MAY 2020 EDITION:

ABN 2020 - 3 AFRICAN (NEWS FROM MARCH AND APRIL) BUTTERFLY THE LEPIDOPTERISTS’ SOCIETY OF AFRICA NEWS

LATEST NEWS

Welcome to May’s newsletter!

This edition of ABN, in terms of pages, is the largest to date; if nothing else, the extraordinary recent circumstances have given many of us an opportunity to photograph the butterflies found in our own gardens!

The 3rd Afrotropical Lepidoptera Workshop, scheduled for Gabon in November, has had to be postponed as a result of the coronavirus pandemic and there is concern about the LepSoc Africa annual conference, scheduled for the weekend of 12 – 13 September. I have provisionally booked the Nestle Centre at Walter Sisulu Botanical Gardens, Roodepoort, Gauteng - BotSoc have currently closed the venue, but let’s hope that the situation improves dramatically in the coming months.

Corrections

Mark Williams and Thomas Desloges noted that I’d omitted Bicyclus mandanes from the list of Bush Browns for which I’d proposed English names. Mark also noticed that Bicyclus campa had been misspelt as B. campus.

Steve Collins pointed out that photographs of Euptera hirundo rufa and Charaxes crossleyi ansorgei had been incorrectly captioned Euptera elabontas and Charaxes eurinome respectively. Charaxes zelica zelica should have been C. z. depunta.

Steve has kindly volunteered to proof-read draft copies of African Butterfly News; I’m hopeful that this edition will be free of any obvious taxonomic errors!

Butterfly releases at weddings Jerome Alexander requested that I warn people about a commercial operation being undertaken by Earle Whitely in KwaZulu-Natal. The business offers to breed butterflies for release at weddings; according to Jerome, he ordered 200 butterflies, which cost R10 000 – it turned out that 80% of them were dead. A colleague of his had a similar experience.

1

Chrysoritis paper

A new paper on Chrysoritis has been published by a team of researchers including Alan Heath. The paper does not include any taxonomic revisions, but investigates the phylogenetic and biogeographic history of the genus and establishes evolutionary branches for both the C. chrysaor and C. thysbe species groups and lineages that fall between them.

The estimated age of divergence of Chrysoritis from a common ancestor is 32 million years although the rapid diversification of the thysbe group seems to have occurred in the last 2 million years. Western fynbos appears to be the source of origin of the thysbe group, whereas the C. chrysaor group has radiated from the more easterly parts of South Africa.

Chrysoritis

Insect apocalypse – latest

A new study – one of the largest undertaken to date – indicates that the so called “insect apocalypse” may not, in some cases be as drastic as previously reported, but that the picture is complicated…

Butterflies – on average – appear to be declining at a rate of approximately 1% per year, although some fresh-water based insects might actually be increasing in numbers.

Insect apocalypse - latest

Clouds over the Clouded Yellow

You may recall Mark Williams’s article in March’s newsletter, where he noted the reappearance of the African Clouded Yellow (Colias electo electo) in Gauteng this season - this species had almost completely disappeared from the Highveld, a state of affairs that occurred over a very brief period of time about 15 years ago.

There may be parallels elsewhere in the world. Alexei Belik writes from Saratov, southwestern Russia and notes that Danube Clouded Yellow (Colias myrmidone) used to be a common butterfly in this part of the world. Despite the continued presence of its larval food plant Chamaecytisus ruthenicus – which is extremely abundant - the butterfly seems to have completely disappeared.

Swara Magazine

Steve Collins forwarded me a copy of Swara magazine, a conservation journal focussed on East Africa. It includes an article summarizing the recent paper on the African Plain Tiger (Danaus chrysippus orientis) that was produced by Steve and co.

Swara - April 2020

2

Genus Acontia in Southern Africa (Hanna and Wolf-Achim Roland)

The Acontia species: these beautiful little moths of the family Noctuiidae can be found by day and night, almost everywhere in Southern Africa.

In this short overview we want to address some features of the genus, especially their appearance, sexual dimorphism, differentiation of two very similar looking species, the endemic species of Namibia and the characteristics of the caterpillars.

According to the website AfroMoths there are 164 species in Africa, 53 of them in Southern Africa. LEPIMAP carries 250 Acontia observations.

Their forewing colouration is characteristically bird-dropping like, with a milky-white, shiny ground- colour.

Acontia antica Acontia wahlbergi

Often the Acontia moths are found sitting on top of leaves – not hiding below them.

Acontia permutata Acontia natalis

3

Females are distinctly darker than males – especially on their hindwings. As the moths rarely open their wings, this feature can be seen on pictures of museum examples like here for A. umbrigera.

Acontia umbrigera

In some cases dimorphism is so strong that in former times male and female specimens of a species have been considered to be two different species.

A good example of this dimorphism is Acontia guttifera:

Acontia guttifera; female Acontia guttifera; male (Copyright: K. Braun)

There are two species which look very much alike, but can be determined by genital analysis – or by geographical distribution. According to Lit 1, Acontia umbrigera is restricted to the Cape Region, the distribution area extending north to Windhoek/Namibia. Acontia trimaculata is widespread in most parts of Sub-Saharan Africa and on the Arabian peninsula.

One possible distinguishing feature on photos is the white median blotch, which is significantly shorter and quadrate in A. umbrigera

Acontia trimaculata, near Alldays, Limpopo Acontia umbrigera, Cape Region; Copyright: T.Rebelo

4

In Namibia there are a lot of endemic species: A. annemarie, A. aureola; A. aurevillii; A. cimbebasia, A. namibiensis, A. okahandja, A. wallengreni, A. wolframmeyi.

Some of them show a very restricted distribution.

Acontia annemarie Acontia wolframmeyi

Acontia aureola Acontia wallengreni

Lit 1 contains a revision of the genus Acontia OCHSENHEIMER, 1816. In this work, one subgenus, 63 species and 8 subspecies are described that are new to science, for example A. permutata.

5

Acontia permutata Acontia melaphora

Lit 2 contains a further revision, transferring e.g. Protarache melaphora to genus Acontia.

The caterpillars are mostly colourful. They often feed on Malvaceae. Lit 3 cites: Larval abdominal segment 1 with 2 SV setae (this character will separate Acontiinae larvae from larvae in the subfamily Eustrotiinae). • Prolegs absent on segments 1-4. • Spinneret highly reduced or absent. • Anal shield with a large anal fork.

Acontia nephele Acontia insocia

6

Acontia transfigurata Acontia conifrons

Identification of different species, by photographs alone, will remain difficult. But this overview may give hints of what to look for.

Solingen, January 2020

Literature

1. Esperiana 14 (2008); Hermann H. Hacker, Albert Legrain & Michael Fiebinger Revision of the genus Acontia OCHSENHEIMER, 1816 (Old World)

2. Esperiana 15 (2010) Hermann H. Hacker, Albert Legrain & Michael Fiebinger Revision of the genus Acontia – Corrigenda and Supplementa

3. http://nearctica.com/moths/noctuid/acontia/acontiinae.htm

Contact: [email protected]

7

Selected encounters with Noctuids (Hanna Roland)

Speaking of the so-called owlet moths, people often think of some dark and inconspicuous night flyers, which are not welcomed or even feared by the tourists in South Africa or Namibia.

Working with the database LEPIMAP of the University of Cape Town, you may be astonished by the fact that over 65% of the entries are butterflies and only 35% belong to the moths, while the number of moth species is 10 times higher than that of butterflies. And there are very few moth- experts.

In my opinion moths have a more mysterious beauty than butterflies.

Over the last few years we have increasingly encountered the problem of suitable lights, to get the desired moth pictures, because of the general aim not to attract insects at night. And lately more and more lodges switch to ecological solar systems for well justified reasons, but unfortunately they are not appropriate for my work. That means that I depend completely on appropriate lights.

During the very many years that we have been discovering different parts of Southern Africa, we were lucky to encounter an overwhelming amount of attractive owlet moths, which are now scientifically divided into Noctuidae and various sub-families of Erebidae. In order to highlight the incredible variety of designs, colours and shapes, I have selected several remarkable representatives of this family. I always feel specially rewarded, when these colourful little creatures open their wings to present the full palette of their beauty, as in:

Ovios capensis or Attatha barlowi

And even if they are grey, they can attract your attention by their wing pattern, dark red bodies or remarkable antennae.

8

Calesia zambesita Antiophlebia bracteata

Another striking aspect can be found in the Hypeninae, which are often endowed with a showy beak (below left). Some of the Euteliidae have a special way to fold their wings and to hold their body in an upward position (right).

Rhynchina tinctalis Eutelia callichroma

Another unusual representative with fascinating features is:

Hemiceratoides hieroglyphica

9

One of the better known and rather small species has an outstanding pink and yellow design (left). Another even smaller species of the Genus Earias shows bright green or yellow colours (right),

Timora leucosticta Earias biplaga

In contrast, the next two moths have a more conspicuous size and also a remarkable pattern. When I am patrolling the different lamp-sites of a lodge at night, they undoubtedly will catch my eye:

Lepidodelta stolifera Fodina embolophora

10

A night-flyer of exquisite beauty, which cannot be so easily distinguished between the leaves of a bush where it is resting, wears a design that is certainly meant to melt with the surroundings of trees and bushes.

Ethiopterpia marmorata

Caterpillars very often also integrate into their habitat. But on the other hand, we see examples of the complete opposite, like the strikingly showy caterpillar of Aegoceropsis trimenii (below):

The moth is equally exceptional and is frequently on the wing.

One of the extraordinary caterpillars that we encountered in Botswana will not be forgotten:

Rhanidophora aurantiaca

11

Two jewels from the Caprivi and Punda Maria in the far North of Krüger Park will close the string of my Noctuid pearls:

Mazuca strigicincta Mazuca elegantissima

Her name “elegantissima” really speaks for her.

Our “hunting ground” in South Africa was principally Limpopo province. And each time we came close to the border of Botswana, in the surroundings of Alldays, we made an interesting observation: the general moth population of this part of the country often reminded us of the moth- spectrum we knew from Namibia. Whereas the Caprivi, another favourite spot on our journeys, differs completely from the rest of the that country.

But wherever you look for moths, you are always rewarded with very beautiful species.

Hanna Roland Solingen, Germany March 2020

12

Join LepSoc (Justin Bode)

As if there aren’t already enough reasons to join LepSoc Africa, Justin Bode is going to award prizes to new members:

The Garden Route

The coronavirus lockdown resulted in some amazingly high traffic on the Highveld Butterfly Club (HBC) WhatsApp group, which was set up by HBC chairman, Andre Coetzer one year ago.

I estimate that there were in excess of 1 000 contributions during the course of our five weeks of enforced captivity, including this quiz, put together by Steve Woodhall and Kevin Cockburn: Butterfly Quiz - Steve Woodhall And a limerick by LepSoc Africa’s poet laureate, Peter Sharland: “Our group are outdoors and LepSocian We’re corona’d in Gauteng dystopian Stuck away in our homes With butterfly tomes We’ve all become truly WhatsAppian”

13

Et tu, Brutus?

I’d prepared some banana-bait for planned butterfly-trips in March and April (which obviously didn’t materialize, on account of the C-word). I decided to put up a trap in my garden in Bryanston, northern Johannesburg, which soon attracted a few White-barred Charaxes (Charaxes brutus natalensis), Cream Striped Owl (Cyligramma latona) and a solitary Yellow Pansy (Junonia hierta cebrene). I have seen Foxy Charaxes (Charaxes saturnus saturnus) in my garden before, but not this season.

Nomad Dart (Jeremy Dobson)

On 21 March, while spending a lazy Saturday at my house in Bryanston, I noticed a large brown Skipper bouncing around in the back garden. I rushed to get my camera and managed one shot before the butterfly flew away, not to be seen again.

The Nomad Dart (Andronymus neander neander) is an occasional visitor to Gauteng, but is not resident in this province Andronymus neander neander – at least, it didn’t used to be. Bryanston, Gauteng There have been several other records for this species within the Highveld region recently. Reinier Terblanche found two separate specimens in his garden in Potchefstroom, there was a Facebook record from Ermelo and Riette Griesel photographed one at Garingboom Guesthouse, Springfontein.

Books wanted

Marijke de Kock is interested in second hand butterfly books: anything from the African Continent. Any of Torben Larsen's books would be a high priority. Please contact Marijke if you can help. [email protected]

A new Russet for the Aloeides Project

Katharina Reddig sent me this photo, taken by her brother in the Windhoek area. I believe it is Small Dune Russet (Aloeides tearei), which is one of the “difficult to get” species on the Aloeides Project wanted list.

The Khomas and Erongo regions were subject to a coronavirus lockdown, but Katharina and her brother have promised to look out for the butterfly and to catch a couple of samples for DNA sequencing.

14

The Lockdown Lists

To keep us occupied, the Highveld Butterfly Club (HBC), which comprises LepSoc Africa members living in Gauteng, Free State and North West provinces, kept lists of the butterflies found in our suburban gardens during the coronavirus lockdown.

