VYTAUTAS MAGNUS UNIVERSITY
Brigita Paulavičiūtė
USE OF MOLECULAR MARKERS IN BIOCHEMICAL TAXONOMY OF TISCHERIIDAE (LEPIDOPTERA: TISCHERIOIDEA) AND ELACHISTIDAE (LEPIDOPTERA: GELECHIOIDEA) MOTHS
Summary of Doctoral Thesis Physical Science, Biochemistry (04P)
Kaunas, 2010
The research work was carried out at Vytautas Magnus University in 2006−2010.
Scientific supervisor: Prof. dr. Algimantas Paulauskas (Vytautas Magnus University, Physical Sciences, Biochemistry – 04P)
Consultant: Prof. dr. Virginijus Sruoga (Vilnius Pedagogical University, Biomedical Sciences, Zoology – 05B)
The Committee of the doctoral dissertation:
Chairman: Dr. Rolandas Meškys (Institute of Biochemistry, Physical Sciences, Biochemistry – 04P)
Members: Prof. habil. dr. Vincas Būda (Vilnius University, Biomedical Sciences, Ecology – 03B) Dr. Jana Radzijevskaja (Vytautas Magnus University, Physical Sciences, Biochemistry – 04P) Prof. habil. dr. Aniolas Sruoga, (Vytautas Magnus University, Biomedical Sciences, Biology – 01B) Prof. dr. Laima Ivanovienė (Kaunas Medicine University, Physical Sciences, Biochemistry – 04P)
Opponents: Prof. habil. dr. Jonas Rimantas Stonis (Vilnius Pedagogical University, Biomedical Sciences, Zoology – 05B) Dr. Lidija Truncaitė (Institute of Biochemistry, Physical Sciences, Biochemistry – 04P)
The defense of dissertation will take place at 2 p.m. on September 28, 2010 in the Faculty of Natural Sciences of Vytautas Magnus University, in the 101 auditorium. Address: Vileikos st. 8, LT-44404 Kaunas, Lithuania.
The summary of doctoral dissertation was distributed on 28 August, 2010.
The dissertation can be reviewed in Martynas Mažvydas National Library of Lithuania, the Libraries of Vytautas Magnus University and Institute of Biochemistry.
VYTAUTO DIDŽIOJO UNIVERSITETAS
Brigita Paulavičiūtė
MOLEKULINIŲ ŽYMENŲ PANAUDOJIMAS TISCHERIIDAE (LEPIDOPTERA: TISCHERIOIDEA) IR ELACHISTIDAE (LEPIDOPTERA: GELECHIOIDEA) DRUGIŲ BIOCHEMINĖJE SISTEMATIKOJE
Daktaro disertacijos santrauka Fiziniai mokslai, biochemija (04P)
Kaunas, 2010
Disertacija rengta 2006−2010 m. Vytauto Didžiojo universitete.
Mokslinis vadovas: Prof. dr. Algimantas Paulauskas (Vytauto Didžiojo universitetas, fiziniai mokslai, biochemija − 04P)
Konsultantas: Prof. dr. Virginijus Sruoga (Vilniaus pedagoginis universitetas, biomedicinos mokslai, zoologija − 05B)
Pirmininkas: Dr. Rolandas Meškys (Biochemijos institutas, fiziniai mokslai, biochemija − 04P)
Nariai: Prof. habil. dr. Vincas Būda (Vilniaus universitetas, biomedicinos mokslai, ekologija − 03B) Dr. Jana Radzijevskaja (Vytauto Didžiojo universitetas, fiziniai mokslai, biochemija − 04P) Prof. habil. dr. Aniolas Sruoga (Vytauto Didžiojo universitetas, biomedicinos mokslai, biologija − 01B) Prof. dr. Laima Ivanovienė (Kauno medicinos universitetas, fiziniai mokslai, biochemija − 04P)
Oponentai: Prof. habil. dr. Jonas Rimantas Stonis (Vilniaus pedagoginis universitetas, biomedicinos mokslai, zoologija − 05B) Dr. Lidija Truncaitė (Biochemijos institutas, fiziniai mokslai, biochemija − 04P)
Disertacija bus ginama viešame Biochemijos mokslo krypties tarybos posėdyje 2010 m. rugsėjo 28 d. 14 val. Vytauto Didžiojo universiteto Gamtos mokslų fakulteto 101 auditorijoje. Adresas: Vileikos g. 8, LT-44404 Kaunas, Lietuva.
Disertacijos santrauka išsiuntinėta 2010 m. rugpjūčio 28 d.
Disertacija galima peržiūrėti Lietuvos nacionalinėje Martyno Mažvydo bibliotekoje, Biochemijos instituto ir Vytauto Didžiojo universiteto bibliotekose.
INTRODUCTION The field of molecular biology has expanded greatly in the last ten years and currently many entomologists want to use this technology since it is a new level of carrying out studies of insect ecological systems and taxonomy. A broad range of novel molecular (DNA) markers is now available for entomological investigations. DNA markers have revolutionized biological sciences and have enhanced many fields of study, especially ecology. DNA markers are also suitable to be used with small amounts of insect material and can be applied to stored, dry or old samples (Loxdale, Lushai, 1998). Molecular tools form a standard part of many conservation studies and can be informative at many different levels of analysis, although there are inherent limitations and strengths of different genes or parts of genes to address specific issues. DNA barcodes of insects, 600- to 800-base-pair segments of the mitochondrial gene cytochrome oxidase have been proposed as a means to quantify global biodiversity. Although mitochondrial (mt) DNA has a long history of use at the species level, the recent analyses proved the use of a single gene, a mitochondrial one, in particular, to be sufficient within the taxonomic scope, to recognize many species lineages. Mitochondrial genome can result in very different assessments of biodiversity (Rubinoff, 2006). The study of mitochondrial DNA (mtDNA) sequences has become the method for a wide range of taxonomic, population and evolutionary investigations in Lepidoptera (Lunt et al, 1996). The increasing popularity of molecular taxonomy will undoubtedly exert a major impact on conservation biology practice. The benefit of such approaches is undeniable since they will clearly be an asset to rapid biological assessments of poorly known taxa or unexplored areas, and to the discovery of cryptic biodiversity (Forister et al., 2007). The mitochondrial COI DNA has been proposed to serve as the core of a global bio-identification system for animals (Hebert et al., 2003). The Tischeriidae and Elachistidae represent rather small families as compared to many other groups of Lepidoptera. Moths are with wingspan from 6–13 mm. They are found all over the world, but most species are known from Boreal, Palearctic and Neotropical regions. These moths are leaf-miners during all larval instars. Molecular tools can help to identify this group. A lot of Tischeriidae and Elachistidae species are siblings externally, and their identification is very problematic, so in this case the structure of the male genital is more popular. However, only two articles dealt with the results of the mitochondrial DNA analysis in Elachista species from Australia (Kaila and Ståhls, 2006) and Tisheria ptarmica from the United Arab Emirates (Nieukerken, 2010). Molecular investigations are necessary to develop new phylogenetical conceptions. Molecular research of Tischeriidae and Elachistidae necessitate a theoretical and practical background for a further use of DNA molecular markers in taxonomical and phylogenetical investigations into these moths.
The aim of the study is to investigate and adjust DNR molecular markers to Tischeriidae (Lepidoptera: Tischerioidea) and Elachistidae (Lepidoptera: Gelechioidea) biochemical taxonomy.
Main objective of the study • To apply molecular methods, previously used in other systematic groups, to moths of Tischeriidae and Elachistidae family. • To identify sequences of cytochrome oxidase I (COI) gene for every species and deposit them to GenBank; • To compare new molecular data in moths of Tischeriidae and Elachistidae (NJ trees) with the cladogram represented before with reference to traditional, morphological and ecological features; • To evaluate genetic diversity of Elachistidae moths populations in Lithuania.
