May 23, 2001, XP00266.1794, retrieved from ecules by a Computational Threading Approach.” J. Mol. Biol., 1995, the Internet on Oct. 20, 2011. http://www.pieris-ag.com.news 249:244-250. events/2001-05-23-Pieris-Announces-Preclinical-In-Vitro-and-In Amstutz et al., “In vitro display technologies: novel developments Vivo-Data.php, one page. and applications.” Curr. Opin. Biotechnol., 2001, 12:400-405. Pini et al., “Phage Display and Colony Filter Screening for High Bachmann, Barbara J., "Linkage Map of Escherichia coli K-12, Throughput Selection of Antibody Libraries.” Comb. Chem. High Throughput Screen., 2002, 5:503-510. Edition 8.” Microbiol. Rev. Jun. 1990, 54(2): 130-197. Rodi et al., "Phage-display technology finding a needle in a vast Beste et al., "Small antibody-like proteins with prescribed ligand molecular haystack.” Curr. Opin. Biotechnol., 1999, 10:87-93. specificities derived from the lipocalin fold.” Proc. Natl. Acad. Sci. Sasu et al., "Antihepcidinantibody treatment modulates iron metabo USA, Mar. 1999, 96:1898-1903. lism and is effective in a mouse model of inflammation-induced Bittker et al., "Nucleic acid evolution and minimization by anemia.” Blood, Apr. 29, 2010, 115(17):3616-3624. nonhomologous random recombination.” Nat. Biotechnol., Oct. Schiweck et al., "Fermenter Production of an Artificial Fab Frag 2002, 20:1024-1029. ment, Rationally Designed for the Antigen Cystatin, and Its Opti Breustedt et al., "Comparative ligand-binding analysis often human mized Crystallization Through Constant Domain Shuffling.” Pro lipocalins.” Biochim. Biophys. Acta, 2006, 1764:161-173. teins: Structure, Function and Genetics, 1995, 23:561-565. Bruckdorfer et al., “From Production of Peptides in Milligram Schlehuber et al., "A Novel Type of Receptor Protein, Based on the Amounts for Research to Multi-Tons Quantities for Drugs of the Lipocalin Scaffold, with Specificity for Digoxigenin.” J. Mol. Biol., Future.” Curr. Pharm. Biotechnol., 2004, 5:29-43. 2000, 297: 1105-1120. Bullocket al., "XL1-Blue: A High Efficiency Plasmid Transforming Schlehuber et al., “Duocalins, engineered ligand-binding proteins recA Escherichia coli Strain with Beta-Galactosidase Selection.” with dual specificity derived from the lipocalin fold.” Biol. Chem. Biotechniques, 1987, 5(4):376-378. Sep. 2001, 382:1335-1342. Dennis et al., "Albumin Binding as a General Strategy for Improving Schmidt et al., “Molecular Interaction Between the Strep-tag Affinity the Pharmacokinetics of Proteins.” J. Biol. Chem. Sep. 20, 2002, Peptide and its Cognate Target, Streptavidin.” J. Mol. Biol., 1996, 277(38):35035-35043. 255:753-766. Fling et al., “Peptide and Protein Molecular Weight Determination by Schoenfeld et al., “An engineered lipocalin specific for CTLA-4 Electrophoresis Using a High-Molarity Tris Buffer System without reveals a combining site with structural and conformational features Urea.” Anal. Biochem., 1986, 155: 83-88. similar to antibodies.” PNAS, May 19, 2009, 106(20:8198-8203. Fuertges et al., The Clinical Efficacy of Poly(Ethylene Glycol)- Silverman et al., “Multivalent avimer proteins evolved by exon shuf Modified Proteins,. J. Control. Release, 1990, 11:139-148. fling of a family of human receptor domains.” Nature Biotechnology, Gaillard et al., “Targeted delivery across the blood-brain barrier.” Dec. 2005, 23(12): 1556-1561. Expert Opin Drug Deliv., 2005, 202):299-309. Skerra, Arne, "Use of the tetracycline promoter for the tightly regu Gaillard et al., “Diphtheria toxin receptor-targeted brain drug deliv lated production of a murine antibody fragment in Escherichia coli.” ery.” International Congress Series. 2005, 1277:185-198. Gene, 1994, 151:131-135. Gebauer et al., "Engineered protein scaffolds as next-generation anti Skerra, Arne, "Anticalins': a new class of engineered ligand-binding body therapeutics.” Current Opinion in Chemical Biology, 2009, proteins with antibody-like properties,” J. Biotechnol., 2001, 74:257 13:245-255. 275. Goetz et al., "Ligand Preference Inferred from the Structure of Skerra, Arne, "Lipocalins as a scaffold.” Biochimica et Biophysica Neutrophil Gelatinase Associated Lipocalin.” Biochemistry, 2000, Acta, 2000, 1482:337-350. 39:1935-1941. Skerra et al., "Use of the Strep-Tag and Streptavidin for Detection and Holliger et al., “Diabodies': Small bivalent and bispecific antibody Purification of Recombinant Proteins.” Methods in Enzymology, fragments.” PNAS USA, Jul. 1993, 90:6444-6448. 2000, vol. 326, pp. 271-304. Ill et al., “Design and construction of a hybrid immunoglobulin Studier et al., “Use of Bacteriophage T7 RNA Polymerase to Direct domain with properties of both heavy and light chain variable Selective High-level Expression of Cloned Genes,” J. Mol. Biol. regions.” Protein Engineering, 1997, 10(8):949-957. 1976, 189:113-130. Kim et al., "High-Affinity Recognition of Lanthanide(III) Chelate Traunecker et al., "Bispecific single chain molecules (Janusins) tar Complexes by a Reprogrammed Human Lipocalin 2,” J. Am. Chem. get cytotoxic lymphocytes on HIV infected cells.” The EMBO Jour Soc., 2009, 131:3565-3576. nal, 1991, 10(12):3655-3659. König et al., "Use of an albumin-binding domain for the selective Traunecker et al., “Janusin: New Molecular Design for Bispecific immobilization of recombinant capture antibody fragments on Reagents.” Int. J. Cancer, 1992. Supplement 7, 51-52. ELISA plates,” J. Immunol. Methods, 1998, 218:73-83. Vajo et al., "Genetically Engineered Insulin Analogs: Diabetes in the Lowman, H.B. "Bacteriophage display and discovery of peptides New Millenium.” Pharmacol. Rev. 2000, 52(1): 1-9. leads for drug development.” Annu. Rev. Biophys. Biomol. Struct. Venturi et al., "High Level Production of Functional Antibody Fab 1997, 26:401-424. Fragments in an Oxidizing Bacterial Cytoplasm.” J. Mol. Biol., 2002, Malyszko et al., “Neutrophil Gelatinase-Associated Lipocalin and 315:1-8. Hepcidin: What Do They Have in Common and Is There a Potential Vogt et al., "Bacterially produced apolipoprotein D binds Interaction?.” Kidney Blood Press Res., 2010, 33:157-165. progesterone and arachidonic acid, but not bilirubin or E-3M2H. Martin et al., “The affinity-selection of a minibody polypeptide Journal of Molecular Recognition, 2001, 14:79-86. inhibitor of human interleukin-6. The EMBO Journal, 1994, Wilson et al., “The use of mRNA display to select high-affinity 13(22):5303-5309. protein-binding peptides.” Proc. Natl. Acad. Sci. USA, Mar. 27. Mateo et al., “Removal of Amphipathic Epitopes from Genetically 2001, 98(7):3750-3755. Engineered Antibodies: Production of Modified Immunoglobulins Yanisch-Perron et al., “Improved M13 phage cloning vectors and with Reduced Immunogenicity.” Hybridoma, 2000, 19(6):463-471. host strains: nucleotide sequences of the M13mp18 and puC19 vec Murakami et al., “Random insertion and deletion of arbitrary Num tors.” Gene, 1985, 33:103-119. ber of bases for codon-based random mutation of DNAs.” Nat. Zaccolo et al., "An Approach to Random Mutagenesis of DNA Using Biotechnol., Jan. 2002, 20:76-81. Mixtures of Triphosphate Derivatives of Nucleoside Analogues.” J. Nemeth et al., "The N-terminus of hepcidin is essential for its inter Mol. Biol., 1996, 255:589-603. action with ferroportin: structure-function study,” Blood, Jan. 1, 2006, 107(1):328-333. * cited by examiner U.S. Patent US 9,051,382 B2

-+….…•…*?+~~+*-*--+--…+--+–~-).*+-***•=~-..-.

--**-*-+~~++•~---+~*•+~-~=-?

U.S. Patent Jun. 9, 2015 Sheet 5 of 18 US 9,051,382 B2

F.G. 3C

pi:Nf3A1.98 A yi , R ; K K W S Q & R {{h(A35) Asia. 31. Eii. s.la Met was the Rh& Lyss Lys Val Ser 3r. As Arg SEQ I3). NC 2 N - A M W F if K J W W N. R. SEQ (33 NC): 3 N is A M W F S K - W - Q & R SSE 3 NO; N is A Si V is . K R V W N R SER ...) No. 5 N : A M W F K , W T N R SEC E SO: . N A s W. F K V W N R SE; , Ni3: 8 N C F A & W S R K. W W C N R Sig Si) MC): 3 N A y V F K T W W R SEO NO: l ; N E. A. Y. W. F F & V W. C. N. R.

3.

pr:NSAL38 F K if T is (; R R. E. SS (NGAits 8 Gill: Tyriheiys is thrLeuly 3.8 y Arg Thysglue:ThrSer SSC I NC: 3 E. S. F W L S E G. S S K E S. SE. If N : 3 E W F W S ; , Y (S 3 K. R. E. '' S SEQ I N (: 3 E V F W S ' ... Y S R K E L E & SEC 1. NC 5: E W E W S '' ... Y S S S K E S T S. SEQ $3 NC: E W F W S '' ... y G R T K E '' S SE IS NC: E W F W S ' , , (; , i. K. E. : T. S. SEQ I.S.: NC: 5 E W F W S Y G R i K E S T S SEQ in NQ: , 4. E W S W S '' ... Y S R K E

p:NGA; 38 E. S. K. E S F : R S S K S G. I. E (rhNGAi.88; 3. iii. &eiya Sua Sri Pheii eArc Fe Seriys Series fgly ...e.:Fr. Gil SSC: Si RO; 2 SS . K S N F : R F S K S C. S. S. E. SEQ E. E. S.): 3 E. S. K. S. t. S I R F & R. S. . . . . E SEQ 3) Ne: ; R K S N F : R F S K S L S. S. S. E. SEK 3 {{: & E K E N F : R if S S S E SEC EE Si.); l. E K. E N F : R F S K S ; S. S. E SE: I NC: & S K S N F : R F S K S E SEC II NC: ; S K E R F : R F S. E. S. . . . . E SE I: 3 NO; l. 4. E I, K E N S S R F S K S S E U.S. Patent Jun. 9, 2015 Sheet 6 of 18 US 9,051,382 B2

FG 3) 15889 to 17172 pilNGAi.88 N. : W . R V Q. C. CS (phrösi. 98 Asn His i.e Waa. Phe Pro Val pro lie Asp Gir. Cys ille Asp Giy SR: f). NC; 2 N SH W F p s Q (S SEQ NO. 3 N l W F p V C { S.E. S. & C: & R i W ; Q C s SEQ S \{i : S. vi y F. E is SE IS No: i. N E E W F : W C G SES E SE} is & Q { & SEQ 3) No. R - I V F : W E r S SSC II) Est: 4 T W R S) T. E. : C . S

phMSA:38 S S C {p}sh GA1.98, Ser Ala Trp Ser His Pro Girl Eile S3EQ SS NO: 3 S A. S SEQ I) NO: 3 S A. S. Q SEQ NC: $. S W S C g SEC 2 NC: S S A. S. SEC NO S A. s S f r SEQ NQ: & S A. S R R SE. T. No: it S A. S g SE: I NC: S. S A S R Q U.S. Patent Jun. 9, 2015 Sheet 7 of 18 US 9,051,382 B2

FG 3E ph NGA1.98 Q D S T S : , I F. A. : P L S K W SEQ Ti S: , Q R S T S ; , , . A I, S K

SEQ RC: & S S ;) I A S S W SEQ SD NEO S Q R S : S. I. I. A S X W SE II & Q: C R D S S D L S R A S K V SEQ NC: 3 & C S : S : . . . A S K V SEQ ICS NC: 3.2 g S T S S J S R A E R L S K W SEQ I NC; ls S : S S. p A P R S S X. W

U.S. Patent Jun. 9, 2015 Sheet 10 of 18 US 9,051,382 B2

FG 3H

SE II: NO Eph GA1.98 } K E N F : R F S X & S E. N. i K. SS S. R S K S E G : E E N 8 : E N F : R S S K S L & E. E. E. N. S X N F : R F S & S. B. S. E. R. S. S. K. E. N. F. S. SR S E S I E. N. ls. K E N F S R F S K S E. N. 2 K. K. N. R F S K S J & E. R. E. N. s E E S R F S K S J S E is E. N.

sto D. No 55 15s 6768 16s. 7772 737-751787, 1787g thSIGA1.98 V F & J P I iss Q & y I 3 S H. T. V. F : V I C T : G S 8 H V F : W E J D R C G S 9 }; J W F P W P T : Q C : ) (3 & si i v Fr P v ) . . . . . ) (3 S s ji I v F : V P S D C 3 & S. 3i T W F : W ...... G S 3 i I v F P W P C E R G &

184 85 ph Nf3Ai. 88 A S S ; ; E SE NC: 1 A W S F: F SE: I SEE: 8 A S is F SEC E REC: S A W S : P F SS. IE) NC: Q A W S : R F SSQ F) Nis): ; A W S E: C. F. SS. If No. 2 A S : R Q F SEC N3: 3 A W S H F

U.S. Patent Jun. 9, 2015 Sheet 15 of 18 US 9,051,382 B2

target ipoda in ritutei K. Mis) Ks (s) Kp (M)

Y-y------aa-a-a-a-varavasaraurasauwarrv wrver s hi?tianisesal 35. s 116 E-04 5.89 E-10

SEQID No. 8 | 1.45 E+06 ------Mar-rraaraar.1.78 E-04 | 1.23 E-10.

ww. ------awakaay...

SEQID No. 13-PEG40 2.98 EOG cyno Hep-25 SEOID No. 1 ravruvan- her 2.84 E-06 || 934E04 3.32 Eliš.

1. SEQIDvvv, No.www.www.www.a. www.swww.www.www.www.8 3.74 E:06.1. 245 E-04rarer'..sas.-----w- | 660www-YYYY------M.------E-11

Fig. 7 U.S. Patent Jun. 9, 2015 Sheet 16 of 18 US 9,051,382 B2

sax-XMax Lipocalin Mutein sEo ID No. 1 w MSN'ssasssssss-WWWWWW-Xaxww.WWarwraw------'-y'ssSEQ ID NO. 2

io. WWNNNNNNNN

a\aWYYYYYYY-MaaraaaaaaaaySEQID No. 6

saxx-xxxxxxxxxx-xxxxxx-xx-xxxx-xxxxSEC ID NO. 7 SEQ ID NO. 8

| SEQID NO. 11

axwww.Mwww.www.wawww.www.www.SEQID No. 14-PEG40SSSSSyyyywVYwww.

Nassaxxxxnessesse.SEQID . . . No. 15 ABDXXX-XXSSwSSS . . . . Mawawwaaranarawawww.axxx

Mawanna--axmaaaaaaaaaaaaaaSYNYWYSYNY'AY'SYNWWWWMWWNYWAAAAANNNNNNNNNNNNNNNASXXXYNXNYWNYWYN

FIG 8 U.S. Patent Jun. 9, 2015 Sheet 17 of 18 US 9,051,382 B2

3 se SEQ ID NO:

4 as WT lipocalin (NGAL98)

Hepcidin 2mg/kg (i.p.)

FIG. 9 U.S. Patent Jun. 9, 2015 Sheet 18 of 18 US 9,051,382 B2

too-oooooyouxercoyo~~ ------i.ipocalin- Matein speciesx route S dose : T% (h) ww.saaaaaaaaaaa-ww.r. SSESS 3.W. SEQED No. 14-PEG 8 WS'''------a-a-a-a-a-aaa-rars S SEQ No. 5-ABE mouse888 v.w as skgS' o y } s colorio -jor oxy x

SEQID No. 14-PEG WWawraxxaaravana''''''',y saaaaa-YYY-WWYYYY

FIG 10 US 9,051,382 B2 1. 2 HUMAN NIEUTROPHIL having the features attendant to the proteins provided by GELATINASE-ASSOCATED LIPOCALN present invention has been previously described. (HNGAL) MUTEINS THAT BIND HEPCIDIN AND NUCLECACIDENCOOING SUCH SUMMARY OF THE INVENTION