This is a summary:

HIGHVELD GARDENS DANAINAE HESPERIIDAE Danaus chrysippus orientis African Plain Tiger COELIADINAE HELICONIINAE Coeliades pisistratus Two-pip Policeman Acraea horta Garden Acraea HESPERIINAE Acraea neobule neobule Wandering Donkey Acraea Nervia nerva nerva Magaliesberg Ranger Acraea natalica Black-based Acraea Afrogegenes letterstedti Brown Dodger Telchinia encedon encedon White-barred Telchinia Gegenes pumilio gambica Dark Dodger Phalanta phalantha aethiopica African Leopard Andronymus neander neander Nomad Dart LIMENITIDINAE TAGIADINAE Hamanumida daedalus Guineafowl Eretis umbra umbra Small Marbled Elf Neptis saclava marpessa Spotted Sailer LYCAENIDAE NYMPHALINAE POLYOMMATINAE Hypolimnas misippus Common Diadem Anthene definita definita Steel-blue Ciliate Blue Junonia hierta cebrene Yellow Pansy Anthene livida livida Pale Ciliate Blue Junonia oenone oenone Dark Blue Pansy Azanus jesous Topaz Babul Blue Junonia orithya madagascariensis African Blue Pansy Azanus natalensis Natal Babul Blue Precis archesia archesia Garden Inspector Cacyreus marshalli Common Geranium Bronze Vanessa cardui Painted Lady Euchrysops dolorosa Sabi Smoky Blue PAPILIONIDAE Lampides boeticus Pea Blue PAPILIONINAE Leptotes pirithous pirithous Common Zebra Blue Papilio demodocus demodocus Citrus Swallowtail Tuxentius melaena melaena Black Pie Papilio nireus lyaeus Narrow Green-banded Swallowtail Zizeeria knysna knysna African Grass Blue PIERIDAE Chilades trochylus Grass Jewel Blue COLIADINAE PORITIINAE Catopsilia florella African Migrant Alaena amazoula ochroma Northern Yellow Zulu Colias electo electo African Clouded Yellow THECLINAE Eurema brigitta brigitta Broad-bordered Grass Yellow Myrina silenus ficedula Common Fig-tree Blue PIERINAE Deudorix antalus Brown Playboy Belenois aurota Pioneer Caper White Hypolycaena philippus philippus Purple-brown Hairstreak Belenois creona severina African Caper White NYMPHALIDAE Mylothris agathina agathina Eastern Dotted Border BIBLIDINAE Mylothris rueppellii haemus Twin Dotted Border Byblia anvatara acheloia African Joker Colotis euippe omphale Southern Round-winged Orange Tip Byblia ilithyia Spotted Joker Pinacopteryx eriphia eriphia Zebra White CHARAXINAE Teracolus agoye bowkeri Desert Speckled Sulphur Tip Charaxes brutus natalensis White-barred Charaxes Teracolus subfasciatus Lemon Traveller Charaxes jahlusa rex Transvaal Pearl-spotted Charaxes 52

Despite our best efforts, the Highveld Butterfly Club was trounced by Steve Woodhall, who recorded 56 species from his garden in Gilletts, KwaZulu-Natal:

15

STEVE WOODHALL HELICONIINAE HESPERIIDAE Acraea horta Garden Acraea COELIADINAE Acraea aganice aganice Dark Wanderer Coeliades forestan forestan Striped Policeman Acraea petraea Blood-red Acraea HESPERIINAE Acraea natalica Black-based Acraea Afrogegenes letterstedti Brown Dodger Telchinia igola Dusky-veined Telchinia Borbo fatuellus fatuellus Long-horned Swift Telchinia encedon encedon White-barred Telchinia HETEROPTERINAE Telchinia esebria Dusky Telchinia Metisella metis paris Eastern Gold-spotted Sylph Phalanta phalantha aethiopica African Leopard TAGIADINAE LIBYTHEINAE Sarangesa motozi Forest Elfin Libythea laius African Snout Netrobalane canopus Buff-tipped Skipper LIMENITIDINAE Tagiades flesus Clouded Flat Cymothoe coranus coranus Blonde Glider LYCAENIDAE Neptis saclava marpessa Spotted Sailer POLYOMMATINAE Pseudacraea eurytus imitator False Wanderer Cacyreus lingeus Bush Bronze Pseudacraea lucretia tarquinea Natal False Chief Leptotes pirithous pirithous Common Zebra Blue NYMPHALINAE Zizeeria knysna knysna African Grass Blue Hypolimnas anthedon wahlbergi Variable Diadem Zizula hylax Tiny Grass Blue Hypolimnas misippus Common Diadem PORITIINAE Junonia natalica natalica Brown Pansy Pentila tropicalis tropicalis Spotted Buff Junonia oenone oenone Dark Blue Pansy THECLINAE Junonia terea elgiva Soldier Pansy Leptomyrina gorgias gorgias Lilac-based Black-eye Precis archesia archesia Garden Inspector NYMPHALIDAE Protogoniomorpha parhassus Common Mother-of-pearl BIBLIDINAE Vanessa cardui Painted Lady Eurytela dryope angulata Golden Piper SATYRINAE Eurytela hiarbas angustata Pied Piper Paralethe dendrophilus indosa Lowland Bush Beauty Sevenia boisduvali boisduvali Boisduval's Tree Nymph Bicyclus safitza safitza Black-haired Bush Brown Sevenia natalensis Bronze Tree Nymph PAPILIONIDAE CHARAXINAE PAPILIONINAE Charaxes brutus natalensis White-barred Charaxes Graphium leonidas leonidas Veined Swordtail Charaxes candiope Green-veined Charaxes Papilio dardanus cenea Mocker Swallowtail Charaxes cithaeron cithaeron Blue-spotted Charaxes Papilio demodocus demodocus Citrus Swallowtail Charaxes druceanus druceanus Silver-barred Charaxes Papilio nireus lyaeus Narrow Green-banded Swallowtail Charaxes ethalion ethalion Satyr Charaxes PIERIDAE DANAINAE COLIADINAE Amauris albimaculata albimaculata Layman Catopsilia florella African Migrant Amauris echeria echeria Chief PIERINAE Danaus chrysippus orientis African Plain Tiger Belenois creona severina African Caper White Belenois gidica abyssinica African Veined White Dixeia pigea Small Ant-heap White 56

16

The Lockdown Pictures

In line with the previous article, I’ve included some photos of butterflies taken in South African gardens during the lockdown:

Charaxes druceanus druceanus Precis archesia archesia Neptis laeta Gillitts, KZN Kyalami, Gauteng Swaziland (Steve Woodhall) (Raimund Schutte) (Nevile Curle)

Eretis umbra umbra Anthene livida livida Andronymus neander neander Fairland, Gauteng Linden, Gauteng Potchefstroom, North West (Bennie Coetzer) (Jan Praet) (Reinier Terblanche)

Myrina silenus ficedula Hypolimnas misippus Hypolycaena philippus philippus Gauteng Krugersdorp, Gauteng Muldersdrift, Gauteng (Julio Balona) (Justin Bode) (Lourens Erasmus)

Charaxes brutus natalensis Belenois aurota Magaliesburg, Gauteng Risidale, Gauteng Colias electo electo (Stephen Ball) (Peter Sharland) Springfontein, Free State (Riette Griesel) 17

Aloeides Project - Latest (Jeremy Dobson, Ian Richardson and Rauri Bowie)

OK, back to the drawing board...

Those of you who read “Sorting the Russets” in March’s newsletter may recall that Jeremy proposed some fairly rigid species-bracketing criteria for differentiating between species, based on mtDNA barcode comparisons. In addition, he believed that comparing barcodes with an ancestral genus (Tylopaedia), might give an indication of the relative evolutionary age of each species. He has been persuaded by his Aloeides Project co-authors - Dr Ian Richardson and Prof Rauri Bowie - that this won’t work and, rather reluctantly, has agreed with them. It’s not that bracketing cannot work (in many cases it will) but rather, with a relatively recent and rapidly evolving genus, such as the Aloeides, a more nuanced approach is necessary.

For the initial Aloeides Project paper, we will adopt conventional phylogenetic modelling techniques - based on mtDNA barcodes - and test the conclusions using conventional taxonomic studies and (hopefully) multi-gene sequencing of nuclear DNA.

We are hoping for assistance with any morphological or ecological studies; remember, this is a LepSoc Africa initiative and anyone may contribute. Etienne Terblanche, who has long been fascinated by the Trimeni and Almeida groups (Speckled and Plain Russets), has promised to focus on these groups; Dave Edge has pledged to undertake a similar role for the Pallida group.

I’m excited to add that Graham Henning has offered to perform a series of genitalia dissections, which will be of major assistance with the forthcoming paper.

As you can imagine, no new data has been forthcoming during the coronavirus lockdown, but we have refined the phylogenetic tree as far as we can, with the data available. The species groups are largely unchanged, but the evolutionary order has been revised, in some cases by 180 degrees.

It seems, in broad terms - that some of the stranger members of the genus - A. barklyi and A. aranda for example, are ancestral to many of the current taxa and that several of the Cape representatives (the Pallidas for example) are the new kids on the block. The other member of the “Odd Russets” which we’ve identified to date is Aloeides arida, which at first glance doesn’t appear particularly unusual, until – as Graham Henning has noted – you look at the orange flush on its hindwing underside.

The Dryas group (the Patterned Russets) is by far the largest, containing more than 50% of the taxa that have been studied to date – it is also the youngest, containing a large number of species that are found only in the Cape and that appear to have radiated relatively recently.

The relatively recent evolution of the Cape floral kingdom is important to our understanding of the Aloeides (and many other butterfly genera): Raimund Schutte is currently busy with a paper on this subject. The massive radiation of Aloeides and Chrysoritis was presumably not so much a result of the Cape’s unique flora, but of the transformation of the region from forest (not an Aloeides biome) to fynbos, with an attendant army of ants. The Russets - which are not butterflies to miss an opportunity - colonized this new frontier and, as a result of the diverse, predator-free and rapidly changing landscapes, were able to not only establish themselves but to disperse - and speciate - at an incredibly rapid rate.

18

AN ALOEIDES 422 Aloeides almeida Almeida PHYLOGENY 415 Aloeides susanae

Group PLAIN

409 Aloeides henningi RUSSETS

435 Aloeides conradsi conradsi Taikosama 404 Aloeides taikosama Subgroup

398 Aloeides swanepoeli Damarensis 402 Aloeides damarensis damarensis Subgroup

417 Aloeides trimeni trimeni Trimeni Group Trimeni SPECKLED RUSSETS SPECKLED 408 Aloeides pierus Pierus

457 Aloeides aranda Aranda

450 Aloeides arida Arida RUSSETS

418 Aloeides barklyi Barklyi ODD

456 Aloeides bamptoni

454 Aloeides margaretae Vansoni 400 Aloeides vansoni Subgroup 455 Aloeides carolynnae carolynnae

411 Aloeides nubilus

397 Aloeides dentatis maseruna

451 Aloeides penningtoni 401 Aloeides titei

452 Aloeides nollothi

416 Aloeides dicksoni

412 Aloeides dryas DryasSubgroup 413 Aloeides simplex

448 Aloeides kaplani DryasGroup PATTERNED RUSSETS PATTERNED 438 Aloeides pallida lilversidgei

440 Aloeides pallida jonathani

446 Aloeides monticola

436 Aloeides pallida littoralis KaplaniSubgroup 444 Aloeides pallida pallida

407 Aloeides caledoni Caledoni

399 Aloeides juana

419 Aloeides thyra thyra Juana

458 Aloeides lutescens Subgroup

19

Jeremy constructed a number of, very similar, phylogenetic trees, using Maximum Likelihood, Neighbour-Joining, Minimum Evolution and UPGMA methods and the various groupings were verified by Rauri and Ian. The above phylogeny however is based on Maximum Parsimony; Ian and Jeremy deferred to Rauri on this matter, as he has more powerful and more expensive toys.

According to Prof Bowie, Maximum Parsimony is a better method for evaluating phylogenetic relationships as it uses shared-derived characteristics rather than simple distance metrics. The above phylogeny is a STRICT tree, a consensus of parsimony trees that Rauri recovered using a program called PAUP.

Now that we’ve cleared that up, let’s look at the tree in some detail.

On a basic level, the Aloeides can be divided into four main categories:

• Patterned Russets (Dryas Group) • Odd Russets (Barklyi, Arida and Aranda Groups) • Plain Russets (Almeida Group) • Speckled Russets (Trimeni Group)

The tree doesn’t really indicate the evolutionary timelines, so Jeremy has tried to reflect this in the diagram below.

5 000 000 YEARS 4 500 000 YEARS 3 500 000 YEARS 2 500 000 YEARS 1 500 000 YEARS 500 000 YEARS

KAPLANI Aproximate timelines of the SUBGROUP

Aloeides species groups DRYAS DRYAS GROUP SUBGROUP

CALEDONI SUBGROUP

JUANA SUBGROUP

VANSONI SUBGROUP

BARKLYI GROUP

ARIDA GROUP

ARANDA GROUP

ALMEIDA GROUP

PIERUS SUBGROUP

TRIMENI SUBGROUP

DAMARENSIS SUBGROUP

TRIMENI TAIKOSAMA GROUP SUBGROUP

20

What are the above timelines based on? Well not very much actually.