Scientific innovation of the work. Molecular methods were applied to Tischeriidae and Elachistidae moths for the first time in this work. It was for the first time that the mtDNA cytochrome oxidase I (COI) gene of Tischeriidae and Elachistidae moths has been amplified. The molecular data were used in molecular taxonomy. A specific COI gene sequence has been identified for every species. Previously, the genetic diversity of Elachistidae moths populations have never been examined. It is for the first time that genetic diversity of Elachistidae populations has been evaluated by means of the random amplification DNA method (RAPD). These investigations presuppose further research into genetic polymorphism of these species and the evaluation of similarities and differences among populations.
Approval of the research work. The main results were presented at the following conferences and meetings: “IV Baltic Genetic Congress” (Daugavpils, Latvia, 2007); “Research and Conservation of Biological Diversity in Baltic Region. 4th International Conference” (Daugavpils, Latvia, 2007); “Lithuanian biological diversity: state, structure, protection” (Vilnius, Lithuania, 2008); “Topicality and promising of natural sciences (biology, ecology, physics)” (Šiauliai, Lithuania, 2008); “The Vital Nature Sign. 3RD International Conference” (Kaunas, Lithuania, 2009); “Research and Conservation of Biological Diversity in Baltic Region. 5th International Conference” (Daugavpils, Latvia, 2009); “19th International Symposium Ecology & Safety” (Sunny Beach, Bulgaria, 2010); “XI International Meeting of Lithuanian Biochemical Society. LBS 50” (Tolieja, Lithuania, 2010); “XXVIII Nordic Baltic Congress of Entomology” (Birštonas, Lithuania, 2010); “IXth European Congress of Entomology” (Budapest, Hungary, 2010). The results of this research have been published in scientific journals; six publications were publish in the Master Journal List of Institute of Scientific Information and four publications – in peer reviewed journals.
The scope of the work. The thesis has been written in Lithuanian and consists of the Introduction, Literature Review, Materials and Methods, Results and Discussions, Conclusions, List of author’s publications and List of references. The thesis has 132 pages. The research data are presented in 31 figures and 23 tables.
MATERIALS AND METHODS
Study area Tischeriidae and Elachistidae moths were collected in a part of West Palearctic region – Lithuania (19 sites), Great Britain (2 sites) and Tropical zone of Neotropical region – Peru (3 sites), Ecuador (4 sites) during the period between 2001 and 2008.
Sampling methods Adult moths were sampled by an entomological net and during light trapping at night (160W DRL type bulb lamp was used). Some species were bred from mines. Species were identified from the external appearance and genitalia of moths under the stereo microscope (Motic SMZ 168). Genitalia were prepared following methods described by Robinson (1976), Traugott-Olsen and Nielsen (1977), and Sruoga and Ivinskis (2005).
DNA extraction We used pined specimens and specimens, which were stored in 96% ethanol. DNA was extracted from head or thorax using four different methods: 1) by V. Tkach and J. Pawlowski (1999); 2) by V. Tkach and J. Pawlowski with some modifications; 3) by H. M. Robertson and E. G. McLeod (1993) with some modifications; 4) with the Nucleospin Tissue Kit (Machery-Nagel, Düren, Germany) according to manufacturer’s protocols. The latter method was best for DNA extraction from Lepidoptera.
DNA amplification Polymorphism of Elachista maculicerusella, E. pollinariella and E. argentella species populations were analyzed by means of the random amplification polymorphic DNA method. As many as 85 DNR samples of the species were used for RAPD reaction. Nine oligonucleotide primers were tested for analysing genetic differences of Elachista genus (Table 1). Two random oligonucleotide primers OPA-09 and OPA-10, synthesized in MBI Fermentas, were most informative and useful for the typing of Elachista species. Table 1. Primer names and sequences amplified by RAPD-PCR for individuals of Elachista Name of primer Sequence OPA-01 5’–CAGGCCCTT-
PCR with random amplified primers was performed in the reaction volume of 25 containing 12,5µl 2X PCR Master Mix (MBI Fermentas, Lithuania), 2µl 10- oligonucleotide primer (stock 10 pmol/µl) (MBI Fermentas, Lithuania), 6,5µl ddH2O and 4µl DNR of moth sample. All reactions were carried out in Eppendorf PCR system “Mastercycler personal” thermal cycler. Samples were initially denatured for 1 min at 94ºC. Subsequent cycles were denatured at 94ºC for 30 sec (denaturation), 35ºC for 30 sec (primers annealing), and 72ºC for 3 min (extension). After amplification, PCR products were separated by electrophoresis in 1.5 % agarose gel. Agarose gel was stained with ethidium bromide and photographed under UV light (EASY Win32, Herolab, Germany). The primers used in other systematic groups have been tested in my research because no other markers for Tischeriidae and Elachistidae have been used before.
Table 2. PCR primers used for Tischeriidae and Elachistidae families Name Sequences of primers Length (bp) of PCR products LCO1490-J- 5’–GGTCAACAAATCATAAAGATATTGG–3’ 700 1514 HCO2198-N- 5’–TAAACTTCAGGGTGACCAAAAAATCA–3’ 700 2175 ND1 3264–J– 5’–ATCAAAAGGAGCTCGATTAGTTTC–3’ 490 12095 ND1 1957–N– 5’– 490 12567 CGTAAAGTCCTAGGTTATATTCAGATTCG– 3’ 16S LR–J– 5’–CCGGTTTGAGCTCAGATCA–3’ 478-483 12887 16S LR–N– 5’–CGCCTGTTTATCAAAAACAT–3’ 478-483 13398 LepWG1 5’–GARTGYAARTGYCAYGGYATGTCTGG–3’ 400 LepWG2 5’–ACTICGCARCACCARTGGAATGTRCA–3’ 400 HcCOII-F 5’–CAGATTAGTGCAATGAATTTAAGATTC-3′ 197 HcCOII-R 5′-TTCTGAACATTGACCAAAAAATAACCC-3′ 197 Ron 5’–TCCAATGCACTAATCTGCCATATTA-3′ 1911 Eva 5’–GGAGGATTTGGAAATTGATTAGTTCC-3′ 1911
Only one pair of specific primers, which amplified mitochondrial DNA sequences of the COI gene, was chosen for a further analysis: LCO1490 (5'–GGT CAA CAA ATC ATA AAG ATA TTG G–3') and HCO2198 (5'–TAA ACT TCA GGG TGA CCA AAA AAT CA–3') (Folmer et al., 1994; Herbert et al., 2003). PCRs were carried out in 25µl reactions containing 2 µl DNA extract, 2 µl of each primer (at 10 pmol/µl) (MBI Fermentas, Lithuania), 0,5 µl of Amplitaq DNA polymerase (5U / µl), 2,5 µl 25 mM MgCl2, 2,5 µl 10X Buffer (Fermentas) and 1 µl 10mM dNTP (Fermentas) and water. Termocycler conditions were initial denaturing at 94°C 2 min, 35 cycles of 30 s denaturing at 94°C, 45 s annealing at 50°C, 1 min extension at 72°C, followed by a final extension of 4 min at 72°C. After amplification, PCR products were separated by electrophoresis in 1.5 % agarose gel. Agarose gel was stained with ethidium bromide and photographed under UV light (EASY Win32, Herolab, Germany). DNA fragment sizes were assessed by comparing them with GeneRulerTM 100bp DNA Lader Plus (MBI Fermentas, Lithuania) (Figure 1).
Figure 1. PCR amplified products of COI gene of Elachistidae moths. Lane M: 100 bp DNA ladder. Lane 1−9: amplified products (700 bp)
PCR products were purified with the Nucleospin PCR clean-up Gel extraction kit (Macherey-Nagel, Germany) and the GeneJet Gel Extraction kit (Fermentas, Lithuania).
Sequencing Some part of the samples was sequenced at the Institute of Biotechnology, the Centre for Sequencing and at Norway Telemark University College. Cycle sequencing was done using the ABI PRISM BigDye terminator version 3.1 cycle sequencing kit. Reactions one – eight were used to produce 20 µl of cycle sequencing product using 8 µl of the ABI reaction mix. Products were separated and visualized using the ABI PRISM 310 Genetic analyser. All fragments were sequenced in both directions.