CROSS-REFERENCE TO RELATED One embodiment of the current relates to a lipocalin APPLICATIONS mutein that is capable of binding hepcidin with an affinity measured by a K, of about 10 nM or lower. More preferably, This application is a National Stage application of PCT/ the lipocalins can have an affinity measured by a K of about EP2011/064085, filed Aug. 16, 2011, which claims priority 10 1 nM or lower. In another embodiment, the lipocalin mutein is from U.S. Provisional Application No. 61/374,199, filed Aug. capable of neutralizing the bioactivity of human hepcidin-25, 16, 2010. preferably with an IC50 value of about 80 nM or lower as The instant application contains a Sequence Listing which determined by a cell-based assay for hepcidin-induced inter has been Submitted in ASCII format via EFS-WEB and is nalization and degradation of ferroportin. hereby incorporated by reference in its entirety. Said ASCII 15 In particular embodiments, a lipocalin mutein according to copy, created on Feb. 7, 2013, is named sequence.txt and is 51 the current invention comprises an amino acid sequence KB. selected from the group consisting of SEQID NOs: 1-14. In another embodiment, the mutein has at least 75% identity to SEQUENCE LISTING 2O the sequence of a wild-type human lipocalin, including human Lipocalin 2. The instant application contains a Sequence Listing which In another embodiment, the mutein of the current invention has been Submitted in ASCII format via EFS-WEB and is is conjugated to a compound selected from the group consist hereby incorporated by reference in its entirety. Said ASCII ing of an organic molecule, an enzyme label, a radioactive copy, created on Oct. 31, 2014 is named 029029-0142 SL.txt 25 label, a colored label, a fluorescent label, a chromogenic and is 70,879 bytes in size. label, a luminescent label, a hapten, digoxigenin, biotin, a cytostatic agent, a toxins, a metal complex, a metal, and BACKGROUND colloidal gold. The mutein can be fused at its N-terminus and/or its C-terminus to a fusion partner which is a protein, a Hepcidin, a peptide hormone typically existing in two 30 protein domain, or a peptide. forms made of either 20 or 25 amino acids, is expressed and In another embodiment, the mutein is conjugated to a com secreted by a number of cells in response to iron loading and pound that extends the serum half-life of the mutein. More inflammation. Hepcidin is produced predominantly in hepa preferably, the mutein is conjugated to a compound selected tocytes of the liver, plays a central role in the regulation of iron from the group consisting of a polyalkylene glycol molecule, homeostasis, acts as an antimicrobial peptide and is directly 35 or indirectly involved in the development of most iron-defi a hydroethylstarch, an Fc part of an immunoglubolin, a C3 ciency/overload syndromes. A major action of hepcidin is to domain of an immoglobulin, a C4 domain of an immuno internalize and degrade the iron exporter ferroportin, which is glubolin, an albuminbinding peptide, and an albuminbinding expressed on all iron-exporting cells. Hepcidin directly binds protein. to ferroportin. A high hepcidin level thus leads to the suppres- 40 In another embodiment, the mutein of the current invention sion of intestinal iron absorption and iron release from mac is an antagonist of a Hepcidin. The hepcidin can be mature rophages and hepatocytes, while a low concentration of hep human Hepcidin. cidin leads to acceleration of iron release from these cells. In another embodiment, the current invention relates to a Hepcidin is also suspected to play role in pathogenesis of nucleic acid molecule comprising a nucleotide sequence anemia of inflammation and iron-deficiency anemia. Anemia 45 encoding a mutein of the current invention. of inflammation, also known as anemia of chronic disease In another embodiment, the lipocalin mutein of the current (ACD) or anemia of chronic disorders, currently is the most invention is selected from the group consisting of muteins of frequent anemia among hospitalized patients and a common retinol-binding protein (RBP), bilin-binding protein (BBP), syndrome complicating many infectious, non-infectious apolipoprotein D (APOD), neutrophil gelatinase associated inflammatory and neoplastic disorders. ACD is a normocytic, 50 lipocalin (NGAL), tear lipocalin (TLPC), C-microglobulin normochromic anemia characterized by decreased iron and related protein (A2m), 24-p3/uterocalin (24-p3), von Ebners iron-binding capacity (transferrin), increased ferritin and the gland protein 1 (VEGP 1), Von Ebners gland protein 2 (VEGP presence of iron in bone marrow macrophages, indicating 2), and Major allergen Can f1 precursor (ALL-1). In related impaired mobilization of iron from its stores. While in anemia embodiments, the lipocalin mutein is selected from the group of inflammation hepcidin levels are increased, in iron-defi- 55 ciency anemia low hepcidin levels are found. Hence, hepcidin consisting of human neutrophilgelatinase associated lipoca could be used as a marker to distinguish these diseases. Hep lin (hNGAL), human tear lipocalin (hTLPC), human apoli cidin may also be a useful marker for screening, prognosis poprotein D (APOD) and the bilin-binding protein of Pieris and monitoring hereditary hemochromatosis and iron loading brassicae. anemias. Hepcidin levels may further be useful in monitoring 60 In another embodiment, the invention relates to a lipocalin EPO treatment and predicting a response to EPO. mutein which prevents human hepcidin-25 induced reduction Methods of isolating, analyzing and quantifying hepcidin of serum iron levels in a subject. as well as agents for the treatment of diseases and conditions The invention also includes a method of treating a disease associated with hepcidin have been described in international or disorder associated with an altered level of a Hepcidin, the patent applications WO 2008/01 1158, WO 2008/097461, 65 method comprising administering a pharmaceutical compo WO 2009/094551A1, WO 2009/139822, WO 2009/058797 sition containing a mutein as described herein to a subject in and WO 2010/017070. However, no hepcidin-binding protein need thereof. In related embodiments, the disease or disorder US 9,051,382 B2 3 4 involves a disorder of iron homeostasis or an inflammatory amino acid codon directly following the upstream BstX1 condition associated with an elevated level of hepcidin. restriction site. Figure discloses full-length DNA sequences as SEQID NOS 45 and 47, respectively, in order of appear DESCRIPTION OF FIGURES ance and discloses protein sequence as SEQID NO: 46. FIG. 3A-3H depicts an alignment of certain amino acid FIG. 1 illustrates the PCR assembly strategy for the simul sequences of hHepcidin-specific, NGAL-based lipocalin taneous random mutagenesis of the 20 amino acid positions muteins in comparison with the polypeptide sequence of 36, 40, 41,49, 52, 68, 70, 72,73, 77,7981, 96,100, 103,106, wildtype NGAL lipocalin. The NGAL-derived, hepdicin 125, 127, 132, and 134 (underlined and numbered) in the binding muteins comprise residues 1 to 178, meaning they amino acid sequence of the mature Len 2. These 20 positions 10 have the length of the mature wildtype proteins. Residues 179 were divided into four sequence subsets. For randomization to 186 are the sequence of a streptavidin binding tag, Strep of the amino acids in each Subset an oligodeoxynucleotide tagTM, used in the isolation of generated muteins. was synthesized (SEQID NO: 16, SEQID NO:39, SEQID FIG. 4A depicts the amino acid sequence of the lipocalin NO: 18, SEQ ID NO: 19) wherein NNK mixtures of the mutein of SEQ ID NO: 1 fused, via a linker (greyish bold nucleotides were employed at the mutated codons. Nmeans a 15 italic) to an ABD domain (bold) and a streptavidin binding mixture of all four bases A, C, G, and T while K means a tag, Strep-tagTM (italic) (SEQID NO: 15). mixture of only the two bases G and T; hence such a triplet FIG. 4B depicts the amino acid sequence of the lipocalin encodes all 20 natural amino acids as well as the amber stop hNGAL (SEQ ID NO: 48), as encoded by the vector codon TAG, which is translated as glutamine in the E. coli phNGAL 98, fused to a streptavidin binding tag, the Strep supE-strains XL 1-blue (Bullock et al., BioTechniques 5 tagTM (italic) and an N-terminal T7 tag (bold italic) (SEQID (1987), 376-378) or TG1 (Sambrook et al., Molecular Clon NO:34). This polypeptide is encoded by phNGAL 101. ing. A Laboratory Manual (1989), Cold Spring Harbor Press) FIG.5 shows the results of a direct ELISA of selected Lcn2 that were used for phagemid production and gene expression. muteins. Four additional oligodeoxynucleotides (SEQ ID NO: 40, FIG. 6 depicts the results of a competitive binding assay of SEQID NO: 21, SEQID NO: 22, SEQID NO: 41) with fixed 25 selected Lcn2 muteins. nucleotide sequences corresponding to the non-coding strand FIG.7 depicts the affinities of selected muteins for human (written below the DNA double strand sequence in 3'-5' direc and cynomolgus Hepcidin-25 as determined by Surface-plas tion) and filling the gaps between the aforementioned oli mon-resonance (SPR). godeoxynucleotides were also used in the assembly reaction. FIG. 8 depicts the in vitro neutralization activity of anti Two shorter flanking oligodeoxynucleotides (SEQID NO: 24 30 Hepcidin-25 lipocalin muteins. and SEQID NO:25), which were added in excess and carried FIG. 9 demonstrates that a lipocalin mutein directed biotin groups, served as primers for the PCR amplification of against hepcidin neutralizes human hepcidin injected into the assembled, entirely synthetic gene fragment. The two 1CC. flanking primers each encompassed a BstXI restriction site FIG. 10 depicts pharmacokinetic parameters for SEQ ID (CCANNNNNNTGG) (SEQ ID NO: 36), giving rise to 35 NO: 14-PEG and SEQID NO: 1-ABD (equal to SEQID NO: mutually non-compatible overhangs upon enzyme digestion. 15). This special arrangement of restriction sites enabled a par ticularly efficient ligation and cloning of the synthetic gene. DETAILED DESCRIPTION OF THE INVENTION Substitution of the amino acid Gln28 to His with respect to the original Lcn2 sequence was necessary to introduce the first 40 In one aspect, the present invention relates to novel, spe BstXI site, while the second one naturally occurs in the cDNA cific-binding proteins directed against or specific for hepci of Lcn2. Furthermore, the unpaired residue Cys87 was din. Proteins of the invention may be used for therapeutic replaced by Ser during the gene assembly. After one pot PCR and/or diagnostic purposes. As used herein, a protein of the the resulting gene fragment was inserted into a vector provid invention “specifically binds a target (here, hepcidin) if it is ing the missing parts of the Lcn2 Structural gene. This illus 45 able to discriminate between that target and one or more tration also depicts two short primers (SEQ ID NO: 32 and reference targets, since binding specificity is not an absolute, SEQID NO: 33) upstream and downstream, respectively, of but a relative property. “Specific binding can be determined, the cassette flanked by the two BstXI restriction sites, which for example, in accordance with Western blots, ELISA-, served for double stranded DNA sequencing. Figure dis RIA-, ECL- IRMA-tests, FACS, IHC and peptide scans. closes full-length DNA sequences as SEQID NOS 42 and 44. 50 Proteins of the invention, which are directed against or respectively, in order of appearance and discloses protein specific for hepcidin, include any number of specific-binding sequence as SEQID NO: 43. protein muteins that are based on a defined protein scaffold. FIG. 2 illustrates the nucleotide sequence of a library of As used herein, a “mutein,” a “mutated entity (whether pro synthetic Lcn2genes (only the central cassette flanked by the tein or nucleic acid) or “mutant” refers to the exchange, two BstXI restriction sites, as in FIG. 1, is shown). This gene 55 deletion, or insertion of one or more nucleotides or amino fragment was prepared by Sloning BioTechnology GmbH. acids, respectively, compared to the naturally occurring Compared with the DNA library described in FIG. 1 there are (wild-type) nucleic acid or protein “reference' scaffold. two differences. First, whenever possible, codons optimized A protein of the invention can be a mutein of a lipocalin, for E. coli expression were used throughout for the non preferably a lipocalin selected from the group consisting of mutated amino acid positions. Second, a mixture of 19 dif 60 retinol-binding protein (RBP), bilin-binding protein (BBP), ferent triplets (GAC, TTC, CTG, CAC, AAT, AGC, ACC, apolipoprotein D (APOD), neutrophil gelatinase associated GCA, ATG, CCT, GTT, TGG, GAG, CAAATC, GGA, CGT, lipocalin (NGAL), tear lipocalin (TLPC), C-microglobulin GCA, TAC), each encoding a different amino acid except related protein (A2m), 24-p3/uterocalin (24-p3), von Ebners Cys, was employed at the 20 randomized positions, which are gland protein 1 (VEGP 1), Von Ebners gland protein 2 (VEGP identical to the ones depicted in FIG.1. Numbering of amino 65 2), and Major allergen Can fl precursor (ALL-1). As used acids corresponds here to an internal scheme employed by herein, a "lipocalin' is defined as monomeric protein of Sloning BioTechnology GmbH, whereby Gly No. 1 is the first approximately 18-20 kDA in weight, having a cylindrical US 9,051,382 B2 5 6 B-pleated sheet SuperSecondary structural region comprising a Hemopexin domain, an SH2 domain, an SH3 domain, a a plurality of (preferably eight) B-strands connected pair-wise Laminin-type EGF-like domain, a C2 domain, “Kappabod by a plurality of (preferably four) loops at one end to define ies’ (Ill. et al. “Design and construction of a hybrid immuno thereby a binding pocket. It is the diversity of the loops in the globulin domain with properties of both heavy and light chain otherwise rigid lipocalin scaffold that gives rise to a variety of 5 variable regions” Protein Eng 10:949-57 (1997)), “Minibod different binding modes among the lipocalin family mem ies” (Martin et al. “The affinity-selection of a minibody bers, each capable of accommodating targets of different size, polypeptide inhibitor of human interleukin-6' EMBO J. shape, and chemical character (reviewed, e.g., in Flower, D. 13:5303-9 (1994)), “Diabodies” (Holligeretal. “Diabodies': R. (1996), supra; Flower, D. R. et al. (2000), supra, or Skerra, small bivalent and bispecific antibody fragments' PNAS A. (2000) Biochim. Biophys. Acta 1482, 337-350). Indeed, 10 USA 90:6444-6448 (1993)), “Janusins” (Traunecker et al. the lipocalin family of proteins have naturally evolved to bind "Bispecific single chain molecules (Janusins) target cytotoxic a wide spectrum of ligands, sharing unusually low levels of lymphocytes on HIV infected cells' EMBO.J. 10:3655-3659 overall sequence conservation (often with sequence identities (1991) and Traunecker et al. “Janusin: new molecular design of less than 20%) yet retaining a highly conserved overall for bispecific reagents' IntJ Cancer Suppl 7:51-52 (1992), a folding pattern. The correspondence between positions in 15 nanobody, an adnectin, a tetranectin, a microbody, an affilin, various lipocalins is well known to one of skill in the art. See, an affibody an ankyrin, a crystallin, a knottin, ubiquitin, a for example, U.S. Pat. No. 7,250,297. Zinc-finger protein, an autofluorescent protein, an ankyrin or In a preferred embodiment, a protein of the invention is a ankyrin repeat protein or a leucine-rich repeat protein, an mutein of Lipocalin 2 (Lcn 2; also known as human neutro avimer (Silverman, Lu Q. Bakker A. To W. Duguay A, Alba B philgelatinase-associated lipocalin, hNGAL, or as sideroca M, Smith R, Rivas A, Li P. Le H, Whitehorn E, Moore KW, lin). The term "human neutrophil gelatinase-associated Swimmer C. Perlroth V. Vogt M, Kolkman J, Stemmer WP lipocalin' or “hNGAL” or “lipocalin 2' or “Lcn2 as used 2005, Nat Biotech, December; 23(12): 1556-61, E-Publica herein to refer to the mature hNGAL with the SWISS-PROT/ tion in Nat. Biotech. 2005 Nov. 20 edition); as well as multi UniProt Data Bank Accession Number P80188 or the mature valent avimer proteins evolved by exon shuffling of a family hNGAL shown in SEQ ID NO:35. The mature form of this 25 of human receptor domains as also described in Silverman J. protein has amino acids 21 to 198 of the complete sequence, Lu Q. Bakker A. To W. Duguay A, Alba B M. Smith R. Rivas since a signal peptide of amino acids 1-20 is cleaved off. The A, Li P. LeH, Whitehorn E, Moore KW, Swimmer C, Perlroth protein further has a disulfide bond formed between the V. Vogt M. Kolkman J. Stemmer W P Nat Biotech, Decem amino acid residues at positions 76 and 175 of the mature ber; 23(12): 1556-61, E-Publication in Nat. Biotechnology. protein. 30 2005 Nov. 20 edition). In a more preferred embodiment, the invention relates to a A protein of the invention may include the wild type (natu lipocalin mutein having a cylindrical B-pleated sheet Super ral) amino acid sequence of the “parental protein scaffold secondary structural region comprising eight B-strands con (such as a lipocalin) outside the mutated amino acid sequence nected pair-wise by four loops at one end to define thereby a positions; alternatively, a lipocalin mutein may also contain binding pocket, wherein at least one amino acid of each of at 35 amino acid mutations outside the sequence positions Sub least three of said four loops has been mutated and wherein jected to mutagenesis that do not interfere with the binding said lipocalin is effective to bind a hepcidin as given non activity and the folding of the mutein. Such mutations can be natural target with detectable affinity. Preferably, said lipoca accomplished on a DNA level using established standard lin mutein has one or more such as 1,2,3,4,6,7,8,9, 10, 11, methods (Sambrook, J. et al. (1989) Molecular Cloning. A 12, 13, 14, 15, 16, 17, 18, 19 or 20 amino acid replacements 40 Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory at a position corresponding to position 36, 40, 41, 49, 52, 68, Press, Cold Spring Harbor, N.Y.). Possible alterations of the 70,72, 73,77, 79, 81.96, 100, 103,106, 125, 127, 132, and/or amino acid sequence are insertions or deletions as well as 134 of the linear polypeptide sequence of NGAL. amino acid Substitutions. In this context, the inventors identified a specific group of Such substitutions may be conservative, i.e. an amino acid Lipocalin 2 muteins with mutations at specific positions 45 residue is replaced with a chemically similar amino acid which show detectable affinity as well as specificity for Hep residue. Examples of conservative substitutions are the cidin. Suitable amino acid positions for mutation include replacements among the members of the following groups: 1) sequence positions 96,100, and 106, of the linear polypeptide alanine, serine, and threonine; 2) aspartic acid and glutamic sequence of human Lipocalin 2. The present invention also acid; 3) asparagine and glutamine; 4) arginine and lysine; 5) relates to nucleic acids encoding these proteins. 50 isoleucine, leucine, methionine, and valine; and 6) phenyla Other protein scaffolds that can be engineered in accor lanine, tyrosine, and tryptophan. One the other hand, it is also dance with the present invention to provide protein muteins possible to introduce non-conservative alterations in the that bind hepcidin with detectable affinity include: an EGF amino acid sequence. In addition, instead of replacing single like domain, a Kringle-domain, a fibronectin type I domain, a amino acid residues, it is also possible to eitherinsert ordelete fibronectin type II domain, a fibronectin type III domain, a 55 one or more continuous amino acids of the primary structure PAN domain, a G 1a domain, a SRCR domain, a Kunitz/ of a parental protein scaffold, where these deletions or inser Bovine pancreatic trypsin Inhibitor domain, tendamistat, a tion result in a stable folded/functional mutein, which can be Kazal-type serine protease inhibitor domain, a Trefoil readily tested by the skilled worker. (P-type) domain, a von Willebrand factor type C domain, an The skilled worker will appreciate methods useful to pre Anaphylatoxin-like domain, a CUB domain, a thyroglobulin 60 pare protein muteins contemplated by the present invention type I repeat, LDL-receptor class A domain, a Sushi domain, but whose protein or nucleic acid sequences are not explicitly a Link domain, a Thrombospondin type I domain, an immu disclosed herein. As an overview, such modifications of the noglobulin domain ora an immunoglobulin-like domain (for amino acid sequence include, e.g., directed mutagenesis of example, domain antibodies or camel heavy chain antibod single amino acid positions in order to simplify Sub-cloning ies), a C-type lectin domain, a MAM domain, a von Will 65 of a mutated lipocalin gene or its parts by incorporating ebrand factor type A domain, a Somatomedin B domain, a cleavage sites for certain restriction enzymes. In addition, WAP-type four disulfide core domain, a F5/8 type C domain, these mutations can also be incorporated to further improve US 9,051,382 B2 7 8 the affinity of a lipocalin mutein for a given target. Further moiety at the side of any of the amino acid positions 14, 21. more, mutations can be introduced to modulate certain char 60, 84,88, 116, 141, 145, 143, 146 and/or 158 may be used to acteristics of the mutein Such as to improve folding stability, PEGylate or HESylate the mutein, for example, in order to serum stability, protein resistance or water solubility or to increase the serum half-life of a respective human Lipocalin reduce aggregation tendency, if necessary. For example, natu 2 mutein. rally occurring cysteine residues may be mutated to other The term “position' when used in accordance with the amino acids to prevent disulphide bridge formation. invention means the position of eitheran amino acid within an Accordingly, the invention also includes functional vari amino acid sequence depicted herein or the position of a ants of proteins disclosed herein, which have a threshold nucleotide within a nucleic acid sequence depicted herein. sequence identity or sequence homology to a reference pro 10 The term “corresponding as used herein also includes that a tein. By “identity” or “sequence identity” is meant a property position is not only determined by the number of the preced of sequences that measures their similarity or relationship. ing nucleotides/amino acids. Accordingly, the position of a The term “sequence identity” or “identity” as used in the given amino acid in accordance with the invention which may present invention means the percentage of pair-wise identical be substituted may very due to deletion or addition of amino residues—following (homologous) alignment of a sequence 15 acids elsewhere in a (mutant or wild-type) lipocalin. Simi of a polypeptide of the invention with a sequence in ques larly, the position of a given nucleotide in accordance with the tion with respect to the number of residues in the longer of present invention which may be substituted may vary due to these two sequences. Percent identity is determined by divid deletions or additional nucleotides elsewhere in a mutein or ing the number of identical residues by the total number of wild type lipocalin 5'-untranslated region (UTR) including residues and multiplying the product by 100. The term the promoter and/or any other regulatory sequences or gene “homology is used herein in its usual meaning and includes (including exons and introns). identical amino acids as well as amino acids which are Thus, under a "corresponding position' inaccordance with regarded to be conservative Substitutions (for example, the invention it is preferably to be understood that nucle exchange of a glutamate residue by an aspartate residue) at otides/amino acids may differ in the indicated number but equivalent positions in the linear amino acid sequence of two 25 may still have similar neighboring nucleotides/amino acids. proteins. Most preferred, the amino acid sequence shown in Said nucleotides/amino acids which may be exchanged, SEQ ID NO:35 is preferred as a “reference sequence”. SEQ deleted or added are also comprised by the term “correspond ID NO:35 shows the mature hNGAL. The term “reference ing position’. When used herein “at a position corresponding sequence' and “wildtype sequence” (of NGAL) is used inter to a position' a position in a "query' amino acid (or nucle changeably herein. Alternatively, the amino acid sequence 30 otide) sequence is meant that corresponds to a position in a with the SWISS-PROT/UniProt Data Bank Accession Num “Subject” amino acid (or nucleotide) sequence. ber P80188 can be used as reference sequence. Specifically, in order to determine whether a nucleotide The percentage of sequence homology or sequence iden residue oramino acid residue of the amino acid sequence of a tity can, for example, be determined herein using the program lipocalin different from a NGAL lipocalin mutein of the BLASTP version blastp2.2.5 (Nov. 16, 2002; cf. Altschul, S. 35 invention corresponds to a certain position in the nucleotide F. et al. (1997) Nucl. Acids Res. 25, 3389-3402). In this sequence or the amino acid sequence of a NGAL lipocalin embodiment the percentage of homology is based on the muteinas described, in particular any of SEQID NOs: 1-14 or alignment of the entire polypeptide sequences (matrix: BLO that having one or more amino acid Substitutions such as 2, 3, SUM 62; gap costs: 11.1; cutoff value set to 10) including 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 at the propeptide sequences, preferably using the wild type pro 40 position36, 40, 41,49, 52, 68, 70, 72,73, 77, 79,81, 96,100, tein scaffold as reference in a pairwise comparison. It is 103, 106, 125, 127, 132, and/or 134 of the linear polypeptide calculated as the percentage of numbers of “positives’ (ho sequence of NGAL, a skilled artisan can use means and mologous amino acids) indicated as result in the BLASTP methods well-known in the art, e.g., alignments, either manu program output divided by the total number of amino acids ally or by using computer programs such as BLAST2.0, selected by the program for the alignment. 45 which stands for Basic Local Alignment Search Tool or Clust It is also possible to deliberately mutate other amino acid alW or any other suitable program which is suitable to gen sequence positions to cysteine in order to introduce new reac erate sequence alignments. Accordingly, a lipocalin mutein of tive groups, for example, for the conjugation to other com any of SEQID Nos: 1-14 or that having one or more amino pounds, such as polyethylene glycol (PEG), hydroxyethyl acid substitutions such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, starch (HES), biotin, peptides or proteins, or for the formation 50 14, 15, 16, 17, 18, 19 or 20 at position 36, 40, 41,49, 52, 68, of non-naturally occurring disulphide linkages. With respect 70,72, 73,77, 79, 81.96, 100, 103,106, 125, 127, 132, and/or to a mutein of human Lipocalin 2, exemplary possibilities of 134 or any other position described herein of the linear Such a mutation to introduce a cysteine residue into the amino polypeptide sequence of NGAL can serve as “subject acid sequence of a lipocalin including human Lipocalin 2 sequence', while the amino acid sequence of a lipocalin mutein to include the introduction of a cysteine (CyS) residue 55 different from NGAL serves as "query sequence'. at at least at one of the sequence positions that correspond to Given the above, a skilled artisan is thus readily in a posi sequence positions 14, 21, 60, 84, 88, 116, 141, 145, 143,146 tion to determine which amino acid position mutated in Lcn2 or 158 of the wildtype sequence of hNGAL. In some embodi as described hereincorresponds to an amino acid of a scaffold ments where a human Lipocalin 2 mutein of the invention has other than Lcn2, preferably such as one of those described a sequence in which, in comparison to the sequence of the 60 herein. Specifically, a skilled artisan can align the amino acid SWISS-PROT/UniProt Data Bank Accession Number sequence of a mutein as described herein, in particular a P80188, a cysteine has been replaced by another amino acid NGAL mutein (or anticalin) of the invention with the amino residue, the corresponding cysteine may be reintroduced into acid sequence of a different lipocalin to determine which the sequence. As an illustrative example, a cysteine residue at amino acid(s) of said mutein correspond(s) to the respective amino acid position 87 may be introduced in Such a case by 65 amino acid(s) of the amino acid sequence of said different reverting to a cysteine as originally present in the sequence of lipocalin. More specifically, a skilled artisan can thus deter SWISS-PROT accession No P80188. The generated thiol mine which amino acid of the amino acid sequence of said US 9,051,382 B2 9 10 different lipocalin corresponds to the amino acid at posi 92% and most preferably more than 95% in relation thereto. tion(s) 36, 40, 41,49, 52, 68, 70, 72,73, 77,79, 81, 96, 100, It is preferred that a structural homolog has still anamino acid 103, 106, 125, 127, 132, and/or 134 or to an amino acid at any replacement at one or more such as 2,3,4,5,6,7,8,9, 10, 11, other position as described herein of the linear polypeptide 12, 13, 14, 15, 16, 17, 18, 19 or 20 positions corresponding to sequence of NGAL. 5 position36, 40, 41,49, 52, 68, 70, 72,73, 77, 79,81, 96,100, Proteins of the invention, which are directed against or 103, 106, 125, 127, 132, and/or 134 of the linear polypeptide specific for hepcidin, include any number of specific-binding sequence of NGAL. protein muteins that are based on a defined protein scaffold. The term “hepcidin” refers to the protein also termed liver Preferably, the scaffold is hNGAL. As used herein, a expressed antimicrobial peptide 1 or putative liver tumor “mutein,” a “mutated entity (whether protein or nucleic acid) 10 regressor, of which the human form has the UniProtKB/ or “mutant” refers to the exchange, deletion, or insertion of Swiss-Prot accession number P81172. On a general basis the one or more nucleotides or amino acids, respectively, com term “hepcidin” refers to any form of the hepcidin protein pared to the naturally occurring (wild-type) nucleic acid or known to be present in vertebrate species, including in mam protein “reference' scaffold. Preferably, the number of nucle mals. The human unprocessed protein has a length of 84 otides oramino acids, respectively, that is exchanged, deleted 15 amino acids and is encoded by the gene "HAMP also known or inserted is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, as “HEPC or “LEAP1. It is cleaved into two chains, which 17, 18, 19, 20 or more such as 25, 30, 35, 40, 45 or 50. are herein also included in the term “Hepcidin.” These two However, it is preferred that a mutein of the invention is still chains are of amino acids 60-84, which is Hepcidin-25 capable of binding hepcidin. (Hepc25) and of amino acids 65-84, which is Hepcidin-20 In Some embodiments, a protein according to the invention (Hepc20). Hepcidin-25 is arranged in the form of a bent binds a hepcidin with a K of 100 uMorless, including 5uM hairpin, stabilized by four disulfide bonds. Natural variants or less, about 500 nM, about 200 nM or less, 100 nM or less, also included in the term “hepcidin' have, for example, the 1 nM or less, or 0.1 nM or less. A protein of the invention may amino acid replacement 59 R->G (VAR 0425129); the specifically bind one or more continuous, discontinuous or amino acid replacement 70 C->R (VAR 042513); the amino conformation epitope(s) of the mature, folded bioactive form 25 acid replacement 71 G->D (VAR 026648) or the amino acid of a hepcidin. replacement 78 C->Y (VAR 042514). A further natural A protein of the invention is able to bind a hepcidin with variant is Hepcidin-22, another N-terminally truncated iso detectable affinity, i.e. with a dissociation constant of at least form (besides Hecidin-20) of Hepcidin-25. 200 nM, i.e. K, of about 200 nM or less. In some embodi The term “mature hepcidin' as used herein refers to any ments, a protein of the invention binds a hepcidin with a 30 mature, bioactive form of the hepcidin protein expressed in a dissociation constant of at least about 100 nM, about 50 nM, vertebrate such as a mammal. The term “human hepcidin' about 25 nM, about 15 nM, about 5 nM, about 2 nM, about 0.5 refers to any form of the hepcidin protein present in humans. nM, about 0.25 nM, about 0.1 nM, about 0.05 nMoreven less. The expression “human hepcidin-25” refers to the mature A protein of the invention preferably binds to a mature human form of human hepcidin with the amino acid sequence as hepcidin molecule with an affinity by a K of about 10 nM or 35 depicted in SEQID NO: 28. In the present invention lipocalin stronger. Binding affinities have been found by the present muteins are provided that are able to bind each given form of inventors to often be of a K, below about 1 nMand, in some hepcidin including proteolytic fragments thereof, regardless cases, about 0.1 nM and below. of whether the respective hepcidin molecule displays biologi The binding affinity of a protein of the invention (e.g. a cal/physiological activity. Thus, the hepcidin molecule may mutein of a lipocalin) to a selected target (in the present case, 40 only be present in a biological sample, without having any hepcidin), can be measured (and thereby K values of a measurable physiological relevance. See, for example, Hep mutein-ligand complex be determined) by a multitude of cidin-22 that so far has only been detected in urine found in methods known to those skilled in the art. Such methods urine and that so far is assumed to merely be a urinary deg include, but are not limited to, fluorescence titration, compe radation product of Hepcidin-25 (reviewed in Kemna et al., tition ELISA, calorimetric methods, such as isothermal titra 45 Haematologica. 