Taking Tylopaedia sardonyx to represent an ancestral genus, the average mtDNA difference between Aloeides and T. sardonyx – is 9.3%. This correlates to about 3 to 3.5 million years of separation. Jeremy has used this figure as a benchmark and shuffled the various groups forwards and backwards, based on the evolutionary order shown in the phylogenetic tree.

Finally, we have taken the various species groups and subgroups and listed them below, with images of the butterfly’s upper and undersides, plus the percentage mtDNA difference between each specimen and the median group representative.

Where possible, the photographs represent the actual specimen from which the mtDNA sequence was extracted. Where no photos were available – the barcode was obtained from GENBANK for example – we have tried to use images from different specimens of the same species, taken from the Aloeides Project database; these typically represent specimens for which leg samples have been submitted to BED, but no results have been obtained as yet.

In instances we have acquired a barcode, but where no samples of similar species are available, the images have been taken Afrotropical Butterflies. Species groups (or subgroups) are named after the median group representative – the most “average” member of the group in terms of mtDNA differences. The names of the groups will probably change as further data is obtained, but we believe this method will be a model for our paper, which will be published once we’ve obtained barcodes for a minimum of 65 Aloeides taxa. We’ve only got 34 species-barcodes so far - there is a long way to go.

Ultimately, we would like to have clear images, to scale, of all Aloeides (new and existing taxa, male and female), with the pictures corresponding with the mtDNA samples used in the phylogenetic trees.

This is going to take quite a few years…

21

TRIMENI GROUP

Taikosama Subgroup

404 Aloeides taikosama Median Subgroup representative

435 Aloeides conradsi conradsi* mtDNA difference to A. taikosama 5.44%

Damarensis Subgroup

402 Aloeides damarensis damarensis Median Subgroup representative

398 Aloeides swanepoeli mtDNA difference to A. damarensis 5.42%

Trimeni Subgroup

417 Aloeides trimeni trimeni Sole Subgroup representative

Pieris Subgroup

408 Aloeides pierus Sole Subgroup representative

22

ALMEIDA GROUP

Almeida Group

422 Aloeides almeida Median Group representative

415 Aloeides susanae mtDNA difference to A. almeida 0.91%

409 Aloeides henningi mtDNA difference to A. almeida 3.04%

ARANDA GROUP

Aranda Group

457 Aloeides aranda Sole Group representative

23

ARIDA GROUP

Arida Group

450 Aloeides arida* Sole Group representative

BARKLYI GROUP

Barklyi Group

418 Aloeides barklyi Sole Group representative

DRYAS GROUP

Juana Subgroup

399 Aloeides juana Median subgroup representative

458 Aloeides lutescens* mtDNA difference to Aloeides juana 0.61%

419 Aloeides thyra thyra mtDNA difference to Aloeides juana 1.46%

24

Kaplani Subgroup

448 Aloeides kaplani* Median subgroup representative

444 Aloeides pallida pallida* mtDNA difference to A. kaplani 0.15%

438 Aloeides pallida lilversidgei mtDNA difference to A. kaplani 0.15%

446 Aloeides monticola mtDNA difference to A. kaplani 0.30%

436 Aloeides pallida littoralis* mtDNA difference to A. kaplani 0.46%

440 Aloeides pallida jonathani* mtDNA difference to A. kaplani 0.61%

Caledoni Subgroup

407 Aloeides caledoni Sole Subgroup representative

25

Dryas Subgroup

412 Aloeides dryas Median subgroup representative

413 Aloeides simplex mtDNA difference to A. dryas 0.30%

416 Aloeides dicksoni mtDNA difference to A. dryas 0.61%

452 Aloeides nollothi* mtDNA difference to A. dryas 1.06%

401 Aloeides titei mtDNA difference to A. dryas 1.52%

451 Aloeides penningtoni* mtDNA difference to A. dryas 1.67%

397 Aloeides dentatis maseruna mtDNA difference to A. dryas 1.52%

26

Vansoni Subgroup

400 Aloeides vansoni Median subgroup representative

454 Aloeides margaretae* mtDNA difference to A. vansoni 0.76%

456 Aloeides bamptoni* mtDNA difference to A. vansoni 1.06%

455 Aloeides carolynnae carolynnae* mtDNA difference to A. vansoni 1.67%

411 Aloeides nubilus mtDNA difference to A. vansoni 1.98%

1. Images are to scale and will be approximately full-size should the document be printed at A4.

2. An asterisk indicates that the photographs do not correspond with the sample from which the mtDNA sequence was obtained.

3. Numbers correspond with Reference Numbers in the Aloeides Project database; all data related to specimens for which barcodes have been obtained may be viewed at the following link:

Aloeides Project - Data summary - Apr 2020

27

The ABC of DNA comparisons (Jeremy Dobson)

The following article has a rather mathematical theme and may not be suitable for normal people. If this describes you, please move to the next feature.

For engineers and other social misfits still reading this piece, I’ve tried to outline some of the techniques involved in mitochondrial DNA comparison, which has become a hugely important tool in modern molecular biology.

Those of you who read “Sorting the Russets” in March’s newsletter, may remember that a barcode is a sequence, 658 characters long, of the letters A, T, C and G, in a specific order. This represents the genetic code of a short, well defined section of the mitochondrial genome.

These characters may be used as a tool for comparing the relative similarity of any organism made up of Eukaryotic cells - basically any living thing apart from bacteria. You will be pleased to know that the coronavirus hardly counts as a living thing; it is a section of RNA (imagine one half of a DNA “ladder” cut longitudinally), that uses its host - hopefully not you - to make copies if itself.

Barcodes are becoming increasingly inexpensive to produce and you can even get an entire nuDNA genome sequenced at Berkeley for $150. Prior to Covid-19, the laboratories at BOLD in Canada charged about R160 per mtDNA sequence, although admittedly this rate assumed that you a) submitted a batch of 95 samples and, b) achieved a 100% success rate (with my previous batch, which included some 5 year old specimens, I achieved an 85% success rate). Local SA laboratories will probably undertake the process for less money, although possibly with a lower success rate.

Once you’ve acquired your barcodes, you can start comparing them as follows (please do try this at home, armed with MS Excel):

First, you should have two or more sequences, which look something this - which happens to be an Aloeides henningi sample, from Greylingstad, Mpumalanga:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTTTAAGAGTTTTAATTC GAATAGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTAC AGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATT GATTAGTACCTTTAATATTAGGAGCACCAGATATAGCATTTCCACGAATAAATAATATAAGATT TTGACTTTTACCACCTTCATTACTATTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCTGGTA CAGGATGAACAGTATACCCCCCGCTTTCATCAAATGTAGCTCATAGAGGATCTTCTGTTGATT TAGCTATTTTTTCTCTTCATCTTGCTGGTGTATCATCAATTTTAGGAGCAATTAACTTTATTACA ACTATTATTAATATACGAATTAATAATTTATCATTTGATCAAATATCTTTATTNATTTGAGCTGTA GGAATTACTGCATTATTATTATTATTATCTTTACCTGTTTTAGCAGGAGCAATTACAATATTATT AACTGATCGTAATTTAAATACTTCATTTTTTGATCCAGCTGGGGGAGGAGACCCNATTTTATAT CAACATTTATTT

28

For Excel, you need to delineate these strings, by either manually adding spaces between each character (which will take at least 10 mindless minutes per sequence), or you can use a program that Andre Coetzer has written and which can be downloaded here (if this doesn’t work contact me and I’ll get you a copy):

Barcode delineator

Once you’ve delineated your barcode, use the text to columns function in Excel (Data / Text to Columns) and you should be able to separate the string such that each character occupies its own separate cell.

Obviously you need a minimum of two sequences before you can start any comparisons: for this exercise, I’ve compared our Aloeides henningi (above) with an Aloeides almeida sample from Stanford, Western Cape. In the illustrations below I’ve only indicated the first 40 characters of the sequences, which are in fact both 658 characters long.

Once you’ve aligned your pair of barcodes, proceed as follows:

First, you need to check for similarities between the character-sets. Place the barcodes, one above each other (starting, say, in Column B), and insert the following “IF” statement in the third line:

=IF(B1 = B2, 0,1)

Excel, like all mathematical programs, applies the “do if true” rule to logical tests. If the contents of cell B1 are equal to the contents of cell B2, Excel returns “0”. If this is not true, then the computer will display “1”.

Your screen should now show a “1” on the third line (A is definitely not equal to T). Select this cell and drag it to the end of the sequence. AutoSum (∑) the contents of the third line and, Voila!, you have the number of base-differences between your two barcodes (19), which – if my memory serves me – was the average age of an American servicemen in Vietnam. You can express this as a percentage of the total number of characters in the sequence (in this case 658) which yields 2.89%.

That’s really all there is to it - except that it isn’t...

29

For some reason, it is deemed necessary to decide which of the above differences are “transversions” and which are “transitions”.

This is a bit more tricky, although it’s an easy enough process using a method that Ian Richardson has developed, which converts the pesky letters to numbers, hence making them a lot more sensible.

If the first character in your top string is “A” replace it with -1. Do the same with “C” (1), “G” (-2) and “T” (2).

To do this in Excel, insert the following nested “IF” statement in cell B4:

=IF(B1="A", -1, IF(B1="C", 1, IF(B1="G", -2, IF(B1="T", 2, 0))))

Select the resulting “-1” and drag to the end of the sequence, as previously. On the fifth line repeat this for your second sequence (Row 2), but replacing “B1” with “B2” in the above formula.

You should have the following result:

Next, you need to process the lower two strings, as follows:

a) If a number on Row 3 is zero (in other words, the two adjacent characters in you barcodes are the same), return a zero on Row 6. b) If not, take the “absolute” sum of Rows 4 and 5 (ignore the negative signs)

For this, type the following equation into cell B6, select and drag to the end of the sequence:

=IF(B3=1,ABS(B4+B5),0)

As a check, AutoSum the contents of Row 6 and you should get 42 (which isn’t, in this case, the answer to the meaning of life, but simply what we’ll call the number of bases).

30

Next, type the following into Row 7:

=IF(B3=1,IF(B6=1,1,0),0)

Add up the row as previously and you will arrive at the figure “7”, which is the number of reversible mtDNA mutations, known as TRANSITIONS. I believe this is intended to represent the number of base-pair copying errors, which may effectively “undo” themselves.

Type the following into Row 8:

=IF(B3=1,IF(B6=1,0,1),0)

Add up the resulting figures and you should get “12” which is the number of permanent mtDNA mutations, known as TRANSVERSIONS.

You should be able to add 7 and 12 without the use of Excel and the resulting number (19) is what is known as the Pairwise Difference between your two samples (PWD).

Those of you who have being paying attention will notice that this is the number we’d already arrived at after Step 1: this is a bit like counting the number of legs in a field and dividing by 4 to get the number of sheep, but anyway, this is how it is done.

This extra effort hasn’t been wasted however as we will need the number of TRANSLATIONS and TRANSITIONS for the final step, which is to apply the Kimura Two-parameter Correction (K2P).

Dr Motoo Kimura - bless him – a renowned Japanese biologist, came up with the following equation, which is considered the gold-standard for this type of genetic comparison:

=(-0.5*LOG((1-2*TRANSITIONS/N-TRANSVERSIONS/N)*SQRT(1- 2*TRANSVERSIONS/N),2.71828))

Where “N” is the number of characters in your barcode strings – 658 in this instance.

Copy the above equation in cell A9 (replacing “TRANSITIONS” with the contents of cell A7, “TRANSVERSIONS” with A8 and “N” with the number 658. Convert the result to a percentage and you will arrive at the K2P number of 2.94%.

This compares with a PWD of 2.89% - the figure we arrived at some time ago – but anyway, no one can now accuse us of taking any shortcuts.

The K2P figure is always a little larger than PWD; with the Aloeides, typically about 5% greater, although only 1.73% in this instance.

31

Eswatini (Mark Liptrot)

Mark Liptrot undertook an expedition to eSwatini (Swaziland) in early March. He experienced good weather and visited nine different venues. The route extended from the south-eastern corner of the country (Lavumisa), through Big Bend, Ezulwini, Mbabane and Piggs Peak. A total of 105 species were seen, and only two of these: Marieps Emperor Swallowtail (Papilio ophidicephalus ayresi) and Table Mountain Beauty (Aeropetes tulbaghia) evaded Mark’s camera.

The best places included the roadside, 2 km from the Lavumisa border post, the Sheba’s Breast hike, Mlilwane and Malolotja Nature Reserves and the Sibebe area.