Data analysis The Nei and Li algorithms (Nei, Li 1979) contained in the TREECON computer package program (Van de Peer, De Wacher 1994) were used to evaluate the genetic distances between the individuals of Elachista species. The dendrogram was constructed by UPGMA (Unweighted Pair Group with Arithmetic Mean) method. We used the PopGen32 program (Yen and Bpyle, 1997) to calculate genetic distances and genetic identity between populations (Nei, 1978) Editing of the DNA sequences, counting assembly and alignment of consensus sequences were performed using the software programs Bioedit version 5.0.9. The COI DNA sequences were phylogenetically analysed using MEGA version 4. (Tamura at al., 2007).
RESULTS AND DISSCUSION Analysis of mtDNA sequences After screening six specific primers for Tischeriidae and Elachistidae moths, LCO1490, HCO2198 that amplified 700 bp fragment of mtDNA cytochrome oxidase subunit I (COI) gene were established to be suitable for a further investigation into Tischeriidae and Elachistidae moths.
COI sequences of Tischeriidae moths Thirteen of Tischeriidae species were studied using molecular methods. Cytochrome oxidase I (COI) gene 700bp fragment was amplified in 22 samples moths belonging to this family. Amplified fragments were sequenced. The COI gene fragment produced a 640 bp sequence alignment and corresponded to sequence position 2239– 2944. Accession numbers of GenBank given to the sequenced Tischeriidae species COI gene fragments are represented in Table 3.
Table 3. GenBank accession numbers of examined specimens of moths Examined specimens and authors of species Accession number GenBank Coptotriche marginea(1) (Haworth, 1828) HM244382
Coptotriche marginea(2) (Haworth, 1828) HM244379 Coptotriche marginea(3) (Haworth, 1828) HM244380 Coptotriche marginea(4) (Haworth, 1828) HM244381 Tischeria ekebladella(1) (Bjerkander, 1795) HM244384 Tischeria ekebladella(2) (Bjerkander, 1795) HM244385
Tischeria ekebladella(3) (Bjerkander, 1795) HM244383 Tischeria dodonea(1) Stainton, 1858 HM244386 Tischeria dodonea(2) Stainton, 1858 HM244388 Tischeria dodonea(3) Stainton, 1858 HM244387
Astrotischeria sp. 4848 HM244389 Astrotischeria sp. 4877 HM244393 Astrotischeria sp. 4894 HM244395 Astrotischeria sp. 4909(1) HM244391 Astrotischeria sp. 4909(2) HM244392
Astrotischeria sp. 4910 HM244390 Astrotischeria sp. 4936 HM244394 Astrotischeria sp. 4937 HM244396 Astrotischeria sp. 4939 HM244398 Astrotischeria sp. 4944(2) HM244397
Astrotischeria sp. 4957(1) HM244399 Astrotischeria sp. 4957(2) HM244400
The analysis of Tischeriidae COI gene sequences demonstrates a different distributional rate of nucleotides (Table 4). 38.6 % T(U), 16.5 % C, 30.2 % A and 14.8 % G nucleotides were discovered in all the sequences. Tischeria dodonaea(1) sequence had the greatest amount of T nucleotides – 40.6%. The Astrotischeria sp. 4944(2) sequence also had a large amount of C nucleotides – 31.7 %; Astrotischeria sp. 4944(2) COI sequence − A nucleotides (31.7 %.); and Astrotischeria sp. 4957(2) − G nucleotides (16.0 %).
Table 4. The rate of nucleotides in mtDNR COI gene fragments of Tischeriidae specimens Specimens T(U) C (%) A (%) G (%) Total rate (%) of nucleotide s Coptotriche marginea(1) 37.8 16.3 30.6 15.3 582 Coptotriche marginea(2) 38.1 16.7 29.9 15.3 635 Coptotriche marginea(3) 38.2 16.1 30.7 15.1 629 Tischeria ekebladella(1) 38.8 16.9 30.0 14.3 629 Tischeria ekebladella(2) 38.6 17.3 30.1 14.0 635 Tischeria ekebladella(3) 38.6 17.2 30.1 14.0 634 Tischeria dodonaea(1) 40.6 15.3 30.4 13.8 616 Tischeria dodonaea(2) 40.4 14.8 30.8 14.0 594 Tischeria dodonaea(3) 39.1 15.3 31.3 14.3 594 Astrotischeria sp. 4848 37.6 16.6 29.6 16.1 601 Astrotischeria sp. 4877 38.7 15.6 31.2 14.5 628 Astrotischeria sp. 4894 38.6 17.2 29.3 14.8 634 Astrotischeria sp. 4909(1) 39.1 16.7 30.1 14.2 635 Astrotischeria sp. 4909(2) 39.1 16.6 30.1 14.2 634 Astrotischeria sp. 4910 38.2 16.6 29.6 15.6 628 Astrotischeria sp. 4936 38.6 17.3 29.3 14.8 635 Astrotischeria sp. 4937 39.0 16.8 29.7 14.5 636 Astrotischeria sp. 4939(1) 39.0 15.9 31.0 14.2 636 Astrotischeria sp. 4944(2) 37.2 16.0 31.7 15.1 589 Astrotischeria sp. 4957(1) 37.4 17.8 28.9 15.9 636 Astrotischeria sp. 4957(2) 37.8 17.1 29.0 16.0 630 Average 38.6 16.5 30.2 14.8 622.6
Tischeriidae moths in mtDNR COI sequences had 57 nucleotides codons (Table 5). The most frequently detected codon in this family was UUA(L), which accounted for 23.8 %, the next frequent codon was AUU(I), which accounted for 17.6 %. The following seven codons were not detected in Tischeriidae moths COI sequences: UAA(*), UAG(*), AAG(K), UGU(C), UGC(C), UGG(W), AGG(R). In Tischeriidae moth sequences 201 out of 636 variable nucleotides were detected. 435 nucleotides were conservative to all sequences of Tischeriidae family moths. The Neighbour-Joining tree (Figure 2) has two large clusters: A and B. The A cluster encompasses genetically similar species: Astrotischeria sp. 4848, Astrotischeria sp. 4910, Astrotischeria sp. 4944(2), Astrotischeria sp. 4877, Astrotischeria sp. 4939(1), Astrotischeria sp. 4957(1), Astrotischeria sp. 4957(2), Astrotischeria sp. 4936, Astrotischeria sp. 4894, Astrotischeria sp. 4937, Astrotischeria sp. 4909(1) ir Astrotischeria sp. 4909(2). Great genetic difference was observed between Astrotischeria sp. 4957 and Astrotischeria sp. 4894 species. Sequences of these two species have 78 polymorphic and 556 conservative nucleotides. Astrotischeria sp. 4936 and Astrotischeria sp. 4894 species were most genetically similar ones in the A cluster.
Table 5. Tischeriidae specimens codons and their numbers Codon* Number Codon Number Codon Number Codon Number (%) ** (%) (%) (%) UUU(F) 12.3(1.81) UCU(S) 6.0(2.38) UAU(Y) 2.0(1.23) UGU(C) 0.0(0.00) UUC(F) 1.3(0.19) UCC(S) 1.0(0.39) UAC(Y) 1.3(0.77) UGC(C) 0.0(0.00) UUA(L) 23.8(4.40) UCA(S) 7.4(2.91) UAA(*) 0.0(0.00) UGA(*) 4.7(3.00) UUG(L) 0.8(0.14) UCG(S) 0.4(0.16) UAG(*) 0.0(0.00) UGG(W) 0.0(0.00) CUU(L) 4.3(0.80) CCU(P) 6.0(1.99) CAU(H) 3.2(1.53) CGU(R) 0.5(0.39) CUC(L) 0.8(0.14) CCC(P) 2.3(0.76) CAC(H) 1.0(0.47) CGC(R) 0.3(0.19) CUA(L) 2.6(0.48) CCA(P) 3.4(1.12) CAA(Q) 3.0(1.91) CGA(R) 2.9(2.05) CUG(L) 0.2(0.03) CCG(P) 0.4(0.12) CAG(Q) 0.1(0.09) CGG(R) 0.2(0.16) AUU(I) 17.6(1.72) ACU(T) 7.4(2.01) AAU(N) 8.7(1.82) AGU(S) 0.3(0.12) AUC(I) 0.9(0.08) ACC(T) 0.4(0.11) AAC(N) 0.9(0.18) AGC(S) 0.1(0.04) AUA(I) 12.3(1.20) ACA(T) 6.8(1.85) AAA(K) 0.2(1.60) AGA(R) 4.5(3.18) AUG(M) 0.4(1.00) ACG(T) 0.1(0.04) AAG(K) 0.0(0.40) AGG(R) 0.0(0.03) GUU(V) 5.1(1.95) GCU(A) 7.9(2.22) GAU(D) 5.5(1.46) GGU(G) 4.3(0.89) GUC(V) 0.5(0.21) GCC(A) 1.5(0.43) GAC(D) 2.0(0.54) GGC(G) 0.2(0.04) GUA(V) 4.3(1.65) GCA(A) 4.6(1.30) GAA(E) 2.2(1.92) GGA(G) 13.6(2.81) GUG(V) 0.5(0.19) GCG(A) 0.2(0.05) GAG(E) 0.1(0.08) GGG(G) 1.2(0.25) * Next to each codon (in brackets) a one-letter abbreviation of amino acid coded by it is shown. ** Error is indicated next to each number (in brackets).
