Rahman et al. BMC Cancer 2010, 10:482 http://www.biomedcentral.com/1471-2407/10/482

RESEARCH ARTICLE Open Access Differential detection of alternatively spliced variants of Ciz1 in normal and cancer cells using a custom exon-junction microarray Faisal A Rahman1,2, Naveed Aziz1, Dawn Coverley1*

Abstract Background: Ciz1 promotes initiation of mammalian DNA replication and is present within nuclear matrix associated DNA replication factories. Depletion of Ciz1 from normal and cancer cells restrains entry to S phase and inhibits cell proliferation. Several alternative splicing events with putative functional consequences have been identified and reported, but many more variants are predicted to exist based on publicly available mRNAs and expressed sequence tags. Methods: Here we report the development and validation of a custom exon and exon-junction microarray focused on the human CIZ1 gene, capable of reproducible detection of differential splice-variant expression. Results: Using a pair of paediatric cancer cell lines and a pool of eight normal lines as reference, the array identified expected and novel CIZ1 splicing events. One novel variant (delta 8-12) that encodes a predicted protein lacking key functional sites, was validated by quantitative RT-PCR and found to be over-represented in a range of other cancer cell lines, and over half of a panel of primary lung tumours. Conclusions: Expression of CIZ1 delta 8-12 appears to be restricted to cancer cells, and may therefore be a useful novel biomarker

Background replication in late G1 phase nuclei [5] and that it coop- Ciz1 (Cip1 interacting zinc-finger protein 1) is a nuclear erate with cyclin E and A in order to execute its func- protein that appears to be encoded by 17 exons that tion in DNA replication [2]. Further detailed analysis map to chromosome 9q34 in man (Unigene Hs.212395). revealed that DNA replication activity resides in the Ciz1 is expressed in a wide range of tissues [1] and con- N-terminal half of Ciz1, while the protein becomes teth- tains N-terminal polyglutamine repeats, 3 zinc finger ered to non-chromatin nuclear matrix structures motifs, one matrin 3 domain at the C-terminal end, 2 through C-terminal sequences that play a role in its putative nuclear localization signals and a number of localization to DNA replication factories [6]. Taken cyclin-dependent kinase phosphorylation sites and together the data suggest that Ciz1 plays a linker role cyclin-binding motifs [2]. Ciz1 was first identified between the DNA replication machinery and the sub- through its interaction with p21/Cip1 [3], a cyclin- nuclear structures that organize their function. dependent kinase (CDK) inhibitor involved in regulation CIZ1 is a hormone-responsive gene [7,8] and is thought of the cell cycle and in cellular differentiation. We iden- to play a role in the development or progression of oestro- tified Ciz1 in a cell-free system that reconstitutes initia- gen responsive tumours. It has also been linked with cer- tion of DNA replication, under the regulation of cyclin tain paediatric cancers [1,9], where alternatively spliced A/CDK2 [4]. Using cell-free and cell-based approaches transcripts are prevalent. Similarly, inappropriate expres- we showed that Ciz1 stimulates initiation of DNA sion of alternatively spliced transcript has been reported to occur in brain tissue from Alzheimer patients [10]. Pre- viously, we surveyed over 600 CIZ1 expressed sequence * Correspondence: [email protected] tags that map to the CIZ1 Unigene cluster [9], to overview 1Department of Biology, University of York, UK Full list of author information is available at the end of the article alternative splicing during development and disease. This

© 2010 Rahman et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Rahman et al. BMC Cancer 2010, 10:482 Page 2 of 12 http://www.biomedcentral.com/1471-2407/10/482

highlighted three exons in the 5′ end of Ciz1 that are com- include probes homologous to exons, observed junc- monly alternatively spliced and potentially mis-spliced tions, hypothetical junctions and retained intron under some circumstances, and suggested a range of other sequences (Fig. 1). The array also includes probes rarer splicing events. homologous to other genes that either emerged from In this study our aim is to look at CIZ1 variant our biochemical studies as Ciz1 interacting partners, expression in order to validate previously reported alter- have roles in cell cycle predicted to interact with Ciz1 native splicing (AS) events, and to discover new ones. or are known to be involved in pathology of sporadic We chose to use an exon junction array because com- cancers (additional file 1 Table S1). For 5′ untranslated monly used methods for splicing analysis such as sequences we included probes that cover possible alter- RT-PCR, cDNA primer extension and nuclease protec- native first exons. These are defined as exon 1a (in tion mapping are extremely labour intensive for highly NCBI Reference Sequence: NM_012127.2 and spliced genes, particularly when analysis of a large num- NM_001131015.1) and exon 1c (NM_001131017.1, ber of samples is expected. Therefore, we have devel- NM_001131018.1 and NM_001131016.1). Other alterna- oped an exon junction-array focused on the human tively used exon 1 s were predicted by AceView (addi- CIZ1 gene that is capable of detecting all known tional file 2 Figure S1) and confirmed by us when variants and hypothetical variants of CIZ1. We present searching CIZ1 EST transcript against the BLAT CIZ1 results generated with this exon array-tool, initially assembly [11]http://genome.ucsc.edu/, and designated using a pair of paediatric cancer cell lines. This identi- exon 1b and 1d (additional file 3 Figure S2). To our fied several novel AS events including one cancer- knowledge inclusion of exon 1b and 1d has not been restricted novel variant that we chose to validate further. verified by inclusion in a full-length human CIZ1 The functional implications of expression of this variant transcript. (which has partial deletion of exon 8 and exon 12 and To allow for a reasonable trade off between signal skipping of exon 9, 10 and 11) are discussed and poten- intensity and specificity, we restricted length of the tial applications highlighted. probes to 40 nucleotides [12]. To increase specificity of probes, interspersed repeats and low complexity DNA Methods sequences were masked (repeats have been replaced by Array and probe design Ns) using repeat masker [13]http://www.repeatmasker. We designed oligonucleotide probes with extensive cov- org. The masked sequences were then searched for simi- erage for CIZ1 mRNAs and predicted variants. These larity against BLAT and areas which showed significant