Unusual species seen were: • Bush Kite (Papilio euphranor), first record on ADU for eSwatini (on the hillside above Veki’s Village, Mbabane) • Natal False Chief (Pseudacraea lucretia tarquinea), second ADU record (in the forest on Sheba’s Breast, Ezulwini) (possibly P. l. expansa?) • Topaz Arab (Colotis calais calais), third record (2 km from Lavumisa border post)

Abantis paradisea Colotis calais calais Artitropa erinnys erinnys Swaziland Swaziland Swaziland Mark Liptrot Mark Liptrot Mark Liptrot

Graphium angolanus angolanus Papilio euphranor Pseudacraea lucretia tarquinea Swaziland Swaziland Swaziland Mark Liptrot Mark Liptrot Mark Liptrot

32

The Algoa Opal (Dave Edge)

The Algoa Opal (Chrysoritis thysbe whitei) was assessed as "Endangered" in the 2013 Butterfly Atlas. Based on the SALCA project, a new Red List is being prepared and this butterfly will be downgraded to "Vulnerable".

Mike Skinner, who lives in Schoenmakerskop, Port Elizabeth is trying to promulgate a small nature reserve on an area currently zoned for housing. The site – which contains unique fynbos – is not only a home for Chrysoritis thysbe whitei, but also for a species of lizard which is on the Eastern Cape red list.

Dave Edge has put Mike in contact with LepSoc Africa’s Eastern Cape branch chairman, Ernest Pringle, who visits Port Elizabeth fairly often. Ernest is not only a butterfly expert who knows the Algoa Opal well, but he is also chairman of the Brenton Blue Trust and a lawyer, with good knowledge of environmental law.

Yebo Gogga

This year’s Yebo Gogga exhibition was scheduled for 6 to 10 May but, unsurprisingly, it has been postponed as a result of the coronavirus epidemic.

Nimba (Szabolcs Sáfián)

News from Liberia from Safi

It is always so nice to photograph a species you never had a chance to shoot at before. Euryphura togoensis is new to me as they are usually rare and they always perch very high. They are also very alert, so one has no chance to get even close to them. Fortunately, on a hilltop in the Nimba Mountains, Liberia, I spotted a male yesterday, which always settled lower, sometimes close to the ground. It was fresh and I decided to Euryphura togoensis give it a chance also today, when I did not forget to take my Nimba, Liberia camera. (Szabolcs Sáfián)

Images are now also uploaded onto ABDB - https://abdb-africa.org/species/

33

Notes on improved museum practice: entomology (Teodor van Wyk)

Teodor van Wyk, of the Department of Conservation Ecology and Entomology, Stellenbosch University, forwarded this article on the curation of museum specimens, which may be of interest to private collectors.

Introduction

Many insect collections that are private or from institutions get damaged by museum beetles, mites, ants and ill practice. Since there is a lot of effort that goes into making a good insect collection, and one would want the collection to last, novel understanding of what to do could better and prolong the life of insect collections. This note describes the mandatory regulatory steps that should be used to maintain an insect collection for longer periods more efficiently.

1. A high pinning standard Insects should always be mounted and spaced to specified standards when placed in a museum. All insects, of any kind of taxa, should always be mounted and housed according to specific acceptable museum standards.

2. No opening of the museum drawers Reference collections and a duplicate drawer system should be used for working with insects not the museum specimens themselves. The process of maintaining a duplicate drawer of insects keep insects undamaged. The standard drawer (the complete and aesthetic collection that houses the types etc.) to be sealed with museum tape (see no. 4) and not to do work with. The duplicate drawer is to do work with or preferably external reference collections should be made and used to do work with. This protects the pristineness of the museum.

3. Assigning replotypes The process of re-collecting, re-labelling and/or re-pinning a museum insect according to the precise correct classification it belonged to (i.e. the exact same taxa), to better the quality of the already collected specimens such as damaged, old or unmounted museum specimens. But also, to assign specimens to very rare sightings. This is where the label information is transferred to depict a new locality, from an old locality, of an already collected specimen, if the taxa are exactly the same. So, if a novel sighting occurs that are just, the converted specimen can be placed in the museum for writeups. It is important that the taxa and identification must be 100% correct and that old famous collector’s labels not be replotyped. This prevents the effort to obtain specimens for new sightings occur (if for example the area is remote) and specimens could not be made. It is not a neotype. It is a method that is not necessary to be displayed on the specimen it is just a replacement method but it can be indicated by a replotype label with the word replotype on a blue label. The old labels are preserved this way, such as famous collectors. Replotype comes from the word replacement. When an insect breaks or gets damaged the replotype should be assigned and the debris removed from the drawer. When a new sighting occurs a replotype label of an existing and matching specimen is assigned if a specimen could not be obtained or captured in the original locality. Replotypes can also be used in other disciplines, such as herbaria. Only qualified entmologists or personel can assign replotypes.

4. Sealing drawers with museum tape The prevention of aerial naphthalene (see no. 6) in the museum is very important. This is achieved by special museum tape that prevent pest damage to housed specimens on the long-term by sealing-off the drawers with museum tape where gaps occur. This prevents mites, museum beetles and other pests from entering and naphthalene from diffusing outward and building up in the museum.

34

5. Oiling the pins Anti-corrosion oil on the pins before and after mounting will slow down and lessen verdigris and rust formation on the pins.

6. Sealing-off of naphthalene Naphthalene is carcinogenic and toxic and naphthalene should therefore be sealed-off as mandatory in the museum boxes, drawers and cabinets. This is done with museum tape (see no. 4) and also by leaving the museum boxes sealed (not opening or inspecting them) after they have been sealed so that the naphthalene does not escape. This improves worker safety. After a drawer has been sealed-off it has to be frozen for a minimum of 48 hours to make sure there is nothing that got trapped inside that could damage the specimens. With the naphthalene properly sealed-off with museum tape the naphthene gets trapped in the drawer and naphthalene balls do not have to be replaced continually.

7. Freezing mounted specimens directly on the mounting boards Freezing of mounting boards with already mounted insects on them is also important. After insects were properly killed and mounted (see no. 1), they should be frozen overnight on their mounting boards. This improves the setting by fixing the insect in position due to the insect dying-off properly in position. It also helps so that the insect does not stay alive on the mounting board. This affects the setting time, say if the insect would have further stayed alive after being mounted. If an insect had been frozen overnight the cells rupture and the setting time is quicker and the result neater (insects may dry up to 3 times faster than without being frozen on the mounting board overnight and larger insects may dry quicker). Proper large freezers will keep damage, to insects on mounting boards being placed and kept in the freezer, to a minimum.

8. Perfect condition of museum specimens Mint specimens are compulsory. Collected and accepted specimens for housing in a museum should as far as possible be in mint condition and four specimens are allowed to be collected preferably with permits. Only where condition permit can one fill the drawer with many of one type of insect to display the variation e.g. small drawers. Very rare or novel specimens that may have been collected in their broken state because of their rarity or novelty should be kept but ultimately and progressively they ought to be upgraded into mint specimens.

Teodor van Wyk

Department of Conservation Ecology and Entomology, Faculty of AgriSciences, Stellenbosch University, Stellenbosch, Private Bag X1 7602 Matieland, South Africa; The Biodiversity Company 777 Peridot Street, Jukskei Park, South Africa

Genetics of structural colours in butterflies Jan Praet forwarded the following article, which investigates the genetics involved in the creation of structural colours in the Junonia genus - the Pansies (Buckeyes in the USA). The research team discovered that it is easy for butterflies to change their wing colours over just a few generations and found the first gene proven to influence the so-called "structural colour" that underlies the iridescent purple, blue, green and golden hues of many butterflies. It was found that there was no variation in the amount of pigment on the scales, but a significant difference in the thickness of a chitin layer covering the wings. Junonia - structural colours

35

A BUTTERFLY SAFARI WHERE (NEARLY) EVERYTHING WENT WRONG (Mark C. Williams - April 2020)

Sitting in our home in Pretoria on a beautiful autumn morning on day 21 of the corona virus- induced lockdown reminds me of another occasion when I was even more isolated for an extended period than I am now. This was nearly fifty years ago, in 1971, when I was a third year university student. During the Easter varsity break I had planned to camp in the Chirinda Forest on Mount Selinda in the south-eastern corner of what was then Southern Rhodesia for 12 days. I was obliged to do this trip on my own because I could not persuade anyone to accompany me on account of the escalating conflict in the country and a profound lack of interest in scaled insects by my friends.

And so it transpired that I found myself on the road heading north from Pretoria in my little grey VW 1600cc beetle at the crack of dawn on the first day of the Easter long weekend, loaded to the gills with camping paraphernalia. When I hit the ‘Great North Road’, a single lane tarred road in those days, I was immediately welded into an interminable, crawling convoy of big blue PUTCO buses. It took me but a little while to realize that these buses were packed with Christian Zionists heading for their Easter jamboree in Moria City. With mounting alarm I realized that they would only be turning off to head east once they reached Pietersburg (now Polokwane). This was a warning: ‘Do not do this trip, turn around and go home now’. I ignored it. At the snail’s pace they were perambulating it would take five hours before I was free of them. So I spent four hours mostly driving in the right hand lane, passing as many buses as possible, before squeezing back into the left lane right in front of a horn-honking bus. Pretty scary stuff when you repeat it several dozen times.

Once past Pietersburg the road opened up and my spirits lifted. There were still quite a lot of cars but the buses were gone. I made good time, enjoying the winding pass over the Zoutpansberg and the dry, Baobab strewn countryside north of the mountains. I arrived at the Beit Bridge border post just before noon to find a three kilometre long line of cars waiting to cross the border. My spirits sank again but undeterred I hauled out my Cadac gas stove, rustled up a bacon-and-egg lunch, and downed a large mug of coffee. Four hours later I was through both border posts. It was four pm and I still had to do 500 km. Oh well, time to get on with it.

The journey to Fort Victoria (now Masvingo) was uneventful and I turned east towards Birchenough Bridge at dusk to find myself on a tar strip road. What the hell? This was shown as a ‘main road’ on my map! Old Rhodesians will remember these roads – two, metre-wide tar strips, which you all drove along at a furious pace, swerving onto the left verge as an oncoming car came hurtling straight at you. A proper ‘pas de deux’ in daylight, but a dance of death in the dark. Fortunately, I managed to glue myself to the tail lights of a Volkswagen Karmann Ghia in front of me but I had to put the pedal to the metal because he was driving like a maniac. When he went verge-ward I simply followed.

Beyond Birchenough Bridge the road reverted to ‘normal’ but I was, by now, pretty bushed. And then, as I approached the mountains, I ran into drizzle and mist. My heart sank into my left boot and exited through the sole. At 11 pm, after eighteen hours on the road, I reached the forest ranger’s headquarters at the foot of Mount Selinda. The rangers were shocked when the crazy chena (Shona for ‘white man’) appeared out of the pouring rain in the middle of the night and woke them up. They took one look at my VW beetle and declared that there was no way it would be able to negotiate the 3 km long, slippery, dirt track up the mountain. I demurred, assuring them they would not believe where these little ‘bugs’ could go. ‘As good as a 4 X 4,’ I said, having observed their two-seater Land Rover in the fore-court. This they had to see they exclaimed. So it was decided that they would drive in front in their Landy and I would follow them up the mountain. Their

36 coyly exchanged glances and flashing white teeth told me they were looking forward to showing me the folly of my misplaced confidence.

So off we went. It was no contest. Within a couple of hundred metres, noticing that I was keeping up easily, the driver of the Landy changed up a gear on the first incline, put foot, developed a serious speed-wobble on the greasy surface, and crashed into a two metre deep ditch on the left side of the road. With them both sheepishly crammed onto my passenger seat I had to reverse back down the road before eventually finding a spot to turn round and head back to the station. It was still raining softly. The tractor was employed, the LR was extricated and I was left to make my way, on my own, to the top. I set up camp in the rain, sneezed, and changed into dry clothes. I was fast asleep in my sleeping bag just after one in the morning.

When I awoke, sometime before noon, it was still raining softly. I stepped out into the forest clearing in the gloom, surrounded by massive tree trunks that disappeared into the mist enveloping their crowns. And sneezed. It did not take me long to realize that I had been invaded by a rhinovirus during the long cold night. Probably courtesy of one of the rangers. Then it proceeded to rain, on and off, for ten days.

By day three my cold had cleared up thanks to many hours spent dozing in my warm sleeping bag while recovering from the 18 hour travel ordeal and waiting for the sun to come out. But by now everything non-metal was increasingly becoming saturated with moisture. My clothes felt clammy and even the interior of my sleeping bag was starting to smell a bit musty. Day five saw the beginning of the great ‘mouldering’. Small patches of fungal filaments and mycelia began to appear on my canvas tent and stretcher, sleeping bag and, horror of horror, my clothes. Day six was highlighted by the shedding of my rank smelling apparel, and naked walkies in the rain. Fortunately daytime temperatures were balmy, so whole-body goose-pimples did not erupt. Day seven turned out to be Tinned Food Armageddon. The sides of the cardboard box (no large plastic containers in those days) containing them collapsed, spilling tins off the rear seat of the car onto the floor, and most of the labels had fallen off. Some barely-clinging-on labels, as well as some assiduous detective work, allowed for provisional matching of tins and labels. Using my pocket- knife (you guessed it – Swiss Army) nail file, appropriate letters were etched on the tins – P for peas, B for baked beans … you get the idea. My leather boots were turning a sickly green. Don’t even ask about the toilet paper!