2008 Jan.: 93:(1)-97). A mutein of the tion calorimetry (ITC), and Surface plasmon resonance (BIA invention may of course also bind physiological active spe core). Such methods are well established in the art and cies such as the mature, bioactive Hepcidin-25. Accordingly, examples thereofare also detailed below. a mutein of the invention may be used as diagnostic and/or The amino acid sequence of a protein of the invention may pharmaceutical, depending on the hepcidin form chosen to be have a high sequence identity to mature human Lipocalin 2 or 50 recognized. other lipocalins. In this context, a protein of the invention may In line with the above, a protein of the invention preferably have at least 70%, at least 75%, at least 80%, at least 82%, at acts as an antagonist of a hepcidin molecule. In some embodi least 85%, at least 87%, at least 90% identity, including at ments, a protein of the invention (e.g., a human Lipocalin 2 least 95% identity to a protein selected from the group con mutein) may act as an antagonist of a hepcidin molecule by sisting of the sequence of SEQID NOS: 1-14. It is preferred 55 inhibiting the ability of the hepcidin molecule to bind to or that a structural homolog has still an amino acid replacement otherwise interact with ferroportin. The hepcidin may be a at one or more such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, mature human hepcidin format such as hepcidin-25 or hep 15, 16, 17, 18, 19 or 20 positions corresponding to position cidin-20. Binding of a mature hepcidin to ferroportin leads to 36, 40, 41,49, 52,68, 70, 72,73,77, 79,81, 96,100, 103,106, internalization and degradation of ferroportin, standard pro 125, 127, 132, and/or 134 of the linear polypeptide sequence 60 cesses of a protein with a cell Surface/membrane location. of NGAL. In yet another aspect, the present invention includes vari The invention also includes structural homologues of the ous lipocalin muteins, including muteins of human Lipocalin proteins selected from the group consisting of the sequence of 2 that specifically bind hepcidin. In this sense, hepcidin can be SEQ ID NOS: 1-14, which have an amino acid sequence regarded a non-natural ligand of wild type human Lipocalin homology or sequence identity of more than about 60%, 65 2, where “non-natural ligand refers to a compound that does preferably more than 65%, more than 70%, more than 75%, not bind to wildtype lipocalins, including human Lipocalin 2 more than 80%, more than 85%, more than 90%, more than under physiological conditions. By engineering wildtype US 9,051,382 B2 11 12 lipocalins such as human Lipocalin 2 with mutations at cer Ile. The mutein may also include a substitution Arg 81-Glu, tain positions, the present inventors have demonstrated that Gly or Gln. The mutein may, for instance, include within the high affinity and high specificity for a non-natural ligand is linear polypeptide sequence of the mature human Lipocalin2 possible. In one aspect at least at 1,2,3,4,5,6,7,8,9, 10, 11, a substitution Ser 127->Thror Trp. A mutein of the invention 12, 13, 14, 15, 16, 17, 18, 19, and/or 20 nucleotide triplet(s) may in Some embodiments have the set of amino acid Substi encoding for any of the sequence positions 36, 40, 41, 49, 52. tutions, relative to the linear polypeptide sequence of a mature 68, 70, 72, 73,77, 79, 81, 96, 100, 103, 106, 125, 127, 132, human Lipocalin 2, of Tyr 52->His, Ser 68->Arg, Arg and/or 134 of the linear polypeptide sequence of h cn2, or 81->Serand Ser 127->Trp. In some embodiments a mutein of other parallel sites on lipocalins, a random mutagenesis can the invention may have the set of amino acid substitutions of be carried out by allowing substitution at this positions by a 10 Tyr 52->Leu, Ser68->Arg, Arg 81->Glu and Ser 127->Trp. subset of nucleotide triplets. A mutein of the invention may in Some embodiments have the The amino acid replacements in the lipocalin muteins of set of amino acid substitutions of Tyr 52->Phe, Ser68->Gly, the invention as described herein are preferably within one, Arg 81->Gly and Ser 127->Trp. A mutein of the invention two, three or four loop regions of a lipocalin, preferably may in Some embodiments have the set of amino acid Substi hNGAL. The loop regions are from positions 33 to 54 (loop 15 tutions of Tyr 52->Trp, Ser68->Ile, Arg 81->Gln and Ser 1), 66 to 83 (loop 2), 94 to 106 (loop 3), and 123 to 136 (loop 127->Trp. In some embodiments a mutein of the invention 4) of hNGAL. 24-36, 53–66, 79-84, and 103-110 may have the set of amino acid substitutions of Tyr 52->Trp, Further, the lipocalins can be used to generate muteins that Ser68->Arg, Arg81->Glu and Ser 127->Trp. A mutein of the have a mutated amino acid residue at any one or more, includ invention may in some embodiments have the set of amino ing at least at any two or all three, of the sequence positions of acid Substitutions, in relation to the sequence of a mature the sequence positions corresponding to the sequence posi human Lipocalin 2, of Tyr 52->Trp, Ser 68->Arg, Arg tions 96, 100 and 106 of the linear polypeptide sequence of a 81->Glu and Ser 127->Thr. In some embodiments a mutein mature human Lipocalin 2. A Substitution at sequence posi of the invention may have the set of amino acid substitutions tion 96 may for example be a substitution Asn 96->Arg, Asp, of Tyr 52->Trp, Ser 68->Arg, Arg 81->Glu and Ser Gln, Gly, Lys, Ser. Thr or Val. A substitution at sequence 25 127->Trp. position 100 may for example be a substitution Tyr 100->Ala, In a further embodiment of the invention, the mutein Arg, Glu, Gln, Gly, Ser and Val. A substitution at sequence includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, position 106 may for example be a substitution Tyr 106->Ile, 16, 17, 18, 19 or 20 mutated amino acid residues at any of the Gly, Phe, Val or Arg. A mutein of the invention may in some sequence positions corresponding to the sequence positions embodiments have the set of amino acid substitutions, rela 30 33,36, 40, 41,42, 43,44, 46,47, 48,49, 50, 51, 52, 54, 55, 59, tive to the linear polypeptide sequence of a mature human 65, 68, 70, 72,73, 75, 77, 78, 79,80, 81, 86, 87, 98, 96, 99, Lipocalin 2, of Asn 96->Val, and Tyr 100->Gln. In such an 100, 103,106, 107,110, 111, 125, 127, 132, 134, 136 and 138 embodiment the tyrosine at position 106 may be unchanged. of the linear polypeptide sequence of hNGAL or the corre A mutein of the invention may in some embodiments have the sponding sites on other lipocalins. In a further embodiment, set of amino acid Substitutions, relative to the linear polypep 35 the mutein includes at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, tide sequence of a mature human Lipocalin 2, of ASn 14, 15, 16, 17, 18, 19, or 20 mutated amino acid residues at 96->Arg, Tyr 100->Glu, and Tyr 106->Phe. In some embodi any one of the sequence positions 33, 36, 40, 41, 42, 43, 44. ments a mutein of the invention may have the set of amino 46,47, 48,49, 50,51,52,54, 55, 59, 65,68, 70, 72,73, 75, 77, acid substitutions of Asn 96->Asp, Tyr 100->Ser and Tyr 78, 79,80, 81, 86, 87,98,96,99, 100, 103,106, 107,110, 111, 106->Gly. A mutein of the invention may in some embodi 40 125, 127, 132, 134, 136 and 138 of the linear polypeptide ments have the set of amino acid substitutions of ASn sequence of hNGAL or the corresponding sites on other 96->Gly, Tyr 100->Gly and Tyr 106->Gly. A mutein of the lipocalins. In still a further embodiment, the mutein includes invention may in some embodiments have the set of amino 18, 19 or 20 mutated amino acid residues at any one of the acid substitutions of Asn 96->Lys, Tyr 100->Ala and Tyr sequence positions 33, 36, 40, 41, 42, 43, 44, 46, 47, 48, 49. 106->Ile. In some embodiments a mutein of the invention 45 50,51,52,54,55, 59, 65,68, 70, 72,73, 75, 77,78, 79,80, 81, may have the set of amino acid substitutions of Asn 96->Ser, 86, 87,98,96,99, 100, 103,106, 107,110, 111, 125, 127, 132, Tyr 100->Arg and Tyr 106->Val. A mutein of the invention 134, 136 and 138 of the linear polypeptide sequence of human may in Some embodiments have the set of amino acid Substi Lipocalin 2 or the corresponding sites on other lipocalins. tutions of Asn 96->Ser, Tyr 100->Val and Tyr 106->Arg. In A mutein of the invention may, for example, with respect to Some embodiments a mutein of the invention may have the set 50 the mature hLcn2 wildtype amino acid sequence, include one of amino acid substitutions of Asn 96->Thr, Tyr 100->Val or more amino acid replacements such as 2, 3, 4, 5, 6, 7, 8, 9. and Tyr 106->Gly. In some embodiments a mutein of the 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 of the group: present invention further includes a mutated amino acid resi Leu36->Ala, Cys, Thr, Val; Ala 40->Arg, Glu, Gly and Ser; due at position 134 within the linear polypeptide sequence of Ile 41->Ile, Leu, Met or Val; Glin 49->Leu or Met; Leu the mature human Lipocalin 2. In one embodiment this Sub 55 70->Asp, Asn., Gln, Met or Phe; Arg 72->Glu, Gly, Leu or stitution is Lys 134->Trp. Val; Lys 73->Ala, Arg, Glu, Gly, Leu, Thr or Tyr; Asp In some embodiments, a mutein of the present invention 77->Arg, Glu, Gly, Leu, Ser or Val; Trp 79->Gly, Leu, Ser, includes, typically in addition to a mutation at one or more of Tyror Val; Leu103->Ala, Arg, Gly or Trp; Tyr 106->Gly, Ile, sequence positions 96, 100 and 106 (Supra), a mutated amino Phe or Val; Lys 125->Arg, Leu, Met, Phe, Thr, or Val; and Tyr acid residue at any one or more of the sequence positions 60 132->Leu or Val. A mutein of the invention may, for instance, corresponding to the sequence positions 52, 68,81, 127 of the have the set of amino acid combinations, in relation to the linear polypeptide sequence of the mature human Lipocalin2. linear polypeptide sequence of a mature human Lipocalin 2, The mutein may, for instance, include within the linear of Ala36, Ser 40, Leu 41, Met 49, Asn 70, Gly 72, Gly 73, Ser polypeptide sequence of the mature human Lipocalin 2, a 77, Leu 79, Leu125 and Val 132. A mutein of the invention substitution Tyr 52->His, Leu, Phe or Trp. The mutein may 65 may, for example, have the set of amino acid combinations, in also include within the linear polypeptide sequence of the relation to the sequence of a mature human Lipocalin 2, of mature human Lipocalin 2 a substitution Ser68->Arg, Gly or Leu36, Arg 40, Val 41, Gln 49, Asp70, Arg 72, Thr 73, Leu US 9,051,382 B2 13 14 77, Ser 79, Thr 125 and Val 132. In some embodiments a amino acid replacement that may be included in a mutein of mutein of the invention may have the set of amino acid com the invention is the replacement Lys 75->Glu. A mutein of the binations of Leu36, Glu 40, Ile 41, Leu 49, Gln 70, Gly 72, invention may also include, with respect to the mature h cn2 Glu 73, Gly 77, Gly 79, Phe 125 and Val 132. A mutein of the wild type amino acid sequence, the amino acid replacement invention may also have the set of amino acid combinations of 5 Cys 87->Ser. A mutein of the invention may also include the Leu36, Glu 40, Ile 41, Met 49, Met 70, Leu 72, Ala 73, Glu amino acid replacement Ser 146->Pro. A further amino acid 77, Leu 79, Val 125, Val 132 or the set of amino acid combi replacement that may be present in a mutein of the present nations of Leu36, Glu 40, Val 41, Met 49, Met 70, Leu72, Ala invention, relative to the mature hLcn2 wild type amino acid 73, Glu 77, Leu 79, Thr 125 and Val 132. In some embodi sequence, is the replacement Glu 147->Gly. A mutein of the ments a mutein of the invention may have the set of amino 10 invention may include further amino acid replacements. The acid combinations of Leu36, Glu 40, Val 41, Met 49, Met 70, muteins can further includeamino acid replacements, such as Leu72, Ala73, Glu 77, Leu 79, Val 125 and Val 132 or the set TyrS2->Gln or Val; Ser68->Lys or ASn; or Arg81->Trp, Asn of amino acid combinations of Thr36, Ser 40, Ile 41, Gln 49, or His. Phe70, Glu 72, Gly 73, Arg 77, Val 79, Val 125 and Leu 132. A mutein of the invention typically exists as monomeric As a further example, a mutein of the invention may have the 15 protein. However, it is also possible that a lipocalin mutein of set of amino acid combinations of Val 36, Glu 40, Met41, Leu the invention is able to spontaneously dimerise or oligomer 49, Met 70, Glu 72, Tyr 73, Val 77, Leu 79, Arg 125 and Val ise. Although the use of lipocalin muteins that form stable 132. A mutein of the invention may also have the set of amino monomers may be preferred for some applications, e.g. acid combinations of Val 36, Gly 40, Leu 41, Leu 49, Leu 70. because of faster diffusion and better tissue penetration, the Val 72, Arg 73, Arg 77, Tyr 79, Met 125 and Val 132. use of lipocalin muteins that form stable homodimers or In one embodiment of the present invention, the mutein multimers may be advantageous in other instances, since Such includes mutated amino acid residues at at least any 10, 14. multimers can provide for a (further) increased affinity and/or 15, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 35 or all 45 of the avidity to a given target. Furthermore, oligomeric forms of the above-listed sequence positions. lipocalin mutein may have slower dissociation rates or pro A mutein of the invention, which binds to Hepcidin, can 25 longed serum half-life. include with respect to the mature human Lipocalin 2 wild It is also noted that the complex formation between the type amino acid sequence (Lcn2) at least 2, 3, 4, 5, 6, 7, 8, 9. respective mutein and its ligand is influenced by many differ 10, 11, 12, 13, 14, 15, 16 or 17 amino acid replacements ent factors such as the concentrations of the respective bind which include, but are not limited to, Leu36 Val or Cys: ing partners, the presence of competitors, pH and the ionic Ala40->Tyr or Lys or Val: Ile41->Thr or Ser or Leu: 30 strength of the buffer system used, and the experimental Gln49->Leu or Trp; Leu70->Gly; Arg72->Gly or Asp; method used for determination of the dissociation constant Lys73->Leu or Thr or Asp: Asp77->Asin or His or Leu: K (for example fluorescence titration, competition ELISA Trp79->Lys; ASn96->Ile or Arg: Tyr100->Gln or Argor Glu: or Surface plasmon resonance, just to name a few) or even the Leu103->Met or Arg or Gly: Tyr106->Tyr or Ala or Trp: mathematical algorithm which is used for evaluation of the Lys125->Thr or Val or Glu: Ser127->Gly or Gln or Ala: 35 experimental data. Tyr132->Met or Seror Thr; and Lys134->Asn Therefore, it is also clear to the skilled person that the K, In one embodiment, a mutein of the invention, which binds values (dissociation constant of the complex formed between to Hepcidin includes the following amino acid replacements: the respective mutein and its target/ligand) may vary within a Leu36->Val; Ala40->Tyr: Ile41->Thr, Gln49->Leu: certain experimental range, depending on the method and Leu70->Gly: Lys73->Leu: Asp77->ASn: Trp79->Lys: 40 experimental setup that is used for determining the affinity of Asn96->Ile: Tyr100->Gln: Leu103->Met; Lys125->Thr: a particular lipocalin mutein for a given ligand. This means Ser127->Gly: Tyr132->Met; and Lys134->Asn. In a further that there may be a slight deviation in the measured K values embodiment, a mutein of the invention, which binds to Hep or a tolerance range depending, for example, on whether the cidin, includes the following amino acid replacements K. Value was determined by Surface plasmon resonance (Bia Leu36->Val; Ala40->Lys: Ile41->Ser; Gln49->Trp: 45 core), by competition ELISA, or by “direct ELISA.” Leu70->Gly; Arg72->Gly: Lys73->Thr; Asp77->His: In one embodiment, the muteins disclosed herein can be Trp79->Lys; ASn96->Arg: Tyr100->Arg; Leu103->Arg: linked, either N- or C-terminal to an affinity tag such as Tyr106->Ala; Lys125->Val; Ser127->Gln: Tyr132->Ser; pentahistidine tag (SEQID NO:37), a hexahistidine tag (SEQ and Lys134->Asn. In another embodiment, a mutein of the ID NO: 38) or a steptavidin tag (e.g. Streptae(R). Thus, the invention, which binds to Hepcidin, includes the following 50 present application encompasses also all explicitly and amino acid replacements Leu36->Cys: Ala40->Val; generic described muteins equipped with Such tags. Ile41->Leu: Gln49->Leu: Leu70->Gly; Arg72->Asp; The term “fragment as used in the present invention in Lys73->Asp; Asp77->Leu: Trp79->Lys; ASn96->Arg: connection with the feature lipocalin mutein fragment relates Tyr100->Glu; Leu103->Gly: Tyr106->Trp; Lys125->Glu: to proteins or peptides derived from full-length mature Lcn 2 Ser127->Ala: Tyr132->Thr; and Lys134->ASn. 55 that are N-terminally and/or C-terminally shortened, i.e. lack A mutein according to the present invention may further ing at least one of the N-terminal and/or C-terminal amino include, with respect to the mature hLcn2 wild type amino acids. Such fragments include preferably at least 10, more acid sequence, the amino acid replacement Gln28->His. A preferably 20, most preferably 30 or more consecutive amino mutein according to the invention may also include, relative acids of the primary sequence of mature Lcn2 and are usually to the mature hLcn2 wild type amino acid sequence, the 60 detectable in an immunoassay of mature Lcn 2. The word amino acid replacement Lys 62->Arg. Further, a mutein “detect' or “detecting as used herein is understood both on a according to the present invention may include, relative to the quantitative and a qualitative level, as well as a combination mature hLcn2 wildtype amino acid sequence, the amino acid thereof. It thus includes quantitative, semi-quantitative and replacement Phe 71->Pro or Ser. A further amino acid qualitative measurements of a molecule of interest. Accord replacement that may be present in a mutein of the present 65 ingly, the presence or absence of a molecule Such as a hepci invention, relative to the mature hLcn2 wild type amino acid din, e.g. in a sample, as well as its concentration or level may sequence, is the replacement Lys 74->Glu. Yet a further be determined. US 9,051,382 B2 15 16 Also included in the scope of the present invention are the tissue or organ or for the selective targeting of cells, e.g., of above muteins, which have been altered with respect to their tumor cells without affecting the Surrounding normal cells. immunogenicity, to reduce any detected immunogenicity by Examples of such therapeutically active agents include radio employing methods known to the skilled worker in the field. nuclides, toxins, Small organic molecules, and therapeutic Cytotoxic T-cells recognize peptide antigens on the cell peptides (such as peptides acting as agonists/antagonists of a Surface of an antigen-presenting cell in association with a cell Surface receptor or peptides competing for a protein class I major histocompatibility complex (MHC) molecule. binding site on a given cellular target). Examples of Suitable The ability of the peptides to bind to MHC molecules is allele toxins include, but are not limited to pertussis-toxin, diphthe specific and correlates with their immunogenicity. To reduce ria toxin, ricin, saporin, pseudomonas exotoxin, calicheami the immunogenicity of a given protein, the ability to predict 10 cin or a derivative thereof, a taxoid, a maytansinoid, a tubul which peptides in a protein have the potential to bind to a ysin or a dolastatin analogue. The dolastatin analogue may be given MHC molecule is of great value. Approaches that auristatin E. monomethylauristatin E. auristatin PYE and employ a computational threading approach to identify auristatin PHE. Examples of cytostatic agent include, but are potential T-cell epitopes have been previously described to not limited to Cisplatin, Carboplatin, Oxaliplatin, 5-Fluorou predict the binding of a given peptide sequence to MHC class 15 racil, Taxotere (Docetaxel), Paclitaxel, Anthracycline (Doxo 1 molecules (Altuviaetal. (1995).J. Mol. Biol. 249:244-250). rubicin), Methotrexate, Vinblastin, Vincristine, Vindesine, Such an approach may also be utilized to identify potential Vinorelbine, Dacarbazine, Cyclophosphamide, Etoposide, T-cell epitopes in the muteins of the invention and to make, Adriamycine, Camptotecine, Combretatastin A-4 related depending on its intended use, a selection of a specific mutein compounds, Sulfonamides, oxadiazolines, benzobthiophe on the basis of its predicted immunogenicity. It may be fur nessynthetic spiroketal pyrans, monotetrahydrofuran com thermore possible to subject peptide regions that have been pounds, curacin and curacin derivatives, methoxyestradiol predicted to contain T-cell epitopes to additional mutagenesis derivatives and Leucovorin. The lipocalin muteins of the to reduce or eliminate these T-cell epitopes and thus minimize invention may also be conjugated with therapeutically active immunogenicity. The removal of amphipathic epitopes from nucleic acids such as antisense nucleic acid molecules, Small genetically engineered antibodies has been described (Mateo 25 interfering RNAs, micro RNAS or ribozymes. Such conju et al. (2000) Hybridoma 19(6):463-471) and may be adapted gates can be produced by methods well known in the art. to the muteins of the present invention. The muteins thus In one embodiment, the muteins of the invention may also obtained may possess a minimized immunogenicity, which is be coupled to a targeting moiety that targets a specific body desirable for their use in therapeutic and diagnostic applica region in order to deliver the inventive muteins to a desired tions, such as those described below. 30 region or area within the body. One example wherein such For some applications, it is also useful to employ the modification may be desirable is the crossing of the blood muteins of the invention in a conjugated form. Accordingly, brain-barrier. In order to cross the blood-brain barrier, the the invention is also directed to lipocalin muteins which are muteins of the invention may be coupled to moieties that conjugated to a compound which can include, but is not facilitate the active transport across this barrier (see Gaillard limited to organic molecules, an enzyme label, a colored 35 PJ, et al. (2005) International Congress Series. 1277,185 label, a cytostatic agent, a toxin, a label that can be photoac 198 or Gaillard PJ, et al. (2005) Expert Opin Drug Deliv. 2(2), tivated and which is suitable for use in photodynamic therapy, 299-309). Such compounds are for example available under a fluorescent label, a radioactive label, a chromogenic label, a the trade name 2B-TransTM (to-BBB technologies BV, luminescent label, metal complexes, metal. Such as colloidal Leiden, NL). Other exemplary targeting molecules to which gold, haptens, digoxigenin, biotin, a chemotherapeutic metal, 40 the muteins of the present invention may be coupled include or a chemotherapeutic metal, to name only a few evocative antibodies, antibody fragments or lipocalin muteins with examples. The mutein may also be conjugated to an organic affinity for a desired target molecule. The target molecule of drug molecule. The conjugation can be carried out using any the targeting moieties may, for example, be a cell-surface conventional coupling method known in the art. antigen. Cell-Surface antigens may be specific for a cell or The term “organic molecule' or “small organic molecule' 45 tissue type. Such as, for example, cancer cells. Illustrative as used herein for the non-natural target denotes an organic examples of such cell surface proteins are HER-2 or pro molecule comprising at least two carbon atoms, but prefer teoglycans such as NEU-2. ably not more than 7 or 12 rotatable carbon bonds, having a As indicated above, a mutein of the invention may in some molecular weight in the range between 100 and 2000 Dalton, embodiments be conjugated to a compound that extends the preferably between 100 and 1000 Dalton, and optionally 50 serum half-life of the mutein (in this regard see also PCT including one or two metal atoms. publication WO 2006/56464 where such conjugation strate In general, it is possible to label a lipocalin mutein gies are described with references to muteins of human neu described herein with any appropriate chemical Substance or trophil gelatinase-associated lipocalin with binding affinity enzyme, which directly or indirectly generates a detectable for CTLA-4). The compound that extends the serum half-life compound or signal in a chemical, physical, optical, or enzy 55 may be a polyalkylene glycol molecule, such as polyethylene matic reaction. An example for a physical reaction and at the (PEG) or an activated derivative thereof; hydroxyethyl starch, same time optical reaction/marker is the emission of fluores fatty acid molecules, such as palmitic acid (Vajo & Duck cence upon irradiation. Alkaline phosphatase, horseradish worth (2000) Pharmacol. Rev. 52, 1-9), an Fc part of an peroxidase or B-galactosidase are examples of enzyme labels immunoglobulin, a C3 domain of an immunoglobulin, a (and at the same time optical labels) which catalyze the for 60 C4 domain of an immunoglobulin, albumin or a fragment mation of chromogenic reaction products. In general, all thereof, an albumin binding peptide, an albumin binding pro labels commonly used for antibodies (except those exclu tein, transferrin, or the tag Pro-Ala-Ser, to name only a few. sively used with the Sugar moiety in the Fc part of immuno The albumin binding protein may be a bacterial albumin globulins) can also be used for conjugation to the muteins of binding protein, an antibody, an antibody fragment including the present invention. The muteins of the invention may also 65 domain antibodies (see U.S. Pat. No. 6,696.245, for be conjugated with any Suitable therapeutically active agent, example), or a lipocalin mutein with binding activity for e.g., for the targeted delivery of Such agents to a given cell, albumin. Accordingly, Suitable conjugation compounds for US 9,051,382 B2 17 18 extending the half-life of a lipocalin mutein of the invention (PEG-ADA) or PEG-superoxide dismutase (see for example, include albumin (Osborn et al. (2002) J. Pharmacol. Exp. Fuertgesetal. (1990)“The Clinical Efficacy of Poly(Ethylene Ther. 303, 540-548), or an albumin binding protein, for Glycol)-Modified Proteins' J. Control. Release 11, 139-148). example, a bacterial albumin binding domain, Such as the one The molecular weight of such a polymer, preferrably poly of streptococcal protein G (König, T. and Skerra, A. (1998).J. ethylene glycol, may range from about 300 to about 70.000 Immunol. Methods 218, 73-83). Other examples of albumin Dalton, including, for example, polyethylene glycol with a binding peptides that can be used as conjugation partner are, molecular weight of about 10,000, of about 20,000, of about for instance, those having a Cys-Xaa-Xaa-Xaa-Xaa-Cys 30.000 or of about 40,000 Dalton. Moreover, e.g. as described consensus sequence, wherein Xaa is Asp, ASn, Ser, Thr, or in U.S. Pat. No. 6,500,930 or 6,620,413, carbohydrate oligo Trp, Xaa is ASn, Gln, His, Ile, Leu, or Lys; Xaa is Ala, Asp, 10 and polymers such as starch or hydroxyethyl starch (HES) Phe, Trp, or Tyr; and Xaa, is Asp, Gly, Leu, Phe, Ser, or Thras can be conjugated to a mutein of the invention for the purpose described in US patent application 2003/0069395 or Dennis of serum half-life extension. et al. (Dennis et al. (2002).J. Biol. Chem. 277, 35035-35043). In another embodiment, in order to provide suitable amino In other embodiments, albumin itself or a biological active acid side chains for conjugating one of the above compounds fragment of albumin can be used as compound of a lipocalin 15 to the muteins of the invention artificial amino acids may be mutein of the invention that extends the serum half-life of the introduced by mutagenesis. Generally, Such artificial amino mutein. The term “albumin' includes all mammal albumins acids are designed to be more reactive and thus to facilitate the Such as human serum albuminor bovine serum albuminor rat conjugation to the desired moiety. One example of Such an albumin. The albumin or fragment thereof can be recombi artificial amino acid that may be introduced via an artificial nantly produced as described in U.S. Pat. No. 5,728,553 or tRNA is para-acetyl-phenylalanine. European patent applications EP 0330451 and EP 0361991. For several applications of the muteins disclosed herein, it Recombinant human albumin (Recombumin(R) for use as a may be advantageous to use them in the form of fusion pro protein stabilizer is for example available from Novozymes teins. In some embodiments, the inventive mutein is fused at Delta Ltd. (Nottingham, UK). its N-terminus and/or its C-terminus to a protein, a protein If the albumin-binding protein is an antibody fragment it 25 domain or a peptide Such as a signal sequence and/or an may be a domain antibody. Domain Antibodies (dAbs) are affinity tag. engineered to allow precise control over biophysical proper For pharmaceutical applications, a mutein of the invention ties and in vivo half-life to create the optimal safety and may be fused to a fusion partner that extends the in vivo serum efficacy product profile. Domain Antibodies are for example half-life of the mutein (see again PCT publication WO 2006/ commercially available from Domantis Ltd. (Cambridge, UK 30 56464 where suitable fusion partner are described with ref and MA, USA). erences to muteins of human neutrophile gelatinase-associ Using transferrin as a moiety to extend the serum half-life ated lipocalin with binding affinity for CTLA-4). Similar to of the muteins of the invention, the muteins can be genetically the conjugated compounds described above, the fusion part fused to the N or C terminus, or both, of non-glycosylated ner may be an Fc part of an immunoglobulin, a C3 domain transferrin. Non-glycosylated transferrin has a half-life of 35 of an immunoglobulin, a C4 domain of an immunogloubu 14-17 days, and a transferrin fusion protein will similarly lin, albumin, an albumin binding peptide or an albumin bind have an extended half-life. The transferrin carrier also pro ing protein, to name only a few. Again, the albumin binding vides high bioavailability, biodistribution and circulating sta protein may be a bacterial albumin binding protein or a bility. This technology is commercially available from BioR lipocalin mutein with binding activity for albumin. Accord exis (BioRexis Pharmaceutical Corporation, PA, USA). 40 ingly, suitable fusion partners for extending the half-life of a Recombinant human transferrin (DeltaFerrinTM) for use as a lipocalin mutein of the invention include albumin (Osborn, B. protein stabilizer is also commercially available from L. et al. (2002) supra J. Pharmacol. Exp. Ther. 303,540-548), Novozymes Delta Ltd. (Nottingham, UK). or an albumin binding protein, for example, a bacterial albu If an Fc part of an immunoglobulin is used for the purpose min binding domain, Such as streptococcal protein G (König, to prolong the serum half-life of the muteins of the invention, 45 T. and Skerra, A. (1998) supra J. Immunol. Methods 218, the SynFusionTM technology, commercially available from 73-83). The albumin binding peptides described in Dennis et Syntonix Pharmaceuticals, Inc (MA, USA), may be used. The al, supra (2002) or US patent application 2003/0069395 hav use of this Fc-fusion technology allows the creation of longer ing a Cys-Xaa1-Xaa-Xaas-Xaa-CyS consensus sequence, acting biopharmaceuticals and may for example comprise wherein Xaa is Asp, Asn. Ser. Thr, or Trp. Xaa, is ASn, Gln, two copies of the mutein linked to the Fc region of an antibody 50 His, Ile, Leu, or LyS, Xaa is Ala, Asp, Phe, Trp, or Tyr, and to improve pharmacokinetics, solubility, and production effi Xaa is Asp, Gly, Leu, Phe, Ser, or Thr can also be used as ciency. fusion partner. It is also possible to use albumin itself or a Yet another alternative to prolong the half-life of a mutein biological active fragment of albumin as fusion partner of a of the invention is to fuse the N- or C-terminus of a mutein of lipocalin mutein of the invention. The term “albumin' the invention to long, unstructured, flexible glycine-rich 55 includes all mammal albumins such as human serum albumin sequences (for example poly-glycine with about 20 to 80 or bovine serum albumin or rat serum albumin. The recom consecutive glycine residues). This approach disclosed in binant production of albumin or fragments thereof is well WO2007/038619, for example, has also been term “rPEG” known in the art and for example described in U.S. Pat. No. (recombinant PEG). 5,728,553, European patent application EP 0330451 or EP0 If polyalkylene glycol is used as compound that extends the 60 361991. half-life of the mutein, the polyalkylene glycol can be substi The fusion partner may confer new characteristics to the tuted or unsubstituted. It can also be an activated polyalkylene inventive lipocalin mutein such as enzymatic activity or bind derivative. Examples of suitable compounds are polyethylene ing affinity for other molecules. Examples of suitable fusion glycol (PEG) molecules as described in WO 99/64016, in proteins are alkaline phosphatase, horseradish peroxidase, U.S. Pat. No. 6,177,074 or in U.S. Pat. No. 6,403,564 in 65 gluthation-5-transferase, the albumin-binding domain of pro relation to interferon, or as described for other proteins such tein G, protein A, antibody fragments, oligomerization as PEG-modified asparaginase, PEG-adenosine deaminase domains, lipocalin muteins of same or different binding US 9,051,382 B2 19 20 specificity (which results in the formation of “duocalins, cf. adenylation or the like. If, however, these termination Schlehuber, S., and Skerra, A. (2001), Duocalins, engineered sequences are not satisfactory functional in a particular host ligand-binding proteins with dual specificity derived from the cell, then they may be substituted with signals functional in lipocalin fold (Biol. Chem. 382, 1335-1342), or toxins. that cell. In particular, it may be possible to fuse a lipocalin mutein 5 Therefore, a nucleic acid molecule of the invention can of the invention with a separate enzyme active site such that include a regulatory sequence, preferably a promoter both “components’ of the resulting fusion protein together sequence. In another preferred embodiment, a nucleic acid act on a given therapeutic target. The binding domain of the molecule of the invention includes a promoter sequence and a lipocalin mutein attaches to the disease-causing target, allow transcriptional termination sequence. Suitable prokaryotic ing the enzyme domain to abolish the biological function of 10 promoters are, for example, the tet promoter, the lacUV5 the target. promoter or the T7 promoter. Examples of promoters useful Affinity tags such as the Strep-tag R or Strep-tagR II for expression in eukaryotic cells are the SV40 promoter or (Schmidt, T.G.M. et al. (1996) J. Mol. Biol. 255, 753-766), the CMV promoter. the myc-tag, the FLAG-tag, the His6-tag (SEQID NO:38) or The nucleic acid molecules of the invention can also be part the HA-tag or proteins such as glutathione-S-transferase also 15 of a vector or any other kind of cloning vehicle, such as a allow easy detection and/or purification of recombinant pro plasmid, a phagemid, a phage, a baculovirus, a cosmid or an teins are further examples of preferred fusion partners. artificial chromosome. Finally, proteins with chromogenic or fluorescent properties The DNA molecule encoding lipocalin muteins of the such as the green fluorescent protein (GFP) or the yellow invention, and in particular a cloning vector containing the fluorescent protein (YFP) are suitable fusion partners for a coding sequence of Such a lipocalin mutein can be trans lipocalin mutein of the invention as well. formed into a host cell capable of expressing the gene. Trans The term “fusion protein’ as used herein also includes formation can be performed using standard techniques (Sam lipocalin muteins according to the invention containing a brook, J. et al. (1989), supra). signal sequence. Signal sequences at the N-terminus of a Thus, the invention is also directed to a host cell containing polypeptide direct this polypeptide to a specific cellular com 25 a nucleic acid molecule as disclosed herein. partment, for example the periplasm of E. coli or the endo The invention also relates to a method for the production of plasmatic reticulum of eukaryotic cells. A large number of a mutein of the invention, signal sequences is known in the art. A preferred signal wherein the mutein, a fragment of the mutein or a fusion sequence for secretion a polypeptide into the periplasm of E. protein of the mutein and another polypeptide is produced coli is the Omp A-signal sequence. 30 starting from the nucleic acid coding for the mutein by means The present invention also relates to nucleic acid molecules of genetic engineering methods. The method can be carried (DNA and RNA) comprising nucleotide sequences coding for out in vivo, the mutein can for example be produced in a muteins as described herein. Since the degeneracy of the bacterial or eucaryotic host organism and then enriched, puri genetic code permits substitutions of certain codons by other fied or isolated from this host organism or its culture. It is also codons specifying the same amino acid, the invention is not 35 possible to produce a protein invitro, for example by use of an limited to a specific nucleic acid molecule encoding a mutein in vitro translation system. The term "enriched' means that of the invention but includes all nucleic acid molecules com the mutein or a functional fragment thereof constitutes a prising nucleotide sequences encoding a functional mutein. significantly higher fraction of the total protein present in a A nucleic acid molecule disclosed in this application may sample or solution of interest than in a sample or Solution be “operably linked to a regulatory sequence (or regulatory 40 from which it was taken. Enrichment may for instance sequences) to allow expression of this nucleic acid molecule. include the isolation of a certain fraction from a cell extract. A nucleic acid molecule, such as DNA, is referred to as This may be obtained by standard techniques such as cen “capable of expressing a nucleic acid molecule' or capable trifugation. Examples of other means of enrichment are fil “to allow expression of a nucleotide sequence' if it includes tration or dialysis, which may for instance be directed at the sequence elements which contain information regarding to 45 removal of undesired molecules below a certain molecular transcriptional and/or translational regulation, and Such weight, or a precipitation using organic solvents or ammo sequences are “operably linked to the nucleotide sequence nium Sulphate. Purification may for instance include a chro encoding the polypeptide. An operable linkage is a linkage in matographic technique, for example gel filtration, ion which the regulatory sequence elements and the sequence to exchange chromatography, affinity purification, hydrophobic be expressed are connected in a way that enables gene expres 50 interaction chromatography or hydrophobic charge induction Sion. The precise nature of the regulatory regions necessary chromatography. Another example for a purification is an for gene expression may vary among species, but in general electrophoretic technique, such as preparative capillary elec these regions include a promoter which, in prokaryotes, con trophoresis. Isolation may include the combination of similar tains both the promoter per se, i.e. DNA elements directing methods. As used herein, “substantially pure' or “substan the initiation of transcription, as well as DNA elements 55 tially purified” means a compound or species that is the pre which, when transcribed into RNA, will signal the initiation dominant species present (i.e., on a molar basis it is more of translation. Such promoter regions normally include 5' abundant than any other individual species in the composi non-coding sequences involved in initiation of transcription tion). In some embodiments, a Substantially purified compo and translation, such as the -35/-10 boxes and the Shine sition is a composition in which the species includes at least Dalgarno element in prokaryotes or the TATA box, CAAT 60 about 50 percent (on a molar basis) of all molecular or, as sequences, and 5'-capping elements in eukaryotes. These applicable, all macromolecular species present. In certain regions can also include enhancer or repressor elements as embodiments, a Substantially pure composition will have well as translated signal and leader sequences for targeting more than about 80%, about 85%, about 90%, about 95%, or the native polypeptide to a specific compartment of a host about 99% of all molecular or, as applicable, all macromolar cell. 65 species present in the composition. In addition, the 3' non-coding sequences may contain regu When producing the mutein in Vivo, a nucleic acid encod latory elements involved in transcriptional termination, poly ing a mutein of the invention is introduced into a suitable US 9,051,382 B2 21 22 bacterial or eukaryotic host organism by means of recombi nition sequences for restriction endonucleases also present in nant DNA technology (as already outlined above). For this the sequence of the cloning vector can be engineered into the purpose, the host cell is first transformed with a cloning sequence of the synthetic oligonucleotides. Thus, after ampli vector comprising a nucleic acid molecule encoding a mutein fication of the respective PCR product and enzymatic cleav of the invention using established standard methods (Sam 5 age the resulting fragment can be easily cloned using the brook, J. et al. (1989), supra). The host cell is then cultured corresponding recognition sequences. under conditions, which allow expression of the heterologous Longer sequence segments within the gene coding for the DNA and thus the synthesis of the corresponding polypep protein selected for mutagenesis can also be subjected to tide. Subsequently, the polypeptide is recovered either from random mutagenesis via known methods, for example by use the cell or from the cultivation medium. 10 In one aspect, the present invention relates to a method for of the polymerase chain reaction under conditions of the generation of a mutein which binds hepcidin, comprising: increased error rate, by chemical mutagenesis or by using Subjecting a nucleic acid molecule encoding a lipocalin to bacterial mutator strains. Such methods can also be used for mutagenesis, resulting in one or more mutein nucleic acid further optimization of the target affinity or specificity of a molecule(s). 15 lipocalin mutein. Mutations possibly occurring outside the The method can further include: segments of experimental mutagenesis are often tolerated or expressing the one more mutein nucleic acid molecule(s) can even prove to be advantageous, for example if they con obtained in (a) in a suitable expression system, tribute to an improved folding efficiency or folding stability bringing the plurarity of muteins into contact with at least of the lipocalin mutein. a fragment or a mature form of hepcidin, and In a further embodiment, the method includes subjecting enriching the one or more mutein(s) having a detectable the nucleic acid molecule to mutagenesis at nucleotide trip binding affinity for a given target by means of selection and/or lets coding for at least any 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, isolation. 13, 14, 15, 16, 17, 18, 19 or 20 of the sequence positions The term “mutagenesis' as used herein means that the corresponding to the sequence positions 33.36, 40, 41, 42, 43. experimental conditions are chosen such that the amino acid 25 44, 46,47, 48,49, 50, 51, 52,54, 55, 59, 65, 68, 70, 72,73, 75, naturally occurring at a given sequence position of the lipoca 77,78, 79,80, 81, 86, 87,98,96,99, 100, 103,106, 107,110, lin, including Lcn 2 (hNGAL: Swiss-Prot data bank entry 111, 125, 127, 132,134,136 and/or 138 of the linear polypep P80188) can be substituted by at least one amino acid that is tide sequence of the lipocalin, or, for example, human Lipoca not present at this specific position in the respective natural lin 2. Such a nucleic acid may subjected to mutagenesis and polypeptide sequence. The term “mutagenesis also includes 30 introduced into a suitable bacterial or eukaryotic host organ the (additional) modification of the length of sequence seg ism by using recombinant DNA technology. Obtaining a ments by deletion or insertion of one or more amino acids. nucleic acid library of a lipocalin can be carried out using any Thus, it is within the scope of the invention that, for example, Suitable technique that is known in the art for generating one amino acid at a chosen sequence position is replaced by a lipocalin muteins with antibody-like properties, i.e. muteins stretch of three random mutations, leading to an insertion of 35 that have affinity towards a given target. Examples of Such two amino acid residues compared to the length of the respec combinatorial methods are described in detail in the interna tive segment of the wild type protein. Such an insertion of tional patent applications WO 99/16873, WO 00/75308, WO deletion may be introduced independently from each other in 03/029471, WO 03/029462, WO 03/029463, WO 2005/ any of the peptide segments that can be subjected to mutagen 019254, WO 2005/019255, WO 2005/019256, or WO 2006/ esis in the invention. In one exemplary embodiment of the 40 56464 for instance. The content of each of these patent appli invention, an insertion of several mutations may be intro cations is incorporated by reference herein in their entirety. duced into the loop AB of the chosen lipocalin scaffold (cf. After expression of the nucleic acid sequences that were International Patent Application WO 2005/019256 which is Subjected to mutagenesis in an appropriate host, the clones incorporated by reference its entirety herein). The term “ran carrying the genetic information for the plurality of respective dom mutagenesis' means that no predetermined singleamino 45 lipocalin muteins, which bind a given target can be selected acid (mutation) is present at a certain sequence position but from the library obtained. Well known techniques can be that at least two amino acids can be incorporated with a employed for the selection of these clones, such as phage certain probability at a predefined sequence position during display (reviewed in Kay, B. K. et al. (1996) supra; Lowman, mutagenesis. H. B. (1997) supra or Rodi, D.J., and Makowski, L. (1999) In one non-limiting approach, the coding sequence of 50 supra), colony screening (reviewed in Pini, A. et al. (2002) human Lipocalin 2 can be used as a starting point for the Comb. Chem. High Throughput Screen. 5, 503-510), ribo mutagenesis of the peptide segments selected in the present some display (reviewed in Amstutz, P. et al. (2001) Curr: invention. For the mutagenesis of the recited amino acid Opin. Biotechnol. 12,400-405) or mRNA display as reported positions, the person skilled in the art has at his disposal the in Wilson, D. S. et al. (2001) Proc. Natl. Acad. Sci. USA 98, various established standard methods for site-directed 55 3750-3755 or the methods specifically described in WO mutagenesis (Sambrook, J. etal. (1989), Supra). A commonly 99/16873, WO 00/75308, WO 03/029471, WO 03/0294.62, used technique is the introduction of mutations by means of WO 03/029463, WO 2005/019254, WO 2005/019255, WO PCR (polymerase chain reaction) using mixtures of synthetic 2005/019256, or WO 2006/56464. oligonucleotides, which bear a degenerate base composition In accordance with this disclosure, another embodiment of at the desired sequence positions. Other similar techniques 60 the above methods comprises: are well known to those of skill in the art. (i) providing at least a fragment of hepcidin as a given The nucleic acid molecules defined above can be con target/ligand for example, nected by ligation with the missing 5'- and 3'-sequences of a contacting the plurality of muteins with said target/ligand nucleic acid encoding a lipocalin polypeptide and/or the vec in order to allow formation of complexes between said ligand tor, and can be cloned in a known host organism. A multitude 65 and muteins having binding affinity for said target/ligand, and of established procedures are available for ligation and clon removing muteins having no or no Substantial binding ing (Sambrook, J. et al. (1989), Supra). For example, recog affinity. US 9,051,382 B2 23 24 In one embodiment of the methods of the invention, the accordance with any known protocol such as the one selection binding affinity is carried out under competitive described by Zaccolo et al. (1996).J. Mol. Biol. 255,589-603. conditions. Competitive conditions as used herein means that Other methods of random mutagenesis that are suitable for selection of muteins encompasses at least one step in which such purposes include random insertion/deletion (RID) the muteins and the fragment of hepcidinor a mature hepcidin mutagenesis as described by Murakami et al. (2002) Nat. Such as Hepcidin-25 (target) are brought in contact in the Biotechnol. 20, 76-81 or nonhomologous random recombi presence of an additional ligand, which competes with bind nation (NRR) as described by Bittker et al. (2002) Nat. Bio ing of the muteins to the target (hepcidin). This additional technol. 20, 1024-1029. If desired, affinity maturation can target may be another form of hepcidin, for example Hepci also be carried out according to the procedure described in din-20 (in case muteins are to be selected that selectively bind 10 WO 00/75308 or Schlehuber et al. (2000).J. Mol. Biol. 297, Hepcidin-25 or even the five N-terminal residues of Hepci 1105-1120, where muteins of the bilin-binding protein hav din-25 (as indicated earlier, it is presently assumed that the ing high affinity to digoxigenin were obtained. A further iron-regulating bioactivity is almost exclusively due to the 25 approach for improving the affinity is to carry out positional amino acid form Hepcidin-25, indicating that the five N-ter saturation mutagenesis. In this approach 'small nucleic acid minal amino acids are essential for this activity, Kenma et al., 15 libraries can be created in which amino acid exchanges/mu Supra), an excess of the target itself or any other non-physi tations are only introduced at Single positions within any of ological ligand of the hepcidin that binds at least an overlap the four loop segments. These libraries are then directly sub ping epitope to the epitope recognized by the muteins of the jected to a selection step (affinity Screening) without further invention and thus interferes with target (hepcidin) binding of rounds of panning. This approach allows the identification of the muteins. Alternatively, the additional ligand competes residues that contribute to improved binding of the desired with binding of the muteins by complexing an epitope distinct target and allows identification of “hot spots” that are impor from the binding site of the muteins to the target by allosteric tant for the binding. effects. Accordingly, any fragment, precursor or mature form In one embodiment, the above method for modifying a of Hepcidin can be used in the generation of muteins of the mutein further includes introducing a Cys residue at at least invention. 25 one of any of the sequence positions that correspond to A further embodiment of the methods of the invention sequence positions 14, 21, 60, 84, 88, 116, 141, 145, 143,146 involves operably fusing a nucleic acid coding for the plural or 158 of the wild type sequence of human Lipocalin 2 and ity of muteins of the invention and resulting from mutagen coupling a moiety that is able to modify the serum halftime of esis at the 3' end with a gene coding for the coat protein pill of said mutein via the thiol group of a Cys residue introduced at a filamentous bacteriophage of the M13-family or for a frag 30 at least one of any of the sequence positions that correspond ment of this coat protein, in order to select at least one mutein to sequence positions 14, 21, 60, 84, 88, 116, 141, 145, 143, for the binding of a given ligand. 146 or 158 of the wildtype sequence of hNGAL. The moiety The fusion protein may include additional components that is able to modify the serum halftime of said mutein may Such as an affinity tag, which allows the immobilization, be selected from the group consisting of a polyalkylene glycol detection and/or purification of the fusion protein or its parts. 35 molecule and hydroxyethylstarch. Furthermore, a stop codon can be located between the Where a protein of the invention is a human Lipocalin 2 sequence regions encoding the lipocalin or its muteins and the mutein of the invention, the naturally occurring disulfide phage capsid gene or fragments thereof, wherein the stop bond between Cys 76 and Cys 175 may be removed. Accord codon, preferably an amber stop codon, is at least partially ingly, such muteins (or any other human Lipocalin 2 mutein translated into an amino acid during translation in a suitable 40 that does not include an intramolecular disulfide bond) can be Suppressor Strain. produced in a cell compartment having a reducing redox For example, the phasmid vector pTLPC27, now also milieu, for example, in the cytoplasma of Gram-negative called pTlc27 that is described here can be used for the prepa bacteria. ration of a phagemid library encoding muteins of the inven In case a lipocalin mutein of the invention includes tion. The inventive nucleic acid molecules coding for muteins 45 intramolecular disulfide bonds, it may be preferred to direct of the invention can be inserted into the vector using the two the nascent polypeptide to a cell compartment having an BstXI restriction sites. After ligation a suitable host strain oxidizing redox milieu using an appropriate signal sequence. such as E. coli XL1-Blue is transformed with the resulting Such an oxidizing environment may be provided by the peri nucleic acid mixture to yield a large number of independent plasm of Gram-negative bacteria Such as E. coli, in the extra clones. A respective vector can be generated for the prepara 50 cellular milieu of Gram-positive bacteria or in the lumen of tion of a hyperphagemid library, if desired. the endoplasmatic reticulum of eukaryotic cells and usually Once a mutein with affinity to a given target has been favors the formation of structural disulfide bonds. selected, it is additionally possible to Subject Such a mutein to It is, however, also possible to produce a mutein of the another mutagenesis in order to Subsequently select variants invention in the cytosol of a host cell, preferably E. coli. In of even higher affinity or variants with improved properties 55 this case, the polypeptide can either be directly obtained in a Such as higher thermostability, improved serum stability, soluble and folded state or recovered in form of inclusion thermodynamic stability, improved solubility, improved bodies, followed by renaturation in vitro. A further option is monomeric behavior, improved resistance against thermal the use of specific host strains having an oxidizing intracel denaturation, chemical denaturation, proteolysis, or deter lular milieu, which may thus allow the formation of disulfide gents etc. This further mutagenesis, which in case of aiming at 60 bonds in the cytosol (Venturi et al. (2002) J. Mol. Biol. 315, higher affinity can be considered as in vitro “affinity matura 1-8.). tion.” can be achieved by site specific mutation based on However, a mutein of the invention may not necessarily be rational design or a random mutation. Another possible generated or produced only by use of genetic engineering. approach for obtaining a higher affinity or improved proper Rather, a lipocalin mutein can also be obtained by chemical ties is the use of error-prone PCR, which results in point 65 synthesis such as Merrifield solid phase polypeptide synthe mutations over a selected range of sequence positions of the sis or by in vitro transcription and translation. It is for example lipocalin mutein. The error-prone PCR can be carried out in possible that promising mutations are identified using US 9,051,382 B2 25 26 molecular modeling and then to synthesize the wanted (de muteins of the invention can serve to detect chemical struc signed) polypeptide in vitro and investigate the binding activ tures by means of established analytical methods (e.g. ELISA ity for a given target. Methods for the solid phase and/or or Western Blot) or by microscopy or immunosensorics. Solution phase synthesis of proteins are well known in the art Here, the detection signal can either be generated directly by (reviewed, e.g., in Lloyd-Williams et al. (1997) Chemical use of a suitable mutein conjugate or fusion protein or indi Approaches to the Synthesis of Peptides and Proteins. CRC rectly by immunochemical detection of the bound mutein via Press, Boca Raton, Fields, GB, and Colowick (1997) Solid an antibody. Phase Peptide Synthesis. Academic Press, San Diego, or Numerous possible applications for the inventive muteins Bruckdorfer et al. (2004) Curr: Pharm. Biotechnol. 5, 29-43). also exist in medicine. In addition to their use in diagnostics In another embodiment, the muteins of the invention may 10 and drug delivery, a mutant polypeptide of the invention, be produced by in vitro transcription/translation employing which binds, for example, tissue- or tumor-specific cellular well-established methods known to those skilled in the art. Surface molecules can be generated. Such a mutein may, for The invention also relates to a pharmaceutical composition example, be employed in conjugated form or as a fusion that includes at least one inventive mutein referred to in the protein for "tumor imaging or directly for cancer therapy. claims or a fusion protein or conjugates thereof and, option 15 In a further aspect, the present invention also encompasses ally, a pharmaceutically acceptable excipient. the use of a mutein according to the invention for the manu The lipocalin muteins according to the invention can be facture of a pharmaceutical composition. The pharmaceutical administered via any parenteral or non-parenteral (e.g. composition thus obtained may be Suited for reducing the enteral) route that is therapeutically effective for proteina level of a Hepcidin. The pharmaceutical composition may be ceous drugs. used as monotherapy or as combination therapy. Accordingly, Accordingly, the muteins of the present invention can be the invention also relates to a mutein as defined above for the formulated into compositions using pharmaceutically accept treatment of a disease or disorder associated with an altered, able ingredients as well as established methods of preparation e.g. increased or reduced, level of a Hepcidin. (Gennaro and Gennaro (2000) Remington. The Science and Diseases Associated with Hepcidin Practice of Pharmacy, 20th Ed., Lippincott Williams & 25 Anemia is a disease associated with serum iron depletion Wilkins, Philadelphia, Pa.). To prepare the pharmaceutical leading to a decrease of hematological parameters such as red compositions, pharmaceutically inert inorganic or organic blood cell (RBC) counts, hematocrit (Ht), hemoglobin (Hb), excipients can be used. serum iron leveland transferrin (Tf) saturation. This results in A protein of the invention of the invention may also be used a decreased oxygen level in the blood and is associated with to target a compound to a pre-selected site. In one Such 30 a declined quality of life (QOL) described by weakness, poor embodiment, a protein of the invention is used for the target concentration, shortness of breath and dyspnea. Severe ane ing of a pharmaceutically active compound to a pre-selected mia can lead to a fast heart rate, cardiac enlargement and heart site in an organism or tissue, comprising: failure. Anemia is often associated with chronic kidney dis a) conjugating the protein with said compound, and ease/established chronic kidney disease (CKD), anemia of b) delivering the protein/compound complex to the pre 35 cancer (AC), chemotherapy induced anemia (CIA) and ane selected site. mia of chronic disease (ACD). For Such a purpose the mutein is contacted with the com The effective managementofanemia has a major impact on pound of interest in order to allow complex formation. Then quality of life and may influence the survival of patients. The the complex comprising the mutein and the compound of declined quality of life can be described by weakness, fatigue, interest are delivered to the pre-selected site. This may, for 40 poor concentration, shortness of breath up to dyspnea. Severe example, be achieved by coupling the mutein to a targeting anemia is associated with a fast heart rate, and can lead to moiety, Such as an antibody, antibody fragment or lipocalin cardiac enlargements and heart failure. mutein or lipocalin mutein fragment with binding affinity for The standard treatment of care are transfusions and the the selected target. administration of ESAs and iron. Nevertheless, new thera This use is in particular suitable, but not restricted to, for 45 peutic approaches are desired since the standard treatments delivering a drug (selectively) to a pre-selected site in an are associated with the following disadvantages or potential organism, Such as an infected body part, tissue or organ which draw backs. Transfusion bears the risk of hemolysis, infec is supposed to be treated with the drug. Besides formation of tions and allergic reactions due to an incompatible blood type. a complex between mutein and compound of interest, the Iron treatment can lead to iron overload in long term treat mutein can also be reacted with the given compound to yield 50 ments and is not recommended for the treatment of anemia of a conjugate of mutein and compound. Similar to the above inflammation since iron contributes to inflammatory complex, Such a conjugate may be suitable to deliver the responses (e.g. inflammatory joint disease). As far as ESAS compound to the pre-selected target site. Such a conjugate of are concerned, about 40-50% of anemic patients are ESA mutein and compound may also include a linker that non-responder with no or delayed Hb-response only after covalently links mutein and compound to each other. Option 55 high dose ESA-treatment that are associated with safety con ally, such a linker is stable in the bloodstream but is cleavable cerns like poorer Survival and shorter progression free Sur in a cellular environment. vival time in cancer patients. The muteins disclosed herein and its derivatives canthus be Iron deficiency anemia is a disorder of iron homeostasis used in many fields similar to antibodies or fragments thereof. that is easily cured by iron administration in contrast to ane In addition to their use for binding to a Support, allowing the 60 mia associated with inflammatory disease. Hepcidin is a target of a given mutein or a conjugate or a fusion protein of parameter that allows distinguishing between these two dis this target to be immobilized or separated, the muteins can be orders since the hepcidin level is only upregulated in combi used for labeling with an enzyme, an antibody, a radioactive nation with inflammation. Substance or any other group having biochemical activity or Anemias associated with chronic inflammatory disease defined binding characteristics. By doing so, their respective 65 like chronic infections, rheumatologic and systemic autoim targets or conjugates or fusion proteins thereof can be mune disorders and inflammatory bowel disease are called detected or brought in contact with them. For example, anemia of inflammation (AI) or anemia of chronic disease US 9,051,382 B2 27 28 (ACD). Hepcidin expression is induced by the inflammatory of recycled iron from macrophages, and mobilization of iron cytokine IL-6, as part of the inflammatory response, resulting stores in the liver. Hepcidin is thought to play a critical role in in iron deficiency induced anemia and a blunted response to the development of anemia associated with inflammatory ESAS. disease. Acute or chronic inflammatory conditions result in Patients with established chronic kidney disease (chronic the up-regulation of hepcidin expression, leading to iron defi renal failure (CRF)) develop uremic anemia as one of the ciency, which can cause anemia associated with inflamma most obvious signs of the disease. This symptom is caused by tory disease (ACD), cancer (AC, CIA) and Chronic Kidney impeded renal production of erythropoietin (EPO). EPO con Disease (CKD) (anemia of CKD). trols red blood cell (RBC) production by promoting survival, A lipocalin mutein according to the invention may be used proliferation and differentiation of erythroid progenitors in 10 as an antagonist of a hepcidin (Supra). In this regard a lipoca the bone marrow. Effective management of anemia in chronic lin mutein according to the invention, typically an isolated renal failure (CRF) has a major impact on quality of life and lipocalin mutein, may be used in therapy, such as human may influence Survival. Supplementation with recombinant therapy. A respective mutein is capable of forming a complex human erythropoietin (rhEPO) is currently the standard treat with a hepcidin, e.g. a human hepcidin, typically with high ment for anemia in those patients. A response rate of 70-90% 15 affinity. Thereby the lipocalin mutein typically blocks the to various ESA’s (erythropoesis stimulating agents) has been interaction with the hepcidin receptor ferroportin. As a result observed in clinical trials with CRF patients. Only in patients internalization and degradation of ferroportin are prevented. with additional inflammatory disease hepcidin plays a promi The lipocalin mutein thereby supports erythropoiesis by nent role in the anemia associated with CKD. allowing mobilization of stored iron and improved enteral Anemia is common in patients with cancer and has a mul iron absorption. An illustrative example of a subject in need of tifactorial aetiology. It may be related to the malignancy itself application of a respective antagonist of a hepcidin according and its extent, as well as to the type, duration and intensity of to the invention is a subject hyporesponsive to ESA-therapy myelosuppressive chemotherapy. Moreover, most patients (about 40-50% of patients) which is thought to be caused by with cancer have been shown to have inappropriately low the decreased availability of iron for the synthesis of hemo levels of circulating EPO for their degree of anemia, reflect 25 globin due to upregulated hepcidin. The term “subject” refers ing a change in this homeostatic mechanism. The incidence of to a vertebrate animal, including a mammal, and in particular anemia severe enough to result in blood transfusions may be a human, in which case the term “patient' can also be used. In as high as 60% in certain tumor types. Anemic patients with Some embodiments, the Subject may have a disorder that cancer may experience symptoms as fatigue, dizziness, short would benefit from a decreased level of a hepcidin such as ness of breath, and cardiovascular symptoms such as palpi 30 hepcidin-25, a decrease in bioactivity of a hepcidin (e.g. tations and cardiac failure. Such clinical sequelae may hepcidin-25 bioactivity), and/or an increase in serum iron decrease the quality of life of these patients. Furthermore, a level, reticulocyte count, red blood cell count, hemoglobin, potential relationship between the correction of anemia and and/or hematocrit. increased Survival in patients receiving chemotherapy has A lipocalin mutein according to the invention may be used recently been discussed. Currently, therapeutic options for 35 to increase iron levels in a body fluid Such as serum. It may anemia in cancer patients are RBC transfusions or ESA’s. also be used to increase reticulocyte count, red blood cell Transfusion of RBCs can be associated with non-hemolytic count, hemoglobin, and/or hematocrit in a Subject, e.g. a and hemolytic transfusion reactions, iron overload in heavily human. A pharmaceutical composition comprising a lipoca transfused patients, or the transmission of infections. Safety lin mutein of the invention may be used in this regard. and Screening requirements in transfusion therapy have 40 Another aspect of the present invention relates to a method increased the logistics and cost of transfusion therapy thus of treating a Subject Suffering from a disease or disorder that restricting transfusions to cases of severe and/or symptomatic is associated with an altered level of a Hepcidin, such as an anemia. ESA’s have provided an alternative to blood trans increased or a decreased level of a Hepcidin. A respective fusions in the treatment of symptomatic anemia which is still disease or disorder may include a genetic or a non-genetic not severe enough to merit transfusions with current policies. 45 disease/disorder causing iron deficiency or overload. A dis However, a clear dose response relationship for ESA’s has not ease state or disorder may include an infectious disease been established, and 40% to 50% of patients show no Hb involving e.g. bacteria, fungi, yeast or viruses. As explained response at all or a delayed response. During the last years above, in Some embodiments the disease or disorder is ane important concerns have emerged regarding the impact of mia, including, but not limited to, anemia resulting from ESAs on cancer patients survival as well as their potential to 50 infection, inflammation, chronic disease, and/or cancer. It increase the risk of thromboembolism (in march 2007 the may in some embodiments include an inflammatory disease FDA instituted a black-box warning about the possible asso Such as arthritis and certain cancer types, a liver disease or a ciation of ESAs with tumor promotion and thromboembolic haematological disease. In some embodiments of the disease events). There is raising evidence from the literature that associated with an incerased level of a Hepcidin is an anemia ESA-resistance of cancer patients is not only predicted by a 55 or a chronic kidney disease or an anemia associated with missing increase in Hb-response within 4 weeks of ESA chronic kidney disease. As already explained above, Such a administration but also by an elevated hepcidin level pre method involves administering a respective mutein of the Sumably as part of an inflammatory response. invention or a pharmaceutical composition comprising a As explained above, Hepcidin is the central negative regu mutein of the invention to a subject in need thereof. lator of iron homeostasis. Hepcidin production increases with 60 A lipocalin mutein of the invention may for instance be iron loading and inflammation and decreases under low iron used to treat a subject having an elevated level of hepcidin, a conditions and hypoxia. Hepcidin acts via binding to the only hepcidin-related disorder, a disorder of iron homeostasis, known mammalian cellular iron exporter, ferroportin, and anemia or inflammatory condition associated with an induces its internalization and degradation. Since ferroportin elevated level of hepcidin. The subject may, for example, be a is expressed in the duodenal enterocytes, spleen, and liver, 65 mammal Such as a human Suffering from African iron over hepcidin increase, and the Subsequent decrease offerroportin, load, alphathalassemia, Alzheimer's disease, anemia, anemia results in the inhibition of duodenal iron absorption, release of cancer, anemia of chronic disease, anemia of inflamma US 9,051,382 B2 29 30 tion, arteriosclerosis or atherosclerosis (including coronary a hepcidin in a body fluid of a subject. For this purpose body artery disease, cerebrovascular disease or peripheral occlu fluid may have been taken from the respective subject. The sive arterial disease), ataxias, ataxias related to iron, atrans level of the Hepcidin may be compared to a control sample, ferrinemia, cancer, ceruloplasmin deficiency, chemotherapy which is known to include a normal level of the Hepcidin. It induced anemia, chronic renal/kidney disease (in particular 5 may thereby be determined whether non-physiological levels anemia associated with chronic kidney disease), including of the Hepcidin are present in the subject. end stage renal disease or chronic renal/kidney failure, cir Accordingly, the invention also relates to a mutein as rhosis of liver, classic hemochromatosis, collagen-induced defined above for the diagnosis of a disease or disorder asso arthritis (CIA), a condition involving hepcidin excess (el ciated with an altered, e.g. increased or reduced, level of a evated hepcidin), congenital dyserythropoietic anemia, con 10 Hepcidin. In some embodiments the disease is an anemia, gestive heart failure, Crohn's disease, diabetes, a disorder of including, but not limited to, anemia resulting from infection, iron biodistribution, a disorder of iron homeostasis, a disorder inflammation, chronic disease, and/or cancer. The disease or of iron metabolism, ferroportin disease, ferroportin mutation disorder may for instance be associated with decreased levels hemochromatosis, folate deficiency, Friedrich's ataxia, of a Hepcidin, Such as hereditary hemochromatosis, an iron funicular myelosis, gracile syndrome, a bacterial infection 15 loading anemia or Hepatitis C. The disease or disorder may Such as H. pyelori infection, Hallervordan Spatz disease, also be associated with increased levels of a Hepcidin, e.g. hemochromatosis, hemochromatosis resulting from muta anemia of inflammation, iron-refractory iron deficiency ane tions in transferrin receptor 2, hemoglobinopathies, hepatitis, mia or a chronic kidney disease. Hepatitis C for instance hepatitis (Brock), hepatitis C, hepatocellular carcinoma, typically involves a hepatic iron overload, generally via hep hereditary hemochromatosis, a viral infection such as HIV. cidin Synthesis Suppression. In the context of diagnosis a Huntington's disease, hyperferritinemia, hypochromic mutein according to the invention can be used to assess hep microcytic anemia, hypoferremia, insulin resistance, iron cidin levels in body fluid of a subject. Since anemic cancer deficiency anemia, an iron deficiency disorder, an iron over patients with low hepcidin concentrations (<13 nmol/L) have load disorder, an iron-deficiency condition with hepcidin been observed to show a better response to erythropoietin excess, juvenile hemochromatosis (HFE2), multiple sclero 25 therapy than patients with high hepcidin concentrations (>13 sis, a mutation of a gene involved in iron metabolism, for nmol/L) hepcidin serum concentrations can for instance be instance expressing a protein involved therein such as trans used for predicting the response to epoetin therapy (about ferrin receptor 2, HFE, hemojuvelin or ferroportin, neonatal 50% of the patients are EPO resistant). hemochromatosis, a neurodegenerative disease related to In still another aspect, the present invention features a iron, osteopenia, osteoporosis pancreatitis, Pantothenate 30 diagnostic or analytical kit comprising a mutein according to kinase-associated neurodegeneration, Parkinson's disease, the present invention. pellagra, pica, porphyria, porphyria cutanea tarda, pseudoen The subject in need of such a treatment may be a mammal, cephalitis, pulmonary hemosiderosis, a red blood cell disor Such as a human, a dog, a mouse, a rat, a pig, an ape Such as der, rheumatoid arthritis, sepsis, sideroblastic anemia, sys cynomolgous monkeys to name only a few illustrative temic lupus erythematosus, thalassemia, thalassemia 35 examples. intermedia, transfusional iron overload, a tumor, Vasculitis, In still another aspect, the present invention features a vitamin B6 deficiency, vitamin B12 deficiency Wilson's dis method for in vivo imaging in a Subject, including adminis ease, or inflammatory condition associated with an elevated tering to said Subject a mutein of the invention or a pharma level of hepcidin. ceutical composition comprising a mutein of the invention. As a further illustrative example a mutein according to the 40 The subject may be defined as above. present invention can in Some embodiments be used in com The invention is further illustrated by the following non bination with erythropoietin. Anemia in patients with cancer limiting Examples and the attached drawings. (AC) and anemia of chronic disease (ACD) are associated Unless otherwise indicated, established methods of recom with high concentrations of hepcidin (about 30 nmol/L) lead binant gene technology were used, for example, as described ing to serum iron deficiency and thus to reduced erythropoie 45 in Sambrook et al. (Supra). sis. Subjects with baseline hepcidin concentrations below 13 nmol/L in serum have been reported to show a better response EXAMPLE 1. to erythropoietin (EPO) therapy than subjects with concen trations above 13 nmol/L. Therefore the treatment of anemic Construction of a Mutant Lcn2 Phage Display cancer patients with a hepcidin antagonist can improve their 50 Library response to erythropoietin. Furthermore a widespread phenomenon among anemic A combinatorial library of Lcn2 variants was generated on subjects is resistance to recombinant erythropoietin (rhEPO), the basis of the cloned cDNA (Breustedt et al. (2006) Bio a therapeutic problem that can be overcome by combinatorial chim. Biophys. Acta 1764, 161-173), which carried the amino therapy with a mutein according to the present invention. 55 acid substitutions Cys87Ser, to remove the single unpaired Hepcidin likely plays a major role in this rhEPO resistance. thiol side chain (Goetz et al. (2000) Biochemistry 39, 1935 Sasu et al. (Blood (2010) 115, 17, 3616-3624) have shown a 1941), as well as Gln28His to introduce a second BstXI distinct correlation between increased hepcidin level and restriction site. Mutagenesis and polymerase chain reaction resistance to erythropoiesis-stimulating agents (ESAS) in (PCR) assembly of this region was essentially performed mice. They also were able to restore ESA-responsiveness by 60 according to a published strategy (Beste et al. (1999) Proc. the administration of a hepcidin-specific antibody. Natl. Acad. Sci. USA 96, 1898-1903: Skerra (2001).J. Bio In yet another aspect the invention relates to the use of a technol. 74, 257-275), this time using a one potamplification mutein according to the invention in diagnosis. The use of a reaction with oligodeoxynucleotides (sequences of SEQ ID mutein according to the invention is typically for the diagno NO: 16 to SEQID NO:25) as illustrated in FIG.1. Oligode sis of a disease or disorder associated with an altered level of 65 oxynucleotides were designed such that the primers with a Hepcidin as well as a respective method of diagnosis. The sequences of SEQ ID NO: 16 to SEQ ID NO: 19 corre use may in some embodiments involve assessing the level of sponded to the coding strand and carried degenerate codons at US 9,051,382 B2 31 32 the amino acid positions 36, 40, 41, 49, 52, or 68, 70, 72,73, ing the phagemid particles was sterile-filtered (0.45 Lum), 77, 79, 81, or 96, 100, 103, 106, or 125, 127, 132, 134 mixed with 1/4 volume 20% w/v PEG 8000, 15% w/v NaCl, respectively, while primers with sequences of SEQID NO:20 and incubated on ice for at least 2 h. After centrifugation (30 to SEQID NO: 23 corresponded to the non-coding strand and min, 18000 g, 4°C.) the precipitated phagemid particles from did not carry degenerate codons oranticodons. The two flank 1 liter of culture were dissolved in 30 ml of cold BBS/E (200 ing primers with SEQID NO: 24 and SEQID NO: 25 were mM Na-borate, 160 mM. NaCl, 1 mM EDTA pH 8.0) con used in excess and served for the amplification of the taining 50 mM benzamidine (Sigma) and Pefabloc 1 g/ml assembled randomized gene fragment. All PCR steps were (Roth, Karlsruhe, Germany). The solution was incubated on performed using Go-Taq Hot Start DNA polymerase ice for 1 h. After centrifugation of undissolved components (Promega, Mannheim, Germany) as described (Schlehuberet 10 (10 min, 43000 g. 4°C.) each supernatant was transferred to al. (2000).J. Mol. Biol. 297, 1105-1120). a new reaction vessel. Oligodeoxynucleotides that did not carry degenerate Addition of 1/4 volume 20% w/v PEG 8000, 15% w/v. codons were purchased in HPLC grade from Metabion (Mu NaCl and incubation for 60 min on ice served to reprecipitate nich, Germany). NNK-containing oligodeoxynucleotides the phagemid particles until the phagemids were aliquoted were purchased desalted from the same vendor and further 15 and frozen at -80° C. for storage. For the first selection cycle purified by urea PAGE. The resulting DNA library was cut phagemids were thawed and centrifuged (30 min, 34000 g, 4° with BstXI (Promega, Mannheim, Germany) and cloned on C.), the Supernatant was removed, and the precipitated the phagemid vectorphNGAL102 (SEQID NO:26), which is phagemid particles were dissolved and combined in a total of based on the generic expression vector pASK111 (Vogt and 400 ul PBS containing 50 mMbenzamidine. After incubation Skerra (2001).J. Mol. Recognit. 14(1), 79-86) and codes for for 30 min on ice the solution was centrifuged (5min, 18500 a fusion protein composed of the OmpA signal peptide, the g, 4° C.) in order to remove residual aggregates and the modified mature Lcn2, followed by an amber codon, and the Supernatant was used directly for the phage display selection. C-terminal fragment of the gene III coat protein of the fila mentous bacteriophage M13, i.e. similar as previously EXAMPLE 2 described for the bilin-binding protein (Beste et al., supra; 25 Skerra, supra). After electroporation of E. coli XL 1-Blue Procurement of Soluble Hepcidin 25 Peptides (Bullock et al. (1987) Biotechniques 5, 376-378) with the ligation mixture of 8.4 ug digested PCR product and 94 ug Synthetic non-modified Hepcidin-25 (human DTHFPIC digested plasmid DNA, 1x10" transformants were obtained. IFCCGCCHRSKCGMCCKT, SEQ ID NO: 28, 2789.4 Alternatively, a cloned synthetic Lcn2 random library, 30 g/mol; mouse DTNFPICIFCCKCCNNSQCGICCKT, SEQ which is described in FIG. 2, was obtained from Sloning ID NO: 29, 2754.2 g/mol; rat DTNFPICLFCCKCCKNSS BioTechnology GmbH (Puchheim, Germany). The central CGLCCIT, SEQID NO:30, 2711.9 g/mol) and the C-termi gene cassette flanked by the two BstXI restriction sites was nal biotinylated rat Hepcidin-25 (DTNFPICLFCCKC amplified via PCR in 20 cycles using appropriate primers CKNSSCGLCCIT (SEQ ID NO: 30)-Mini-PEG-linker-K- (SEQ ID NO: 24 and SEQ ID NO: 25) and subcloned on 35 Biotin, 3210.5 g/mol) was obtained from PeptaNova GmbH phNGAL108 (SEQID NO: 27), which is based on the generic (Sandhausen, GE). expression vector p ASK75 (Skerra (1994) Gene 151, 131 The human and mouse C-terminal biotinylated Hepcidin 135) and carries essentially the same features as phNGAL 102 25 was obtained from Bachem AG (Bubendorf, CH). Analo (SEQ ID NO: 26) but mediates amplicillin resistance instead gous to the rat Hepcidin-25 these targets were biotinylated via of chloramphenicol resistance, in the same way, yielding a 40 a Lysine residue coupled to the C-terminus via a Mini-PEG library with a complexity corresponding to 1.7x10" indepen linker. dent transformants. The following steps in library generation were performed EXAMPLE 3 identically for both Lcn2 libraries. 100 ml of the culture, containing the cells which were transformed with the phas 45 Generation of a Library with 10 Billion Independent mid vectors on the basis of phNGAL102 or phNGAL108, NGAL Muteins respectively, coding for the library of the lipocalin muteins as phage pill fusion proteins, were transferred to a sterile Erlen A random library of NGAL lipocalin (Lcn2) with high meyer flask and incubated for one hour at 37°C., 160 rpm in complexity was prepared essentially as described in Example 2YT medium without antibiotic selection pressure. Before 50 1 above. The amplification reaction is illustrated in FIG. 1, the infection with VCS-M13 helperphage the culture was diluted phagemid vector phNGAL102 is of SEQID NO: 26. in 2YT medium to an OD550 of 0.1 with the corresponding antibiotic added and further grown under identical conditions EXAMPLE 4 until an OD550 of 0.6 was reached. After infection with VCS-M13 helper phage (Agilent Technologies, La Jolla, 55 Phagemid Presentation and Selection of NGAL USA) at a multiplicity of infection of approximately 10 the Muteins with Affinity for Human Hepcidin culture was shaken for additional 30 min at 37°C., 100 rpm. Then the incubator temperature was lowered to 26°C. and the Phagemid display and selection was performed employing shaker speed was increased again to 160 rpm, after 10 min the phagemids obtained from Example 1 essentially as kanamycin (70 g/ml) was added, followed by induction of 60 described in international patent application WO/2005/ gene expression via addition of anhydrotetracycline (ACROS 019256. The library was subjected to 3 cycles of phage dis Organics, Geel, Belgium) at 25 g/l (125 ul of a 200 ug/ml play selection against the soluble, C-terminal biotinylated stock solution in dimethylformamide, DMF per liter of cul human Hepcidin-25 target peptide. ture). Incubation continued for another 12-15 hat 26°C., 160 2x10' to 1x10" phagemids of the library obtained in rpm. 65 Example 1 were used. In brief, the phagemids were centri Cells from the complete culture were sedimented by cen fuged (21460xg, 4°C., 20 min) and resuspended in 1 ml PEBS trifugation (30 min, 18000 g. 4°C.). The Supernatant contain (4 mM. KHPO, 16 mM NaBPO 115 mM NaCl, pH 7.4) US 9,051,382 B2 33 34 containing 50 mM benzamidine. PBS containing 1% w/v. cell extract for 1 h at room temperature plates were washed Casein (Sigma) and 0.1% Tween 20R) was used as blocking five times and bound Lipocalin muteins were detected via an buffer. Prior to the incubation with the target protein, anti-T7 monoclonal antibody-HRP conjugate (Novagen), phagemids from the library were incubated with casein diluted 1:10.000 in PBST/0.1. Therefore, QuantaBluTM blocked Streptavidinbeads for 30 minutes for the depletion of 5 (Pierce: 1:2 diluted in PBS/T 0.1%) was used as fluorogenic phagemids representing multi-reactive or misfolded lipocalin HRP substrate. After 45 min of signal development at room mutein or Streptavidin bead-specific muteins. temperature fluorescence was excited at a wavelength of 320 In different Panning approaches a 1 LM Solution of target nm (+12.5 nm) and measured at 430 nm (t17.5 nm) in a was either captured on StreptavidinTM-coated, 1% Casein GENiosPlus plate reader (Tecan). blocked magnetic beads prior to the incubation with 10 In a reverse ELISA approach soluble expressed muteins phagemids (solid in solution approach) or 500 nM Hepcidin from the crude cell lysate were captured in ELISA plates via 25 was incubated in solution with 3:1012 phagemids from the their T7-tag following incubation with varying amounts of NGAL library blocked with 1% Casein (solution approach). C-terminal biotinylated hHepcidin to reach target-limiting In the solution approach peptide bound phagemids were cap conditions in order to differentiate the muteins by their affin tured via StreptavidinTM-coated magnetic beads (Invitrogen/ 15 ity. Binding of the target was detected via Extravidin-HRP Dynal) within 20 min, followed by 8 wash cycles and elution conjugate (Sigma). One could compete for mutein binding by with either 300 uL 70 mM Triethylamin for 10 min, and the addition of 100 nM non-biotinylated human Hepcidin-25 neutralization with an appropriate amount of 1 M Tris/HCl, indicating, that the muteins bind the non-modified hiepci pH 7.4 (basic elution) or with 300 uL 0.1 M Glycin/HCl pH din-25 as well. 2.2 for 10 min. and neutralization with an appropriate amount Screening of 2160 clones, selected as described in of 0.5 M Tris-Base (acidic elution). Example 4, led to the identification of more then 1000 pri In the solid in Solution approach blocked phagemids were mary hits indicating the Successful isolation of target-specific incubated with the Streptavidin bead-coated target followed muteins. The reverse ELISA approach under target-limiting by 8 wash cycles and elution as described above 0199. conditions and the competition ELISA allowed for a differ Beginning with the second enrichment cycle, only half of the 25 entiation of hepcidin-specific muteins in terms of their target combined phagemid solutions were used for phagemid affinity. Using these ELISA approaches the clones with SEQ amplification. IDNO: 1, SEQIDNO: 2, SEQID NO:3, SEQID NO:4, SEQ Phagemid amplification between each panning cycle was ID NO:5, SEQID NO: 6, SEQID NO: 7 SEQIDNO: 8, SEQ performed as described in Schlehuber, S. et al. (J. Mol. Biol. ID NO:9, SEQID NO: 10, SEQID NO: 11, and SEQID NO: (2000), 297, 1105-1120). 30 12 were identified. The sequences of these muteins are Two further selection rounds against Hepcidin-25 were depicted in FIG. 3. carried out in this way employing the preparation of amplified phagemids from the respective previous enrichment cycle EXAMPLE 6 with the exception that only about 1x10 phagemids were utilized beginning with the second enrichment cycle. 35 Production of Hepcidin-Binding Muteins (NGAL) EXAMPLE 5 The recombinant Lcn2 and the hHepcidin-specific Lcn2 variants were produced by periplasmic secretion in E. coli Identification of hHepcidin-Specific Muteins Using K12 strain JM83 (Yanisch-Perron et al. (1985) Gene 33, High-Throughput ELISA Screening 40 103-119), the E. coli supE strain TG1-F— (a derivative of E. coli K12 TG1 Kim et al. (2009) J. Am. Chem. Soc. 131, Screening of the muteins selected according to Example 4 3565-3576 that was cured from its episome using acridinium was performed essentially as described in Example 3 of inter orange), E. coli BL21 (Studier and Moffat (1986) J. Mol. national patent application WO 2006/56464. Biol. 189, 113-130), or E. coli W3110 (Bachmann (1990) Lipocalin muteins were selected in a HT-screening ELISA. 45 Microbiol. Rev. 54, 130-197). Therein, NGAL variants equipped with a T7 detection tag For a small scale soluble protein expression the plasmid (Novagen) as well as a Strep-tag II affinity tag (IBA) were phNGAL98 (SEQID NO:31) was used, encoding a fusion of soluble expressed in a 96 well microtiter plate using the E. the Omp A signal peptide with the respective mutein and the coli strain TG1/ F with phNGAL 101. This vector corre C-terminal Strep-tag II, whereby the plasmid carries the two sponds to phNGAL 98 (SEQID NO:31) with an N-terminal 50 non-compatible BstXI restriction sites for unidirectional sub T7 tag consisting of 11 amino acids (MASMTGGQQMG) cloning of the mutated gene cassette. Growth was allowed to (residues 187-197 of SEQ ID NO:34, see also FIG. 4B). occur in a 2 L shaking flask culture in the presence of LB Lipocalin mutein expression was induced onvernight at 22 Ampicillin medium according to the protocol described in C. at 700 rpm with anhydrotetracycline (0.2Lug/ml) at an Schlehuber, S. et al. (J. Mol. Biol. (2000), 297, 1105-1120). ODsso of 0.6. Afterwards, cells were lysed (100 mM Na 55 For larger amounts of protein the periplasmatic production borate, pH 8.0, 80 mM NaCl, 1 mM EDTA, 0.025% w/v. was performed with the same vector expressed in the E. coli lysozyme) for 1 h under agitation. To minimize non-specific strain W3110 via bench top fermenter cultivation in a 1 1 or 10 binding in the subsequent ELISA screen, the crude cell 1 vessel based on the protocol described in Schiweck, W., and lysates were supplemented with 2% w/v. BSA and 0.1% V/v Skerra, A. Proteins (1995) 23,561-565). Tween 20 and tested in ELISA for binding to human Hepci 60 In order to increase the in vivo half-life, selected lipocalin din-25. Therefore, soluble C-terminal biotinylated human muteins were exemplarily modified by the following proce Hepcidin-25 was immobilized on wells of black Fluotrac 600 dures. ELISA plates (Greiner; 384 well) with 1 lug/ml via capturing An ABD-fusion protein was constructed and periplasmati by Neutravidin (5ug/ml. Thermo Scientific). Neutravidin, cally expressed for the mutein of SEQID NO: 1. The albumin Streptavidin, 5ug/ml each, and 3% milk were used as nega 65 binding domain from the streptococcal protein G was fused to tive control. Plates were blocked with PBST/0.1 containing the C-terminus of the mutein via the original linker derived 2% w/v. BSA, and subsequently incubated with the bacterial from streptococcal protein Gas described in SEQID NO: 15. US 9,051,382 B2 35 36 In the case of site-directed PEGylation the hNGAL The binding affinity of the Lcn2 muteins to non-modified muteins having a free cystein residue at amino acid position hepcidin-25 in Solution was evaluated in a competition 87 (SEQID NO: 13, SEQID NO: 14) were used for PEGy ELISA approach. Therefore, a constant concentration of 1 lation with branched 40k PEG-maleimide. To this aim, the ug/ml C-terminal biotinylated human hepcidin (Bachem AG, Serine at position 87 was back-mutated to a Cysteine that 5 CH) was captured on the surface of a polystyrol plate originally occurs in hNGAL wildtype by site-directed (Greiner, GE) via Neutravidin (Thermo Scientific, 5 ug/ml, mutagenesis (Quick-change mutagenesis Kit, Stratagene). GE). In parallel a two step dilution series of non-biotinylated Prior to the PEGylation reaction the free cysteine residue was human hepcidin starting from 1 uM was incubated with a reduced in a 1:1 molar ratio of Anticalin with TCEP for 3 hat constant concentration of hepcidin-specific mutein for 1 h at RT. Thereafter, PEGylation was performed by mixing the 10 room temperature in a non-protein binding 96 well polypro protein with >2 molar excess of PEG40-maleimide reagent pylene plate (Nunc, GE). The constant concentration of for 1.5 h at RT. lipocalin muteins corresponds to the ECs of the respective The Lcn2 variants were purified from the periplasmic frac muteins as determined in a direct ELISA as described above tion in a single step via Streptavidin affinity chromatography in this example. In the following the mixture of non-modified 15 human hepcidinand lipocalin mutein was transferred onto the (Strep-TactinTM Superflow, IBA) using a column of appropri hepcidin-captured Neutravidin plate. The C-terminal biotiny ate bed volume according to the procedure described by lated hepcidin was allowed to compete with the non-modified Skerra, A. & Schmidt, T. G. M. (2000) (Use of the Strep-tag hepcidin for Anticalin binding for 20 min. at room tempera and streptavidin for detection and purification of recombinant ture. During these 20 min, free lipcocalin mutein was bound proteins. Methods Enzymol. 326A, 271-304). To achieve to the captured hepcidin and detected via a rabbit anti-strep higher purity and to remove any aggregated recombinant tag II polyconal antibody (GenScript, USA). A goat anti protein, a gel filtration of the muteins was finally carried out rabbit IgG-HRP conjugate (Abcam, UK) was employed as on a Superdex 75 HR 10/30 column (24-ml bed volume, secondary detection antibody. Parallel to the competition Amersham Pharmacia Biotech, Freiburg, Germany) in the assay, anticalin binding was determined on the same plate in presence of PBS buffer. The monomeric protein fractions 25 a “direct ELISA, in order to obtain a standard curve linking were pooled, analysed for purity by SDS-PAGE (Fling and the RFU values to anticalin concentration. This curve was Gregerson (1986) Anal. Biochem. 155, 83-88), and used for then used to standardize competition data to the level of further biochemical characterization. anticalins bounds to the plate and fitted with Graphpad soft The pegylated versions of hNGAL muteins were purified ware. ICso values correspond to the half-maximum amount of by chromatography and, where necessary, a further reduction 30 lipocalin mutein bound to the plate. of bacterial endotoxins was achieved by MustangE mem Results from measurements employing the muteins of the brane (Pall Corporation, US) filtration. sequences of SEQID NO: 1 to SEQID NO: 12, as well as of SEQID NO: 14, linked to PEG40, of SEQID NO: 13, linked EXAMPLE 7 to PEG40 and of SEQID NO: 1, linked to ABD (SEQID NO: 35 15), are summarized in FIG. 6. Affinity Measurement Using ELISA Techniques ICso values of the selected Lcn2 muteins vary from 100 pM up to 10.8 nM. Serum half-life extension via the albumine A “direct ELISA was performed to verify the binding binding domain had no effect on the binding affinity of the affinity and specificity of the selected Lcn2 muteins. There mutein of SEQ ID NO: 1, whereas pegylation reduced the fore, a constant concentration of 1 Jug/ml C-terminal biotiny 40 binding affinities by a factor of 2 for SEQID NO: 13-PEG40 lated hepcidin (Bachem AG, CH) was captured on the surface and by a factor of 4 for SEQID NO: 14-PEG40, respectively. of a polystyrol plate (Greiner, GE) via Neutravidin (Thermo Scientific, 5 g/ml). Two step dilution series of purified Lcn2 EXAMPLE 8 muteins were incubated with the captured hepcidin for 1 h at room temperature and detected either via the Strep-tag II 45 Affinity Measurement Using using a rabbit anti-strep-tag II polyconal antibody (Gen Surface-Plasmon-Resonance (SPR) Script, USA) or by using a scaffold-specific polyclonal rabbit antibody. In both cases an anti rabbit IgG-HRP conjugate Surface plasmon resonance was used to measure binding (Abcam, UK) was employed as secondary detection anti kinetics and affinity of the lipocalin muteins disclosed herein. body. 50 Lipocalin muteins were immobilized to a CM5 sensor chip The absorption AA at 320 nm was measured in an ELISA using standard amine chemistry: The Surface of the chip was reader (Tecan, GE) and the data were fitted with Graphpad activated using EDC and NHS. Subsequently, 20 g/mL Prism software (Statcom, USA). lipocalin mutein solutions in 10 mM sodium acetate pH 4.5 Results from measurements employing the muteins of the (60 ug/mL in 10 mM sodium acetate pH 4.0 for peglyted sequences of SEQID NO: 1 to SEQID NO: 12, as well as of 55 lipocalin mutein) were applied at a flow rate of 5ul/min until SEQID NO: 14, linked to PEG40, of SEQID NO: 13, linked a surface density of 500-700 resonance units (RU) for non to PEG40 and of SEQID NO: 1, linked to albumine-binding modified lipocalin muteins and of approximately 1600RU for domain (ABD) (SEQID NO: 15) are summarized in FIG. 5. pegylated lipocalin with the sequence of SEQID NO: 13 was K, values of the selected Lcn2 muteins vary from 220 pM achieved. Residual activated groups were Saturated with etha up to 6.8 nM. All muteins bound human and cynomolgus 60 nolamine. The reference channels were treated with EDC/ hepcidin-25 with comparable affinity. Serum half-life exten NHS following ethanolamine (blank immobilization). All sion of the lipocalin mutein of SEQID NO: 1 via C-terminal reagents and materials were purchased from GE Healthcare. fusion of the albumine-binding domain had no significant Serial dilutions of human and cynomolgus Hepcidin-25 in effect on the binding affinity of the mutein whereas pegyla running buffer (HBS-EP+, GE Healthcare, BR-1006-68) tion reduced the binding affinities in this ELISA format sig 65 were applied to the prepared surface. The following param nificantly by a factor of 5 for SEQID NO: 8 and a factor of 8 eters were used for the binding assay: contact time 60s, for the mutein of SEQID NO: 1. dissociation time 180-360s, flow rate 30 uI/min. All mea US 9,051,382 B2 37 38 surements were performed on a Biacore T100 instrument (GE SEQID NO: 13 linked to PEG40 and SEQID NO: 1 linked to Healthcare) at 25° C. Regeneration of the surfaces having ABD (SEQID NO: 15) neutralized the bioactivity of human lipocalins immobilized thereon were achieved with subse hepcidin-25 with IC50 values shown in FIG. 8. quent injections of 2 M/4 M Guanidinium-HCl (120-600s) and 10 mM glycine-HCl pH 1.5/2.0 (40-240s) followed by an 5 EXAMPLE 10 extra wash with running buffer and a stabilization period of 120 S. Anti-Hepcidin Lipocalin Muteins Neutralize Human Data were evaluated with Biacore T100 Evaluation soft Hepcidin in Mice ware (V2.0.1). Double referencing was used. The 1:1 Bind ing model (Langmuir) was used to fit the raw data. 10 The activity of anti-human hepcidin lipocalin muteins was Duplicates were reproducible and no binding to the refer evaluated in vivo in mice that were administered human hep ence channel was detected. The binding parameters of the cidin in an amount Sufficient to generate a hypoferremic lipocalin muteins with the sequences of SEQID NO: 1, SEQ response as described (Nemeth et al. (2006) Blood, 107:328 ID NO: 8 as well as of SEQID NO: 13, linked to PEG40, to 333). human and cynomolgus Hepcidin-25 are Summarized in FIG. 15 7. Two weeks before the experiment C57BL/6 mice were Cynomolgus Hepcidin-25 was binding to immobilized Switched to an iron deficient diet to Suppress endogenous lipocalin muteins with an approximately 2-fold higher affin hepcidin. Prior to the experiment a 3-fold molar excess of ity compared to the human target. Kinetic analysis of hep lipocalin mutein was allowed to bind synthetic human hepci cidin-25 on the immobilized pegylated variant having the din-25 for 30 minutes. In parallel wildtype lipocalin (NGAL sequence of SEQID NO: 13 revealed a high affinity of 40pM. 98) was pre-incubated with human hepcidin-25 in the same molar ratio as an isotypic control. Mice received a single EXAMPLE 9 intraperitoneal (i.p.) injection of either PBS (vehicle) or 2 mg/kg hepcidin or 2 mg hepcidin/Kg pre-incubated with Cell-Based Assay for Hepcidin-Induced 25 either lipocalin mutein or wild type lipocalin (negative con Internalization and Degradation of Ferroportin trol). Two hours later, blood was collected under isoflurane anesthesia and total serum iron levels were determined using An in vitro cell-based assay was used to measure the neu a colorimetric assay on a KoneLab XTiclinical analyzer. tralization activity of the lipocalin muteins of the present The results are depicted in FIG.9 as total serum iron levels invention that are directed against human hepcidin. The assay 30 in LM concentrations. Hepcidin treatment induced a signifi is based on hepcidin-induced internalisation and degradation cant drop of serum iron levels in iron-starved mice. Hepcidin of its receptor, ferroportin and was implemented basically as pre-incubated with the wildtype lipocalin also exhibited described (Nemeth et al. 2004, 2006). hypoferremia. The pre-complexation of human hepcidin with Briefly, a HEK-293 stable cell line was prepared that the lipocalin mutein protected the animals from the hypofer allowed for the inducible expression of murine ferroportin 35 remic response. (FPN) carboxy-terminally fused with green fluorescent pro tein (GFP). The inducible expression of the FPN-GFP fusion EXAMPLE 11 protein was controlled by Doxycyclin using the commer cially available tetracycline-regulated T-REX expression sys Determination of Pharmacokinetic (PK) Parameter tem (Invitrogen, Karlsruhe, Germany). The FPN-GFP coding 40 for Anti-Hepcidin-25 Lipocalin Muteins sequence was cloned into pcDNA 4/TO vector, which con tains an inducible promoter and a Zeocin resistance marker. Pharmacokinetic (PK) parameters (half-life plasma con The resulting construct was stably transfected into T-REX centration) for the Lcn 2 mutein having the sequence of SEQ 293 cells which express the regulatory protein required for ID NO: 14 linked to PEG40 and of SEQID NO: 1 linked to doxycycline-inducible expression. 45 ABD (SEQID NO: 15) were determined following i.v. single The assay for hepcidin-induced internalisation of the hep bolus administration in NMRI mice and Cynomolgus cidin receptor was performed as follows: Cells of the T-REX (Macacca fascicularis) at doses depicted in FIG. 10. Plasma 293::FPN-GFP stable line were seeded in T75 cell culture was prepared from terminal blood samples taken at pre-de flasks at 80% confluence. In the evening FPN-GFP expres termined timepoints and the concentrations of the lipocalin sion was induced with 4 ng/ml Doxycyclin and stabilized 50 mutein were determined by ELISA. The elimination rate with 10 uMAmmonium iron(III) citrate for 16hat 37°C. On constant was calculated by least squares linear regression of the next morning cells were trypsinized and seeded in a the terminal portion of the log transformed plasma concen 24-well plate at 0.3 million cells/well in a volume of 450 ul. tration-time curve. The start of the terminal elimination phase Cells were allowed to attach for 1 h at 37° C. prior to the for each individual profile was defined by visual inspection addition of hepcidin. Cells were incubated at 37°C. for 24h 55 and was the first point at which there was no systematic and GFP fluorescence of the detached cell suspension was deviation from the log-linear decline in serum concentrations. analyzed by flow cytometry. T1/2 was calculated according to the following formula: The EC80 (40 nM) of hepcidin-mediated degradation of the Fpn-GFP fusion protein was used in neutralization assays. ln(2) For this purpose Anticalins were incubated with hepcidin at 60 room temperature for 30 min prior to addition to the cells. 2 Following the 24h incubation period fluorescence was quan tified as described above. T1/2 SEQ ID NO: 14-PEG (mouse): 27.9 h; T1/2 SEQ ID The anti-hepcidin lipocalin muteins having the sequences NO: 1-ABD (mouse): 30 h; T1/2 SEQ ID NO: 14-PEG of SEQIDNO:1, SEQIDNO: 2, SEQIDNO:4, SEQID NO: 65 (Cyno): 88 h. 6, SEQID NO: 7, SEQID NO: 8, SEQID NO: 10, SEQ ID One skilled in the art would readily appreciate that the NO: 11, as well as of SEQID NO: 14 linked to PEG40 and present invention is well adapted to carry out the objects and US 9,051,382 B2 39 40 obtain the ends and advantages mentioned, as well as those without the first. A third option refers to the applicability of inherent therein. Further, it will be readily apparent to one the first and second elements together. Any one of these skilled in the art that varying Substitutions and modifications options is understood to fall within the meaning, and there may be made to the invention disclosed herein without fore satisfy the requirement of the term “and/or” as used departing from the scope and spirit of the invention. The herein. Concurrent applicability of more than one of the compositions, methods, procedures, treatments, molecules options is also understood to fall within the meaning, and and specific compounds described herein are presently rep therefore satisfy the requirement of the term “and/or as used resentative of preferred embodiments are exemplary and are herein. not intended as limitations on the scope of the invention. The inventions illustratively described herein may suitably Changes therein and other uses will occur to those skilled in 10 be practiced in the absence of any element or elements, limi the art which are encompassed within the spirit of the inven tation or limitations, not specifically disclosed herein. Thus, tion are defined by the scope of the claims. The listing or for example, the terms “comprising.” “including.” contain discussion of a previously published document in this speci ing.” etc. shall be read expansively and without limitation. In fication should not necessarily be taken as an acknowledge each instance herein any of the terms “comprising”, “consist ment that the document is part of the state of the art or is 15 ing essentially of and “consisting of may be replaced with common general knowledge. either of the other two terms. It must be noted that as used herein, the singular forms “a”, Additionally, the terms and expressions employed herein “an', and “the’, include plural references unless the context have been used as terms of description and not of limitation, clearly indicates otherwise. Thus, for example, reference to and there is no intention in the use of such terms and expres “an antibody' includes one or more of such different antibod sions of excluding any equivalents of the features shown and ies and reference to “the method’ includes reference to described orportions thereof, but it is recognized that various equivalent steps and methods known to those of ordinary skill modifications are possible within the scope of the invention in the art that could be modified or substituted for the methods claimed. Thus, it should be understood that although the described herein. present invention has been specifically disclosed by exem All publications and patents cited in this disclosure are 25 plary embodiments and optional features, modification and incorporated by reference in their entirety. To the extent the variation of the inventions embodied thereinherein disclosed material incorporated by reference contradicts or is inconsis may be resorted to by those skilled in the art, and that such tent with this specification, the specification will supersede modifications and variations are considered to be within the any such material. Scope of this invention. Unless otherwise indicated, the term “at least preceding a 30 The invention has been described broadly and generically series of elements is to be understood to refer to every element herein. Each of the narrower species and Subgeneric group in the series. Those skilled in the art will recognize, or be able ings falling within the generic disclosure also form part of the to ascertain using no more than routine experimentation, invention. This includes the generic description of the inven many equivalents to the specific embodiments of the inven tion with a proviso or negative limitation removing any Sub tion described herein. Such equivalents are intended to be 35 ject matter from the genus, regardless of whether or not the encompassed by the present invention. excised material is specifically recited herein. As used herein, the conjunctive term “and/or between Other embodiments are within the following claims. In multiple recited elements is understood as encompassing addition, where features or aspects of the invention are both individual and combined options. For instance, where described in terms of Markush groups, those skilled in the art two elements are conjoined by “and/or”, a first option refers 40 will recognize that the invention is also thereby described in to the applicability of the first element without the second. A terms of any individual member or subgroup of members of second option refers to the applicability of the second element the Markush group.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 48

<21 Os SEQ ID NO 1 &211s LENGTH: 178 212s. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mutein of hNGAL

<4 OOs SEQUENCE: 1 Glin Asp Ser Thir Ser Asp Lieu. Ile Pro Ala Pro Pro Lieu. Ser Llys Val 1. 5 1O 15 Pro Leu Gln Glin Asn Phe Glin Asp Asn Glin Phe His Gly Lys Trp Tyr 2O 25 3 O

Val Val Gly Lieu Ala Gly Asn. Glu Val Lieu. Arg Glu Asp Lys Asp Pro 35 4 O 45

Met Lys Met Trp Ala Thr Ile Tyr Glu Lieu. Glu Glu Asp Llys Ser Tyr SO 55 60 US 9,051,382 B2 41 42 - Continued

Asn Wall Thir Ile Wall Met Phe Luell Ala Lys Lys Cys Glu Tyr Luell Phe 65 70

Glin Thir Phe Wall Pro Gly Ser Glin Pro Gly Glu Phe Thir Luell Gly Asp 85 90 95

Ile Ser Ser Pro Gly Arg Thir Ser Gly Luell Wall Arg Wall Wall Ser 105 11 O

Thir Asn Tyr Asn Glin His Ala Met Wall Phe Phe Thir Wall Trp Glin 115 12 O 125

Asn Arg Glu Wall Phe Trp Ile Thir Luell Tyr Gly Arg Thir Glu Luell 13 O 135 14 O

Thir Ser Glu Luell Lys Glu Asn Phe Ile Arg Phe Ser Ser Luell Gly 145 150 155 160

Lell Pro Glu Asn His Ile Wall Phe Pro Wall Pro Ile Asp Glin Cys Ile 1.65 17O 17s Asp Gly

SEQ ID NO 2 LENGTH: 178 TYPE : PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mutein of hNGAL

SEQUENCE: 2

Glin Asp Ser Thr Ser Asp Lell Ile Pro Ala Pro Pro Lell Ser Lys Wall 1. 5 1O 15

Pro Luell Glin Glin Asn Phe Glin Asp Asn Glin Phe His Gly Lys Trp 25 3O

Wall Wall Gly Thir Ala Gly Asn Ser Ile Luell Arg Glu Asp Asp Pro 35 4 O 45

Glin Lys Met Trp Ala Thir Ile Glu Luell Lys Glu Asp Ser SO 55 6 O

Asn Wall Thir Arg Wall Phe Phe Glu Gly Lys Arg Wall 65 70

Glu Thir Phe Wall Pro Gly Ser Glin Pro Gly Glu Phe Thir Luell Gly 85 90 95

Ile Ser Ala Pro Gly Gly Thir Ser Ile Luell Wall Arg Wall Wall Ser 105 11 O

Thir Asn Tyr Asn Glin His Ala Met Wall Phe Phe Wall Wall Trp Glin 115 12 O 125

Asn Arg Glu Luell Phe Trp Ile Thir Luell Gly Arg Thir Glu Luell 13 O 135 14 O

Thir Ser Glu Luell Lys Glu Asn Phe Ile Arg Phe Ser Ser Luell Gly 145 150 155 160

Lell Pro Glu Asn His Ile Wall Phe Pro Wall Pro Ile Asp Glin Cys Ile 1.65 17O 17s

Asp Gly

SEQ ID NO 3 LENGTH: 178 TYPE : PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mutein of hNGAL US 9,051,382 B2 43 44 - Continued

<4 OOs, SEQUENCE: 3 Glin Asp Ser Thir Ser Asp Lieu. Ile Pro Ala Pro Pro Lieu. Ser Llys Val 1. 5 1O 15 Pro Leu Gln Glin Asn Phe Glin Asp Asn Glin Phe His Gly Lys Trp Tyr 2O 25 3O Val Val Gly Val Ala Gly Asn Gly Lieu. Lieu. Arg Glu Asp Lys Asp Pro 35 4 O 45 Lieu Lys Met His Ala Thir Ile Tyr Glu Lieu Lys Glu Asp Llys Ser Tyr SO 55 6 O Asn Val Thir Arg Val Lieu. Phe Val Arg Llys Lys Cys Arg Tyr Tyr Ile 65 70 7s 8O Ser Thr Phe Val Pro Gly Ser Glin Pro Gly Glu Phe Thr Lieu. Gly Arg 85 90 95 Ile Llys Ser Glu Pro Gly Arg Thr Ser Phe Leu Val Arg Val Val Ser 1OO 105 11 O Thr Asn Tyr Asn Gln His Ala Met Val Phe Phe Lys Met Val Trp Glin 115 12 O 125 Asn Arg Glu Val Phe Trp Ile Thr Lieu. Tyr Gly Arg Thr Lys Glu Lieu 13 O 135 14 O Thir Ser Glu Lieu Lys Glu Asn. Phe Ile Arg Phe Ser Llys Ser Lieu. Gly 145 150 155 160 Lieu Pro Glu Asn His Ile Val Phe Pro Val Pro Ile Asp Glin Cys Ile 1.65 17O 17s Asp Gly

<210s, SEQ ID NO 4 &211s LENGTH: 178 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mutein of hNGAL

<4 OOs, SEQUENCE: 4 Glin Asp Ser Thir Ser Asp Lieu. Ile Pro Ala Pro Pro Lieu. Ser Llys Val 1. 5 1O 15 Pro Leu Gln Glin Asn Phe Glin Asp Asn Glin Phe His Gly Lys Trp Tyr 2O 25 3O

Val Val Gly Val Ala Gly Asn. Glu Met Lieu. Arg Glu Asp Lys Asp Pro 35 4 O 45

Lieu Lys Met Lieu Ala Thir Ile Tyr Glu Lieu Lys Glu Asp Llys Ser Tyr SO 55 6 O

Asn Val Thr Arg Val Met Phe Glu Tyr Lys Lys Cys Val Tyr Lieu. Ile 65 70 7s 8O

Glu Thr Phe Val Pro Gly Ser Glin Pro Gly Glu Phe Thr Lieu. Gly Thr 85 90 95

Ile Llys Ser Val Pro Gly Lieu. Thir Ser Gly Lieu Val Arg Val Val Ser 1OO 105 11 O

Thr Asn Tyr Asn Gln His Ala Met Val Phe Phe Lys Arg Val Trp Glin 115 12 O 125

Asn Arg Glu Val Phe Trp Ile Thr Lieu. Tyr Gly Arg Thr Lys Glu Lieu 13 O 135 14 O

Thir Ser Glu Lieu Lys Glu Asn. Phe Ile Arg Phe Ser Llys Ser Lieu. Gly 145 150 155 160 US 9,051,382 B2 45 46 - Continued Lieu Pro Glu Asn His Ile Val Phe Pro Val Pro Ile Asp Glin Cys Ile 1.65 17O 17s Asp Gly

SEO ID NO 5 LENGTH: 178 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mutein of hNGAL

SEQUENCE: 5 Glin Asp Ser Thir Ser Asp Lieu. Ile Pro Ala Pro Pro Leu Ser Lys Wall 1. 15 Pro Lieu. Glin Glin Asn. Phe Glin Asp Asn Glin Phe His Gly Lys Trp 2O 25 3O

Val Val Gly Ala Ala Gly Asn. Ser Lieu. Lieu Arg Glu Asp Lys Asp Pro 35 4 O 45 Met Lys Met Trp Ala Thr Ile Tyr Glu Lieu Lys Glu Asp Llys Ser SO 55 6 O

Asn Val Thir Arg Val Asn. Phe Gly Gly Lys Lys Cys Ser Tyr Lieu. Ile 65 70 7s

Glu Thr Phe Val Pro Gly Ser Glin Pro Gly Glu Phe Thr Lieu. Gly Ser 85 90 95

Ile Llys Ser Arg Pro Gly Ala Thr Ser Val Lieu Val Arg Val Val Ser 1OO 105 11 O

Thr Asn Tyr Asn Gln His Ala Met Val Phe Phe Lys Lieu Val Thr Glin 115 12 O 125

Asn Arg Glu Val Phe Trp Ile Thr Lieu. Tyr Gly Arg Thr Lys Glu Luell 13 O 135 14 O Thir Ser Glu Lieu Lys Glu Asn. Phe Ile Arg Phe Ser Lys Ser Leu Gly 145 150 155 160

Lieu. Pro Glu Asn His Ile Wall Phe Pro Wall Pro Ile Asp Gln Cys Ile 1.65 17O 17s Asp Gly

SEQ ID NO 6 LENGTH: 178 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mutein of hNGAL

SEQUENCE: 6 Glin Asp Ser Thir Ser Asp Lieu. Ile Pro Ala Pro Pro Leu Ser Lys Wall 1. 15

Pro Lieu. Glin Glin Asn. Phe Glin Asp Asn Glin Phe His Gly Lys Trp 2O 25 3O

Val Val Gly Lieu Ala Gly Asn. Glu Ile Lieu Arg Glu Asp Lys Asp Pro 35 4 O 45

Lieu Lys Met Trp Ala Thir Ile Tyr Glu Lieu. Lys Glu Asp Llys Ser SO 55 6 O

Asn Val Thir Arg Val Glin Phe Gly Glu Lys Lys Cys Gly Tyr Gly Ile 65 70 7s 8O

Glu Thr Phe Val Pro Gly Ser Glin Pro Gly Glu Phe Thr Lieu. Gly Ser 85 90 95 US 9,051,382 B2 47 48 - Continued

Ile Ser Wall Pro Gly Gly Thir Ser Arg Luell Val Arg Val Wall Ser 105 11 O

Thir Asn Tyr Asn Glin His Ala Met Wall Phe Phe Lys Phe Wall Trp Glin 115 12 O 125

Asn Arg Glu Wall Phe Trp Ile Thir Luell Tyr Gly Arg Thir Lys Glu Luell 13 O 135 14 O

Thir Ser Glu Luell Lys Glu Asn Phe Ile Arg Phe Ser Ser Luell Gly 145 150 155 160

Lell Pro Glu Asn His Ile Wall Phe Pro Wall Pro Ile Asp Glin Cys Ile 1.65 17O 17s Asp Gly

SEO ID NO 7 LENGTH: 178 TYPE : PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mutein of hNGAL

SEQUENCE: 7

Gln Asp Ser Thr Ser Asp Lell Ile Pro Ala Pro Pro Lell Ser Lys Wall 1. 5 1O 15

Pro Luell Glin Glin Asn Phe Glin Asp Asn Glin Phe His Gly Lys Trp Tyr 25 3O

Wall Wall Gly Luell Ala Gly Asn Arg Wall Luell Arg Glu Asp Asp Pro 35 4 O 45

Glin Lys Met Phe Ala Thir Ile Glu Luell Lys Glu Asp Ser Tyr SO 55 6 O

Asn Wall Thir Gly Wall Asp Phe Arg Thir Lys Lell Ser Ile 65 70

Gly Thir Phe Wall Pro Gly Ser Glin Pro Glu Phe Thir Luell Gly Wall 85 95

Ile Ser Glin Pro Gly Trp Thir Ser Luell Wall Arg Wall Wall Ser 105 11 O

Thir Asn Tyr Asn Glin His Ala Met Wall Phe Phe Thir Wall Trp Glin 115 12 O 125

Asn Arg Glu Wall Phe Trp Ile Thir Luell Gly Arg Thir Glu Luell 13 O 135 14 O

Thir Ser Glu Luell Lys Glu Asn Phe Ile Arg Phe Ser Ser Luell Gly 145 150 155 160

Lell Pro Glu Asn His Ile Wall Phe Pro Wall Pro Ile Asp Glin Cys Ile 1.65 17O 17s Asp Gly

SEQ ID NO 8 LENGTH: 178 TYPE : PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mutein of hNGAL

<4 OOs, SEQUENCE: 8 Glin Asp Ser Thir Ser Asp Lieu. Ile Pro Ala Pro Pro Lieu. Ser Llys Val 1. 5 15 Pro Leu Gln Glin Asn Phe Glin Asp Asn Glin Phe His Gly Lys Trp Tyr 25 US 9,051,382 B2 49 50 - Continued

Val Val Gly Lieu Ala Gly Asn. Glu Val Lieu Arg Glu Asp Lys Asp Pro 35 4 O 45

Met Lys Met Trp Ala Thr Ile Tyr Glu Lieu Lys Glu Asp Ser SO 55 6 O

Asn. Wall. Thir Ile Wal Met Pro Leu Ala Glu Lys Cys Glu Luell Phe 65 70 7s

Gln Thr Phe Val Pro Gly Ser Glin Pro Gly Glu Phe Thr Luell Gly Gly 85 90 95

Ile Llys Ser Gly Pro Gly Arg Thr Ser Gly Lieu Val Arg Wall Wall Ser 1OO 105 11 O

Thr Asn Tyr Asn Gln His Ala Met Val Phe Phe Llys Val Wall Trp Glin 115 12 O 125

Asn Arg Glu Val Phe Trp Val Thr Lieu. Tyr Gly Arg Thr Glu Luell 13 O 135 14 O

Thir Ser Glu Lieu Lys Glu Asn. Phe Ile Arg Phe Ser Lys Ser Luell Gly 145 150 155 160

Lieu. Pro Glu Asn His Ile Wall Phe Pro Wall Pro Ile Asp Glin Cys Ile 1.65 17O 17s Asp Gly

SEO ID NO 9 LENGTH: 178 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mutein of hNGAL

SEQUENCE: 9

Glin Asp Ser Thir Ser Asp Lieu. Ile Pro Ala Pro Pro Leu Ser Lys Wall 1. 15

Pro Lieu. Glin Glin Asn. Phe Glin Asp Asn Glin Phe His Gly Lys Trp 2O 25 3O

Val Val Gly Lieu Ala Gly Asn. Glu Val Lieu Arg Glu Asp Asp Pro 35 4 O 45

Met Lys Met Trp Ala Thr Ile Tyr Glu Lieu Lys Glu Asp Ser SO 55 6 O

Asn Val Thir Ile Val Met Ser Lieu Ala Lys Lys Cys Glu Luell Phe 65 70 7s 8O

Gln Thr Phe Val Pro Gly Ser Glin Pro Gly Glu Phe Thr Luell Gly Asp 85 90 95

Ile Llys Ser Ser Pro Gly Arg Thr Ser Gly Lieu Val Arg Wall Wall Ser 1OO 105 11 O

Thr Asn Tyr Asn Gln His Ala Met Val Phe Phe Llys Val Wall Trp Glin 115 12 O 125

Asn Arg Glu Val Phe Trp Ile Thr Lieu. Tyr Gly Arg Thr Glu Luell 13 O 135 14 O

Thir Ser Gly Lieu Lys Glu Asn. Phe Ile Arg Phe Ser Lys Ser Luell Gly 145 150 155 160

Lieu. Pro Glu Asn His Ile Wall Phe Pro Wall Pro Ile Asp Glin Cys Ile 1.65 17O 17s

Asp Gly US 9,051,382 B2 51 52 - Continued

SEQ ID NO 10 LENGTH: 179 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mutein of hNGAL

SEQUENCE: 1.O Glin Asp Ser Thir Ser Asp Lieu. Ile Pro Ala Pro Pro Leu Ser Lys Wall 1. 15 Pro Lieu. Glin Glin Asn. Phe Glin Asp Asn Glin Phe His Gly Lys Trp 2O 25 3O

Val Val Gly Lieu Ala Gly Asn. Glu Ile Lieu Arg Glu Asp Lys Asp Pro 35 4 O 45 Met Lys Met Trp Ala Thr Ile Tyr Glu Lieu Lys Glu Asp Arg Ser SO 55 6 O

Asn Val Thir Ile Val Met Phe Leu Ala Lys Lys Cys Glu Tyr Lieu. Phe 65 70 7s Gln Thr Phe Val Pro Gly Ser Glin Pro Gly Glu Phe Thr Lieu. Gly Asp 85 90 95

Ile Llys Ser Ser Pro Gly Arg Thr Ser Gly Lieu Val Arg Val Val Ser 1OO 105 11 O

Thr Asn Tyr Asn Gln His Ala Met Val Phe Phe Llys Val Val Trp Glin 115 12 O 125

Asn Arg Glu Val Phe Trp Ile Thr Lieu. Tyr Gly Arg Thr Lys Glu Luell 13 O 135 14 O Thr Pro Glu Lieu Lys Glu Asn. Phe Ile Arg Phe Ser Lys Ser Leu Gly 145 150 155 160

Lieu. Pro Glu Asn His Ile Wall Phe Pro Wall Pro Ile Asp Gln Cys Ile 1.65 17O 17s Asp Gly Phe

SEQ ID NO 11 LENGTH: 178 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mutein of hNGAL

SEQUENCE: 11 Glin Asp Ser Thir Ser Asp Lieu. Ile Pro Ala Pro Pro Leu Ser Lys Wall 1. 15 Pro Lieu. Glin Glin Asn. Phe Glin Asp Asn Glin Phe His Gly Lys Trp 2O 25 3O

Val Val Gly Lieu Ala Gly Asn. Glu Ile Lieu Arg Glu Asp Lys Asp Pro 35 4 O 45

Met Lys Met Trp Ala Thr Ile Tyr Glu Lieu Lys Glu Asp Llys Ser SO 55 6 O

Asn Val Thir Ile Val Met Phe Leu Ala Lys Lys Cys Glu Tyr Lieu. Phe 65 70 7s 8O

Gln Thr Phe Val Pro Gly Ser Glin Pro Gly Glu Phe Thr Lieu. Gly Asp 85 90 95

Ile Llys Ser Ser Pro Gly Arg Thr Ser Gly Lieu Val Arg Val Val Ser 1OO 105 11 O

Thr Asn Tyr Asn Gln His Ala Met Val Phe Phe Llys Val Val Trp Glin 115 12 O 125 US 9,051,382 B2 53 54 - Continued

Asn Arg Glu Val Phe Trp Ile Thr Lieu. Tyr Gly Arg Thr Lys Glu Luell 13 O 135 14 O Thir Ser Gly Lieu Lys Glu Asn. Phe Ile Arg Phe Ser Lys Ser Leu Gly 145 150 155 160

Lieu Pro Glu Asn His Ile Wall Phe Pro Wall Pro Ile Asp Gln Cys Ile 1.65 17O 17s Asp Gly

<210s, SEQ ID NO 12 &211s LENGTH: 178 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mutein of hNGAL

<4 OOs, SEQUENCE: 12 Gln Asp Ser Thr Ser Asp Lieu. Ile Pro Ala Pro Pro Leu Ser Lys Wall 1. 5 1O 15

Pro Lieu. Glin Glin Asn Phe Glin Asp Asin Glin Phe His Gly Lys Trp 2O 25 3O

Val Val Gly Lieu Ala Gly Asn. Glu Val Lieu. Arg Glu Asp Lys Asp Pro 35 4 O 45 Met Lys Met Trp Ala Thir Ile Tyr Glu Lieu Lys Glu Asp Llys Ser SO 55 6 O

Asn. Wall. Thir Ile Wall Met Phe Lieu. Ala Glu Glu Cys Glu Tyr Lieu. Phe 65 70 7s

Glin. Thir Phe Wall Pro Gly Ser Glin Pro Gly Glu Phe Thr Lieu. Gly Asp 85 90 95

Ile Llys Ser Ser Pro Gly Arg Thr Ser Gly Lieu Val Arg Val Val Ser 1OO 105 11 O

Thr Asn Tyr Asn Glin His Ala Met Wall Phe Phe Llys Val Val Trp Glin 115 12 O 125

Asn Arg Glu Val Phe Trp Ile Thr Lieu. Tyr Gly Arg Thr Lys Glu Luell 13 O 135 14 O Thir Ser Glu Lieu Lys Lys Asn. Phe Ile Arg Phe Ser Lys Ser Leu Gly 145 150 155 160

Lieu Pro Glu Asn His Ile Wall Phe Pro Wall Pro Ile Asp Gln Cys Ile 1.65 17O 17s Asp Gly

<210s, SEQ ID NO 13 &211s LENGTH: 178 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mutein of hNGAL

<4 OOs, SEQUENCE: 13

Gln Asp Ser Thr Ser Asp Lieu. Ile Pro Ala Pro Pro Leu Ser Lys Wall 1. 5 1O 15

Pro Lieu. Glin Glin Asn Phe Glin Asp Asin Glin Phe His Gly Lys Trp 2O 25 3O

Val Val Gly Lieu Ala Gly Asn. Glu Val Lieu. Arg Glu Asp Lys Asp Pro 35 4 O 45

Met Lys Met Trp Ala Thir Ile Tyr Glu Lieu Lys Glu Asp Llys Ser Tyr SO 55 6 O US 9,051,382 B2 55 56 - Continued

Asn. Wall. Thir Ile Wal Met Pro Leu Ala Glu Lys Cys Glu Tyr Lieu. Phe 65 70 7s Gln Thr Phe Val Pro Gly Cys Gln Pro Gly Glu Phe Thr Lieu. Gly Gly 85 90 95

Ile Llys Ser Gly Pro Gly Arg Thr Ser Gly Lieu Val Arg Val Val Ser 1OO 105 11 O

Thr Asn Tyr Asn Gln His Ala Met Val Phe Phe Llys Val Val Trp Glin 115 12 O 125

Asn Arg Glu Val Phe Trp Val Thr Lieu. Tyr Gly Arg Thr Lys Glu Luell 13 O 135 14 O Thir Ser Glu Lieu Lys Glu Asn. Phe Ile Arg Phe Ser Lys Ser Leu Gly 145 150 155 160

Lieu. Pro Glu Asn His Ile Wall Phe Pro Wall Pro Ile Asp Gln Cys Ile 1.65 17O 17s Asp Gly

SEQ ID NO 14 LENGTH: 178 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mutein of hNGAL

SEQUENCE: 14

Glin Asp Ser Thir Ser Asp Lieu. Ile Pro Ala Pro Pro Leu Ser Lys Wall 1. 15

Pro Lieu. Glin Glin Asn. Phe Glin Asp Asn Glin Phe His Gly Lys Trp 2O 25 3O

Val Val Gly Lieu Ala Gly Asn. Glu Val Lieu Arg Glu Asp Lys Asp Pro 35 4 O 45

Met Lys Met Trp Ala Thr Ile Tyr Glu Lieu Glu Glu Asp Llys Ser SO 55 6 O

Asn Val Thir Ile Val Met Phe Leu Ala Lys Lys Cys Glu Tyr Lieu. Phe 65 70 7s 8O

Gln Thr Phe Val Pro Gly Cys Gln Pro Gly Glu Phe Thr Lieu. Gly Asp 85 90 95

Ile Llys Ser Ser Pro Gly Arg Thr Ser Gly Lieu Val Arg Val Val Ser 1OO 105 11 O

Thr Asn Tyr Asn Gln His Ala Met Val Phe Phe Lys Thr Val Trp Glin 115 12 O 125

Asn Arg Glu Val Phe Trp Ile Thr Lieu. Tyr Gly Arg Thr Lys Glu Luell 13 O 135 14 O

Thir Ser Glu Lieu Lys Glu Asn. Phe Ile Arg Phe Ser Lys Ser Leu Gly 145 150 155 160

Lieu. Pro Glu Asn His Ile Wall Phe Pro Wall Pro Ile Asp Gln Cys Ile 1.65 17O 17s Asp Gly

<210s, SEQ ID NO 15 &211s LENGTH: 243 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223s OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mutein of hNGAL with ABD domain and STREP tag US 9,051,382 B2 57 - Continued

<4 OOs, SEQUENCE: 15 Glin Asp Ser Thir Ser Asp Lieu. Ile Pro Ala Pro Pro Lieu. Ser Llys Val 1. 5 1O 15 Pro Leu Gln Glin Asn Phe Glin Asp Asn Glin Phe His Gly Lys Trp Tyr 2O 25 3O Val Val Gly Lieu Ala Gly Asn. Glu Val Lieu. Arg Glu Asp Lys Asp Pro 35 4 O 45 Met Lys Met Trp Ala Thr Ile Tyr Glu Lieu. Glu Glu Asp Llys Ser Tyr SO 55 6 O Asn Val Thir Ile Val Met Phe Leu Ala Lys Lys Cys Glu Tyr Lieu. Phe 65 70 7s 8O Gln Thr Phe Val Pro Gly Ser Glin Pro Gly Glu Phe Thr Lieu. Gly Asp 85 90 95 Ile Llys Ser Ser Pro Gly Arg Thr Ser Gly Lieu Val Arg Val Val Ser 1OO 105 11 O Thr Asn Tyr Asn Gln His Ala Met Val Phe Phe Llys Val Val Trp Glin 115 12 O 125 Asn Arg Glu Val Phe Trp Ile Thr Lieu. Tyr Gly Arg Thr Lys Glu Lieu 13 O 135 14 O Thir Ser Glu Lieu Lys Glu Asn. Phe Ile Arg Phe Ser Llys Ser Lieu. Gly 145 150 155 160 Lieu Pro Glu Asn His Ile Val Phe Pro Val Pro Ile Asp Glin Cys Ile 1.65 17O 17s

Asp Gly Ser Ala Gly Ala Val Asp Ala Asn. Ser Lieu Ala Glu Ala Lys 18O 185 19 O

Val Lieu Ala Asn Arg Glu Lieu. Asp Llys Tyr Gly Val Ser Asp Tyr Tyr 195 2OO 2O5

Lys Asn Lieu. Ile Asn. Asn Ala Lys Thr Val Glu Gly Val Lys Ala Lieu. 21 O 215 22O Ile Asp Glu Ile Lieu Ala Ala Lieu Pro Ser Ala Trp Ser His Pro Glin 225 23 O 235 24 O

Phe Glu Lys

<210s, SEQ ID NO 16 &211s LENGTH: 88 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic NNK oligomer for positions 36, 40, 41, 49, 52 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (2O) . . (21) <223> OTHER INFORMATION: a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (32) ... (33) <223> OTHER INFORMATION: a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (35) ... (36) <223> OTHER INFORMATION: a, c, g, or t 22 Os. FEATURE <221 > NAMEAKEY: modified base <222s. LOCATION: (59) . . (60) <223> OTHER INFORMATION: a, c, g, or t 22 Os. FEATURE <221 > NAMEAKEY: modified base <222s. LOCATION: (68) . . (69) <223> OTHER INFORMATION: a, c, g, or t US 9,051,382 B2 59 - Continued

<4 OOs, SEQUENCE: 16 gaagtggit at gtgg taggtn nkgcagggala tinnknnkctic agagaagaca aagacccgnn 6 O kaagatgnink gccaccatct atgagctg 88

SEO ID NO 17 LENGTH: 79 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic NNK oligomer for positions 68, 7 O, 72, 73, 77, 79, 81 FEATURE: NAMEAKEY: modified base LOCATION: (20) . . (21) OTHER INFORMATION: a, c, o FEATURE: NAMEAKEY: modified base LOCATION: (26) (27) OTHER INFORMATION: a, c, o FEATURE: NAMEAKEY: modified base LOCATION: (32) (33) OTHER INFORMATION: a, c, o FEATURE: NAMEAKEY: modified base LOCATION: (35) (36) OTHER INFORMATION: a, c, o FEATURE: NAMEAKEY: modified base LOCATION: (47) (48) OTHER INFORMATION: a, c, o FEATURE: NAMEAKEY: modified base LOCATION: (53) . . (54) OTHER INFORMATION: a, c, o FEATURE: NAMEAKEY: modified base LOCATION: (59) . . (6O) OTHER INFORMATION: a, c, o

<4 OOs, SEQUENCE: 17 caagagctac aatgtcaccin inkgtcnnktt trunk.nnkaag aagtgtninkt acnnkat cnn. 6 O kactitttgtt coaggttcc 79

SEQ I D NO 18 LENGT H: 68 TYPE : DNA ORGAN SM: Artificial Sequence FEATU RE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic igomer for positions 96, 100 103, 106 RE: KEY: modified base ON: (19) . . (20) INFORMATION: a, c, g, or RE: KEY: modified base ON: (31) ... (32) INFORMATION: a, c, g, or RE: KEY: modified base ON: (40) ... (41) INFORMATION: a, c, g, or RE: KEY: modified base LOCAT ON: (49) . . (5O) OTHER INFORMATION: a, c, g, or

<4 OOs, SEQUENCE: 18 ggcgagttca cqctgggcnn kattalaga.gt innkcctggan nkacgagtnin kct cqtc.cga 6 O gtggtgag 68 US 9,051,382 B2 61 62 - Continued

SEQ ID NO 19 LENGTH: 68 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic NNK oligomer for positions 125, 127, 132, 134 FEATURE: NAMEAKEY: modified base LOCATION: (19) . . (20) OTHER INFORMATION: a, c, g, or FEATURE: NAMEAKEY: modified base LOCATION: (25) . . (26) OTHER INFORMATION: a, c, g, or FEATURE: NAMEAKEY: modified base LOCATION: (40) ... (41) OTHER INFORMATION: a, c, g, or FEATURE: NAMEAKEY: modified base LOCATION: (46) . . (47) OTHER INFORMATION: a, c, g, or SEQUENCE: 19 gctatoggtgt tottcaagnin kgttninkcaa aac agggagin niktitcnnkat caccct citac gggagaac

<210s, SEQ ID NO 2 O &211s LENGTH: 45 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223s OTHER INFORMATION: Description of Artificial Sequence: Synthetic PCR-Primer with fixed nucleotide sequences corresponding to the non-coding strand

<4 OOs, SEQUENCE: 2O ggtgacattg tagct Cttgt Ctt Cttt Cag ct catagatg gtggc

SEQ ID NO 21 LENGTH: 42 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic PCR-Primer with fixed nucleotide sequences corresponding to the non-coding strand

SEQUENCE: 21 gcc.cagcgtgaacticgc.ctg gctgggalacc tigaacaaaa git

SEQ ID NO 22 LENGTH: 54 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic PCR-Primer with fixed nucleotide sequences corresponding to the non-coding strand

SEQUENCE: 22 Cttgaagaac accatagcat gctggttgta gttggtgctic acc acticgga cag

SEQ ID NO 23 LENGTH: 64 TYPE: DNA ORGANISM: Artificial Sequence US 9,051,382 B2 63 - Continued

22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic PCR-Primer with fixed nucleotide sequences corresponding to the non-coding strand

<4 OOs, SEQUENCE: 23 ggagaa.gcgg atgaagttct cct ttagttc Caagttcago to Cttggttc. tcc.cgtagag 6 O ggtg 64

<210s, SEQ ID NO 24 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic 5' flanking PCR-Oligo biotinylated

<4 OOs, SEQUENCE: 24 cCagga caac Caattic catg ggaagtggta ttgg taggit 4 O

<210s, SEQ ID NO 25 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic 3' flanking PCR-Oligo biotinylated

<4 OOs, SEQUENCE: 25 ttcagggagg cccagagatt tagaag.cg gatgaagttc 4 O

<210s, SEQ ID NO 26 &211s LENGTH: 4746 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic Phage display vector phNGAL1 O2 with CamR used as backbone for NNK-Library

<4 OOs, SEQUENCE: 26 c catalacgct cqgttgcc.gc cgggcgttitt ttattggc.ca gatgattaat t cotta at titt 6 O tgttgacact citat cattgg tagagittatt ttaccacticc citat cagtga tagagaaaag 12 O tgaaatgaat agttcgacaa aaatctagat aacgagggca aaaaatgaaa alagacagcta 18O tcgcgattgc agtggctctg ctaccgtagc gCaggcc.ca.g gactic cacct 24 O cagacctgat cocago ccca cct ctdagca aggtocct ct gcago agaac titccaggaca 3OO accalatt.cca tigaagtgg tatgtgg tag gtc.tc.gcagg gaatgcaatt Ctcagagaag 360 acaaagaccc gcaaaagatg tatgccacca tctatgagct gaaagaagac aagagctaca 42O atgtcacctic cqt cct gttt aggaaaaaga agtgtgacta Ctggat Cagg actitttgttc 48O

Caggttcc.ca gcc aggcgag ttcacgctgg gcaac attaa gagttaccct ggattaacga 54 O gttacctict C cagtggtg agcaccaact acaac cagoa tgctatggtg ttcttcaaga 6OO aagtttctica aaa.cagggag tacttcaaga to accotecta cgggaga acc aaggagctga 660

Cttcggaact aaaggagaac ttcatcc.gct tot Coaaatc. tctgggcct c cctgaaaacc 72 O a catcgtc.tt coctdtcc.ca atcgaccagt gt atcgacgg Cagcgctggit ggggcct aga 78O ctgttgaaag ttgtttagca aalacc Coata cagaaaattic att tactaac gtctggaaag 84 O acgacaaaac tittagat.cgt. tacgctaact atgagggctg tctgtggaat gct acaggcg 9 OO

US 9,051,382 B2 73 74 - Continued

<4 OOs, SEQUENCE: 28 Asp Thr His Phe Pro Ile Cys Ile Phe Cys Cys Gly Cys Cys His Arg 1. 5 1O 15 Ser Lys Cys Gly Met Cys Cys Llys Thr 2O 25

<210s, SEQ ID NO 29 &211s LENGTH: 25 212. TYPE: PRT <213s ORGANISM: Mus musculus 22 Os. FEATURE: <223> OTHER INFORMATION: Hepcidin-25

<4 OOs, SEQUENCE: 29 Asp Thr Asn Phe Pro Ile Cys Ile Phe Cys Cys Lys Cys Cys Asn Asn 1. 5 1O 15 Ser Glin Cys Gly Ile Cys Cys Llys Thr 2O 25

<210s, SEQ ID NO 3 O &211s LENGTH: 25 212. TYPE: PRT <213> ORGANISM: Rattus norvegicus 22 Os. FEATURE: <223> OTHER INFORMATION: Hepcidin-25 <4 OOs, SEQUENCE: 30 Asp Thr Asn. Phe Pro Ile Cys Lieu. Phe Cys Cys Llys Cys Cys Lys Asn 1. 5 1O 15 Ser Ser Cys Gly Lieu. Cys Cys Ile Thr 2O 25

<210s, SEQ ID NO 31 &211s LENGTH: 3745 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic Expression vector phNGAL98 with AmpR encoding Wild type Licn2 with the C-terminal Strep-tagII

<4 OOs, SEQUENCE: 31 c catcgaatg gccagatgat taatticcitaa tttttgttga cactictato a ttgatagagt 6 O tattittacca citc cctatica gtgatagaga aaagtgaaat gaatagttcg acaaaaatct 12 O agataacgag ggcaaaaaat gaaaaagaca gct atcgcga ttgcagtggc tictggctggc 18O titcgct accq tag.cgcaggc ccaggactico acct cagacic tdatcc.cagc cccacct citg 24 O agcaaggit co Ctctgcagca gaact tccag gacaaccaat tcc atgggala gtgg tatgtg 3OO gtaggit ct cq Cagggaatgc aattct caga gaaga caaag accc.gcaaaa gatgtatgcc 360 accatc tatg agctgaaaga agacaagagc tacaatgtca cct cogt cct gtttaggaaa aagaagtgtg act actggat Caggacttitt gttcCaggitt CCC agcCagg cagttcacg 48O

Ctgggcaa.ca ttalagagitta C cctggatta acgagttacct cqtc.cgagt ggtgagc acc 54 O aact acaacc agcatgctat gigtgttctitc aagaaagttt citcaaaacag ggagtacttic aagat caccc tictacgggag aaccalaggag Ctgactitcgg alactaaagga gaact tcatC 660 cgctitcticca aatctotggg cct coctdaa aacca catcg tct tcc.ctgt cccaatcgac 72 O

Cagtgitatic acggcagcgc titggit ctoac cc.gcagttcg aaaaataata agcttgacct gtgaagtgaaaaatggcgca cattgtgcga catttitttitt gtctg.ccgtt taccgctact 84 O

US 9,051,382 B2 77 - Continued tagtgtagcc gtagttaggc caccact tca agaactctgt agcaccgcct acatacct cq 33 OO Ctctgctaat cctgttacca gtggctgctg C cagtggcga taagt catgt Cttaccgggt 3360 tggact caag acgatagitta cc.ggataagg cqcagcggtc gggctgaacg gggggttcgt. 342O gcacacagcc cagcttggag caacgacct acaccgaact gagatacct a cagcgtgagc 3480 tatgagaaag cqccacgctt CCC galaggga gaaaggcgga Caggitat cog gtaag.cggca 354 O gggit cqqaac aggaga.gc.gc acgagggagc titcCaggggg aaacgc.ctgg tat ctittata 36OO gtcCtgtcgg gtttcgc.cac Ctctgactitg agcgt.cgatt tttgttgatgc ticgtcagggg 366 O ggcggagcct atggaaaaac gcc agcaacg C9gcctttitt acggttcct g gcc ttittgct 372 O ggcc titttgc ticacatgacc cqaca 3745

<210s, SEQ ID NO 32 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 32 cc.caggactic cacct cagac c 21

<210s, SEQ ID NO 33 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence & 22 O FEATURE; <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 33 actg.cgggtg ggaccalagcg ctg.ccgt 27

<210s, SEQ ID NO 34 &211s LENGTH: 197 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic hNGAL with T7 tag encoded by phNGAL 101

<4 OOs, SEQUENCE: 34

Glin Asp Ser Thir Ser Asp Lieu. Ile Pro Ala Pro Pro Lell Ser Llys Val 1. 5 1O 15

Pro Luell Glin Glin Asn. Phe Glin Asp Asn. Glin Phe His Gly Lys Trp Tyr 25 3O

Wall Wall Gly Lieu Ala Gly Asn Ala Ile Lieu. Arg Glu Asp Asp Pro 35 4 O 45

Glin Lys Met Tyr Ala Thr Ile Tyr Glu Lieu Lys Glu Asp Ser Tyr SO 55 6 O

Asn Wall Thir Ser Val Lieu. Phe Arg Asp Trp Ile 65 70

Arg Thir Phe Val Pro Gly Ser Glin Pro Gly Glu Phe Thir Luell Gly Asp 85 95

Ile Ser Tyr Pro Gly Lieu. Thr Ser Tyr Lieu. Wall Arg Wall Wall Ser 105 11 O

Thir Asn Tyr ASn Gln His Ala Met Wall Phe Phe Thir Wall Ser Glin 115 12 O 125 US 9,051,382 B2 79 80 - Continued

Asn Arg Glu Tyr Phe Lys Ile Thr Lieu. Tyr Gly Arg Thr Lys Glu Luell 13 O 135 14 O

Thir Ser Glu Lieu Lys Glu Asn. Phe Ile Arg Phe Ser Lys Ser Luell Gly 145 150 155 160

Lieu. Pro Glu Asn His Ile Wall Phe Pro Wall Pro Ile Asp Glin Cys Ile 1.65 17O 17s

Asp Gly Ser Ala Trp Ser His Pro Glin Phe Met Ala Ser Met Thir Gly 18O 185 19 O Gly Glin Gln Met Gly 195

SEO ID NO 35 LENGTH: 178 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic Wild type hNGAL

SEQUENCE: 35

Glin Asp Ser Thir Ser Asp Lieu. Ile Pro Ala Pro Pro Leu Ser Lys Wall 1. 15 Pro Lieu. Glin Glin Asn. Phe Glin Asp Asn Glin Phe His Gly Lys Trp 2O 25 3O

Val Val Gly Lieu Ala Gly Asn Ala Ile Lieu Arg Glu Asp Asp Pro 35 4 O 45

Gln Lys Met Tyr Ala Thr Ile Tyr Glu Lieu Lys Glu Asp Ser O s 60

Asn Val Thir Ser Val Lieu. Phe Arg Llys Llys Lys Cys Asp Trp Ile 65 70 7s

Arg Thr Phe Val Pro Gly Ser Glin Pro Gly Glu Phe Thr Luell Gly Asn 85 90 95

Ile Llys Ser Tyr Pro Gly Lieu. Thir Ser Tyr Lieu Val Arg Wall Wall Ser 1OO 105 11 O

Thr Asn Tyr Asn Gln His Ala Met Val Phe Phe Llys Llys Wall Ser Glin 115 12 O 125

Asn Arg Glu Tyr Phe Lys Ile Thr Lieu. Tyr Gly Arg Thr Glu Luell 13 O 135 14 O

Thir Ser Glu Lieu Lys Glu Asn. Phe Ile Arg Phe Ser Lys Ser Luell Gly 145 150 155 160

Lieu. Pro Glu Asn His Ile Wall Phe Pro Wall Pro Ile Asp Glin Cys Ile 1.65 17O 17s Asp Gly

SEQ ID NO 36 LENGTH: 12 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide FEATURE: NAMEAKEY: modified base LOCATION: (4) ... (9) OTHER INFORMATION: a, c, t, g, unknown or other

SEQUENCE: 36 c cannnnnnt gg US 9,051,382 B2 81 - Continued

<210s, SEQ ID NO 37 &211s LENGTH: 5 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic 5xHis tag

<4 OO > SEQUENCE: 37

His His His His His 1. 5

<210s, SEQ ID NO 38 &211s LENGTH: 6 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic 6xHis tag <4 OOs, SEQUENCE: 38

His His His His His His 1. 5

<210s, SEQ ID NO 39 &211s LENGTH: 79 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide 22 Os. FEATURE: <221> NAME/KEY: modified base <222s. LOCATION: (2O) . . (21) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (26) (27) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (32) (33) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (35) (36) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (47) ... (48) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (53) . . (54) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (59) . . (60) <223> OTHER INFORMATION: a, c, t, g, unknown or other

<4 OOs, SEQUENCE: 39 caagagctac aatgtcacan nkgtcnnktt trunk.nnkaag aagtgtninkt acnnkat cnn. 6 O kactitttgtt coaggttcc 79

<210s, SEQ ID NO 4 O &211s LENGTH: 45 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide US 9,051,382 B2 83 - Continued

<4 OOs, SEQUENCE: 4 O ggtgacattg tagct cittat cittctitt cag ct catagatg gtggc 45

> SEQ ID NO 41 is LENGTH: 64 TYPE: DNA > ORGANISM: Artificial Sequence FEATURE: > OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide

<4 OOs, SEQUENCE: 41 ggagaa.gcgg atgaagttct cct ttagttc Caagc.cago to Cttggttc. tcc.cgtagag 6 O ggtg 64

> SEQ ID NO 42 is LENGTH: 567 TYPE: DNA > ORGANISM: Artificial Sequence FEATURE: > OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide FEATURE: > NAME/KEY: CDS LOCATION: (1) . . (564)

& 4 OO > SEQUENCE: 42

Cag gac to c acc toa gac Ctg at C CC a gcc CCa cott Ctg agc aag gt C 48 Glin Asp Ser Thir Ser Asp Lell Ile Pro Ala Pro Pro Lell Ser Lys Wall 1. s 10 15 cott Ctg cag cag aac tto Cag gac aac Cala titc Cat 999 aag tgg tat 96 Pro Luell Glin Glin Asn Phe Glin Asp Asn Glin Phe His Gly Trp Tyr 2O 25 gtg gta ggt citc. gca 999 aat gca att citc. aga gaa gac gac cc.g 144 Wall Wall Gly Luell Ala Gly Asn Ala Ile Luell Arg Glu Asp Asp Pro 35 4 O 45

Cala aag atg tat gcc a CC atc. tat gag Ctg a.a.a. gaa gac agc tac 192 Glin Lys Met Ala Thir Ile Glu Luell Lys Asp Ser Tyr SO 55 aat acc to c gtc Ctg titt agg a.a.a. aag aag gac tgg at C 24 O Asn Wall Thir Ser Wall Lell Phe Arg Lys Asp Trp Ile 65 70 7s 8O agg act titt gtt C Ca ggit t cc cag CC a ggc gag tto acg Ctg ggc aac 288 Arg Thir Phe Wall Pro Gly Ser Glin Pro Gly Glu Phe Thir Luell Gly Asn 85 90 95 att aag tac cott gga tta acg tac citc. gtc cga gtg gtg agc 336 Ile Ser Tyr Pro Gly Lell Thir Ser Luell Wall Arg Wall Wall Ser 1OO 105 11 O a CC aac tac aac Cag Cat gct atg gtg ttic titc aag a.a.a. gtt tot Cala 384 Thir Asn Tyr Asn Glin His Ala Met Wall Phe Phe Lys Wall Ser Glin 115 12 O 125 aac agg gag tac tto aag atc. acc citc. tac 999 aga a CC aag gag Ctg 432 Asn Arg Glu Phe Ile Thir Luell Gly Arg Thir Glu Luell 13 O 135 14 O act tog gala Cta aag gag aac ttic at C cgc titc t cc a.a.a. tot Ctg ggc 48O Thir Ser Glu Luell Lys Glu Asn Phe Ile Arg Phe Ser Ser Luell Gly 145 150 155 160 citc. cott gala aac CaC atc. gtc ttic cott gt C CCa atc. gac cag at C 528 Lell Pro Glu Asn His Ile Wall Phe Pro Wall Pro Ile Asp Glin Cys Ile 1.65 17O 17s US 9,051,382 B2 85 - Continued gac ggc agc gct tdg toc cac ccg cag titc gala aaa taa 567 Asp Gly Ser Ala Trp Ser His Pro Glin Phe Glu Lys 18O 185

<210s, SEQ ID NO 43 &211s LENGTH: 188 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 43 Glin Asp Ser Thir Ser Asp Lieu. Ile Pro Ala Pro Pro Lieu. Ser Llys Val 1. 5 1O 15 Pro Leu Gln Glin Asn Phe Glin Asp Asn Glin Phe His Gly Lys Trp Tyr 2O 25 3O Val Val Gly Lieu Ala Gly Asn Ala Ile Lieu. Arg Glu Asp Lys Asp Pro 35 4 O 45 Glin Llys Met Tyr Ala Thir Ile Tyr Glu Lieu Lys Glu Asp Llys Ser Tyr SO 55 6 O Asn Val Thir Ser Val Lieu. Phe Arg Llys Llys Lys Cys Asp Tyr Trp Ile 65 70 7s 8O Arg Thr Phe Val Pro Gly Ser Glin Pro Gly Glu Phe Thr Lieu. Gly Asn 85 90 95

Ile Llys Ser Tyr Pro Gly Lieu. Thir Ser Tyr Lieu Val Arg Val Val Ser 1OO 105 11 O Thr Asn Tyr Asn Gln His Ala Met Val Phe Phe Lys Llys Val Ser Glin 115 12 O 125

Asn Arg Glu Tyr Phe Lys Ile Thr Lieu. Tyr Gly Arg Thr Lys Glu Lieu 13 O 135 14 O

Thir Ser Glu Lieu Lys Glu Asn. Phe Ile Arg Phe Ser Llys Ser Lieu. Gly 145 150 155 160

Lieu Pro Glu Asn His Ile Val Phe Pro Val Pro Ile Asp Glin Cys Ile 1.65 17O 17s Asp Gly Ser Ala Trp Ser His Pro Glin Phe Glu Lys 18O 185

<210s, SEQ ID NO 44 &211s LENGTH: 567 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 44 ttatttitt cq aactgcgggt gggaccalagc gctg.ccgt.cg atacactggit cattgggac 6 O agggaagacg atgtggittitt Cagggaggcc cagagatttg gagaa.gcgga tigaagttctic 12 O ctittagttcc gaa.gc.cagct c cttggttct c cc.gtagagg gtgat cittga agtactic cct 18O gttittgagaa actittcttga agaacaccat agcatgctgg ttgtagttgg togct caccac 24 O tcggacgagg taacticgtta atcCagggta act cittaatgttgcc.ca.gcg talacticgc.c 3OO tggctgggaa cct ggaacaa aagtic ctdat coagtag to a cacttcttitt toctaaa.ca.g 360 gacggaggtg acattgtagc ticttgtct tc titt cagctica tagatggtgg catacat Ctt 42O ttgcgggtct ttgtc.ttct c tdagaattgc attcc ctdcg agacctacca cataccactt 48O US 9,051,382 B2 87 - Continued cc catggaat tttgtc.ct ggaagttctg. Ctgcagaggg accttgctica gaggtggggc 54 O tgggat Cagg totgaggtgg agt cctg 567

<210s, SEQ ID NO 45 &211s LENGTH: 404 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide 22 Os. FEATURE: <221s NAME/KEY: CDS <222s. LOCATION: (2) ... (403) 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (32) ... (34) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (44) (49) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (71) (73) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (80) (82) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (128) (130) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221> NAME/KEY: modified base <222s. LOCATION: (134) (136) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (14 O) (145) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (155) (157) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (161) (163) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (167) (169) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (212) (214) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (224) (226) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (233) ... (235) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (242) (244) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (299) (301) <223> OTHER INFORMATION: a, c, t, g, unknown or other 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (305) (3 O7) <223> OTHER INFORMATION: a, c, t, g, unknown or other US 9,051,382 B2 89 90 - Continued

FEATURE: > NAMEAKEY: modified base > LOCATION: (32O) ... (322) > OTHER INFORMATION: a, c, t, g, unknown or other FEATURE: > NAMEAKEY: modified base > LOCATION: (326) ... (328) > OTHER INFORMATION: a, c, t, g, unknown or other & 4 OO > SEQUENCE: 45 c caa tt C cat ggg aaa tig tat gtc gtg ggc nnn goc gga aat nnn nnn 49 in Phe His Gly Llys Trp Tyr Val Val Gly Xaa Ala Gly Asn. Xaa Xala 5 10 15

Ctg cgt gag gat aag gat CC9 nnn aaa atg nnn gog acc att tac gag 97 Lell Arg Glu Asp Lys Asp Pro Xala Lys Met Xaa Ala Thir Ile Tyr Glu 2O 25 3O ttg aaa gaa gat aaa to a tat aac git c acc nnn gtg nnn titt nnn nnn 145 Lell Lys Glu Asp Llys Ser Tyr Asn Val Thr Xaa Val Xaa Phe Xaa Xala 35 4 O 45 aag aaa to nnn tac nnn att nnn acc titt gtg ccg ggg agc cag cc.g 193 Lys Lys Cys Xaa Tyr Xaa Ile Xaa Thr Phe Val Pro Gly Ser Glin Pro SO 55 6 O ggc gag titt act tta ggc nnn att aaa agt nnn c cq ggc nnn aca to a 241 Gly Glu Phe Thr Lieu. Gly Xaa Ile Llys Ser Xaa Pro Gly Xaa Thr Ser 65 70 7s 8O

ttg gtc. c9c gtc gtg agc acc aac tac aac Cag cat gcc atg gtg 289 Xaa Leu Val Arg Val Val Ser Thr Asn Tyr Asn Gln His Ala Met Val 85 90 95 tto ttic aag nnn gtg nnn cag aac cqc gag nnn titt nnn atc aca citg 337 Phe Phe Lys Xaa Val Xaa Glin ASn Arg Glu Xaa Phe Xaa Ile Thr Lieu 1OO 105 11 O tac ggg cc acg aaa gala Ctg aca agc gag ctgaag gala aat titt at C 385 Gly Arg Thir Lys Glu Lieu. Thir Ser Glu Lieu Lys Glu Asn. Phe Ile 115 12 O 125 cgc ttt to c aaa tot ctd g 4O4. Arg Phe Ser Lys Ser Lieu 13 O

> SEQ ID NO 46 is LENGTH: 134 TYPE PRT > ORGANISM: Artificial Sequence FEATURE: > OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide FEATURE: NAME/KEY: MOD RES LOCATION: (11) . . (11) OTH INFOR A. ON: Any amino acid FEA : KEY: MOD RES O C ION: (15) . . (15) NFORMATION: Any amino acid E A.: R KEY: MOD RES ION: (16) ... (16) : O A. ON: Any amino acid E O RES ION: (24) . . (24) o o i. NFORMATION: Any amino acid E A.: K EY O D RES ION: (27) . . (27) NFORMATION: Any amino acid

K EY O D RES C ION: (43) . . (43) NFORMATION: Any amino acid US 9,051,382 B2 91 - Continued

22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (45) ... (45) <223> OTHER INFORMATION: Any amino acid 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (47) ... (47) <223> OTHER INFORMATION: Any amino acid 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (48) ... (48) <223> OTHER INFORMATION: Any amino acid 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (52) ... (52) <223> OTHER INFORMATION: Any amino acid 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (54) . . (54) <223> OTHER INFORMATION: Any amino acid 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (56) . . (56) <223> OTHER INFORMATION: Any amino acid 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (71) . . (71) <223> OTHER INFORMATION: Any amino acid 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (75) . . (75) <223> OTHER INFORMATION: Any amino acid 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (78) . . (78) <223> OTHER INFORMATION: Any amino acid & 22 O FEATURE; <221s NAME/KEY: MOD RES <222s. LOCATION: (81) . . (81) <223> OTHER INFORMATION: Any amino acid 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (100) ... (100) <223> OTHER INFORMATION: Any amino acid 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (102) ... (102) <223> OTHER INFORMATION: Any amino acid 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (107) . . (107) <223> OTHER INFORMATION: Any amino acid 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (109) . . (109) <223> OTHER INFORMATION: Any amino acid <4 OOs, SEQUENCE: 46 Glin Phe His Gly Llys Trp Tyr Val Val Gly Xaa Ala Gly Asn. Xaa Xala 1. 5 1O 15 Lieu. Arg Glu Asp Lys Asp Pro Xala Lys Met Xaa Ala Thir Ile Tyr Glu 2O 25 3O

Lieu Lys Glu Asp Llys Ser Tyr Asn Val Thr Xaa Val Xaa Phe Xaa Xala 35 4 O 45

Lys Lys Cys Xaa Tyr Xaa Ile Xaa Thr Phe Val Pro Gly Ser Glin Pro SO 55 6 O

Gly Glu Phe Thr Lieu. Gly Xaa Ile Llys Ser Xaa Pro Gly Xaa Thr Ser 65 70 7s 8O

Xaa Lieu Val Arg Val Val Ser Thr Asn Tyr Asn Gln His Ala Met Val 85 90 95

Phe Phe Lys Xaa Val Xaa Glin Asn Arg Glu Xaa Phe Xaa Ile Thr Lieu. 1OO 105 11 O US 9,051,382 B2 93 - Continued

Tyr Gly Arg Thir Lys Glu Lieu. Thir Ser Glu Lieu Lys Glu Asn. Phe Ile 115 12 O 125

Arg Phe Ser Lys Ser Lieu. 13 O

<210s, SEQ ID NO 47 &211s LENGTH: 404 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide

<4 OOs, SEQUENCE: 47 ccagagattt ggaaaag.cgg ataaaattitt cott cagctic gcttgtcagt tottt cqtgc 6 O gcc.cgtacag ttgat Ctta aagtact.cgc ggttctggga cactitt Cttg aagaacacca 12 O tggcatgctg gttgtagttg gtgct cacga cqcggaccala gitatgatgtc. aggc.ccgggt 18O aacttittaat gttgcctaaa gtaaacticgc ccggctggct ccc.cggcaca alaggtacgaa 24 O tccagtag to goatttcttt ttgcgaaaca acacggaggit gacgittatat gattitat citt 3OO

Ctttcaactic gtaaatgg to goatacattt totg.cggat.c ctitat cotca cqcagaatgg 360 catttic cqgc caggcc cacg acataccatt toccatggaa ttgg 4O4.

<210s, SEQ ID NO 48 &211s LENGTH: 197 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide

<4 OOs, SEQUENCE: 48 Met Ala Ser Met Thr Gly Gly Glin Gln Met Gly Glin Asp Ser Thr Ser 1. 5 1O 15

Asp Lieu. Ile Pro Ala Pro Pro Lieu. Ser Llys Val Pro Lieu. Glin Glin Asn 2O 25 3O Phe Glin Asp Asin Glin Phe His Gly Lys Trp Tyr Val Val Gly Lieu Ala 35 4 O 45

Gly Asn Ala Ile Lieu. Arg Glu Asp Lys Asp Pro Glin Llys Met Tyr Ala SO 55 6 O

Thir Ile Tyr Glu Lieu Lys Glu Asp Llys Ser Tyr Asn Val Thr Ser Val 65 70 7s 8O

Lieu. Phe Arg Llys Llys Lys Cys Asp Tyr Trp Ile Arg Thr Phe Val Pro 85 90 95

Gly Ser Glin Pro Gly Glu Phe Thr Lieu. Gly Asn Ile Llys Ser Tyr Pro 1OO 105 11 O

Gly Lieu. Thir Ser Tyr Lieu Val Arg Val Val Ser Thr Asn Tyr Asn Glin 115 12 O 125

His Ala Met Val Phe Phe Lys Llys Val Ser Glin Asn Arg Glu Tyr Phe 13 O 135 14 O

Lys Ile Thr Lieu. Tyr Gly Arg Thr Lys Glu Lieu. Thir Ser Glu Lieu Lys 145 150 155 160

Glu Asn. Phe Ile Arg Phe Ser Lys Ser Lieu. Gly Lieu Pro Glu Asn His 1.65 17O 17s US 9,051,382 B2 95 96 - Continued Ile Val Phe Pro Val Pro Ile Asp Glin Cys Ile Asp Gly Ser Ala Trp 18O 185 19 O

Ser His Pro Glin Phe 195

The invention claimed is: Phe, Valor Arg; Lys 125->Arg, Leu, Met, Phe, Thr, or Val; Ser 1. A lipocalin mutein that is capable of binding hepcidin 10 127->Thr or Trp: Tyr 132->Leu or Val; and Lys 134->Trp. with an affinity by a K, of about 10 nM or lower, wherein the 7. The lipocalin mutein according to claim 1, comprising lipocalin mutein comprises: one of the following sets of amino acid combinations: (i) a set of mutated amino acid residues at the sequence (a) Leu36, Glu 40, Val 41; Met 49; Trp 52, Ile 68, Met 70, positions 96, 100, and/or 106 of the linear polypeptide 15 Leu72, Ala73, Glu 77, Leu79; Gln 81, Asp96, Ser 100, sequence of mature human neutrophil gelatinase-asso Arg 103, Gly 106, Thr 125, Trp 127, Val 132, Trp 134; ciated lipocalin (hNGAL), selected from the group con sisting of (a) Asn 96->Val, Tyr 100->Gln, and Tyr (b) Leu36, Glu 40, Val 41, Met 49, Trp 52, Ile 68, Met 70; 106->unchanged, (b) Asn 96->Arg, Tyr 100->Glu, and Leu72, Ala73, Glu 77, Leu79, Gln 81, Gly96, Gly 100, Tyr 106->Phe, (c) Asn 96->Asp, Tyr 100->Ser, and Tyr Arg 103, Gly 106, Val 125, Trp 127, Val 132, Trp 134; 106->Gly, (d) Asn 96->Gly, Tyr 100->Gly, and Tyr (c) Leu36, Glu 40, Val 41, Met 49, Trp 52, Ile 68, Met 70, 106->Gly, (e) Asn 96->Lys, Tyr 100->Ala, and Tyr Leu72, Ala73, Glu 77, Leu79; Gln 81, Asp96, Ser 100, 106->Ile, (f) Asn 96->Ser, Tyr 100->Arg, and Tyr Arg 103, Gly 106, Val 125, Trp 127, Val 132, Trp 134; 106->Val, (g) Asn 96->Ser, Tyr 100->Val, and Tyr (d) Leu36, Glu 40, Ile 41, Met 49, Trp 52, Ile 68, Met 70, 106->Arg, and (h) Asn 96->Thr, Tyr 100->Val, and Tyr Leu72, Ala73, Glu 77; Leu79; Gln 81, Asp96, Ser 100, 106->Gly; and 25 Arg 103, Gly 106, Val 125, Trp 127, Val 132, Trp 134; (ii) at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, (e) Leu36, Glu 40, Ile 41, Met 49, Trp 52, Ile 68, Met 70, or 17 mutated amino acid residues at any of the sequence Leu72, Ala73, Glu 77, Leu79, Gln 81, Asp96, Ser 100, positions corresponding to the sequence positions 36, Arg 103, Gly 106, Val 125, Trp 127, Val 132, Trp 134; 40, 41, 49, 52, 68, 70, 72, 73,77, 79, 81, 103,125, 127, and 132, and 134 of the linear polypeptide sequence of 30 (f) Leu36, Glu 40, Val 41, Met 49, Trp 52, Ile 68, Met 70, mature hNGAL. Leu72, Ala73, Glu 77, Leu79, Gln 81, Asp96, Ser 100, 2. The lipocalin mutein according to claim 1, with an IC50 Arg 103, Gly 106, Val 125, Trp 127, Val 132, Trp 134. value of about 80 nM or lower as determined by a cell-based 8. The lipocalin mutein according to claim 1, wherein the assay for hepcidin-induced internalization and degradation of lipocalin mutein further comprises, with respect to the amino ferroportin. 35 acid sequence of mature hNGAL, one or more amino acid 3. The lipocalin mutein according to claim 1, wherein the replacements selected from the group consisting of Gln lipocalin mutein binds a mature human hepcidin defined by a 28->His: Lys 59->Glu; Lys 62->Arg: Phe 71->Pro or Ser; K of 10 nM or lower. Lys 74->Glu; Lys 75->Glu: Ile 80->Phe: Cys 87->Ser: Ile 4. The lipocalin mutein according to claim 1, which is 135->Val; Ser 146->Pro and Glu 147->Gly. capable of neutralizing the bioactivity of human hepcidin-25 40 9. The lipocalin mutein according to claim 1, wherein the and/or preventing human hepcidin-25 induced reduction of lipocalin mutein is conjugated to a compound selected from serum iron levels in a human. the group consisting of an organic molecule, an enzyme label, 5. The lipocalin mutein according to claim 1, wherein the a radioactive label, a colored label, a fluorescent label, a lipocalin mutein comprises a mutated amino acid residue at chromogenic label, a luminescent label, a hapten, digoxige any one or more of the sequence positions corresponding to 45 nin, biotin, a cytostatic agent, a toxin, a metal complex, a the sequence positions 52, 68, 81, 127 and 134 of the linear metal, and colloidal gold. polypeptide sequence of mature hNGAL. 10. The lipocalin mutein according to claim 1, wherein the 6. The lipocalin mutein according to claim 1, wherein the lipocalin mutein is fused at its N-terminus and/or its C-termi lipocalin mutein comprises within the linear polypeptide nus to a fusion partner which is a protein, or a protein domain sequence of mature hNGAL one or more of the following 50 or a peptide. substitutions: Leu 36->Ala, Cys, Thr or Val; Ala 40->Arg, 11. The lipocalin mutein according to claim 1, wherein the Glu, Gly or Ser: Ile 41->Ile, Leu, Metor Val; Gln 49->Leu or lipocalin mutein is conjugated to a compound that extends the Met: Tyr 52->His, Leu, Phe or Trp; Ser68->Arg, Gly, or Ile: serum half-life of the lipocalin mutein. Leu 70->Asp, ASn, Gln, Met or Phe: Arg 72->Glu, Gly, Leu 12. A nucleic acid molecule comprising a nucleotide or Val; Lys73->Ala, Arg, Glu, Gly, Leu, Thr or Tyr; Asp 55 sequence encoding the lipocalin mutein according to claim 1. 77->Arg, Glu, Gly, Leu, Ser or Val; Trp 79->Gly, Leu, Ser, 13. A pharmaceutical composition comprising a lipocalin Tyror Val; Arg81->Glu, Gly, or Gln: Asn 96->Arg, Asp, Gln, mutein according to claim 1 and a pharmaceutically accept Gly, Lys, Ser. Thr or Val; Tyr 100->Ala, Arg, Glu, Gln, Gly, able excipient. Seror Val; Leu103->Ala, Arg, Gly or Trp;Tyr 106->Ile, Gly,