Figure 1 Schematic representation of the location of human CIZ1 probes, designed to detect expression of the most common predicted exons, less common alternative exons, rare alternative exons containing intronic sequences, most common and observed rare exon-junctions and a selection of hypothetical junctions. For junction probes between most common predicted exon, - indicates the junction such as Ciz1ex2-ex3. For junction probes between less common predicted exons, such as Ciz1 exon 2 alternative 1 and exon 2 alternative 2, the probe designation will be defined as Ciz1-ex2a1-ex2a2. Probe sequences are given in additional file 1 Table S1. Rahman et al. BMC Cancer 2010, 10:482 Page 3 of 12 http://www.biomedcentral.com/1471-2407/10/482

similarity were excluded. For junction probes, we European Collection of Cell Cultures (ECACC) and the employed the sliding window method where the 40 nt Japanese Collection of Research Bioresources (JCRB). can slide across the target junction to allow for near Cells were cultured exactly as recommended. Total similarity in melting temperatures [12]. Probes were RNA was extracted using TRIZOL as recommended by then searched for similarityusingBLASTnon-redun- the manufacturer (Invitrogen). RNA concentration was dant database with expectation value of 10 http://blast. quantified using nanodrop spectrophotometer and equal ncbi.nlm.nih.gov/Blast.cgi[14]. Probes with more than 20 concentrations from each of the eight samples were contiguous identical bases to non-self transcript were pooled together. SKNMC and TC466 Ewing tumour cell excluded. For all probes, exclusion criteria were set to lines were used as test samples to validate the array and include those with hairpin structures with stem exceed- were handled as described previously [9]. ing 9 bases as well as those with self complementarities of more than 6 bases [15]. However, due to the con- Preparation and labeling of templates straints of the exon junctions, these parameters could 20 μg of pooled RNA reference control or test samples not be applied to all probes. As the CIZ1 gene is rich in (SKNMC and TTC466) were reversed transcribed as GCs, the target Tm was set not to exceed 85°C (addi- described and labeled using Invitrogen protocol (Super- tional file 1, Table S1). Probes were synthesized by Script ™Plus Indirect cDNA labeling System). Labelled Operon Biotechnologies GmbH, Cologne, Germany. The reference and test sample (20 μl each) were combined oligonucleotide probes were printed on Nexterion Slides in an amber tube, mixed and heated at 99°C for three E(Schott)usingaQArrayMini (Genetix) as follows: minutes before hybridization. 5 replicates were printed for each probe in a random pattern including buffer as negative controls. Two slides Prehybridization and Hybridization from each batch of printing were analysed for spot qual- Prior to hybridization slides were prepared as mentioned ity using Ribogreen (Molecular Probes). Prior to hybridi- previously. Hybridization was carried out in a final sation, each slide was washed at room temperature as volume of 40 μl in Corning hybridization chambers, in a follows: 1 × 5 min in 0.1% Triton X-100, 2 × 2 min in water bath at 42°C for 16-24 h. Microarray slides were 1 mM HCL, 1 × 10 min in 100 mM KCL. Slides were then washed twice in 1× SSC with 0.1% SDS for five subsequently blocked by incubation in 1 × Nexterion® minutes, once in 0.1× SSC with 0.1% SDS for 5 minutes Blocking E (Schott) for 15 min and then dried by centri- and a final wash in 0.05× SSC for five minutes. Slides fugation. Microarray data associated with this paper was were transferred to a centrifuge tray and spun for three submitted to ArrayExpress (accession: E-MEXP-2331) minutes at 2000 rpm at room temperature to dry. with the experiment name ‘Differential detection of alternatively spliced variants of Ciz1′. Image acquisition and data analysis Slides were scanned using GenePix 4000B microarray Cell culture and RNA extraction scanner and images were analyzed using GenePix soft- A pool of eight stable cell lines of non-tumour origin ware where a grid layout was applied to the features. were used as a reference control, (IMR90, WI38, Data analysis was performed using ArrayAssist software HEK293,MRC5,HFL1,ASF-4-1,TIG-2M-30and where background correction was done using fore- RPM1788, Table 1). Cell lines were obtained from the ground-background (FG-BG). Features with signal inten- sities less than 2.5 fold of the mean background signal Table 1 Cell lines used in this analysis were removed, and ratios were normalized using house- keeping gene normalization [16] and were averaged and Cell line Derivation Reference log transformed. TTC466 Ewings Tumour [23] SKNMC PNET [24] Reverse-Transcriptase PCR H727 Human bronchial carcinoid [25] cDNA was generated using superscript III Synthesis Kit IMR90 Human embryonic lung [26] according to manufacturer’s instructions (Invitrogen). WI38 Human embryonic lung [27] Normalization of input cDNA was done using Actin for- HEK293 Human embryonic kidney [28] ward (5′CAACCGCGAGAAGATGACC3′) and reverse MRC5 Human embryonic lung [29] primers (5′TCCAGGGCGACGTAGCA CA3′)asendo- exon 8 HFL1 Human embryonic lung [30] genous control. For CIZ1 sequences spanning to exon 13,primersCiz1-ex8F(5′CTCCAGGGCAGTTA- ASF-4-1 Skin fibroblast from upper arm [31] CAGGAC3′) and Ciz1-ex13R2 (5′TGCGAGGGGTT RPMI 1788 normal blood, IgM secreting [32] TTGAAGTAG3′) were PCR amplified at 58°C annealing TIG-2M-30 muscle, normal diploid fibroblast [33] temperature using phusion high-fidelity DNA polymerase Rahman et al. BMC Cancer 2010, 10:482 Page 4 of 12 http://www.biomedcentral.com/1471-2407/10/482