Day eight marked the inception of madness. Naked forest walkies now became walkie-talkies. The resident troop of Samango monkeys had become extremely curious about the singing, whistling, steaming, pink apparition wandering around on the forest floor below them and, over several days, had come closer and closer when they concluded that I was strange but harmless. Close enough to see the whites of their eyes. And so I began chatting to them. I bet you would have done the same. The only ‘contact’ I had with the outside world was the ominous crump of exploding ZANU mortars at the border near the Mozambique town of Espungabera, six kilometres away. Day ten witnessed the moment of climax. My clothes, tent and sleeping bag were kaput, my tinned food was succumbing to rust, and my brain was being slow-cooked inside my cranium. The ‘moment’ arrived during my daily walkie-talkie-with-the-primates. I told them a joke, started giggling, then laughing hysterically. Eventually I collapsed in a heap on the soaked leaf-littered forest floor. Shaken by this absolute loss of control I decided ENOUGH – tomorrow morning I am going HOME.

Day eleven. Sometime after sunrise I crawled out of my tent to find that everything was enveloped in steam. Not mist – real steam was rising in plumes from every wet surface. Shafts of sunlight were pouring through the canopy, dispelling ten days of unremitting gloom. I did a little dance that Zorba the Greek would have been proud of. Hundreds of hungry butterflies were everywhere!

37

Purgatory had become paradise in the blink of an eye. Two days of indescribably joyous butterflying followed and I left early on the morning of day 13 with a light heart.

The thirteenth day? ‘No,’ I thought, ‘I am not superstitious.’ Until, after an hour’s driving, I reached the banks of the seriously flooded main tributary of the Save River. The castellated, low-level causeway was nearly underwater. Just the tops of the 50 cm high concrete pillars were visible. Dozens of vehicles were parked at both ends of the 200 m long crossing. Some people had pitched tents and some were even having a braai and quaffing beers. I approached one chap on the river bank who was intently watching a stick he had planted in the water. ‘Going up or down?’ I enquired. ‘Down,’ he replied. ‘How fast?’ ‘Two inches in the last hour.’ According to his calculations the depth of the water would be about eight inches in about another four hours. Three hours later a large bus crossed from the other side. An hour later a Land Rover did the trip. Shortly thereafter a VW beetle went aqua. I had heard that VW beetles, because of their rear engine, are amphibious. I can state with a high degree of certainty that this is only partly true.

Several mature adults, when they saw what I was about to do, tried to persuade me that this may not be such a good idea. But an immature prefrontal cortex and loads of testosterone won the day. I stripped down to my shorts, jumped in, rolled down the windows, switched the wipers on and chucked her into second gear. Almost immediately water came cascading over the bonnet, up the windshield and over the roof. The wipers were totally ineffectual and I stuck my head out of the window, using the concrete pillars as directional guides. Jets of water, emanating from the clutch and brake pedal holes, were flying past my left shoulder. But things were going tolerably well. The stronger current in the midcourse of the river was pretty hectic but the high levels of testosterone were now augmented by insanely high levels of adrenalin. With the engine sputtering and coughing like a terminal asthmatic I reached the safety of the far bank and yanked the handbrake on. Sopping wet, I jumped out with an attitude that would have made Crocodile Dundee blush, flipped the engine cover open and touched the distributor cap to see how wet it was. It was wet. My shoulder-length hair (now only a distant memory) attempted to uproot itself, and my eyes glazed over as I staggered about wondering if cardiac arrest was imminent. The reaction from the assembled gallery was uproarious to put it mildly. When I had recovered, someone told me that all they could see was the outlined shape of my beetle hidden under the brown water as it progressed. Someone else declared that I obviously had a death wish and should be certified. He was probably right.

The rest, as they say, was plain sailing and I reached home safe and sound a day and a half later. There is however a postscript. A week after getting back, ‘Eva Braun’s’ (I know, her name is probably not quite PC nowadays) wheels started making grinding noises. Two weekends were spent cleaning and repacking the wheel bearings...

There has to be moral to this story – right? Many lessons were indeed learnt and a number of take homes and bottom lines are possible. But for me, a loner distrustful of my fellow man at the time, I realized just how much we humans need each other. In the time of corona the poignancy of this insight is re-affirmed for me in spades.

38

March migration? The nymphalids (Etienne Terblanche)

Odit veritas moras: “truth hates delay,” reads the Latin saying. I’m compelled to send in news though the data must be labelled “quick and dirty.” 3 Kerk Street, Haenertsburg, is where I live with my tribe. If you feel like a “Terblanche avalanche” of words, activity, and tea, join us! In any event, “our” street (I’ve always wanted to say that), like all the others in this village, enjoys one or two butterfly-friendly aspects. It runs exactly north-east. And the houses are at least 30 metres apart across the street. The street therefore acts as an unnatural north-east gully about 30 metres wide. Over the past weeks of March (2020), nymphalids were involved in what appears to be a migration. A constant stream of these creatures joined—no, overtook—pierids down the street. Leading the pack has been Acraea natalica, outnumbering the rest by a solid margin. Other floaters included A. aglaonice, A. horta, Junonia hierta, J. oenone, Precis octavia wsf, and the odd, indomitable Byblia ilithyia.

On 23 March 2020, after two days of a colder eastern breeze blowing into the unnatural gully mentioned above, nymphalid street numbers were down, but considerable numbers of Catopsilia florella and some Pinacopteryx eriphia (somehow always singly) were migrating anew across the village, distinctly in a north-westerly direction (more north than west), joined by Eurema brigitta who continued heading north-east. However, on a grass slope near Ebenezer dam later that day, my son Benjamin and I saw A. natalica flying north-east across the grass, including females. At any given moment when the sun was out, on a straight line ahead, at least ten were flitting by. A. natalica was followed by good numbers and the most beautiful forms of A. aglaonice.

If the nymphalid movement does qualify as a migration, it is interesting to think that in December here in our neck of the woods pierids dominated while a sprinkling of nymphalids already joined the crowd, whereas now in March the situation has reversed for the most part. A migratory cross- stitching across seasons!

Acraea natalica from the foot of Serala, prior to migration suggested here; they were already out in numbers. Lovely pink form.

Acraea aglaonice, part of the migration, and beautifully salmon.

39

How the Zebra lost its stripes (Mark Liptrot)

Mark Liptrot wishes to know if anyone has ever seen a similarly patterned Leptotes (Zebra Blue)?

This specimen was photographed in Mantenga Nature Reserve, eZulwini, eSwatini, on the hike up the mountain past the pine chalets (Coordinates: -26.443766879091804 31.164502143859856); it was mud-puddling around a footpath trampled by cattle. Mark’s time there was limited and a short search revealed no further specimens.

Hungry Caterpillars

Beverley Eliot, who lives in L’Agulhas (about 30 kilometres south of Bredasdorp), sent me some photos of Large White (Pieris brassicae) caterpillars that were feeding on her Rocket plants - and apparently doing quite a bit of damage.

Hopefully I persuaded Beverley to show some compassion for these European “settlers”…

Springtime in the UK

Chris Dobson, currently a resident of Tonbridge, Kent, sent me some recent photos from his new neighbourhood.

The coronavirus lockdown regulations, while similar to South Africa in some respects, do at least allow you to wander – in solitude – through local streets and parks.

Aglais io Anthocharis cardamines Celastrina argiolus Dene Park Tonbridge Tonbridge Tonbridge Chris Dobson Chris Dobson Chris Dobson

40

Caterpillar Hugger (Justin Bode)

Justin Bode composed the following article, which he is circulating to the gardening community.

Nature balances itself out when left alone. With no interference, larval predators (wasps, flies, robber flies, viruses, bacteria etc) would keep lepidoptera numbers in check.

For a butterfly or moth to ensure their survival as a species, theoretically only two eggs laid by the female need to reach adulthood, mate, lay eggs and continue with the life cycle. And yet in some cases 50 to 100 eggs are laid to ensure survival due to the large numbers of larvae that are predated on.

The updated conservation assessments of South Africa's butterflies indicate an increase in critically endangered species from 15 to 25 within the last 6 or so years (I need to check on how many are of conversation concern, but I think it is around 150) out of a total of around 800 taxa of butterflies in South Africa. We have not even looked at the conservation status of the around 10,000 species of moths that occur in South Africa as the knowledge, expertise, funding and human resources are just not available. So our butterflies are actually in trouble.

I from time to time give talks about butterflies at garden clubs, nature clubs and field-guide courses and often get the question, why do we not see any butterflies anymore. Short answers, we are destroying habitats, we use poisons on anything that may look like it may affect our plants, we rip out indigenous larval food-plants because we consider them weeds and replace them with pretty plants that serve no purpose in the environment they are in, other than our own pleasure. True, gardeners certainly do not do as much damage to the environment as huge industrial, mining and commercial developments and in many cases, gardens offer a last refuge to insects, birds, reptiles and small mammals.

In many cases we do not realize the impact of what we are causing. When we moved into our new house, we were delighted to have a small colony of Woolly Legs butterflies living on our lawn, their larvae are carnivorous (yes, really) and feed on plant lice. We made the decision to rip up the lawn, cut and fill to make a level area for a jungle gym for our children. Without realizing it at the time, we had destroyed that small butterfly colony. So in no way am I pointing fingers at anyone, I too have acted without regard to the balance that has been achieved (I wonder now if I would have had the plant lice problem on my gooseberries if I had not redone the lawn).

The more we learn, the more we find out that we know actually very little.

Yes, some lepidoptera can become pests, one thinks of the army worms, cycad moths, lily borer moths that can cause much destruction. But out of the more than 10,000 species of lepidoptera in South Africa less than 100 are recorded as using economically important crops as host plants. In a garden situation most of the species regarded as pests would be kept in check by their larval predators, but if they too have been poisoned, they cannot do what they would usually do.

In the majority of cases the plant that has been fed on recovers and often stronger as it is getting natural fertilizer from the caterpillars frass. There is no point for the caterpillar to destroy the plant (yes, they may defoliate the plant, but seldom destroy it) as there would be nothing for its offspring too feed on then.

41

Butterflies and moths also serve as important pollinators, not quite at the same level of bees, but certainly important enough to warrant taking them into consideration. There are a number of plants that rely exclusively on certain butterflies or moths for pollination. In South Africa, our proposed national butterfly, the Table Mountain Beauty is the ONLY known pollinator of the Red Disa orchid, lose the butterfly and the plant will follow it into extinction pretty quickly afterwards.

I have always on this page tried to assist with ID of lepidoptera and or their larvae where I can, as it is passion of mine along with creating a garden for them. I respect others opinions, even when I disagree with them so am in no way trying to pick a fight, but rather offer an alternative perspective.

One final thought, perhaps that plant that you are horrified that is being munched by a hungry caterpillar is actually on this earth as caterpillar food and not for our enjoyment?

Happy gardening in these strange times that we are living in. Justin Bode

Lepidochrysops (Marianne Espeland)

Marianne reports that she has received funding for her research proposal to continue work on Lepidochrysops and allied genera. Although approximately € 20 000 was cut from the budget, Marianne believes that she should still manage. About €4 000 has been allocated to cover some travel and other expenses incurred during the course of the project. She also intends to apply for a grant to National Geographic, including the names of everyone wishing to take part next season.

She intends to start the project either in August or September this year, since Svenja Ahlborn (who will be the PhD student on the project), will hand in her Master’s thesis niche modelling on Cape Lepidochrysops in July and can't start other work until this has been done. Two visits to SA, by Marianne and Svenja are planned, one this year and one in 2021. There is also a proposed visit to ABRI. Detailed plans for South Africa have still to be made; the trips will involve fieldwork and photographing specimens in collections. She hopes to be able to attend at least one LepSoc Africa meeting – more if possible! She would appreciate any suggestions, or offers of assistance. She further notes that she is working on the final figures for the first Lepidochrysops phylogeny paper, which should be circulated shortly. [email protected]

LepSoc Africa – Budget for 2020

Peter Ward, LepSoc Africa’s Treasurer, is preparing a list of items for our 2020 financial budget. I’ve requested R15 000 for barcoding samples for the Aloeides Project; does anyone else have any suggestions?

Please forward them to me ([email protected]) or Peter ([email protected]). 42

Gauteng Butterflies (Raimund Schutte)

Raimund sent me some great photos of butterflies from the Johannesburg area, taken in January and February:

Acraea horta Acraea natalica Belenois aurota Kyalami, Gauteng Kyalami, Gauteng St Stithians, Gauteng (Raimund Schutte) (Raimund Schutte) (Raimund Schutte)

Belenois creona severina Catopsilia florella Cyligramma latona St Stithians, Gauteng St Stithians, Gauteng Kyalami, Gauteng (Raimund Schutte) (Raimund Schutte) (Raimund Schutte)

Junonia hierta cebrene Junonia orithya madagascariensis Pontia helice helice St Stithians, Gauteng St Stithians, Gauteng St Stithians, Gauteng (Raimund Schutte) (Raimund Schutte) (Raimund Schutte)

Precis archesia archesia Papilio demodocus demodocus Telchinia rahira rahira Kyalami, Gauteng Kyalami, Gauteng St Stithians, Gauteng (Raimund Schutte) (Raimund Schutte) (Raimund Schutte)

43

KZN holiday (Jeremy Dobson)

Before the coronavirus lockdown I spent a few days in KZN – the South Coast and Drakensberg areas. Generally the areas I visited looked great - there has been plenty of rain - and the butterflies were good.

Ingeli The fringes of Ingeli Forest, about 25 km east of Kokstad, contained plenty of common forest butterflies, such as Eastern Gold-spotted Sylph (Metisella metis paris) and Rainforest Dull Brown (Cassionympha cassius). A few Karkloof Bush Beauty (Paralethe dendrophilus albina) were flying and, in the adjacent grassy areas, I saw a couple of Dark Ranger (Kedestes niveostriga niveostriga). Several Bush Kites (Papilio euphranor) were seen above the forest canopy; a solitary male posed – briefly – on the ground, for a photograph. Southern Gaudy Commodore (Precis octavia sesamus) - both dry season and wet season forms - were very common in the surrounding grassland, although there was no sign of Pondoland Autumn Widow (Dira oxylus); I had found a couple of these butterflies at Ingeli in December 2008, but haven’t seen them since at this locality.

28 species - Abundance Index 4.2 (Good)

Metisella metis paris Papilio euphranor Paralethe dendrophilus albina Ingeli, KwaZulu-Natal Ingeli, KwaZulu-Natal Ingeli, KwaZulu-Natal

Izingolweni The Umtamvuna valley near Izingolweni was thick with False Dotted Border (Belenois thysa thysa) - nearly all males - and Veined Swordtail (Graphium leonidas leonidas). Southern Sapphire (Iolaus silas) were flying in fair numbers, as well as Rainforest Acraea (Acraea boopis boopis) and Dusky- veined Telchinia (Telchinia igola). 61 species - AI 4.3 (Good)

Belenois thysa thysa Bicyclus safitza safitza Alaena amazoula amazoula Izingolweni, KwaZulu-Natal Izingolweni, KwaZulu-Natal Izingolweni, KwaZulu-Natal

44

Old Pont Some of you may have read in January’s newsletter about Cameron Blair’s discovery of the Barred Sailer (Neptis trigonophora trigonophora) near Southbroom on the KZN south coast. I can confirm that this species is now found in Port Edward as well (Old Pont area and surrounds). Nothing is easy of course; it flies with Spotted Sailer (Neptis saclava marpessa) and Common Barred Sailer (Neptis laeta). The Umtamvuna forest contains many of the special butterflies that Port St Johns is renowned for, such as Southern Yellow-banded Evening Brown (Gnophodes betsimena diversa), Boisduval's False Acraea (Pseudacraea boisduvalii trimenii) form colvillei and now, Neptis trigonophora; for most of us, it is a significantly closer destination.

43 species - AI 3.6 (Average)

Artitropa erinnys erinnys (larva) Junonia natalica natalica Leptotes pirithous pirithous Port Edward, KwaZulu-Natal Port Edward, KwaZulu-Natal Port Edward, KwaZulu-Natal

Oribi Gorge A visit to Oribi Gorge yielded 47 species (3.8 - Average). Most of the Oribi specials, such as Pondo Shadefly (Coenyra aurantiaca) and Coast Purple Tip (Colotis erone), were flying in reasonable numbers. I didn’t see any False Wanderer (Pseudacraea eurytus imitator) or the apricot-coloured female form of Small Ant-heap White (Dixeia pigea), which are sometimes found in this forest.

Coenyra aurantiaca Pseudacraea lucretia tarquinea Colotis erone Oribi Gorge, KwaZulu-Natal Oribi Gorge, KwaZulu-Natal Oribi Gorge, KwaZulu-Natal

45

Cathedral Peak Finally, I spent a few days at Cathedral Peak (Colleen and I were celebrating our 30th wedding anniversary and had decided not to risk an overseas holiday given the travel uncertainty at the time). The hotel is great and there are nice walks in the surrounding hills, but to be honest, this is not a great butterfly destination in March. Apart from loads of Gaudy Commodore, the only noteworthy butterflies I saw were Marsh Commodore (Precis ceryne ceryne) Precis octavia sesamus and Orange Telchinia (Telchinia anacreon). Cathedral Peak, KwaZulu-Natal

27 species - AI 4.1 (Good)

Armenia Conference (Dubi Benyamini)

Please refer to the links for Registration and a call for Abstracts for the first international Congress of the Near East Butterflies, which will be held in Yerevan, Armenia - between 15-18 of June. This small country has some 275 butterflies; mid-June is their spring time. Armenia Conference - Registration Armenia - Abstracts Note: I haven’t heard from Dubi recently; it is possible that this conference has been cancelled.

46

Butterflies of the Soutpansberg (Christopher Willis)

Christopher Willis put together an album of butterfly photographs from the Soutpansberg as a tribute to Ian Gaigher, who was a major figure in the promotion of biodiversity conservation within the Soutpansberg and Vhembe Biosphere Reserve.

Hemiolaus caeculus caeculus Precis tugela tugela Papilio ophidicephalus entabeni Soutpansberg, Limpopo Soutpansberg, Limpopo Soutpansberg, Limpopo Christopher Willis Christopher Willis Christopher Willis

Telchinia induna salmontana Nepheronia thalassina sinalata Netrobalane canopus Soutpansberg, Limpopo Soutpansberg, Limpopo Soutpansberg, Limpopo Christopher Willis Christopher Willis Christopher Willis

Caprona pillaana Catacroptera cloanthe cloanthe Dotta callicles Soutpansberg, Limpopo Soutpansberg, Limpopo Soutpansberg, Limpopo Christopher Willis Christopher Willis Christopher Willis

47

Storage of Lepidoptera collections (Jeremy Dobson) Due to the lockdown there has been no further progress with this matter, but I’ve retained March’s article, below, for information.

A reminder that we need to find a storage facility for Lepidoptera specimens. I have had a couple of discussions with potential sponsors and I’m confident that we will be able to commence with this project fairly soon, although details of the development still need to be resolved. An architect and a quantity surveyor are currently - at risk – devolving the scheme a bit further:

1. The minimum requirement is approximately 500 m2 of industrial storage space (enough to contain about 1 million specimens and twice this with racking), with an office component for deliveries and sorting and a study and toilet. We would need to appoint a permanent manager / curator, whose job description would include looking after the specimens, sorting and cataloguing the collection and coordinating visits by researchers. 2. The ultimate goal would be the construction of a national Butterfly Centre. The ABRI collection could possibly be purchased and with this and other collections, we would hold the largest and most comprehensive collection of African Lepidoptera anywhere in the world. In addition to the storage component (say 1 500 m2), the Centre could have a public display area, a bookshop, a photographic gallery and possibly a butterfly flight-house and a restaurant.

LepSoc Africa Transcribing Project

As above, there has been no further progress in this period; I tried scanning some documents using OCR software and the results were spectacularly unsuccessful. Note that this is not – primarily – a data collection exercise, but rather an attempt to recover (in an electronic format) some history of Africa’s butterfly pioneers.

The members of LepSoc Africa hold a considerable amount of original letters, notes and other memorabilia, related to African Lepidoptera and African lepidopterists.

At the suggestion of Silvia Kirkman, I’d like to initiate a formal scanning and archiving project, to preserve these unique documents. We hope to scan and, using specialized software, transcribe handwritten notes into editable text. The work will be fully cross-referenced and, once complete, should become a very interesting and valuable resource. There may be a publishing opportunity in future.

I appeal for a volunteer to assist with this undertaking: assume at this stage that there will be no salary, although full recognition will be awarded and all costs will be borne by LSA. Although not essential, it would probably assist if applicants are reasonably familiar with the scientific names of South African butterflies.

48

Permits

LepSoc Africa members can now apply, online, to be included on provincial research-permits. Details as follow:

• Log on to the Lepidopterists’ Society of Africa website www.lepsocafrica.org • Go to ‘Members Only’ and then click on ’Permits’ • Please read the relevant information and then click on ‘Apply for a permit’ • Complete the form and tick the Acknowledgement boxes. Without ticking these boxes you will not be able to submit the form • Submit the form • The system acknowledges that the application has been received and will be attended to (you will receive a message “Your application has been received and will be attended to”) • An email is sent to the Permits Administrator (PA) advising him/her of the new application • By the end of May each year the member must submit his/her observations to the PA

NOTE: Western Cape permits must be applied for individually, as described elsewhere on the website.

Permits have been acquired for KZN and Northern Cape; Mpumalanga and Limpopo are expected shortly.

Fourth Afrotropical Lepidoptera Workshop

As noted earlier, the Afrotropical Lepidoptera Workshop, scheduled for November, has been postponed due the coronavirus pandemic.

I had intended to wait until the end on May before making a final decision, but unfortunately the situation has not improved significantly - at least not in South Africa - and I’m fairly certain that the picture will be no clearer in one month’s time: the risk of people losing their deposits due to late cancellation of the Workshop is too great for us to proceed.

My suggestion is that we postpone the event by one calendar year - taking cognisance of the lunar cycle, provisionally Sat 31 October to Sun 15 November 2021.

49

UPCOMING EVENTS

Butterfly Events

The next Butterfly Evening was scheduled for Ruimsig Country Club, Roodepoort on Thursday 14 May at 19h00, however this has been postponed pending relaxation of the coronavirus restrictions.

We are hoping to proceed with LepSoc Africa’s annual conference and AGM, which is scheduled for 12 and 13 September; the situation will be monitored and you will be advised accordingly.

BOOKS

LepSoc Africa Book Stock

LepSoc Africa holds a considerable stock of Metamorphosis journals and also books, such as The Emperor Moths of Namibia by Rolf Oberprieler and The Butterflies of Zambia by A. Heath, M. Newport and D. Hancock. The above books are on sale for R150 and R175 respectively. Please order using the LSA Website (http://lepsocafrica.org/) as follows:

From the Home page, select the Publications tab at the top of the page. Select Shop near the top-right of this page. Select what you wish to purchase from the numerous books and back-issues of Metamorphosis contained on this page. Select the Cart and Checkout tab at the top of the page. Once you are happy press Go to Checkout, select the delivery method that you require and Place Order!

50

Field Guide to Butterflies of South Africa

(Steve Woodhall)

Fully revised, the new edition of Field Guide to Butterflies of South Africa features all of South Africa’s 671 butterfly species. This popular guide includes newly described species and subspecies, and the most recent taxonomic changes based on DNA studies.

Butterflies of South Africa

Moths of Africa (Hermann Hacker)

In February 2019 the first volume of the book-series Moths of Africa was released. The book is a review of the African Boletobiinae and includes descriptions of 4 genera, 266 species and 7 subspecies new to science.

Compiled, primarily, by Hermann Hacker, the book includes input from Ralf Fiebig and Dirk Stadie, whom many of you will remember from last year’s Madagascar Workshop.

It isn’t cheap (€162), but according to Hermann Staude, this book is one of the most important works on African Lepidoptera to be produced in recent years.

Moths of Africa

Dragonfly Book

LepSoc Africa members, Michèle and Warwick Tarboton, have produced an updated edition of their book Dragonflies and Damselflies of South Africa.

Why not keep an eye out for these amazing insects while you are in the field? This book is the perfect reference. Among other outlets, the book may be ordered online from Macro for R248. Dragonflies and Damselflies of South Africa

51

COLLECTORS CORNER

If you are looking for cabinets, someone I can recommend is Brendan McErlaine (082 446 5136).

Olivier Houe (082 455 3356 or [email protected]) can be contacted for trays, traps, pins or other entomological supplies.

David Horne has requested a spot in “Collectors Corner”. David’s business, “Mad Hornet Entomological Supplies”, carry a range of entomological equipment; David is interested to hear about what items are required by collectors and breeders, in order that he may procure supplies at reasonable prices and ensure ready availability.

Mad HorneT Entomological Supplies (A product of Horne Technologies CC) www.madhornet.co.za [email protected] 076 563 2084

52

FEATURES

English names for Afrotropical Butterflies (Jeremy Dobson)

Please welcome Thomas Desloges to the “English naming panel”! Tom is an expert on butterflies of the Congo, with a specific interest in the Limenitidinae; he has prepared a list of names for Euptera and Euryphura, which are included in this newsletter and is going to have a look at Pseudathyma. A reminder that Peter Sharland is looking at Cymothoe, Graham Henning at Acraea and Martin Lunderstedt at Pseudacraea and Euriphene…

Anyone may propose a name, but in order to be a judge on the review panel, you must first submit proposed names for a minimum of ten “Placeholders”: this must include all representatives of one or more genera (refer to Method and Program – Phase 2, below):

OBJECTIVES

1. To create a single, comprehensive and consistent list of English names for Afrotropical Papilionoidea; this list will be published in Metamorphosis, once it has been completed (this will only be in about 8-years’ time, unless I receive significant assistance). Afrotropical Butterflies includes most currently recognized English names, although these extend only to species level. More than 50% of African butterflies - in excess of 3 000 taxa) do not currently have English names. 2. To create names that, where possible, assist recognition of butterflies among non-experts - in other words, the vast majority of butterfly enthusiasts! 3. It should be possible to insert the completed list seamlessly into a world-list of English butterfly names (we are merely writing the African chapter): the names need to take cognizance of butterfly names used elsewhere in the world.

GUIDELINES

1. If at all possible, names should assist with identification. Keys could include colour, pattern, size, shape, distribution, flight characteristics or behaviour. 2. In line with the above, authors names or the name of the discoverer (which are recognised in the scientific name in any case), should be avoided, if at all possible. Annotation such as “Common” or the names of towns or cities should be used with discretion. Remember, that the names apply to the entire Afrotropical region; “Northern” is unlikely to be an apt name for a South African taxa, unless as a distinction between northern and southern subspecies. 3. Names may not exceed 40 characters in length, including spaces or punctuation. Although not essential, by default, names should follow the structure of the scientific taxonomy: a name for the genus or group, a name for the species and, where applicable, a moniker to distinguish subspecies. Soutpansberg Emperor Swallowtail (Papilio ophidicephalus entabeni) for example.

53

METHOD AND PROGRAM

Phase 1 – Compilation of Placeholder list 1. An initial checklist of “placeholders” will be compiled. This includes the latest, published English names (including, for SA taxa, those in Steve Woodhall’s new book), plus the suggested names that have been previously listed in ABN - the highlighted genera in the tables below. 2. Everyone is welcome to compile lists of placeholder names, but please don’t re-do the names that have been listed already – that step relates to the review process (see Phase 2 below). For consistency, entries must include names for each representative of an African genus. In instances where there is a current “placeholder”, the proposed name will be listed as an alternative proposal under your name. 3. I have committed to “publishing” a full list of species within six genera in each edition of ABN. Names have been proposed for 30 genera so far, which means we have 291 still to go; about eight years at the current rate.

Phase 2 – Review, revision and finalization of the list 1. Once we have a full list of “placeholders” and alternative proposals, the review, approval or revision of names can commence. While we are unlikely to achieve consensus in all instances, the process will be as democratic as possible. Placeholder names should be changed if a) they are incorrect, misleading or do not follow the guidelines, or b) by replacement, by an alternative proposal, by a simple majority of votes by the accredited “Judges”; in the event of a tie, the existing Placeholder will remain. 2. While this review process can commence at any time (subject to the individual reviewer’s qualification for the role – see below), it should probably only be concluded once all the names within a family - or at the very least, within a subfamily - have been completed. 3. Membership of the review panel is open to anyone, but in order to have a voice in the review process, you must first undertake an “entrance exam”. To qualify as a reviewer, you must create a minimum of 10 “placeholder” names for the English naming project, which should include all representatives of one, or more genera. SA English names, or other names already on the placeholder list, do not qualify as “placeholders”, although they will be listed as “Alternatives” under your name. The idea is that reviewers may be more inclined to treat the process with some sensitivity if there are a few of their own suggestions in the mix. Also, of course, it demonstrates a commitment to the project and will help speed up the ultimate outcome.

We will try and “finalize” a minimum of six genera every two months (one genus from each column in the table, below); this will take another eight years, but if possible – and if I get assistance from enough people – I’m sure we can wrap this up much sooner. The highlighted genera have been processed already (green in this newsletter and yellow in previous editions):

54

GENUS GENUS NAME COUNT GENUS GENUS NAME COUNT Charaxes Charaxes 457 Platylesches Hopper 27 Euphaedra Forester 346 Ypthima Three-ring 26 Acraea Acraea 202 Afriodinia Judy 25 Iolaus Sapphire 174 Precis Commodore 25 Bebearia Small Forester 167 Sevenia Tree Nymph 25 Lepidochrysops Giant Cupid 158 Hypolimnas Diadem 24 Papilio Swallowtail 157 Mimeresia Harlequin 24 Cymothoe Glider 153 Pseudathyma False Sergeant 24 Telchinia Telchinia 153 Appias Albatross White 23 Bicyclus Bush Brown 125 Falcuna Marble 23 Mylothris Dotted Border 124 Gorgyra Leaf Sitter 23 Anthene Ciliate Blue 107 Metisella Sylph 23 Neptis Sailer 104 Brakefieldia Patroller 22 Euriphene Nymph 102 Dixeia Small White 22 Liptena Liptena 100 Iridana Sapphire Gem 22 Colotis Tip 94 Capys Protea 21 Apallaga Yellow Sprite 88 Neocoenyra Round Ringlet 21 Pentila Spotted Buff 81 Borbo Swift 20 Aloeides Russet 75 Ceratrichia Forest Sylph 20 Ornipholidotos Glasswing 75 Cerautola Angled Flash 20 Heteropsis Low-eye 70 Cupidesthes Light Hairtail 20 Chrysoritis Opal 69 Eresina Tree Buff 20 Graphium Swordtail 66 Geritola Light Flash 20 Amauris Friar 65 Kedestes Ranger 20 Belenois Caper White 65 Pseudonympha Brown 20 Pilodeudorix Blue Playboy 65 Tetrarhanis On-off 20 Neurellipes Zebra Hairtail 64 Aphysoneura Bamboo Ringlet 19 Cephetola Dark Flash 55 Stugeta Marbled Sapphire 19 Stempfferia Plain Flash 52 Eicochrysops Ash Blue 18 Aslauga Purple 51 Eresiomera Pearly 18 Pseudacraea False Acraea 51 Euryphura Commander 18 Cigaritis Silverline 46 Harpendyreus Mountain Blue 18 Aphnaeus Highflier 44 Leptotes Zebra Blue 18 Euptera Pilot 44 Thermoniphas Chalk Blue 18 Telipna Telipna 39 Chloroselas Gem 17 Lachnocnema Woolly Legs 38 Coeliades Policeman 17 Strabena High-eye 37 Hewitsonia Tiger Flash 17 Deudorix Playboy 35 Paradeudorix Fairy Playboy 17 Hypolycaena Fairy Hairstreak 35 Artitropa Night Fighter 16 Thestor Skolly 35 Tuxentius Pie 16 Micropentila Dots 34 Andronymus Dart 15 Alaena Zulu 33 Eretis Elf 15 Abantis Paradise Skipper 32 Osmodes White-spots 15 Uranothauma Heart 32 Eurema Grass Yellow 14 Euchrysops Smoky Blue 31 Leptosia Wood White 14 Junonia Pansy 31 Tarucus Pierrot 14 Pseudaletis Fantasy 31 Leptomyrina Black-eye 13 Spialia Sandman 29 Meza Three-spot Missile 13 Triclema Small Hairtail 29 Nepheronia Vagrant 13 Axiocerses Scarlet 28 Perrotia Bamboo Dart 13 Baliochila Mottled Buff 28 Stygionympha Hillside Brown 13 Mimacraea Acraea Mimic 28 Willemi Sylph 13 Sarangesa Elfin 28 Gretna Twilight Skipper 12 Celaenorrhinus Dark Sprite 27 Hypophytala Banded Flash 12 Eagris Flat 27 Myrina Fig-tree Blue 12

55

GENUS GENUS NAME COUNT GENUS GENUS NAME COUNT Orachrysops Cupid 12 Tagiades Clouded Flat 6 Vanessa Admiral 12 Torynesis Veined Widow 6 Caenides Recluse 11 Tsitana Sylph 6 Chilades Jewel Blue 11 Astictopterus Dark Ranger 5 Nervia Painted Ranger 11 Aterica Glade Nymph 5 Trimenia Silver-spotted Copper 11 Byblia Joker 5 Acleros Dusky Dart 10 Danaus Tiger 5 Cacyreus Bronze 10 Euchloe Green-striped White 5 Colias Clouded Yellow 10 Euploea Crow 5 Eurytela Piper 10 Evena Large Pathfinder 5 Leona Large Recluse 10 Gnophodes Evening Brown 5 Palla Palla 10 Hovala Malagasy Yellow Sylph 5 Pteroteinon Red-eye 10 Libythea Snout 5 Azanus Babul Blue 9 Melphinyet Forest Swift 5 Chondrolepis Snow-horned Skipper 9 Paronymus Large Dart 5 Cooksonia Tiger Mimic 9 Physcaeneura Webbed Ringlet 5 Deloneura Large Buff 9 Pinacopteryx Zebra White 5 Issoria Fritillary 9 Pseudopontia Ghost 5 Lipaphnaeus Silver Speckle 9 Semalea Silky Skipper 5 Oboronia Ginger Blue 9 Spalgis Harvester 5 Oxylides False Head 9 Tirumala Monarch 5 Scopulifera Orange Sprite 9 Actizera Rayed Blue 4 Citrinophila Lemon Buff 8 Ampittia Ranger 4 Durbania Rocksitter 8 Apaturopsis Empress 4 Euliphyra Witch 8 Argyrocheila Fairy Buff 4 Fulda Malagasy Hopper 8 Cassionympha Dull Brown 4 Neita Large Ringlet 8 Cnodontes Plain Buff 4 Pardaleodes Pathfinder 8 Coenyropsis Lined Ringlet 4 Protogoniomorpha Mother-of-Pearl 8 Cupidopsis Meadow Blue 4 Tarsocera Spring Widow 8 Dapidodigma Virgin 4 Teriomima Yellow Buff 8 Dotta Spangled Ranger 4 Antanartia Admiral 7 Durbaniella Rocksitter 4 Ariadne Castor 7 Epitola Pointed Flash 4 Calleagris Milky Flat 7 Erikssonia Acraea Copper 4 Dingana Widow 7 Etesiolaus Green Sapphire 4 Hemiolaus Hairstreak 7 Euthecta Small Buff 4 Larinopoda Pierid Buff 7 Gegenes Dodger 4 Salamis Mother-of-Pearl 7 Hewitola Pointed Flash 4 Serradinga Speckled Widow 7 Hypomyrina Orange Playboy 4 Syrmoptera False Head 7 Lissia Large Recluse 4 Teracolus Tip 7 Megalopalpus Harvester 4 Torbenia Glasswing 7 Monza Grass Skipper 4 Zophopetes Palm Night-fighter 7 Neptidopsis False Sailer 4 Argemma Forest Sylph 6 Obania Obania 4 Dira Autumn Widow 6 Ortholexis Scarce Sprite 4 Epitolina Dull Flash 6 Paralethe Bush Beauty 4 Fresna Acraea Hopper 6 Parasiomera Harlequin 4 Hypoleucis Costus Skipper 6 Parnara Watchman 4 Lycaena Copper 6 Parosmodes Orange 4 Melphina Forest Swift 6 Pseuderesia Harlequin 4 Paracleros Dusky Dart 6 Saribia Judy 4 Phalanta Leopard 6 Teniorhinus Small Fox 4 Phasis Arrowhead 6 Toxochitona Fluttering Buff 4 Pontia Dappled White 6 Vanessula Lady’s Maid 4 Pyrrhiades Policeman 6 Zeritis Checkered Gem 4

56

GENUS GENUS NAME COUNT GENUS GENUS NAME COUNT Afrogegenes Dodger 3 Ptelina Bordered Buff 2 Arnetta Malagasy Sylph 3 Pyrrhochalcia Policeman 2 Caprona Ragged Skipper 3 Rhabdomantis Large Fox 2 Catopsilia Migrant 3 Takliades Policeman 2 Ceratricula Forest Sylph 3 Triskelionia Tricerate Elfin 2 Coenyra Shadefly 3 Xanthonymus Yellow Disc 2 Crudaria Grey 3 Zizeeria Grass Blue 2 Cyrestis Map 3 Aeropetes Mountain Pride 1 Eresinopsides Mottled Tree Buff 3 Afrodryas Autumn-leaf Vagrant 1 Flandria Forest Sylph 3 Ankola Red Disc 1 Gamia Grand Skipper 3 Argynnis Fritillary 1 Hallelesis Cream Ringlet 3 Argyraspodes Silver-spotted Copper 1 Harma Angled Glider 3 Batelusia Zebra Flash 1 Kakumia Ant Buff 3 Calopieris Desert Beauty 1 Kallimoides African Leaf 3 Carcharodus Sandman 1 Larsenia Swift 3 Catochrysops Shiny Blue 1 Leucochitonea White-cloaked Skipper 3 Cesa Gem 1 Malaza Malagasy Sylph 3 Congdonia Plain Buff 1 Melanitis Evening Brown 3 Durbaniopsis Rocksitter 1 Melitaea False Fritillary 3 Erionota Banana Skipper 1 Mesoxantha Drury’s Delight 3 Euryphaedra Forester 1 Monile Jewelled Hairtail 3 Gideona Pointed Tip 1 Phytala Forest Flash 3 Gomalia Green-marbled Sandman 1 Pieris Cabbage White 3 Gyrogra Leaf Sitter 1 Prosopalpus Dwarf Skipper 3 Hamanumida Guinea-fowl 1 Pseudonacaduba Lineblue 3 Herila Speckled Orange 1 Teratoneura Isabella 3 Hipparchia Grayling 1 Tylopaedia King Copper 3 Isoteinon Dark Ranger 1 Xanthodisca Yellow Disc 3 Katreus Giant Sprite 1 Zenonia Spotted Hopper 3 Kumothales Congo Nymph 1 Zintha Pierrot 3 Lampides Pea Blue 1 Acada Axehead 2 Lepella Central Sylph 1 Aethiopana Acraea Flash 2 Mallika Jackson’s Leaf 1 Alenia Speckled Sandman 2 Mashunoides Marsh Ringlet 1 Bettonula Brown Sprite 2 Moltena Strelitzia Night-fighter 1 Brephidium Pygmy Blue 2 Mopala Grass Skipper 1 Brusa Marbled Swift 2 Neoepitola Congo Flash 1 Catacroptera Pirate 2 Netrobalane Buff-tipped Skipper 1 Cynandra Brilliant Nymph 2 Noctulana Brown Forest Swift 1 Elymnias Palmfly 2 Oraidium Dwarf Blue 1 Eronia Vine-leaf Vagrant 2 Pardopsis Polka Dot 1 Euryphurana Noble Commander 2 Pharmacophagus Swallowtail 1 Harmilla Elegant Forester 2 Ploetzia Hopper 1 Hollandus Pathfinder 2 Powellana Congo Flash 1 Kobelana Dark Flat 2 Pseudargynnis Leopard Nymph 1 Lachnoptera Leopard 2 Pseudoneaveia Congo Flash 1 Lasiommata Wall Brown 2 Smerina Leopard 1 Mashuna Marsh Ringlet 2 Tumerepedes Nigerian Buff 1 Melampias Boland Brown 2 Vansomerenia Gem 1 Neaveia Pierine Blue 2 Ypthimomorpha Three-ring 1 Osphantes Lobed Skipper 2 Zizina Clover Blue 1 Paternympha Small Ringlet 2 Zizula Gaika Blue 1 Pelopidas Branded Swift 2 6434 Procampta Elf 2 Pseudoneptis False Sailer 2

57

The six genera – all Pieridae - for which I’ve proposed English names in this edition of the newsletter are: Colotis (94 taxa), Nepheronia (13 taxa), Teracolus (7 taxa), Pseudopontia (5 taxa), Pieris (3 taxa) and Afrodryas (single taxon).

In addition, we have the two genera for which Thomas Desloges has listed proposed names:

Euptera (44 taxa) and Euryphura (18 taxa).

ENGLISH NAME FULL SCIENTIFIC NAME AUTHOR Scarlet Tip Colotis annae annae (Wallengren, 1857) Golden Scarlet Tip Colotis annae hildebrandtii (Staudinger, 1884) Western Scarlet Tip Colotis annae walkeri (Butler, 1884) Red Tip Colotis antevippe antevippe (Boisduval, 1836) Southern Red Tip* Colotis antevippe gavisa (Wallengren, 1857) Abyssinian Red Tip Colotis antevippe zera (Lucas, 1852) African Arab Tip Colotis aurigineus (Butler, 1883) Sulphur Orange Tip Colotis auxo auxo (Lucas, 1852) Malawi Sulphur Orange Tip Colotis auxo dissociatus (Butler, 1897) Topaz Arab Colotis calais calais (Cramer, 1775) Malagasy Topaz Arab Tip Colotis calais crowleyi (Sharpe, 1898) Namib Topaz Arab Tip Colotis calais williami Henning & Henning, 1994 Kilimanjaro Arab Tip Colotis castalis (Staudinger, 1884) Eastern Lilac Tip* Colotis celimene amina (Hewitson, 1866) Niger Lilac Tip Colotis celimene angusi Rothschild, 1921 Lilac Tip Colotis celimene celimene (Lucas, 1852) Namib Lilac Tip Colotis celimene pholoe (Wallengren, 1860) Sudan Lilac Tip Colotis celimene sudanicus (Aurivillius, 1905) Golden Arab Tip Colotis chrysonome (Klug, 1829) Black-marked Orange Tip Colotis daira daira (Klug, 1829) Kenya Black-marked Orange Tip Colotis daira jacksoni (Sharpe, 1890) Sudan Black-marked Orange Tip Colotis daira stygia (Felder & Felder, 1865) African Banded Scarlet Tip Colotis danae eupompe (Klug, 1829) Desert Arab Colotis doubledayi (Hopffer, 1862) Rwanda Elgon Crimson Tip Colotis elgonensis basilewskyi Berger, 1956 Elgon Crimson Tip Colotis elgonensis elgonensis (Sharpe, 1891) Cameroon Elgon Crimson Tip Colotis elgonensis glauningi (Schultze, 1909) Kenya Elgon Crimson Tip Colotis elgonensis kenia Talbot, 1939 Large Elgon Crimson Tip Colotis elgonensis nobilis Carcasson, 1961 Small Sahel Orange Tip Colotis ephyia (Klug, 1829) Coast Purple Tip Colotis erone (Angas, 1849) Somalia Round-winged Orange Tip Colotis euippe complexivus (Butler, 1886) Round-winged Orange Tip Colotis euippe euippe (Linnaeus, 1758) Abyssinian Round-winged Orange Tip Colotis euippe exole (Reiche, 1850) Congo Round-winged Orange Tip Colotis euippe mediata Talbot, 1939 Chad Round-winged Orange Tip Colotis euippe mirei Bernardi, 1960 Southern Round-winged Orange Tip Colotis euippe omphale (Godart, 1819) Dune Crimson Tip Colotis eunoma eunoma (Hopffer, 1855) Northern Dune Crimson Tip Colotis eunoma flotowi (Suffert, 1904)

58

Southern Small Orange Tip* Colotis evagore antigone (Boisduval, 1836) Small Orange Tip Colotis evagore evagore (Klug, 1829) Socotra Small Orange Tip Colotis evagore niveus (Butler, 1881) European Small Orange Tip Colotis evagore nouna (Lucas, 1849) Island Red Tip Colotis evanthe evanthe (Boisduval, 1836) Northern Island Red Tip Colotis evanthe evanthides (Holland, 1896) Northern Sulphur Orange Tip Colotis evarne (Klug, 1829) Eastern Orange Tip Colotis evenina casta (Gerstaecker, 1871) African Orange Tip Colotis evenina evenina (Wallengren, 1857) Zanzibar Orange Tip Colotis evenina sipylus (Swinhoe, 1884) Kenya Orange Tip Colotis evenina xantholeuca (Sharpe, 1904) Large Salmon Arab Tip Colotis fausta fausta (Olivier, 1807) Somalia Large Salmon Arab Tip Colotis fausta mijurteina Carpenter, 1951 Yemen Large Salmon Arab Tip Colotis fausta vi (Swinhoe, 1884) Malagasy Crimson Tip Colotis guenei (Mabille, 1877) Southern Yellow Patch Tip Colotis halimede australis Talbot, 1939 Yellow Patch Tip Colotis halimede halimede (Klug, 1829) Somalia Yellow Patch Tip Colotis halimede restricta Talbot, 1939 Congo Orange Tip Colotis hecqi Bouyer, 2018 Uganda Eastern Purple Tip Colotis hetaera ankolensis Stoneham, 1940 Baro Eastern Purple Tip Colotis hetaera aspasia (Ungemach, 1932) Eastern Purple Tip Colotis hetaera hetaera (Gerstaecker, 1871) Somalia Eastern Purple Tip Colotis hetaera lorti (Sharpe, 1896) Yellow Orange Tip Colotis incretus (Butler, 1881) Bushveld Purple Tip Colotis ione (Godart, 1819) Kalahari Orange Tip Colotis lais (Butler, 1876) Desert Orange Tip Colotis liagore (Klug, 1829) Malagasy Black Tip Colotis mananhari (Ward, 1870) Bushveld Orange Tip Colotis pallene (Hopffer, 1855) Ethiopia Blue-spotted Arab Tip Colotis phisadia ocellatus (Butler, 1886) Blue-spotted Arab Tip Colotis phisadia phisadia (Godart, 1819) Mombasa Blue-spotted Arab Tip Colotis phisadia rothschildi (Sharpe, 1898) Somalia Blue-spotted Arab Tip Colotis phisadia somalica Storace, 1948 Uganda Blue-spotted Arab Tip Colotis phisadia vagus d’Abrera, 1980 Indian Blue-spotted Arab Tip Colotis phisadia vestalis (Butler, 1876) Somalia Orange Patch Tip Colotis pleione heliocaustus (Butler, 1886) Sudan Orange Patch Tip Colotis pleione nilus Talbot, 1942 Orange Patch Tip Colotis pleione pleione (Klug, 1829) Somalia Large Lilac Tip Colotis praeclarus (Butler, 1886) Yellow Splendour Tip Colotis protomedia (Klug, 1829) Queen Purple Tip Colotis regina (Trimen, 1863) Taveta Orange Tip Colotis rogersi (Dixey, 1915) Black Bordered Arab Tip Colotis ungemachi (Le Cerf, 1922) No Patch Tip Colotis venosa (Staudinger, 1885) Senegal Veined Arab Tip Colotis vesta amelia (Lucas, 1852) Southern Veined Arab Tip* Colotis vesta argillaceus (Butler, 1877) Masasi Veined Arab Tip Colotis vesta catachrysops (Butler, 1878) Nyanza Veined Arab Tip Colotis vesta hanningtoni (Butler, 1883) Tanzania Veined Arab Tip Colotis vesta kagera Congdon, Kielland & Collins, 1998 Nyassa Veined Arab Tip Colotis vesta mutans (Butler, 1877) 59

Semuliki Veined Arab Tip Colotis vesta princeps Talbot, 1939 Mweru Veined Arab Tip Colotis vesta rhodesinus (Butler, 1894) Sudan Veined Arab Tip Colotis vesta velleda (Lucas, 1852) Veined Arab Tip Colotis vesta vesta (Reiche, 1850) Malagasy Lilac Tip Colotis zoe (Grandidier, 1867) Large Vagrant Nepheronia argia argia (Fabricius, 1775) Central Large Vagrant Nepheronia argia argolisia (Stoneham, 1957) Eastern Large Vagrant Nepheronia argia mhondana (Suffert, 1904) Southern Large Vagrant Nepheronia argia varia (Trimen, 1864) Transvaal Large Vagrant Nepheronia argia variegata Henning, 1994 Northern Green-eyed Vagrant Nepheronia buquetii buchanani (Rothschild, 1921) Green-eyed Vagrant* Nepheronia buquetii buquetii (Boisduval, 1836) Malagasy Vagrant Nepheronia pauliani (Bernardi, 1959) Round-winged Vagrant Nepheronia pharis pharis (Boisduval, 1836) Eastern Round-winged Vagrant Nepheronia pharis silvanus (Stoneham, 1957) Southern Cambridge Vagrant* Nepheronia thalassina sinalata (Suffert, 1904) Cambridge Vagrant Nepheronia thalassina thalassina (Boisduval, 1836) Congo Cambridge Vagrant Nepheronia thalassina verulanus (Ward, 1871) Speckled Sulphur Tip Teracolus agoye agoye (Wallengren, 1857) Desert Speckled Sulphur Tip Teracolus agoye bowkeri (Trimen, 1883) Somalia Speckled Sulphur Tip Teracolus agoye zephyrus (Marshall, 1897) Miombo Traveller Tip Teracolus ducissa (Dognin, 1891) Yemen Banded Gold Tip Teracolus eris contractus Gabriel, 1954 Banded Gold Tip Teracolus eris eris (Klug, 1829) Lemon Traveller Tip* Teracolus subfasciatus (Swainson, 1833) Southern Ghost Pseudopontia australis Dixey, 1923 West African Ghost Pseudopontia gola Sáfián & Mitter, 2011 Mabira Ghost Pseudopontia mabira Mitter & Collins, 2011 Paradox Ghost Pseudopontia paradoxa (Felder & Felder, 1869) Zambezi Ghost Pseudopontia zambezi Mitter & W. De Prins, 2011 European Cabbage White* Pieris brassicae (Linnaeus, 1758) Mountain Cabbage White Pieris brassicoides brassicoides Guérin-Méneville, 1849 Meru Mountain Cabbage White Pieris brassicoides marghanita Hemming, 1941 Autumn-leaf Vagrant Afrodryas leda (Boisduval, 1847) Pale Swallow Pilot Euptera amieti Collins & Libert, 1998 Orange Pilot Euptera aurantiaca Amiet, 1998 Mixed False Sailer Pilot Euptera chothyma Libert, 2017 Dark False Sailer Pilot Euptera choveti Amiet & Collins, 1998 Pale-fronted Pilot Euptera collinsi Chovet & Libert, 1998 Central Mimic Pilot Euptera crowleyi centralis Libert, 1995 Mimic Pilot Euptera crowleyi crowleyi (Kirby, 1889) