DOCSLIB.ORG

Lung Microbiota Predict Invasive Pulmonary Aspergillosis and Its Outcome in Immunocompromised Patients

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Lung Microbiota Predict Invasive Pulmonary Aspergillosis and Its Outcome in Immunocompromised Patients Respiratory infection Original research Thorax: first published as 10.1136/thoraxjnl-2020-216179 on 25 June 2021. Downloaded from Lung microbiota predict invasive pulmonary aspergillosis and its outcome in immunocompromised patients Anaïs Hérivaux,1,2 Jesse R Willis,3,4 Toine Mercier,5,6 Katrien Lagrou,6,7 Samuel M Gonçalves,1,2 Relber A Gonçales,1,2 Johan Maertens,5,6 Agostinho Carvalho,1,2 Toni Gabaldón,3,4,8 Cristina Cunha 1,2 ► Additional supplemental ABStract material is published online Rationale Recent studies have revealed that the lung Key messages only. To view, please visit the journal online (http:// dx. doi. microbiota of critically ill patients is altered and predicts org/ 10. 1136/ thoraxjnl- 2020- clinical outcomes. The incidence of invasive fungal What is the key question? 216179). infections, namely, invasive pulmonary aspergillosis ► Does the lung microbiota modulate (IPA), in immunocompromised patients is increasing, but susceptibility to invasive pulmonary For numbered affiliations see the clinical significance of variations in lung bacterial aspergillosis (IPA) and predict its clinical end of article. communities is unknown. outcome? Objectives To define the contribution of the lung Correspondence to What is the bottom line? microbiota to the development and course of IPA. Dr Cristina Cunha, Life and ► We show that variation in the lung microbiota Health Sciences Research Methods and measurements We performed an is associated with the development of IPA in Institute (ICVS), University observational cohort study to characterise the lung critically ill patients. Patients with IPA display of Minho, Braga 4710-057, microbiota in 104 immunocompromised patients using Portugal; a microbiota signature in the lower airways bacterial 16S ribosomal RNA gene sequencing on cristinacunha@ med. uminho. characterised by a decreased bacterial diversity bronchoalveolar lavage samples sampled on clinical pt and Dr Toni Gabaldón, that predicts clinical outcomes after infection. Comparative Genomics Group, suspicion of infection. Associations between lung Moreover, we describe associations between Barcelona Supercomputing dysbiosis in IPA and pulmonary immunity were evaluated Centre (BSC-CNS), 08034 lung dysbiosis in IPA and pulmonary antifungal by quantifying alveolar cytokines and chemokines and Barcelona, Spain; immunity, including alveolar cytokines and immune cells. The contribution of microbial signatures toni. gabaldon. bcn@ gmail. com chemokines and neutrophil counts. to patient outcome was assessed by estimating overall http://thorax.bmj.com/ AH and JRW contributed survival. Why read on? equally. Main results Patients diagnosed with IPA displayed ► Recent studies have unveiled alterations in the a decreased alpha diversity, driven by a markedly lung microbiota of critically ill patients, which TG and CC are joint senior increased abundance of the Staphylococcus, Escherichia, were associated with alveolar and systemic authors. Paraclostridium and Finegoldia genera and a decreased inflammation to predict disease outcomes. IPA Received 9 September 2020 proportion of the Prevotella and Veillonella genera. is frequently observed in critically ill patients. Accepted 26 May 2021 The overall composition of the lung microbiome was However, no study to date has determined influenced by the neutrophil counts and associated with whether the lung microbiota is altered in on September 27, 2021 by guest. Protected copyright. differential levels of alveolar cytokines. Importantly, the patients with IPA or predict clinical outcomes degree of bacterial diversity at the onset of IPA predicted after infection. the survival of infected patients. Conclusions Our results reveal the lung microbiota as an understudied source of clinical variation in patients at predictive of disease outcomes across numerous risk of IPA and highlight its