(Finnzymes). For the variant with partial deletion of exon 8 probe in either cell line suggesting a problem with the and exon 12 and skipping of exon 9, 10 and 11,splicejunc- probe. For the remaining 3 (Fig. 2A, B), their failure was tion specific primers were used. Forward primer, Ciz1- cell-line specific, possibly reflecting severe under or over jex8-ex12F (5′CTCCAGGGCAGTTACAGGAC3′)and expression outside the detection parameters of this ana- reverse primer hCiz1-Jex13-ex14R (5′CTCAAGCGACTT- lysis. For the 73 CIZ1 junction probes used here repro- CAGCTCCT3′)werePCRamplifiedat60°Cannealing ducible data was not available for 5 junctions observed temperature using Taq polymerase (New England Biolab in the EST databases and 14 that were rare or hypothe- (NEB). For alternative exon 1 s, forward primers Ciz1- tical junctions for SKNMC cells (Fig. 3). Similarly for ex1b (5′CAGACGGACCTTGGT CTCC3′), Ciz1-exon 1c TTC466, of the 73 junction probes, data was not avail- (5′GCGACTTGAGCGTTGAGG3′)andCiz1-ex1d(5′ able for 4 observed junctions and 17 rare or hypotheti- GGCGG TGGTGGAGAGAAG3′) were all combined with cal junctions (Fig. 4). Three of the observed and 11 of reverse primer Ciz1-ex5R (5′CGATTGG GGGTGGTA- the rare or hypothetical junctions were common to both GAGG3′) in separate reactions. Taq polymerase (NEB) cell lines. We consider these figures to be within the was used for amplification at annealing temperatures of expected range due to the constraints inherent in 60°C, 62°C and 56°C respectively. designing probes for exon junctions, coupled with the fact that some of the hypothetical junctions may never Quantitative Real-Time PCR exist in reality. Of greater interest is the hypothetical Reactions were carried out using an ABI 7000, initial junctions that were consistently represented in the tran- incubation at 95°C/10 min, followed by 95°C/15 sec and scriptome of these two cell lines. These are ex1ca1-ex2, 1 min at 60°C for 40 cycles. Triplicate reactions were ex1c-ex2a2, ex1c-ex4, ex1c-ex6, ex2-ex7 and ex7-ex10 carried out in 96-well plates in a 25 μl reaction volume (depicted graphically in additional file 3 Figure S2), indi- containing 12.5 μl cyber green Master Mix (Applied cating an unanticipated level of AS around untranslated Biosystems), 20 ng cDNA and 200 nM each of hCiz1- exons 1 and 2. Jex8-ex12F forward and hCiz1-Jex13-ex14R reverse. Pri- Analysis of 3 technical replicates for Ewings tumour mers used for normalization include, Actin F and Actin cell line SKNMC showed that CIZ1 exon 1b is up-regu- RaswellasGAPDHforward(5′ATCCCATCAC- lated and CIZ1 intron 12 (alternative exon) is down CATCTTCCAGG3′)andreverse(5′GCATC GCC regulated relative to the reference template, although CCACTTGATTTTG 3′). both fall only just within inclusion criteria of 1.5 fold change. When compared to 2 further biological repli- Results and discussion cates (isolated from separate population of SKNMC CIZ1 is represented by 865 GenBank entries that map to cells), neither probe proved to be consistently different Unigene Build number 224, cluster Hs.212395. These to the reference template (Table 2 and Fig. 2A). How- mRNAs and ESTs were aligned cooperatively by Ace- ever similar analysis of cell line TTC466 also indicated View [17] to exclude redundancies producing 27 mRNA differential expression of the alternative exon 1s.Infact assemblies (additional file 2 Figure S1 1). These were CIZ1 exon 1c was considerably up-regulated in all three then aligned to the gene sequence and exon boundaries biological replicates (Table 3), with an SEM of 0.355135 and splice junctions identified. CIZ1 probes were between the three technical replicates (Fig. 2B). More- designed from constitutive regions, alternative regions over among the exon 1c-junction probes, 4 were consis- and observed exon-exon splice junctions. To allow for tently up-regulated relative to the reference control in discovery of novel alternative splicing events, we also all 3 biological replicates and 3 of these were among the designed probes representing hypothetical exon-exon top 4 ranked products [18] (additional file 4 Table S2). junctions. The array is designed to survey overall CIZ1 This analysis revealed splicing of exon 1c onto exon 2 alternative splicing in different tissues, diseases and (variant 2), exon 4 and exon 6 and splicing of alternative developmental stages, with the aim of substantiating exon 1c (1ca1) onto exon 2 (Table 3 and Fig. 3). observed alternative splicing features and identifying Other genes in this study that were overrepresented in novel alternative splicing events. Here we discuss initial all technical and biological replicates were RB1 and array results on the SKNMC PNET and TTC466 Ewing VPS72 for SKNMCS cell line, and CDC2, CDC6, tumour cell lines. TNRC9 and DDX17 in TTC466 cells (additional files 6 Analysis of the technical replicates in this study and 7 Tables S4-S13). VPS72 is an interacting partner of showed that out of 26 exon probes the data was consis- EWSR1 gene [19]. RB1, CDC2 and CDC6 may share the tent and informative for 24 probes (92%) for the same pathways as CIZ1 gene. Expression of these genes SKNMC cell line and 23 probes (88.5%) for TTC466 needs to be validated and their function with regard to cell line. Data was not obtained for the CIZ1 exon 17 Ciz1 further analysed. Rahman et al. BMC Cancer 2010, 10:482 Page 5 of 12 http://www.biomedcentral.com/1471-2407/10/482

Figure 2 Expression of CIZ1 in paediatric cancer cell lines revealed by hybridization to CIZ1 exon probes. A:CIZ1exonexpressionin primitive neural ectodermal tumour (PNET) cell line SKNMC. B: CIZ1 exon expression in Ewing tumour TTC466 cell line. Plots show the average of three technical replicates expressed as log2 of the ratio between signal generated by the test sample and signal generated by reference RNA. Change is considered to be significant where this fall outside 0.58 or -0.58 and therefore exceed 1.5 fold relative to control. Bars indicating SEM are shown for probes included by these selection criteria. No reliable data was achieved for probes indicated with a grey dot.

Expression of alternative exon 1s consistent up-regulation in TTC466 cell line as well as the We surveyed CIZ1 ESTs using BLAT [11] to review alter- junctions of exon 1c and other exons (2, 4 and 6). Taken native usage of exon 1. This showed that CIZ1 exon 1c is together these results suggest that exon 1c is the most supported by 4mRNAs and 139 ESTs which exceeds by widely used alternative exon 1 for the CIZ1 gene. Protein far the number of mRNAs and ESTs supporting other translation for alternative usage of exon 1 s on the back- exon 1 s. The second most common is exon 1b supported ground of full length Ciz1 showed that exon 1c and 1d by 16 ESTs. This analysis might not reflect the true nature would encode the same protein. On the other hand trans- of exon 1 usage due to possible bias towards 3′ exons. In lation for exon 1b showed there are two additional pre- this study, we detected over-expression of the novel alter- dicted methionines upstream of the usual predicted native exon 1b in technical replicates of both SKNMC and methionine in exon 2, adding an extra 28 amino-acids to TTC466 cell lines (Tables 2 and 3), however no change the N-terminal end of the Ciz Protein. 5′ UTR selection was observed in biological replicates of the two cell lines. has been shown to affect alternative splicing of down- On the other hand for exon 1c, array results showed stream exons. For example, for oestrogen receptor b it has Rahman et al. BMC Cancer 2010, 10:482 Page 6 of 12 http://www.biomedcentral.com/1471-2407/10/482

Figure 3 Expression of CIZ1 in paediatric cancer cell lines revealed by hybridization to CIZ1 exon-junction probes for SKNMC PNET cell line. Plots show the average of three technical replicates expressed as log2 of the ratio between signal generated by the test sample and signal generated by reference RNA. Change is considered to be significant where this fall outside 0.58 or -0.58 and therefore exceed 1.5 fold relative to control. Bars indicating SEM are shown for probes included by these selection criteria. No reliable data was achieved for probes indicated with a grey dot. Rahman et al. BMC Cancer 2010, 10:482 Page 7 of 12 http://www.biomedcentral.com/1471-2407/10/482

Figure 4 Expression of CIZ1 in paediatric cancer cell lines revealed by hybridization to CIZ1 exon-junction probes for TTC466 Ewing tumour. Plots show the average of three technical replicates expressed as log2 of the ratio between signal generated by the test sample and signal generated by reference RNA. Change is considered to be significant where this fall outside 0.58 or -0.58 and therefore exceed 1.5 fold relative to control. Bars indicating SEM are shown for probes included by these selection criteria. No reliable data was achieved for probes indicated with a grey dot. Rahman et al. BMC Cancer 2010, 10:482 Page 8 of 12 http://www.biomedcentral.com/1471-2407/10/482

Table 2 Summary of CIZ1 alternative splicing in SKNMC cell line SKNMC exon probes Average of 3 technical replicates (B1) Biological replicate 2 Biological replicate 3 Ciz1-ex1b2 + = = Ciz1-intron 12 - = - SKNMC junction probes Ciz1-ex8a0-ex12a1 + + + Ciz1-ex8af2-ex15 + + = Ciz1-ex12-ex13 + + + Ciz1-ex15-ex16 - = = Three independent RNA isolates from proliferating SKNMC cell (Biological replicates, B1, B2 and B3) were analysed on individual arrays, with one isolate undergoing analysis in triplicate (technical replicate, T1, T2 and T3 shown in Fig. 2A and 3). Probes that are up or down regulated more that 1.5 fold and who’s SEM indicate agreement between three technical replicates are shown. Results for these probes derived from the two further biological replicates (replicate 2 and replicate 3) are also shown. + indicates significantly up-regulated, - indicates significantly down-regulated and = indicates no significant change. Significance is taken to be a change that is ≥ 1.5 fold compared to control RNA. For paediatric cancer cell line SKNMC, expression of two probes was consistently and significantly altered compared to control samples, these are Ciz1-ex8a0-ex12a1 and Ciz1-ex12-ex13. Raw data is given in Additional file 5, tables S4-S8. been reported that alternative 5′ UTR influences splicing Exclusion of exon 4 and may alter protein function [20]. Furthermore, inap- Previously, we showed that an alternatively spliced propriate expression of 5′ UTRs has been implicated in human CIZ1 variant, with deletion of exon 4 (ΔE4), is carcinogenesis in the case of BRCA1 [21] and Mdm2 [22]. mis-expressed as a consequence of intronic mutation in The functional significance of CIZ1 alternative exon 1 Ewings Tumour (ET) cell lines, including the two cell expression requires further investigation, however their lines used here [9]. However, skipping of exon 4 was not expression may play a role in specifying alternative splicing reproducibly detected in either cell line. This is most of the rest of the CIZ1 gene. likely due to constraint inherent in the sequence of

Table 3 Summary of CIZ1 alternative splicing in TTC466 Ewing cell line TTC466 exon probes Average of 3 technical replicates Biological Biological (Biol. 1) replicate 2 replicate 3 Ciz1-ex1 + nd = Ciz1-ex1b1 + = = Ciz1-ex1c + + + Ciz1-ex2 + = = Ciz1-ex3 + + + TTC466 junction probes Ciz1-ex1ca1-ex2 + + + Ciz1-ex1c-ex2a2 + + + Ciz1-ex1c-ex4 + + + Ciz1-ex1c-ex6 + + + Ciz1-ex2-ex7-a + + + Ciz1-ex2-ex7-b + = = Ciz1-ex4-ex5 + + + Ciz1-ex7-ex10 + + + Ciz1-ex8a0-ex12a1 - nd _ Ciz1-ex9-ex10 + + + Ciz1-ex13-ex14 + = = Ciz1-ex15-ex16 _ = = Ciz1-ex16-ex17 + = = Three independent RNA isolates from proliferating TTC466 cells (Biological replicates, B1, B2 and B3) were analysed on individual arrays, with one isolate undergoing analysis in triplicate (technical replicate, T1, T2 and T3). Probes that are up or down regulated more that 1.5 fold and who’s SEM indicate agreement between three technical replicates are shown. Results for these probes derived from the two further biological replicates (replicate 2 and replicate 3) are also shown. + indicates significantly up-regulated, - indicates significantly down-regulated and = indicate no significant change. For paediatric cancer cell line TTC466, expression of 2 exon probes was consistently and significantly altered compared to control samples, these are Ciz1-ex1c and Ciz1-ex3. For exon junction probes a total of 8 probes met all our selection criteria. These are Ciz1-ex1ca1-ex2, Ciz1-ex1c-ex2a2, Ciz1-ex1c-ex4, Ciz1-ex1c-ex6, Ciz1-ex2-ex7-a, Ciz1-ex4-ex5, Ciz1-ex7- ex10 and Ciz1-ex9-ex10. Raw data is given in Additional file 6, tables S9-S13. Rahman et al. BMC Cancer 2010, 10:482 Page 9 of 12 http://www.biomedcentral.com/1471-2407/10/482

CIZ1 junction exon 3-exon 5. Thus, this approach is not because the same probe is up-regulated in all replicate suitable for further investigation of alternative splicing at experimentscarriedoutwithSKNMCcells.Thisisthe this site. only probe that is significantly altered in both cell lines, albeit upregulated in one and down regulated in the A novel cancer-associated variant other. This probe indicates expression of a CIZ1 splice In addition to extensive AS of exon 1c , for TTC4666 variant with partial deletion of exon 8 and 12 and skip- cells a further 9 probes were significantly under or over ping of exon 9, 10 and 11, and is the top one of 4 ranked represented in 3 technical replicates compared to the products for SKNMC cells (additional file 4 Table S2). reference control, and four of these (2-7a, 4-5, 7-10, To further investigate alternative splicing between 9-10) were reproducibly detected in 2 further biological exon 8 and 12 in human CIZ1 (Fig. 5A), we used RT- replicates. We were most interested in one probe (8a0- PCR from exon 8 (forward primer 8F) coupled with a 12a1) that is down-regulated in 3 of 3 technical repli- reverse primer in exon 13 (13R). Results showed 3 tran- cates and 2 of 3 biological replicates in TTC466 cells, scripts in Ewings tumour cell lines and also in a third

Figure 5 Detection of over expressed CIZ1 spliced variants in cancer cell lines. A: Schematic representation of CIZ1 exon 8 to exon 13 and the primers (Ciz1-ex8F-Ciz1-ex13R) used for amplification. Schematics I-III corresponds to the 3 bands seen in Fig. 5B (upper panel) which were verified by sequencing. Schematic I represents full length exon 8-13, II shows partial deletion of exon 8 and III shows partial deletion of exon 8 and skipping of exon 9. Schematic IV indicates primers used to amplify the product shown in Fig. 5B (middle panel) and in Fig. 5C and D. B: Upper, RT-PCR using the primer pair Ciz1-ex8F and Ciz1-ex13 R. Middle, RT-PCR using variant specific primers (Ciz1-jex8-ex12F - Ciz1-jex13-ex14R). Bottom, actin primers were used for normalization. The panel includes three normal cell lines (HFL1, ASF and TIG) and three cancer cell lines TTC466, SKNMC and H727). Stars indicate sequenced bands. C: Validation of microarray result for exon 8-12 with SKNMC and TTC466. Histogram shows average quantitative PCR result for 3 replicates with SEM. Results were normalised to Actin levels and calibrated to pooled reference RNA (8 normal cell lines including, IMR90, WI38, HEK293, MRC5, HFL1, ASF-4-1, TIG-2M-30 and RPM1788), as used in the microarray experiment. D: Quantitative PCR with Ciz1 splice variant specific primers (Ciz1-jex8-ex12F and Ciz1-jex13-ex14R). The panel includes lung (SBC2, SBC5 and H727), cervix (Hela), and Urothelial cancer cell lines (RT112, RT4 and EJ). Normal cell lines were also included (HFL and TIG) as well as the reference poole RNA, which was used as calibrator. Results were normalized to GAPDH. Rahman et al. BMC Cancer 2010, 10:482 Page 10 of 12 http://www.biomedcentral.com/1471-2407/10/482

cancer cell line H727 (human lung carcinoid). Three 8-exon 12) in SKNMC and slight down-regulation in products of the same mobility were detectable in 3 nor- TTC466 cell line (Fig. 5C), validating results obtained by mal cell lines, but at considerably lower levels for the array analysis. Quantitative detection of this apparently smaller of the three (Fig. 5B, upper). Thus, these pro- cancer-associated variant was extended to cover other ducts are over-expressed in cancer cell lines. Sequencing cancer cell lines derived from lung (SBC2, SBC5 and revealed the upper band (1344bp) to be the expected H727), cervix (Hela) and urothelial cells (RT112, RT4 CIZ1 full-length sequence (Reference sequence and EJ). Two individual normal cell lines HFL and TIG, NM_0121276.2, Fig. 5A), the middle band to lack as well as the pooled reference RNA were included as sequences internal to exon 8 (168 bp) and the lower controls. Significant (greater than 2 fold) over- expres- band to lack this region plus the whole of exon 9 (1054 sion was detected in four of the 7 cancer cell lines (Fig. bp). Taking NM_012127.2 as a reference sequence the 5D). Furthermore, using Tissue Scan lung cancer array exon 9 deletion is described as c.1338_1505del168 and HLRT504 (Origene), we performed quantitative real- exon 9 skipping as r.1702_1823del. Despite its preva- time PCR on cDNA obtained from 48 tissues. Results lence in the cancer cell lines we studied, to our knowl- showed significantly elevated levels of this CIZ1 splice edge, this is the first time this variant has been reported. variant in 13 tumour samples compared to the matched Neither of these events is represented by probes in our paired normal controls (Fig. 6). Thus, the data indicate array. Notably, the variant detected by our array that that exclusion of exon 9, 10, 11 andpartofexon 8and splices exon 8toexon 12 (c1038_2218del1181) was exon 12 is a recurrent event in cancer cells. This variant barely detectable by this analysis. Therefore in order to (c1038_2218del1181) lacks sequences that encode motifs quantify its expression we designed specific primers that are important for the function of Ciz1 in DNA Ciz1-jex8-ex12F-Ciz1-jex13-ex14R (Fig. 5A). Results replication. Bioinformatic analysis revealed that the showed increased expression in SKNMC cells compared excluded sequence encodes as many as 6 putative CDK to 3 normal cell lines (HFL, ASF and TIG) and compar- phosphorylation sites and 2 cyclin interaction sites (CY able expression in TTC466 cells (Fig. 5B, middle). The motifs). Notably sequences encoded by exon 9 engage in 165 bp product was sequenced, verified for SKNMC and sequential interaction with cyclin E and A, and support TTC466 and found to be as expected. Similar results functional cooperation with cyclinA/CDK2 driving were obtained by quantitative real time PCR after nor- initiation of DNA replication in vitro [2]. This analysis malisation to actin levels and calibration to the pooled was carried out with murine Ciz1 protein which is 64% reference RNA used in the arrays. As expected, results homologous at the protein level to human Ciz1 in this showed significant over expression for this variant (exon region (exon 8-12). As the human variant described here

Figure 6 Quantitative PCR with CIZ1 splice variant specific primers (Ciz1-jex8-ex12F and Ciz1-jex13-ex14R) in Lung cancer.Thelung cancer Tissue Scan cDNA array (HLRT504, Origene) contains matched pair sets of 48 tissues covering four disease stages and normal tissues. Each pair set is calibrated to its normal tissue and results were normalized to Actin. Grey columns indicates tumour and white columns indicates paired normal tissue. Rahman et al. BMC Cancer 2010, 10:482 Page 11 of 12 http://www.biomedcentral.com/1471-2407/10/482

is lacking these sequences our extrapolation is that it RNA; NEB: New England Biolab; RB1: retinoblastoma 1; VPS72: vacuolar protein sorting 72 homolog (S. cerevisiae); CDC2: cell division cycle 2; CDC6: will not be active in DNA replication, despite most cell division cycle 6 homolog (S. cerevisiae); TNRC9: TOX high mobility group likely retaining down-stream sequences that anchor Ciz1 box family member 3; DDX17: DEAD (Asp-Glu-Ala-Asp) box polypeptide 17; to the nuclear matrix [6]. Although further functional UTR: Un-Translated Region; BRCA1: breast cancer 1; Mdm2: Murine double minute 2; SEM: Standard Error of the Mean; GAPDH: glyceraldehyde-3- analyses are needed to understand the impact that phosphate dehydrogenase. expression of this variant has on DNA replication, these data suggest it may interfere with the normal function Acknowledgements This work was funded wholly by Yorkshire Cancer Research (registered of Ciz1. charity 516898). All authors are employees of the University of York. We thank N Copeland and J Ainscough for critical comments on the Conclusion manuscript.

Expression of variant 8a0-12a1 that is restricted to can- Author details cer cells may offer a useful marker for their detection. 1Department of Biology, University of York, UK. 2Parkwood Hospital, Furthermore, because siRNA depletion of Ciz1 has been Blackpool, UK. shown to delay S phase entry and restrain cell prolifera- Authors’ contributions tion [5], selective inhibition of CIZ1 variants have FAR participated in the design of the study, carried out molecular genetic potential to offer selective restraint of those cell that studies, statistical analysis, data interpretation and drafted the manuscript. NA participated in the design of the study, statistical and data interpretation. express them. Thus variant 8a0-12a1 has potential appli- DC conceived of the study, and participated in its design and coordination cation as a selective therapeutic target in some lung can- and helped to draft the manuscript. All authors read and approved the final cer patients. manuscript.

Competing interests Additional material DC is partly supported by and holds shares in University of York spin-out Cizzle Biotechnology. The CIZ1 splice variant array, and the delta 8-12 variant described in this paper were patent protected by the University of York on Additional file 1: Table S1. Probe sequences. 30 July 2009. Additional file 2: Figure S1. Schematic representation of predicted human Ciz1 alternatively spliced transcripts assembled by AceView from Received: 28 August 2009 Accepted: 10 September 2010 865 mRNA and ESTs submitted to GenBank [17]. Blue lines represent Published: 10 September 2010 exons, black represent introns, yellow represent 5’ or 3’ untranslated regions and * represent non canonical exon-intron boundaries. References Alternative transcript assemblies were designated, B, A, E, F, G, H, I, J, K, L, 1. Warder DE, Keherly MJ: Ciz1, Cip1 interacting zinc finger protein 1 binds M, P, Q, R, S, V, W, Y, Z, 27, 28, 29, 30, 31 and 32 by AceView. the consensus DNA sequence ARYSR(0-2)YYAC. Journal of Biomedical Additional file 3: Figure S2. Observed and hypothetical exon-junctions Science 2003, 10:406-417. generated by alternative splicing of Ciz1 alternative exon 1 s (ex 1a, ex 2. Copeland NA, Sercombe HE, Ainscough J, F-X , Coverley D: Ciz1 1b, ex 1c and ex 1d). Common exons are indicated by labelled boxes cooperates with cyclin A/CDK2 to activate mammalian DNA replication and less common alternative exons by solid black boxes. Observed and in vitro. Journal of Cell Science . hypothetical junctions are indicated by black and grey broken lines 3. Mitsui K, Matsumoto A, Ohtsuka S, Ohtsubo M, Yoshimura A: Cloning and respectively. Splicing events that are over represented in TTC466 are characterization of a novel P21Cip1/Waf1_ interacting zinc finger protein, indicated by solid lines. Sequences at 3’ end of alternative exon 1 s are Ciz1. Biochemical and Biophysical Research Communications 1999, given in additional file 7 Table S14. 264:457-464. Additional file 4: Table S2. Ranked product, top 4 up-regulated probes 4. Coverley D, Laman H, Laskey RA: Distinct roles for cyclins E and A during in technical replicates of SKNMC. Table S3 Ranked product, top 4 up- DNA replication complex assembly and activation. Nature Cell Biology regulated probes in technical replicates of TTC466. 2002, 4:523-528. 5. Coverley D, Marr J, Ainscough JF-X: Ciz1 promotes mammalian DNA Additional file 5: Table S4. microarray result for SKNMC technical replication. Journal of Cell Science 2005, 118:101-112. replicate 1 (T1). Table S5 microarray result for SKNMC technical replicate 6. Ainscough JF, Rahman FA, Sercombe H, Sedo A, Gerlach B, Coverley D: C- 2 (T2). Table S6 microarray result for SKNMC technical replicate 3 (T3). terminal domains deliver the DNA replication factor Ciz1 to the nuclear Table S7 microarray result for SKNMC biological replicate 2 (B2). Table matrix. J Cell Sci 2007, 120:115-124. S8 microarray result for SKNMC biological replicate 3 (B3). 7. den Hollander P, Rayala SK, Coverley D, Kumar R: Ciz1, a novel DNA- Additional file 6: Table S9. microarray result for TTC466 technical binding coactivator of the estrogen receptor a, confers hypersensitivity replicate 1 (T1). Table S10 microarray result for TTC466 technical to estrogen action. Cancer Research 2006, 66:11021-11030. replicate 2 (T2). Table S11 microarray result for TTC466 technical 8. Hakim O, John S, Ling JQ, Biddie SC, Hoffman AR, Hager GL: Glucocorticoid replicate 3 (T3). Table S12 microarray result for TTC466 biological receptor activation of the Ciz1-Lcn2 locus by long range interactions. J replicate 2 (B2). Table S13 microarray result for TTC466 biological Biol Chem 2009, 284:6048-6052. replicate 3 (B3). 9. Rahman FA, Ainscough JF-X, Copeland N, Coverley D: Cancer-associated Additional file 7: Table S14. Sequences of alternative exon 1 (3’ end). missplicing of exon 4 influences the subnuclear distribution of the DNA replication factor Ciz1. Human Mutation 2007, 28:993-1004. 10. Dahmcke CM, Buchmann-Moller S, Jensen NA, Mitchelmore C: Altered splicing in exon 8 of the DNA replication factor CIZ1 affects subnuclear distribution and is associated with Alzheimer’s disease. Mol Cell Neurosci Abbreviations 2008, 38:589-594. PNET: primitive neuroectodermal tumor; Ciz1: CDKN1A interacting zinc finger 11. Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM, protein 1; RT-PCR: reverse transcriptase polymerase chain reaction; AS: Haussler D: The human genome browser at UCSC. Genome Res 2002, alternative splicing; EST: expressed sequence tag; BLAST: Basic Alignment 12:996-1006. Search Tool; BLAT: Blast-Like Alignment Tool; cDNA: DNA complementary to Rahman et al. BMC Cancer 2010, 10:482 Page 12 of 12 http://www.biomedcentral.com/1471-2407/10/482

12. Srinivasan K, Shiue L, Hayes JD, Centers R, Fitzwater S, Loewen R, Edmondson LR, Bryant J, Smith M, Rommelfanger C, Welch V, Clark TA, doi:10.1186/1471-2407-10-482 Sugnet CW, Howe KJ, Mandel-Gutfreund Y, Ares M Jr: Detection and Cite this article as: Rahman et al.: Differential detection of alternatively measurement of alternative splicing using splicing-sensitive microarrays. spliced variants of Ciz1 in normal and cancer cells using a custom Methods 2005, 37:345-359. exon-junction microarray. BMC Cancer 2010 10:482. 13. Smith AFA, Hubley R, Green P: RepeatMasker Open-3.0 1996. 14. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997, 25:3389-3402. 15. Le K, Mitsouras K, Roy M, Wang Q, Xu Q, Nelson SF, Lee C: Detecting tissue-specific regulation of alternative splicing as a qualitative change in microarray data. Nucleic Acids Res 2004, 32:e180. 16. Richmond CS, Glasner JD, Mau R, Jin H, Blattner FR: Genome-wide expression profiling in Escherichia coli K-12. Nucleic Acids Res 1999, 27:3821-3835. 17. Thierry-Mieg D, Thierry-Mieg J: AceView: a comprehensive cDNA- supported gene and transcripts annotation. Genome Biol 2006, 7(Suppl 1 (S12)):11-14. 18. Breitling R, Armengaud P, Amtmann A, Herzyk P: Rank products: a simple, yet powerful, new method to detect differentially regulated genes in replicated microarray experiments. FEBS Lett 2004, 573:83-92. 19. Rual JF, Venkatesan K, Hao T, Hirozane-Kishikawa T, Dricot A, Li N, Berriz GF, Gibbons FD, Dreze M, Ayivi-Guedehoussou N, Klitgord N, Simon C, Boxem M, Milstein S, Rosenberg J, Goldberg DS, Zhang LV, Wong SL, Franklin G, Li S, Albala JS, Lim J, Fraughton C, Llamosas E, Cevik S, Bex C, Lamesch P, Sikorski RS, Vandenhaute J, Zoghbi HY, Smolyar A, Bosak S, Sequerra R, Doucette-Stamm L, Cusick ME, Hill DE, Roth FP, Vidal M: Towards a proteome-scale map of the human protein-protein interaction network. Nature 2005, 437:1173-1178. 20. Smith L: Post-transcriptional regulation of gene expression by alternative 5’-untranslated regions in carcinogenesis. Biochem Soc Trans 2008, 36:708-711. 21. Sobczak K, Krzyzosiak WJ: Structural determinants of BRCA1 translational regulation. J Biol Chem 2002, 277:17349-17358. 22. Okumura N, Saji S, Eguchi H, Nakashima S, Saji S, Hayashi S: Distinct promoter usage of mdm2 gene in human breast cancer. Oncol Rep 2002, 9:557-563. 23. Zhang J, Hu S, Schofield DE, Sorensen PH, Triche TJ: Selective usage of D- Type cyclins by Ewing’s tumors and rhabdomyosarcomas. Cancer Res 2004, 64:6026-6034. 24. Dunn T, Praissman L, Hagag N, Viola MV: ERG gene is translocated in an Ewing’s sarcoma cell line. Cancer Genet Cytogenet 1994, 76:19-22. 25. Takahashi T, Nau MM, Chiba I, Birrer MJ, Rosenberg RK, Vinocour M, Levitt M, Pass H, Gazdar AF, Minna JD: p53: a frequent target for genetic abnormalities in lung cancer. Science 1989, 246:491-494. 26. Nichols WW, Murphy DG, Cristofalo VJ, Toji LH, Greene AE, Dwight SA: Characterization of a new human diploid cell strain, IMR-90. Science 1977, 196:60-63. 27. Hayflick L, Moorhead PS: The serial cultivation of human diploid cell strains. Exp Cell Res 1961, 25:585-621. 28. Shaw G, Morse S, Ararat M, Graham FL: Preferential transformation of human neuronal cells by human adenoviruses and the origin of HEK 293 cells. Faseb J 2002, 16:869-871. 29. Jacobs JP, Jones CM, Baille JP: Characteristics of a human diploid cell designated MRC-5. Nature 1970, 227:168-170. 30. Breul SD, Bradley KH, Hance AJ, Schafer MP, Berg RA, Crystal RG: Control of collagen production by human diploid lung fibroblasts. J Biol Chem 1980, 255:5250-5260. 31. Kaji K, Kanda N: Cellular aging and growth characteristics of two human Submit your next manuscript to BioMed Central skin fibroblast strains, derived from a same individual at different ages and take full advantage of: of a 11 years interval. BiomedGerentol 1992, 16:132. 32. Rubinstein HM, Lubrano T, Mathews HL, Lange CF, Silberman S, Adams EM, Minowada J: A lymphocyte cell line that makes serum cholinesterase • Convenient online submission instead of acetylcholinesterase. Biochem Genet 1984, 22:1171-1175. • Thorough peer review 33. Aizawa S, Mitsui Y, Kurimoto F, Matsuoka K: Cell-surface changes • No space constraints or color figure charges accompanying aging in human diploid fibroblasts: effects of tissue, donor age and genotype. Mech Ageing Dev 1980, 13:297-307. • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar Pre-publication history • Research which is freely available for redistribution The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2407/10/482/prepub Submit your manuscript at www.biomedcentral.com/submit