The B cluster includes species from Tischeria and Coptotriche genus: Tischeria dodonaea, T. ekebladella and Coptotriche marginea. 10 out of 636 polymorphic nucleotides were detected among Coptotriche marginea. Intraspecific differences were not observed among Tischeria ekebladella moth sequences (1 polymorphic nucleotide), but Tischeria dodonaea species had some differences between the specimens (38 polymorphic nucleotides out of 636).
Tischeriidae polymorphism Some difference was noticed between cladogram (according to Puplesis, Diškus, 2003) and the NJ tree (Figure 2). In cladogram, which was based on cladistical methods, there are three basic evolutionary developmental ways: Tischeria, Astrotischeria and Coptotriche.
Astrotischeria A
Coptotriche
B
Tischeria
Figure 2. Neighbor-Joining tree for Tischeriidae species. The tree was constructed by Kimura2-parameter model (bootstrap replications = 10000, complete deletion), based on the analysis of 581 sites of mitochondrial COI. Bootstrap values are shown above the branches
According to the conception of phylogenetic cladistic, two clades (Tischeria and Astrotischeria) are siblings, whereas Coptotriche is a sibling taxon to Tischeria + Astrotischeria. Molecular research into Tischeriidae demonstrates the same 3 big clusters (NJ tree), but Astrotischeria is a sibling group to other two clusters taken together (Tischeria + Coptotriche). Though this molecular data specify the phylogenetic relationship between the Tischeriidae family genuses, it does not contradict to the politipical conception of the family. This molecular data confirm at least tree genus in the Tischeriidae family. Phylogenetic lines on cladogram (Puplesis, Diškus, 2003) are based on typical morphological male and female features, which demonstrate the process of evolution (synapomorph). NJ tree was composed by the sequences of mtDNR COI gene, which presented the female line only.
COI sequences of Elachistidae moths 11 Elachistidae species were studied by means of molecular methods. Cytochrome oxidase I (COI) primer was amplified in 31 specimens of this family. Amplified fragments were sequenced. COI gene fragment produced a 640bp sequence alignment and corresponded to sequence position 2239–2944. The accesion number of GenBank given to the sequenced Elachistidae species COI gene fragments are presented in Table 6.
Table 6. GenBank accession numbers of examined specimens, species groups and subgenus Examined specimens and authors Species Subgenus Accession of species groups number GenBank Perittia herrichiella(1) HM034446 (Herrich-Schäffer, 1855) Perittia herrichiella(2) HM034447 (Herrich-Schäffer, 1855) Elachista albifrontella(1) bifasciella Elachista GU248251 (Hübner, 1817) Elachista albifrontella(2) bifasciella Elachista GU248252 (Hübner, 1817) Elachista alpinella(1) bifasciella Elachista GU248254 Stainton, 1854 Elachista alpinella(2) bifasciella Elachista GU248255 Stainton, 1854 Elachista alpinella(3) bifasciella Elachista GU248256 Stainton, 1854 Elachista alpinella(4) bifasciella Elachista GU248257 Stainton, 1854 Table 6. GenBank accession numbers of examined specimens, species groups and subgenus (continuation) Elachista alpinella(5) bifasciella Elachista GU248258 Stainton, 1854 Elachista alpinella(6) bifasciella Elachista GU248259 Stainton, 1854 Elachista argentella(1) argentella Aphelosetia DQ666137 (Clerck, 1759) Elachista argentella(2) argentella Aphelosetia DQ666138 (Clerck, 1759) Elachista argentella(3) argentella Aphelosetia HM034449 (Clerck, 1759) Elachista argentella(4) argentella Aphelosetia HM034448 (Clerck, 1759) Elachista canapennella bifasciella Elachista GU248260 (Hübner, 1813) Elachista consortella freyerella Elachista GU248261 (Stainton, 1851) Elachista humilis(1) Zeller, 1850 bifasciella Elachista GU248253 Elachista humilis(2) Zeller, 1850 bifasciella Elachista HM034450 Elachista maculicerusella(1) bifasciella Elachista DQ666141 (Bruand, 1859) Elachista maculicerusella(2) bifasciella Elachista DQ666142 (Bruand, 1859) Elachista maculicerusella(3) bifasciella Elachista DQ666143 (Bruand, 1859) Elachista pollinariella(1) argentella Aphelosetia DQ666140 Zeller, 1839 Elachista pollinariella(2) argentella Aphelosetia DQ666139 Zeller, 1839 Elachista pollinariella(3) argentella Aphelosetia DQ666144 Zeller, 1839 Elachista pollinariella(4) argentella Aphelosetia GU248246 Zeller, 1839 Elachista pollinariella(5) argentella Aphelosetia GU248247 Zeller, 1839 Elachista pullicomella(1) bedellella Aphelosetia GU248248 Zeller, 1839 Elachista pullicomella(2) bedellella Aphelosetia GU248249 Zeller, 1839 Elachista pullicomella(3) bedellella Aphelosetia GU248250 Zeller, 1839 Elachista utonella(1) Frey, 1856 tetragonella Elachista HM034451 Elachista utonella(2) Frey, 1856 tetragonella Elachista HM034452
The COI gene fragment analysis of Elachistidae sequences demonstrates different distributional rates of nucleotides (Table 7).
Table 7. Elachistidae specimens rate of nucleotides mtDNR COI gene fragments Specimens T(U) C (%) A (%) G (%) Total rate of (%) nucleotides Perittia herrichiella(1) 38.7 17.5 29.7 14.1 576 Perittia herrichiella(2) 38.5 17.5 29.9 14.1 576 Elachista albifrontella(1) 38.0 16.7 30.9 14.4 576 Elachista albifrontella(2) 38.0 16.7 30.9 14.4 576 Elachista alpinella(1) 36.8 18.4 30.7 14.1 576 Elachista alpinella(2) 37.3 18.4 30.2 14.1 576 Elachista alpinella(3) 36.8 18.4 30.7 14.1 576 Elachista alpinella(4) 37.0 18.6 30.4 14.1 576 Elachista alpinella(5) 36.8 18.4 30.7 14.1 576 Elachista alpinella(6) 36.8 18.4 30.7 14.1 576 Elachista argentella(1) 39.0 16.7 30.3 14.1 575 Elachista argentella(2) 39.0 16.7 30.3 14.1 575 Elachista argentella(3) 38.8 16.7 30.0 14.5 640 Elachista argentella(4) 38.8 17.0 29.8 14.4 631 Elachista canapennella 41.5 14.6 30.0 13.9 576 Elachista consortella(1) 39.4 15.6 30.6 14.4 576 Elachista humilis(1) 39.4 15.6 30.6 14.4 576 Elachista humilis(2) 39.8 15.4 30.0 14.8 623 Elachista maculicerusella(1) 39.1 16.3 30.4 14.2 576 Elachista maculicerusella(2) 39.1 16.3 30.4 14.2 576 Elachista maculicerusella(3) 39.1 15.6 31.4 13.9 576 Elachista pollinariella(1) 39.5 16.0 30.8 13.7 575 Elachista pollinariella(2) 39.4 16.1 30.7 13.7 576 Elachista pollinariella(3) 39.5 16.0 30.8 13.7 575 Elachista pollinariella(4) 39.8 15.4 31.1 13.7 570 Elachista pollinariella(5) 39.1 16.5 30.7 13.7 576 Elachista pullicomella(1) 39.9 15.5 30.6 14.1 576 Elachista pullicomella(2) 40.2 15.8 30.3 13.7 575 Elachista pullicomella(3) 39.9 15.5 30.7 13.9 574 Elachista utonella(1) 37.2 18.1 30.3 14.3 623 Elachista utonella(2) 37.6 18.4 29.5 14.4 630 Average 38.7 16.7 30.4 14.1 584
38.7% T(U), 16.7 % C, 30.4 % A and 14.1% G nucleotides were obtained in sequences. The Elachista canapennella sequence mainly has T nucleotides – 41.5%. The E. alpinella(4) sequence has the maximum number of C nucleotides – 18.6%. The E. maculicerusella(3) COI sequence has the greatest number of A nucleotides – 31.4 %. The largest number of G nukleotides – 14.8% has been obtained in the E. humilis(2) sequence. MtDNR COI sequences of Elachistidae moths have 63 nucleotides codons (Table 8). The most common codon in mtDNA COI sequences of this family UAU(Y) accounts for 16.9%. Codons GUC(V), GUG(V), GCA(A), GAU(D) and GGA(G) are most rarely detected in sequences; they accounted for as little as 0.1% only. The CUA(L) codon was not detected in COI sequences of Elachistidae moths.
Table 8. Tischeriidae specimens codon and their number Codon * Number Codon Number Codon Number Codon Number (%) ** (%) (%) (%) UUU(F) 15.8(1.50) UCU(S) 2.6(0.65) UAU(Y) 16.9(1.56) UGU(C) 4.6(1.22) UUC(F) 5.2(0.50) UCC(S) 1.7(0.44) UAC(Y) 4.8(0.44) UGC(C) 2.9(0.78) UUA(L) 1.2(0.99) UCA(S) 3.3(0.84) UAA(*) 8.5(1.65) UGA(*) 5.6(1.09) UUG(L) 2.3(1.88) UCG(S) 2.0(0.51) UAG(*) 1.4(0.26) UGG(W) 7.7(1.00) CUU(L) 2.0(1.62) CCU(P) 1.3(0.59) CAU(H) 1.5(1.12) CGU(R) 0.6(0.30) CUC(L) 1.1(0.91) CCC(P) 5.8(2.56) CAC(H) 1.2(0.88) CGC(R) 0.8(0.42) CUA(L) 0.0(0.00) CCA(P) 1.1(0.49) CAA(Q) 0.3(1.23) CGA(R) 0.4(0.20) CUG(L) 0.7(0.60) CCG(P) 0.8(0.37) CAG(Q) 0.2(0.77) CGG(R) 0.6(0.30) AUU(I) 17.3(2.26) ACU(T) 3.8(1.54) AAU(N) 14.1(1.45) AGU(S) 4.3(1.08) AUC(I) 5.5(0.71) ACC(T) 4.4(1.79) AAC(N) 5.4(0.55) AGC(S) 9.7(2.47) AUA(I) 0.2(0.03) ACA(T) 0.9(0.36) AAA(K) 4.5(1.10) AGA(R) 2.1(1.08) AUG(M) 1.1(1.00) ACG(T) 0.8(0.32) AAG(K) 3.7(0.90) AGG(R) 7.2(3.71) GUU(V) 0.3(1.03) GCU(A) 0.2(1.00) GAU(D) 0.1(0.44) GGU(G) 0.2(0.42) GUC(V) 0.1(0.31) GCC(A) 0.2(1.17) GAC(D) 0.2(1.56) GGC(G) 0.8(2.17) GUA(V) 0.7(2.36) GCA(A) 0.1(0.33) GAA(E) 0.3(0.95) GGA(G) 0.1(0.25) GUG(V) 0.1(0.31) GCG(A) 0.3(1.50) GAG(E) 0.4(1.05) GGG(G) 0.5(1.17) * Next to each codon (in brackets) a one-letter abbreviation of amino acid coded by it is shown. ** Error is indicated next to each number (in brackets).
The analysis of COI sequences of 11 Elachistidae species and 31 samples produced a 640 bp sequence alignment. The total nucleotide diversity and genetic divergence obtained for Elachistidae moths contrasted with 229 different. Molecular analysis results were summarized and the Neighbor-Joining tree was constructed (Figure 3). NJ tree have two big clusters: A and B. A cluster has two subclusters: A1 and A2. The A1 subcluster includes genetically similar species: Elachista alpinella, E. humilis, E. maculicerusella, E. albifrontella and E. consortella. A total of 122 polymorphic nucleotides was detected in COI gene fragments of this species. The maximum parsimony analysis revealed 109 parsimony informative characters. The most genetically similar ones were E. humilis and E. consortella species. 530 conservative sites were detected in their COI gene fragments. E. alpinella and E. maculicerusella are the most genetically different species in the A1 subclaster. As many as 73 polymorphic sites were detected in sequences of these species. The A2 subcluster has the following genetically similar species: Elachista argentella, E. canapennella, E. pullicomella and E. pollinariella. The most genetically similar are E. argentella and E. canapennella species. Their sequences have 578 conservative sites and 53 polymorphic nucleotides. The most genetically different species in the A2 subclaster are E. argentella and E. canapennella, E. argentella and E. pulicomella. COI gene fragments of these moths have 60 out of 640 polymorphic nucleotides. The B cluster includes Elachistidae species from two genera: Perittia herrichiella and Elachista utonella. COI gene fragments of this species differ in 102 polymorphic nucleotides. The greatest intraspecific differences were observed in Elachista utonella species. Two specimens of these species have 39 variable nucleotides in COI sequences.
A1
A
A2
B
Figure 3. Neighbor-Joining tree for Elachistidae species. The tree was constructed by the Kimura2-parameter model (bootstrap replications = 10000, complete deletion), based on the analysis of 568 sites of mitochondrial COI. Bootstrap values are shown above branches
Polymorphism of the Elachistidae species groups According to the results of the phylogenetic analysis of the Elachistinae subfamily, Elachista genus was grouped into four subgenus: Dibrachia, Hemiprosopa, Aphelosetia and Elachista (Kaila, 1999). At the present time the Elachista genus contains 11 species groups Kaila (Kaila, 1997, 1999). Our 11 species of Elachistidae belonged to subgenus 2 (Aphelosetia and Elachista) and 5 species groups (Elachista argentella, E. bedellella, E.bifasciella, E. freyerella and E. tetragonella) were investigated. The Neighbor – Joining tree has two big clusters: A and B (Figure 4). Species from 3 species groups belong to the A cluster: Elachista bifasciella, E. freyerella and E. tetragonella. 179 polymorphic nucleotides were found in the sequences of COI gene in this cluster. The B cluster includes a large group of E. argentella, E. bedellella and E. bifasciella species. 101 polymorphic nucleotides were detected among the species of moths in this cluster. The greatest genetic differences were detected in the specimens’ sequences of E. bifasciella and E. tetragonella species groups (187 polymorphic nucleotides). E. argentella and E. bedellella are genetically similar. 87 polymorphic sites were detected in COI sequences of this species. L. Kaila cladogram presents lines with morphological male and female features, which demonstrate the process of evolution. The NJ tree was formed on the basis of mtDNR COI gene sequences. The Elachistidae family molecular data is in line with L. Kaila classification.
E. bifasciella
A
E. freyerella
E. tetragonella
E. argentella
B E. bedellella
E. bifasciella
E. argentella
Figure 4. Neighbor-Joining tree of Elachistidae species. The tree was constructed by Kimura2-parameter model (bootstrap replications = 10000, complete deletion), based on the analysis of 568 sites of mitochondrial COI. Bootstrap values are shown above branches
Genetic analysis of Elachistidae populations using RAPD The polymorphic patterns of genomic DNA amplified by RAPD-PCR were detected in the Elachista species populations in Lithuania. Nine oligonucleotide primers were tested for analysing genetic differences of Elachista. Reproducible polymorphic amplification patterns were obtained using two primers: OPA-09 and OPA-10.
Figure 5. RAPD agarose gel electrophoresis profiles of different individuals of Elachista species populations. Lines marked with letters and numbers (Sarg1, Sarg2...) represent the individual that belongs to a different population. M – DNA size markers whose size in base pairs (bp) is given on the sides of each marker. A – Strėvininkai and Rumšiškės population profiles obtained with OPA–09 primer; B – Grobštas nature reserve population profiles obtained with OPA–09 primer; C – Čižiūnai population profiles obtained with OPA–10 primer
Each primer provided a distinct and reproducible pattern of amplified PCR fragments in the present study; RAPD-PCR was conducted to identify genetic differences of Elachista in Lithuania. A total of 50 DNA samples of Elachista species were used for the RAPD analyses: 18 from Kaišiadorys district, 4 from Tauragė district, 13 from Trakai district and 15 from the Curonian Peninsula. Reproducible polymorphic amplification patterns were obtained using two primers: OPA-09 and OPA-10. The 50 DNA samples were amplified with these primers. Each primer provided a distinct and reproducible pattern of amplified PCR fragments (Figure 5). Primer OPA-09 produced from 1 to 8 fragments. The size of the fragments being analysed was from 170 to 1500bp and it varied among the individuals. Primer OPA-10 produced 2−4 fragments varying in size from 170 to 700bp in all Elachista moth individuals. We analysed 33 loci per 7 populations and all of them were found to be polymorphic. The percentage of polymorphic loci of the seven analysed populations (Table 9): Strėvininkai f. (E. argentella), Grobštas nature reserve (E. argentella), Čižiūnai (E. argentella), Grobštas nature reserve (E. pollinariella), Čižiūnai (E. pollinariella), Rumšiškės (E. maculicerusella), Viešvilė nature reserve (E. maculicerusella) were 51.52%, 39.39%, 24.24%, 15.15%, 21.21%, 63.64% and 18.18% respectively. Table 9. Number of locus in Elachista species with OPA-09 primer Species Number of locus Specific locus Elachista argentella 8–27 9 Elachista pollinariella 7 7 Elachista maculicerusella 4–24 8
Genetic distances among Elachista species from different regions of Lithuania were analysed and a genetic dendrogram was drawn. The dendrogram was drawn, and genetic distances and genetic identity between all Elachista moths populations were estimated using the PopGen 32 programme. The dendrogram showed that Elachista species from different populations differed, and individuals that came from the same region were distributed over different clusters. Tauragė population of Elachista maculicerusella was heterogeneous. The results of genetic distances among the populations of Elachista species from Tauragė (E. maculicerusella) and Čižiūnai (E. pollinariella) were heterorganic. The research results from Rumšiškės (E. maculicerusella), Strėvininkai f. (E. argentella), Grobštas nature reserve (E. argentella) and Čižiūnai (E. argentella) represent some identical genotypes in this locality. The principal coordinate analysis (PCA) is one of the multivariate approaches of grouping based on similarity coefficients or variance–covariance values of the component traits of the entities (Liu et al., 2001). In the present study, according to the PCA analysis, Elachista moths were grouped into three distinct groups (Figure 6). Elachista moths from Rumšiškės (Rmac) formed one group, moths from Čižiūnai (Czarg) formed a second group and those from Strėvininkai forest (Sarg) belonged to a third group. Elachista moths from Čižiūnai (Czpol), Grobštas nature reserve (Gpol) and Grobštas nature reserve (Garg) were separated most distinctly.
Figure 6. Association among 7 Elachista populations by the principal coordinates analysis. Pop1 – Sarg, Pop2 – Garg, Pop3 – Czarg, Pop4 – Gpol, Pop5 – Czpol, Pop6 – Rmac, Pop7 – Tmac. Genotyping was done on 50 Elachista moths
Nei’s (1972) genetic identity and genetic distance of 7 Elachista moth populations were listed. The genetic distance ranged from 0.0209 (between 5 and 7 populations) to 0.9794 (between 7 and 5 populations). A phylogenetic tree of the 7 Elachista populations based on Nei’s genetic distance showed a similar topology. A great genetic similarity and genetic distance are from Czpol and Tmac populations. They formed their own branch in the dendrogram. Sarg and Garg formed also formed their own branch.
CONCLUSIONS 1. After molecular research methods have been applied to moths it was established for the first time that sequences of mtDNR COI gene were sufficiently informative and suitable to carry out investigations into Tischeriidae and Elachistidae moths with the help of the specific molecular marker LCO1490-J-1514, HCO2198-N-2175. 2. It has been established that out of 636 nucleotides as many as 201 polymorphic and 435 conservation nucleotides characteristic of all examined moths of this family were detected in sequenced mitochondrial DNR COI gene sequences, and 229 variable and 404 conservative nucleotides out of 640 nucleotides were detected in the sequences of the moths belonging to the Elachistidae family. 3. It has been elucidated that T(U) (38.6 %) and C (16.5 %) nucleotides were most frequently found in specific COI gene sequences of the genera of the Tischeridae family, and that UUA(L) (23.8%) was the most frequent codon, whereas T(U) (38.7%) and A (30.4%) nucleotides and UAU(Y) (16.9%) codon were most frequently detected in COI gene sequences of the Elachistidae family. The following seven codons UAA(*), UAG(*), AAG(K), UGU(C), UGC(C), UGG(W) and AGG(R) were not detected in COI gene sequences of moths belonging to the Tischeriidae family, and it was only CUA(L) codon that was not found in the moths of the Elachistidae family. 4. A different intraspecific mtDNR COI gene variability was found in different genera of both the Tischeriidae and Elachistidae families: only one variable nucleotide was found in the Tischeria ekebladella genus, whereas Tischeria dodonaea individuals contained as many as 38 variable nucleotides, there were 39 variable nucleotides in COI gene sequences of the Elachista utonella genus. No differences in E. argentella, E. albifrontella ir E. humilis genera were found in COI gene fragments. 5. It has been established that groups of Elachista bifasciella and E. tetragonella genera are genetically most distant ones; as many as 187 polimorphic nucleaotides were discovered in their COI gene sequences, and groups of E. argentella ir E. bedellella are genetically closest; 87 polymorphic nucleotides were found in their COI gene sequences. 6. Having carried out molecular investigations into Tischeriidae, three basic clusters were distinguished, however, unlike the earlier published family cladograms, Astrotischeria is a sister group to two other branches taken together (Tischeria + Coptotriche). These data support the Tischeriidae polytypical conception and make taxonomic legality of three genera within the Tischeriidae family more exact. 7. The analysis of the data of molecular investigations supplements rather than contradicts the earlier presented cladogram of moth genera of the Elachistidae family in which the lines of evolution are presented on the basis of characteristic morphological features that show evolutionary processes. 8. Investigations into genetic diversity of moth populations of the Elachistidae family revealed a different degree of genetic differentiation of different populations. The smallest genetic differentiation has been established among Elachista argentella moth populations – in Grobštas nature reserve, in Smiltynė (Curonioan Peninsula) and Čižiūnai (Trakaidistrict); the greatest genetic differentiation has been estabished among E. pollinariella moth populations in Grobštas nature reserve (Curonian Peninsula) and Čižiūnai (Trakai district).
SANTRAUKA Įvadas Molekuliniai žymenys yra polimorfinės DNR sekos lokalizuotos tam tikrose genomo vietose ir nustatomos naudojant įvairius molekulinės biologijos metodus. Jais nustatomi dviejų ar daugiau idividų ląstelėse esančios genetinės informacijos skirtumai. Morfologiniai žymenys naudojami ir šiandien, bet dėl įvairių trūkumų jų panaudojimas labai ribotas. Įvairūs molekuliniai tyrimo metodai vis dažniau naudojami entomologijoje (Loxdale, Lushai, 1998). Tiriant vabzdžių filogenezę ir sistematiką molekuliniai tyrimo metodai vis populiarėja, tačiau iki šiol jie nebuvo taikomi Tischeriidae ir Elachistidae šeimų drugių tokio pobūdžio tyrimuose. Šių šeimų drugiai filogenetiškai vieni primityviausių drugių būrio atstovai, jungiantys giminiškas šeimas. Tischeriidae ir Elachistidae drugiai plačiai paplitę tiek Baltijos regione, tiek visame pasaulyje, joms priklauso vieni mažiausių Žemėje mikro drugiai, kurie išsiskiria ne tik archaiška sandara, bet ir labai didele specializacija. Daugelio jų išskleistų sparnų ilgis tesiekia vos 6–13 mm. Daugelis Tischeriidae ir Elachistidae rūšių išoriškai yra panašios ir sunkiai atskiriamos, todėl pagrindinis dėmesys apibūdinant rūšį skiriamas patinų genitalijų struktūrai. Minuojantis gyvenimo būdas – svarbi primityvių Microlepidoptera biologinė adaptacija, suteikusi šiems vabzdžiams daug privalumų. Iki šiol molekulinių tyrimų su šiais drugiais atlikta ypač mažai, todėl visi publikuoti apžvalginiai darbai (tiek Lietuvos autorių, tiek užsienio mokslininkų), iki šiol buvo nepatvirtinti molekuliniais tyrimais. Darbo tikslas: ištirti ir pritaikyti molekulinius DNR žymenis Tischeriidae (Lepidoptera: Tischerioidea) ir Elachistidae (Lepidoptera: Gelechioidea) drugių biocheminėje sistematikoje. Darbo uždaviniai: 1. Tischeriidae ir Elachistidae šeimų drugiams pritaikyti molekulinius tyrimo metodus, jau anksčiau taikytus kitose sistematinėse grupėse; 2. Nustatyti kiekvienai tirtai rūšiai specifines citochromo c oksidazės geno (COI) sekas bei deponuoti gautas DNR sekas genų banke; 3. Atlikti naujai išaiškintų molekulinių Tischeriidae ir Elachistidae duomenų (NJ medžių) ir ankščiau publikuotų kladogramų, sudarytų remiantis vien tradiciniais, morfologiniais ir ekologiniais požymiais lyginamąją analizę; 4. Įvertinti Elachistidae šeimos drugių populiacijų genetinę įvairovę Lietuvoje. Mokslinis naujumas. Tischeriidae ir Elachistidae šeimos molekuliniai tyrimai yra nauji ne tik Lietuvoje, bet ir pasaulyje. Svarbiausias šio tyrimų etapo rezultatas buvo tai, kad pirmą kartą tiriamoje taksonominėje grupėje pavyko pritaikyti molekulinius tyrimų metodus. Tischeriidae ir Elachistidae šeimos drugiams pirmą kartą pavyko amplifikuoti mitochondrinės DNR citochromo c oksidazės I (COI) molekulinį žymenį (LCO1490, HCO2198) ir jį panaudoti šių šeimų molekulinėje sistematikoje. Pirmą kartą buvo nustatytos kiekvienai tirtai rūšiai specifinės COI geno sekos. Siekiant išsiaiškinti Elachistidae šeimos drugių populiacijų genetinę įvairovę, pirmą kartą buvo panaudotas atsitiktinai padaugintos polimorfinės DNR (APPD) metodas. Šiuo metodu buvo įvertinti atsitiktinai amplifikuojančių molekulinių žymenų tinkamumas. Tai sudaro prielaidas toliau tirti pasirinktų rūšių genetinį polimorfizmą ir panaudoti šiuos tyrimus populiacijų panašumų ir skirtumų nustatymui bei tarprūšinių ryšių analizei ir filogenijai. Naujų Tischeriidae ir Elachistidae filogenetinių koncepcijų pateikimui reikalingi molekuliniai tyrimai. Molekuliniai Tischeriidae ir Elachistidae tyrimai sudaro teorines ir praktines prielaidas tolimesniam molekulinių DNR žymenų panaudojimui šių šeimų ir biologiškai artimų drugių šeimų tyrimams bei molekulinių duomenų panaudojimui, sprendžiant drugių filogenijos ir sistematikos problemas. Darbo rezultatų aprobacija ir publikacijos. Šio darbo rezultatai buvo pristatyti 10 tarptautinių ir respublikinių konferencijų: „Baltijos genetikų kongrese“ (Daugpilis, Latvija 2007); IV, V kasmetinėse Tarptautinėse konferencijose „Bioįvairovės tyrimai ir išsaugojimas“ (Daugpilis, Latvija 2007; 2009); Respublikinėje konferencijoje „Lietuvos biologinė įvairovė: būklė, struktūra ir apsauga“ (Vilnius, 2008); Respublikinėje konferencijoje „Gamtos mokslų (biologija, ekologija, fizika) aktualijos ir perspektyvos“ (Šiauliai, 2008); Tarptautinėje konferencijoje „The Vital Nature Sign 3RD (Kaunas, 2009); Tarptautiniame simpoziume „Ecology & Safety“ (Sunny Beach, Bulgarija, 2010); Lietuvos Biochemikų draugijos XI tarptautinėje konferencijoje „LBD 50“ (Tolieja, Molėtų r., 2010); „Tarptautiniame XXVIII šiaurės šalių entomologų kongrese“ (Birštonas, 2010); „XI Europos entomologų kongrese“ (Budapeštas, Vengrija, 2010). Šios disertacijos rezultatai buvo paskelbti 10 mokslinių straipsnių, 6 iš jų – moksliniuose leidiniuose, įrašytuose į Mokslinės informacijos instituto sąrašą.
Išvados 1. Pritaikius dieniniams drugiams naudotus molekulinius tyrimus pirmą kartą nustatyta, kad mtDNR COI geno sekos yra pakankamai informatyvios ir tinkamos primityvių Tischeriidae ir Elachistidae drugių tyrimuose, naudojant specifinį molekulinį žymenį: LCO1490-J-1514, HCO2198-N-2175; 2. Nustatyta, kad Tischeriidae šeimos drugių sekvenuotose mitochondrinės DNR COI geno sekose iš 636 nukleotidų buvo nustatyti 201 polimorfinis ir 435 konservatyvūs nukleotidai būdingi visiems ištirtiems šios šeimos drugiams, o Elachistidae šeimos drugių sekose iš 640 nukleotidų buvo nustatyti 229 variabilūs ir 404 konservatyvūs visiems šios šeimos drugiams; 3. Išaiškinta, kad Tischeridae šeimos rūšių specifinėse COI geno sekose dažniausiai aptinkami T(U) (38,6 %) ir C (16,5 %) nukleotidai, bei dažniausiai pasitaikantis kodonas yra UUA(L) (23,8 %), o Elachistidae šeimos rūšių COI geno sekose dažniausiai aptinkami buvo T(U) (38,7 %) ir A (30,4%) nukleotidai, bei dažniausiai pasitaikantis kodonas – UAU(Y) (16,9 %). Tischeriidae šeimos drugių COI geno sekose neaptikti 7 kodonai: UAA(*), UAG(*), AAG(K), UGU(C), UGC(C), UGG(W), AGG(R), o Elachistidae šeimos drugių sekose neaptiktas tik CUA(L) kodonas; 4. TiekTischeriidae, tiek Elachistidae šeimų skirtingose rūšyse aptiktas skirtingas vidurūšinis mtDNR COI geno variabilumas: Tischeria ekebladella rūšyje aptiktas tik 1 variabilus nukleotidas, tuo tarpu Tischeria dodonea individuose yra 38 variabilūs nukleotidai, Elachista utonella rūšies individų COI geno sekose – 39 variabilūs nukleotidai, tuo tarpu E. argentella, E. albifrontella ir E. humilis rūšių COI genų fragmentuose skirtumų neaptikta; 5. Nustatyta, kad genetiškai tolimiausios yra Elachista bifasciella ir E. tetragonella rūšių grupės tarp kurių COI geno sekų aptikti 187 polimorfiniai nukleotidai, o genetiškai artimiausios yra E. argentella ir E. bedellella rūšių grupės tarp kurių COI geno sekų rasti 87 polimorfiniai nukleotidai; 6. Atlikus Tischeriidae molekulinius tyrimus išaiškinti 3 pagrindiniai klasteriai, tačiau, skirtingai nuo anksčiau publikuotų šeimos kladogramų, Astrotischeria yra seserinė grupė 2 kitoms šakoms kartu paėmus (Tischeria + Coptotriche). Šie duomenys paremia Tischeriidae politipinę koncepciją ir patikslina 3 genčių taksonominį teisėtumą Tischeriidae šeimoje; 7. Molekulinių tyrimų duomenų analizė papildo, o ne prieštarauja anksčiau pateiktai Elachistidae šeimos drugių rūšių kladogramai, kurioje vystymosi linijos pateiktos remiantis būdingais evoliucinius procesus parodančiais morfologiniais požymiais; 8. Elachistidae šeimos drugių populiacijų genetinės įvairovės tyrimai atskleidė nevienodą skirtingų populiacijų genetinės diferenciacijos laipsnį. Mažiausia genetinė diferenciacija nustatyta tarp Elachista argentella drugių populiacijų: Grobšto gamtiniame rezervate, Smiltynėje (Kuršių nerija) ir Čižiūnuose (Trakų r.); didžiausia genetinė diferenciacija nustatyta tarp E. pollinariella drugių populiacijų: Grobšto gamtiniame rezervate (Kuršių nerija) ir Čižiūnuose (Trakų r.).
Moksliniai straipsniai disertacijos tema 1. Paulavičiūtė B. 2007. Twelve rare species of moths (Lepidoptera) collected in Lithuania in 2004–2006. New and Rare for Lithuania Insect species. Records and Descriptions 19: 26–28. ISSN 1648-8555. 2. Paulavičiūtė B. 2008. New data on twenty rare species of moths (Lepidoptera) found in Lithuania. New and Rare for Lithuania Insect species. Records and Descriptions 20: 45–48. ISSN 1648-8555. 3. Paulavičiūtė B. 2008. Nauji duomenys apie Elachistidae (Lepidoptera, Gelechioidea) rūšių paplitimą Lietuvoje. Lietuvos biologinė įvairovė: būklė, struktūra ir apsauga 3: 86–91. ISSN 1822-2781. 4. Paulavičiūtė B., 2008. Molekulinių metodų taikymas drugių (Lepidoptera) taksonomijoje. Jaunųjų mokslininkų darbai 3(19): 105–108. ISSN 1648-8776. 5. Paulavičiūtė B. 2009. New data on seven rare species of Tortricidae (Lepidoptera) found in Lithuania. New and Rare for Lithuania Insect species. Records and Descriptions 21: 109–111. ISSN 1648-8555. 6. Paulavičiūtė B., Paulauskas A., Sruoga V. 2009. Genetic differences among the E. argentella and E. bifasciella species groups (Lepdoptera: Elachistidae: Elachistinae). Acta Biologica Universitatis Daugavpilensis 9(2): 241–248. ISSN 1407-8953. 7. Paulavičiūtė B., Paulauskas A., Sruoga V. 2009. Identification of E. argentella, E. bedelella and E. bifasciella species groups (Lepidoptera: Elachistidae: Elachistinae) by molecular methods. 3rd International Conference The Vital Nature Sign: 91–93. 8. Paulavičiūtė B., Tamutis V. 2009. Melitaea (Nymphalidae) species from collections of T.Ivanauskas zoological museum. Acta Zoologica Lituanica 19(4): 314–317. ISSN 1648-6919. 9. Sruoga V., Stunžėnas V., Paulavičiūtė B. 2009. COI gene as a molecular marker of Elachista species (Lepidoptera: Elachistidae: Elachistinae) from different Lithuanian populations. Proceedings of the Latvian academy of Sciences, Section B 63: 21–24. ISSN 1407-009X. 10. Paulavičiūtė B., Paulauskas A. 2010. DNA diagnostics to identify Elachista (Lepidoptera: Elachistidae: Elachistinae) species. Ecology & Safety 4(1): 47– 52. ISSN 1313-2563. Konferencijų pranešimų tezės: 1. Paulavičiūtė B., Sruoga V. Genetic divergence of Elachista (Lepidoptera: Elachistidae: Elachistinae) species. IV Baltic Genetical Congress. Daugavpils, October 9–12, 2007. 2. Paulavičiūtė B., Sruoga V. DNA analysis of three Elachista (Lepidoptera: Elachistidae: Elachistinae) species. Research and Conservation of Biological Diversity in Baltic Region. 4th International Conference. Daugavpils, 25– 27.04.2007. 3. Paulavičiūtė B. Nauji duomenys apie Elachistidae (Lepidoptera) rūšių paplitimą Lietuvoje. Lietuvos Biologinė įvairovė: būklė, struktūra ir apsauga. Vilnius, lapkričio 27d. 2008 m. 4. Paulavičiūtė B. Molekulinių tyrimo metodų panaudojimas drugių (Lepidoptera) tyrimuose. Gamtos mokslų (biologija, ekologija, fizika) aktualijos ir perspektyvos. Šiauliai, Gegužės 16 d. 2008. 5. Paulavičiūtė B., Paulauskas A., Sruoga V. Identification of E. argentella, E. bedellella and E. bifasciella species groups (Lepdoptera: Elachistidae: Elachistinae) by molecular methods. The Vital Nature Sign. 3RD International Conference, 22–23 May, 2009. 6. Paulavičiūtė B., Paulauskas A., Sruoga V. Genetic differences among Elachista species of the E. argentella, E. bedellella and E. bifasciella species groups (Lepdoptera: Elachistidae: Elachistinae). Research and Conservation of Biological Diversity in Baltic Region. 5th International Conference. Daugavpils, 22–24 April, 2009. 7. Paulavičiūtė B., Paulauskas A. DNA diagnostics to identify Elachista (Lepidoptera: Elachistidae: Elachistinae) species. 19th International Symposium Ecology & Safety. Bulgaria, 7–11 June, 2010. 8. Paulavičiūtė B., Paulauskas A., Sruoga V. Sequences and analysis of the mitochondrial DNA in the Elachista (Lepidoptera: Elachistidae: Elachistinae) moths at the species group level. XI International Meeting of Lithuanian Biochemical Society “LBS 50”.Tolieja, 15–17 June, 2010. 9. Paulavičiūtė B., Paulauskas A., Sruoga V. 2010. Citochrome oxydase I sequences analysis of Elachista (Lepidoptera: Elachistidae: Elachistinae) species. XXVIII Nordic Baltic Congress of Entomology. Birštonas 2–7 of August, 2010. 10. Paulavičiūtė B., Paulauskas A., Sruoga V. 2010. Molecular investigation of Elachista (Lepidoptera: Elachistidae: Elachistinae) moths at the species group level. IXth European Congress of Entomology. Hungary, 22–27 August, 2010.
Brigita Paulavičiūtė Curriculum vitae
Gimimo laikas ir vieta: 1979 05 16, Naujoji Akmenė Adresas: Antakalnio g. 38−5, Kaunas LT-46278 Tel: +37061800583 El. Paštas: [email protected] Išsilavinimas ir profesija: 1997−2001 Vilniaus pedagoginis universitetas, biologijos specialybės bakalaurė 2004−2006 Vilniaus pedagoginis universitetas, biologijos specialybės magistrė 2006−2010 Vytauto Didžiojo universiteto, Gamtos mokslų fakulteto, Biologijos katedros doktorantė Darbinė veikla: 2001−2002 Kauno Šilainių vidurinės mokyklos biologijos mokytoja Nuo 2004 Kauno Tado Ivanausko zoologijos muziejaus bestuburių skyriaus vyr. Zoologė Stažuotės: 20090401−20090530 Mokslinė stažuotė Norvegijoje, Telemark University College, Biotechnologijos labaratorijoje Tyrimų sritis: Tischeriidae ir Elachistidae drugių įvairovė, jų biocheminės sistematikos tyrimai