potential as a diagnostic and chronic respiratory diseases. For example, the diver- therapeutic target in the context of respiratory fungal sity of sputum microbiota predicts exacerbations in diseases. bronchiectasis,6 disease progression and lung func- tion decline in cystic fibrosis (CF)7 and mortality after acute exacerbations of chronic obstructive © Author(s) (or their pulmonary disease (COPD).8 employer(s)) 2021. Re- use INTRODUCTION Although lung dysbiosis is established as a major permitted under CC BY- NC. No In the past decade, advances in molecular methods trigger of exacerbations in inflammatory airway commercial re- use. See rights and permissions. Published for the quantification and sequencing of bacterial diseases, only a few studies have addressed the by BMJ. DNA have revealed that the lungs, previously consid- mechanisms whereby specific bacterial commu- ered sterile, instead harbour complex and dynamic nities contribute to disease severity. Nonetheless, To cite: Hérivaux A, Willis JR, communities of bacteria.1 The lung microbiome is mounting evidence supports a key contribution of Mercier T, et al. Thorax Epub 2 ahead of print: [please known to diverge significantly across healthy and the lung microbiota to the activation and regula- 3 4 include Day Month Year]. diseased states and is associated with variations tion of lung immunity. For instance, the dysbiosis in doi:10.1136/ in both alveolar and systemic immunity.5 The struc- the lower respiratory tract of patients with COPD thoraxjnl-2020-216179 ture and composition of the lung microbiome are revealed an expansion of streptococcal genera that, Hérivaux A, et al. Thorax 2021;0:1–9. doi:10.1136/thoraxjnl-2020-216179 1 Respiratory infection by suppressing the antimicrobial peptide cathelicidin, impaired patients were randomly selected from the patients indicated for Thorax: first published as 10.1136/thoraxjnl-2020-216179 on 25 June 2021. Downloaded from the pulmonary clearance of bacteria.4 Moreover, the disruption bronchoscopy at around the same time as the cases of IPA to of the lung microbiota in patients with idiopathic pulmonary obtain a 1:1 case–control ratio. Patients with ‘possible’ disease fibrosis was described to promote increased levels of alveolar were excluded from the study, and no mold-active antifungals profibrotic cytokines underlying local inflammation and aber- were administered by the treating physician(s) before sample rant repair to drive disease progression.9 collection. This study was approved by the Ethics Committee for The lung microbiome of critically ill patients also differs Research in Life and Health Sciences of the University of Minho, profoundly from that of healthy individuals10–12 and is associ- Portugal, and the Ethics Committee of the University Hospitals ated with alveolar inflammation and injury.10 11 Such features of Leuven, Belgium (IRB number 126/014). Written informed of lung dysbiosis were found to predict the clinical outcome consent was obtained from the patient or a representative prior of patients with sepsis and acute respiratory distress syndrome to collection of airway samples. Additional details, including (ARDS).13 14 A history of smoking was related to the composi- tion of the lung microbiome in intensive care patients, and devel- opment of ARDS was associated with a respiratory microbial Table 1 Demographics and clinical characteristics of the study cohort community structure characterised by a relative enrichment of taxa more abundant in smokers at baseline.11 Collectively, these Variables IPA Controls P value observations highlight the composition of the lung microbiome (n=54) (n=50) as a key factor involved in the development of complications in Age, mean±SD 63.6±12.6 60.9±13.1 0.26 the intensive care setting. Man, no (%) 34 (63) 35 (70) 0.53 Owing to advances in critical care medicine and the intro- Underlying disease, no (%)* duction of broad- spectrum antibiotics, the incidence of inva- sive fungal infections in critical care is on the rise, namely, Acute leukaemia 16 (29.6) 14 (28) 0.08 among haematological patients under chemotherapy or patients Allogeneic HSCT 10 (18.5) 16 (32) undergoing solid organ or allogeneic haematopoietic stem- Chronic lymphoproliferative 8 (14.8) 10 (20) cell transplantation (HSCT).15 In particular, invasive pulmo- diseases nary aspergillosis (IPA) remains a major cause of mortality in SOT 5 (9.3) 4 (8) these clinical settings with rates estimated between 20% and Influenza A (H1N1) 8 (14.8) 0 (0) 30%16 17 and more than 80% when involving cases of infection with azole- resistant strains.18 The relevance of these numbers Solid tumours 2 (3.7) 4 (8) is further highlighted by the lack of any licensed vaccine and Liver cirrhosis 3 (5.6) 2 (4) limitations in currently available tests for the diagnosis of IPA. COPD 2 (3.7) 0 (0) An improved understanding of the pathogenesis of IPA is there- ICU admission 28 (51.9) 12 (24) 0.009 fore required for the development of more effective diagnostic or control measures for this infection. Mechanical ventilation 18 (33.3) 5 (10) 0.005 Although the importance of the lung microbiome has already Severe neutropenia, no (%)† 20 (37) 11 (22) 0.13 http://thorax.bmj.com/ 19 20 been put forward in the context of IPA, no study to date has BAL cell counts, mean (range)‡ determined whether the lung microbiota is altered in patients Neutrophils 4.9 (0–30.3) 4.0 (0–24.6) 0.28 with IPA and whether it predicts clinical outcomes after infec- Lymphocytes 4.0 (0–175.7) 1.3 (0.1–17.4) 0.004 tion. In light of these observations, we hypothesised that varia- tion in the lung microbiota is a relevant factor contributing to the CMV IgG serostatus development of IPA and its outcome in immunocompromised Positive 18 (33.3) 20 (40) 0.80 patients. We report that the dysbiosis of the lung microbiota Negative 14 (25.9) 12 (24) in immunocompromised patients is associated with the devel- on September 27, 2021 by guest. Protected copyright. Unknown 22 (40.7) 18 (36) opment of IPA and that a decreased bacterial diversity in IPA predicts poorer outcomes. Moreover, we describe associations Immunosuppression, no (%) between lung dysbiosis and pulmonary immunity, as revealed by Steroids 25 (46.3) 14 (28) 0.06 the differential effects on the levels of alveolar cytokines and the Other immunosuppressive 4 (7.4) 10 (20) number of neutrophils.
Load more

Recommended publications
  • Gut Microbiota Differs in Composition and Functionality Between Children
    Diabetes Care Volume 41, November 2018 2385 Gut Microbiota Differs in Isabel Leiva-Gea,1 Lidia Sanchez-Alcoholado,´ 2 Composition and Functionality Beatriz Mart´ın-Tejedor,1 Daniel Castellano-Castillo,2,3 Between Children With Type 1 Isabel Moreno-Indias,2,3 Antonio Urda-Cardona,1 Diabetes and MODY2 and Healthy Francisco J. Tinahones,2,3 Jose´ Carlos Fernandez-Garc´ ´ıa,2,3 and Control Subjects: A Case-Control Mar´ıa Isabel Queipo-Ortuno~ 2,3 Study Diabetes Care 2018;41:2385–2395 | https://doi.org/10.2337/dc18-0253 OBJECTIVE Type 1 diabetes is associated with compositional differences in gut microbiota. To date, no microbiome studies have been performed in maturity-onset diabetes of the young 2 (MODY2), a monogenic cause of diabetes. Gut microbiota of type 1 diabetes, MODY2, and healthy control subjects was compared. PATHOPHYSIOLOGY/COMPLICATIONS RESEARCH DESIGN AND METHODS This was a case-control study in 15 children with type 1 diabetes, 15 children with MODY2, and 13 healthy children. Metabolic control and potential factors mod- ifying gut microbiota were controlled. Microbiome composition was determined by 16S rRNA pyrosequencing. 1Pediatric Endocrinology, Hospital Materno- Infantil, Malaga,´ Spain RESULTS 2Clinical Management Unit of Endocrinology and Compared with healthy control subjects, type 1 diabetes was associated with a Nutrition, Laboratory of the Biomedical Research significantly lower microbiota diversity, a significantly higher relative abundance of Institute of Malaga,´ Virgen de la Victoria Uni- Bacteroides Ruminococcus Veillonella Blautia Streptococcus versityHospital,Universidad de Malaga,M´ alaga,´ , , , , and genera, and a Spain lower relative abundance of Bifidobacterium, Roseburia, Faecalibacterium, and 3Centro de Investigacion´ BiomedicaenRed(CIBER)´ Lachnospira.
    [Show full text]
  • Fecal Microbiome Signatures of Pancreatic Cancer Patients
    www.nature.com/scientificreports OPEN Fecal microbiome signatures of pancreatic cancer patients Elizabeth Half1,8,9, Nirit Keren2,8, Leah Reshef2, Tatiana Dorfman3, Ishai Lachter1, Yoram Kluger3, Naama Reshef4, Hilla Knobler4, Yaakov Maor5, Assaf Stein6, Fred M. Konikof6,7 & Uri Gophna 2* Pancreatic cancer (PC) is a leading cause of cancer-related death in developed countries, and since most patients have incurable disease at the time of diagnosis, developing a screening method for early detection is of high priority. Due to its metabolic importance, alterations in pancreatic functions may afect the composition of the gut microbiota, potentially yielding biomarkers for PC. However, the usefulness of these biomarkers may be limited if they are specifc for advanced stages of disease, which may involve comorbidities such as biliary obstruction or diabetes. In this study we analyzed the fecal microbiota of 30 patients with pancreatic adenocarcinoma, 6 patients with pre-cancerous lesions, 13 healthy subjects and 16 with non-alcoholic fatty liver disease, using amplicon sequencing of the bacterial 16S rRNA gene. Fourteen bacterial features discriminated between PC and controls, and several were shared with fndings from a recent Chinese cohort. A Random Forest model based on the microbiota classifed PC and control samples with an AUC of 82.5%. However, inter-subject variability was high, and only a small part of the PC-associated microbial signals were also observed in patients with pre-cancerous pancreatic lesions, implying that microbiome-based early detection of such lesions will be challenging. Pancreatic cancer (PC) is the 4th and 5th leading cause of cancer-related death in the USA and the EU, respec- tively1,2.
    [Show full text]
  • Phylogenomic Analysis Supports the Ancestral Presence of LPS-Outer Membranes in the Firmicutes
    Phylogenomic analysis supports the ancestral presence of LPS-outer membranes in the Firmicutes. Luisa Cs Antunes, Daniel Poppleton, Andreas Klingl, Alexis Criscuolo, Bruno Dupuy, Céline Brochier-Armanet, Christophe Beloin, Simonetta Gribaldo To cite this version: Luisa Cs Antunes, Daniel Poppleton, Andreas Klingl, Alexis Criscuolo, Bruno Dupuy, et al.. Phy- logenomic analysis supports the ancestral presence of LPS-outer membranes in the Firmicutes.. eLife, eLife Sciences Publication, 2016, 5, pp.e14589. 10.7554/eLife.14589.020. pasteur-01362343 HAL Id: pasteur-01362343 https://hal-pasteur.archives-ouvertes.fr/pasteur-01362343 Submitted on 8 Sep 2016 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License RESEARCH ARTICLE Phylogenomic analysis supports the ancestral presence of LPS-outer membranes in the Firmicutes Luisa CS Antunes1†, Daniel Poppleton1†, Andreas Klingl2, Alexis Criscuolo3, Bruno Dupuy4, Ce´ line Brochier-Armanet5, Christophe Beloin6, Simonetta Gribaldo1* 1Unite´ de
    [Show full text]
  • MICRO-ORGANISMS and RUMINANT DIGESTION: STATE of KNOWLEDGE, TRENDS and FUTURE PROSPECTS Chris Mcsweeney1 and Rod Mackie2
    BACKGROUND STUDY PAPER NO. 61 September 2012 E Organización Food and Organisation des Продовольственная и cельскохозяйственная de las Agriculture Nations Unies Naciones Unidas Organization pour организация para la of the l'alimentation Объединенных Alimentación y la United Nations et l'agriculture Наций Agricultura COMMISSION ON GENETIC RESOURCES FOR FOOD AND AGRICULTURE MICRO-ORGANISMS AND RUMINANT DIGESTION: STATE OF KNOWLEDGE, TRENDS AND FUTURE PROSPECTS Chris McSweeney1 and Rod Mackie2 The content of this document is entirely the responsibility of the authors, and does not necessarily represent the views of the FAO or its Members. 1 Commonwealth Scientific and Industrial Research Organisation, Livestock Industries, 306 Carmody Road, St Lucia Qld 4067, Australia. 2 University of Illinois, Urbana, Illinois, United States of America. This document is printed in limited numbers to minimize the environmental impact of FAO's processes and contribute to climate neutrality. Delegates and observers are kindly requested to bring their copies to meetings and to avoid asking for additional copies. Most FAO meeting documents are available on the Internet at www.fao.org ME992 BACKGROUND STUDY PAPER NO.61 2 Table of Contents Pages I EXECUTIVE SUMMARY .............................................................................................. 5 II INTRODUCTION ............................................................................................................ 7 Scope of the Study ...........................................................................................................
    [Show full text]
  • Type of the Paper (Article
    Supplementary Materials S1 Clinical details recorded, Sampling, DNA Extraction of Microbial DNA, 16S rRNA gene sequencing, Bioinformatic pipeline, Quantitative Polymerase Chain Reaction Clinical details recorded In addition to the microbial specimen, the following clinical features were also recorded for each patient: age, gender, infection type (primary or secondary, meaning initial or revision treatment), pain, tenderness to percussion, sinus tract and size of the periapical radiolucency, to determine the correlation between these features and microbial findings (Table 1). Prevalence of all clinical signs and symptoms (except periapical lesion size) were recorded on a binary scale [0 = absent, 1 = present], while the size of the radiolucency was measured in millimetres by two endodontic specialists on two- dimensional periapical radiographs (Planmeca Romexis, Coventry, UK). Sampling After anaesthesia, the tooth to be treated was isolated with a rubber dam (UnoDent, Essex, UK), and field decontamination was carried out before and after access opening, according to an established protocol, and shown to eliminate contaminating DNA (Data not shown). An access cavity was cut with a sterile bur under sterile saline irrigation (0.9% NaCl, Mölnlycke Health Care, Göteborg, Sweden), with contamination control samples taken. Root canal patency was assessed with a sterile K-file (Dentsply-Sirona, Ballaigues, Switzerland). For non-culture-based analysis, clinical samples were collected by inserting two paper points size 15 (Dentsply Sirona, USA) into the root canal. Each paper point was retained in the canal for 1 min with careful agitation, then was transferred to −80ºC storage immediately before further analysis. Cases of secondary endodontic treatment were sampled using the same protocol, with the exception that specimens were collected after removal of the coronal gutta-percha with Gates Glidden drills (Dentsply-Sirona, Switzerland).
    [Show full text]
  • Tenebrio Molitor Larvae Meal Affects the Cecal Microbiota of Growing Pigs
    Tenebrio Molitor Larvae Meal Affects the Cecal Microbiota of Growing Pigs Sandra Meyer, Denise K. Gessner, Garima Maheshwari, Julia Röhrig, Theresa Friedhoff, Erika Most, Holger Zorn, Robert Ringseis and Klaus Eder Table S1. Characteristics of gene-specific primers used for qPCR analysis in small intestinal mucosa. Annealing PCR Forward (5` to 3`) NCBI GeneBank Gene Temperature Product Slope R2 E Reverse (5` to 3`) Accession No. (°C) Size (bp) Reference genes CAGTCACCTTGAGCCGGGCGA ATP5MC1 64 94 NM_001025218 -3.55 0.999 1.91 TAGCGCCCCGGTGGTTTGC AGGGGCTCTCCAGAACATCATCC GAPDH 60 446 NM_001206359 -3.33 1.000 2.00 TCGCGTGCTCTTGCTGGGGTTGG GTCGCAAGACTTATGTGACC RPS9 62 325 XM_021094878 -3.28 0.999 2.02 AGCTTAAAGACCTGGGTCTG CTACGCCCCCGTCGCAAAGG SDHA 64 380 XM_021076930 -3.32 1.000 2.00 AGTTTGCCCCCAGGCGGTTG Target genes GATCGGCTCCATCGTCAGCA CLDN1 60 115 NM_001244539 -3.54 0.994 1.92 CGACACGCAGGACATCCACA ACTTCCAAACTGGCTGTTGC CXCL8 59 120 NM_213867 -3.59 0.994 1.90 GGAATGCGTATTTATGCACTGG GTTCTCTGAGAAATGGGAGC IL1B 58 143 NM_214055 -3.51 0.997 1.93 CTGGTCATCATCACAGAAGG AAGGTGATGCCACCTCAGAC IL6 60 151 NM_001252429 -3.54 0.994 1.92 TCTGCCAGTACCTCCTTGCT MUC1 CGGGCTTCTGGGACTCTTTT 58 312 XM_021089728 -3.63 0.999 1.89 1 TTCTTTCGTCGGCACTGACA TGTGTTTTGCTTTGGGTCCAG MUC13 58 171 NM_001105293 -3.58 1.000 1.90 CACAGCCAACTCCACTGTAGC CTTCCAACCATCCTCCCACC MUC2 58 174 XM_021082584 -3.53 0.996 1.92 GCCGTCTTGAAATCATCGCC GCCTACTCGTCCAACGGGAA OCLN 60 246 NM_001163647 -3.60 0.999 1.90 GCCCGTCGTGTAGTCTGTCT CAGACTTCGACCACAACGGA SLC15A1 58 99 NM_214347 -3.52 0.998 1.93 TTATCCCGCCAGTACCCAGA CGCAACCATTGGAGTTGGCGC SLC2A2 63 122 NM_001097417 -3.37 0.997 1.98 TGGCACAAACAAACATCCCACTCA CTGACACTGGTGCTTGCTTT SLC2A5 57 156 XM_021095282 -3.45 0.989 1.95 TTCGCTCATGTATTCCCCGA GTGGCGGACAGTAGTGAACA SLC5A1 57 89 NM_001164021 -3.31 1.000 1.92 AGAAGGCAGGATTTCAGGCA GTCGTCCTGATCCTGACCCG TJP1 60 207 XM_021098827 -3.26 0.996 2.03 TGGTGGGTTTGGTGGGTTGA CCAAGGACTCAGATCATCGT TNF 58 146 NM_214022 -3.36 1.000 1.99 GCTGGTTGTCTTTCAGCTTC Table S2.
    [Show full text]
  • Clinical and Genomic Characterization of Two Vaginal Megasphaera Species
    Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2015 Clinical and Genomic Characterization of Two Vaginal Megasphaera Species Abigail L. Glascock Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Bioinformatics Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/4033 This Thesis is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. i CLINICAL AND GENOMIC CHARACTERIZATION OF VAGINAL MEGASPHAERA SPECIES A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at Virginia Commonwealth University. by ABIGAIL LEIGH GLASCOCK Bachelor of Science, James Madison University, 2010 Director: JENNIFER M. FETTWEIS, PH.D. ASSISTANT PROFESSOR, CENTER FOR THE STUDY OF BIOLOGICAL COMPLEXITY, DEPARTMENT OF OBSTETRICS AND GYNECOLOGY, SCHOOL OF MEDICINE Virginia Commonwealth University Richmond, Virginia December 2015 ii © Abigail Leigh Glascock, 2015 All Rights Reserved iii Acknowledgment First and foremost, I would like to extend my sincerest gratitude to my advisor, Dr. Jennifer M. Fettweis. Dr. Fettweis has served as a dedicated and caring mentor to me since I first arrived at VCU in 2010 as a laboratory technician. She has sacrificed countless hours of her time and spent many late nights in the lab discussing my research, reviewing my writing, scientific posters and presentations, and guiding me towards a successful and fulfilling science career. She has been supportive and proactive every step of the way in helping me to become a better scientist.
    [Show full text]
  • Altered Diversity and Composition of Gut Microbiota in Wilson's Disease
    www.nature.com/scientificreports OPEN Altered diversity and composition of gut microbiota in Wilson’s disease Xiangsheng Cai1,2,3,9*, Lin Deng4,9, Xiaogui Ma1,9, Yusheng Guo2, Zhiting Feng5, Minqi Liu2, Yubin Guan1, Yanting Huang1, Jianxin Deng6, Hongwei Li7, Hong Sang8, Fang Liu7* & Xiaorong Yang1* Wilson’s disease (WD) is an autosomal recessive inherited disorder of chronic copper toxicosis with high mortality and disability. Recent evidence suggests a correlation between dysbiosis in gut microbiome and multiple diseases such as genetic and metabolic disease. However, the impact of intestinal microbiota polymorphism in WD have not been fully elaborated and need to be explore for seeking some microbiota beneft for WD patients. In this study, the 16S rRNA sequencing was performed on fecal samples from 14 patients with WD and was compared to the results from 16 healthy individuals. The diversity and composition of the gut microbiome in the WD group were signifcantly lower than those in healthy individuals. The WD group presented unique richness of Gemellaceae, Pseudomonadaceae and Spirochaetaceae at family level, which were hardly detected in healthy controls. The WD group had a markedly lower abundance of Actinobacteria, Firmicutes and Verrucomicrobia, and a higher abundance of Bacteroidetes, Proteobacteria, Cyanobacteria and Fusobacteria than that in healthy individuals. The Firmicutes to Bacteroidetes ratio in the WD group was signifcantly lower than that of healthy control. In addition, the functional profle of the gut microbiome from WD patients showed a lower abundance of bacterial groups involved in the host immune and metabolism associated systems pathways such as transcription factors and ABC-type transporters, compared to healthy individuals.
    [Show full text]
  • Phylogenetic Distribution of Three Pathways for Propionate Production Within the Human Gut Microbiota
    The ISME Journal (2014) 8, 1323–1335 & 2014 International Society for Microbial Ecology All rights reserved 1751-7362/14 www.nature.com/ismej ORIGINAL ARTICLE Phylogenetic distribution of three pathways for propionate production within the human gut microbiota This article has been corrected since Advance Online Publication and a corrigendum is also printed in this issue Nicole Reichardt1,2, Sylvia H Duncan1, Pauline Young1, Alvaro Belenguer1,3, Carol McWilliam Leitch1,4, Karen P Scott1, Harry J Flint1 and Petra Louis1 1Rowett Institute of Nutrition and Health, University of Aberdeen, Bucksburn, UK and 2Institute of Molecular, Cell and Systems Biology, College of Medical, Veterinary and Life Sciences, University of Glasgow, Glasgow, UK Propionate is produced in the human large intestine by microbial fermentation and may help maintain human health. We have examined the distribution of three different pathways used by bacteria for propionate formation using genomic and metagenomic analysis of the human gut microbiota and by designing degenerate primer sets for the detection of diagnostic genes for these pathways. Degenerate primers for the acrylate pathway (detecting the lcdA gene, encoding lactoyl- CoA dehydratase) together with metagenomic mining revealed that this pathway is restricted to only a few human colonic species within the Lachnospiraceae and Negativicutes. The operation of this pathway for lactate utilisation in Coprococcus catus (Lachnospiraceae) was confirmed using stable isotope labelling. The propanediol pathway that processes deoxy sugars such as fucose and rhamnose was more abundant within the Lachnospiraceae (based on the pduP gene, which encodes propionaldehyde dehydrogenase), occurring in relatives of Ruminococcus obeum and in Roseburia inulinivorans. The dominant source of propionate from hexose sugars, however, was concluded to be the succinate pathway, as indicated by the widespread distribution of the mmdA gene that encodes methylmalonyl-CoA decarboxylase in the Bacteroidetes and in many Negativicutes.
    [Show full text]
  • Full Disclosure Form Information Provided by the Authors Is Available with the Full Text of This Article at Neurology.Org/NN
    ARTICLE OPEN ACCESS Disease-modifying therapies alter gut microbial compositioninMS Ilana Katz Sand, MD,* Yunjiao Zhu, PhD,* Achilles Ntranos, MD, Jose C. Clemente, PhD, Correspondence Egle Cekanaviciute, PhD, Rachel Brandstadter, MD, Elizabeth Crabtree-Hartman, MD, Sneha Singh, BSc, Dr. Katz Sand [email protected] Yadira Bencosme, MPH, Justine Debelius, PhD, Rob Knight, PhD, Bruce A.C. Cree, MD, PhD, MAS, Sergio E. Baranzini, PhD, and Patrizia Casaccia, MD, PhD Neurol Neuroimmunol Neuroinflamm 2019;6:e517. doi:10.1212/NXI.0000000000000517 Abstract Objective To determine the effects of the disease-modifying therapies, glatiramer acetate (GA) and dimethyl fumarate (DMF), on the gut microbiota in patients with MS. Methods Participants with relapsing MS who were either treatment-naive or treated with GA or DMF were recruited. Peripheral blood mononuclear cells were immunophenotyped. Bacterial DNA was extracted from stool, and amplicons targeting the V4 region of the bacterial/archaeal 16S rRNA gene were sequenced (Illumina MiSeq). Raw reads were clustered into Operational Taxonomic Units using the GreenGenes database. Differential abundance analysis was per- formed using linear discriminant analysis effect size. Phylogenetic investigation of communities by reconstruction of unobserved states was used to investigate changes to functional pathways resulting from differential taxon abundance. Results One hundred sixty-eight participants were included (treatment-naive n = 75, DMF n = 33, and GA n = 60). Disease-modifying therapies were associated with changes in the fecal microbiota composition. Both therapies were associated with decreased relative abundance of the Lach- nospiraceae and Veillonellaceae families. In addition, DMF was associated with decreased relative abundance of the phyla Firmicutes and Fusobacteria and the order Clostridiales and an increase in the phylum Bacteroidetes.
    [Show full text]
  • Unique Roles of Vaginal Megasphaera Phylotypes in Reproductive Health 2
    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.18.246819; this version posted August 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Unique roles of vaginal Megasphaera phylotypes in reproductive health 2 3 Abigail L. Glascock1, Nicole R. Jimenez2, Sam Boundy2, Vishal N. Koparde1, J. Paul 4 Brooks3, David J. Edwards4, Jerome F. Strauss III5, Kimberly K. Jefferson2, Myrna G. 5 Serrano2, Gregory A. Buck2,6, Vaginal Microbiome Consortium and Jennifer M. 6 Fettweis2,5* 7 1Life Sciences, Virginia Commonwealth University, Richmond, Virginia, USA 8 2Department of Microbiology & Immunology, Virginia Commonwealth University, 9 Richmond, Virginia, USA 10 3Department of Supply Chain Management and Analytics, Virginia Commonwealth 11 University, Richmond, Virginia, USA 12 4Department of Statistical Sciences and Operations Research, Virginia Commonwealth 13 University, Richmond, Virginia, USA 14 5Department of Obstetrics and Gynecology, Virginia Commonwealth University, 15 Richmond, Virginia, US 16 6Department of Computer Science, Virginia Commonwealth University, Richmond, 17 Virginia, USA 18 Running Title: Vaginal Megasphaera 19 *Address correspondence to Jennifer M. Fettweis, [email protected]. 20 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.08.18.246819; this version posted August 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
    [Show full text]
  • Three Novel Clostridia Isolates Produce N-Caproate and Iso-Butyrate from Lactate: Comparative Genomics of Chain-Elongating Bacteria
    microorganisms Article Three Novel Clostridia Isolates Produce n-Caproate and iso-Butyrate from Lactate: Comparative Genomics of Chain-Elongating Bacteria Bin Liu 1 , Denny Popp 1 , Nicolai Müller 2, Heike Sträuber 1 , Hauke Harms 1 and Sabine Kleinsteuber 1,* 1 Department of Environmental Microbiology, Helmholtz Centre for Environmental Research—UFZ, 04318 Leipzig, Germany; [email protected] (B.L.); [email protected] (D.P.); [email protected] (H.S.); [email protected] (H.H.) 2 Department of Biology, University of Konstanz, 78457 Konstanz, Germany; [email protected] * Correspondence: [email protected]; Tel.: +49-341-235-1325 Received: 9 November 2020; Accepted: 9 December 2020; Published: 11 December 2020 Abstract: The platform chemicals n-caproate and iso-butyrate can be produced by anaerobic fermentation from agro-industrial residues in a process known as microbial chain elongation. Few lactate-consuming chain-elongating species have been isolated and knowledge on their shared genetic features is still limited. Recently we isolated three novel clostridial strains (BL-3, BL-4, and BL-6) that convert lactate to n-caproate and iso-butyrate. Here, we analyzed the genetic background of lactate-based chain elongation in these isolates and other chain-elongating species by comparative genomics. The three strains produced n-caproate, n-butyrate, iso-butyrate, and acetate from lactate, with the highest proportions of n-caproate (18%) for BL-6 and of iso-butyrate (23%) for BL-4 in batch cultivation at pH 5.5. They show high genomic heterogeneity and a relatively small core-genome size. The genomes contain highly conserved genes involved in lactate oxidation, reverse β-oxidation, hydrogen formation and either of two types of energy conservation systems (Rnf and Ech).
    [Show full text]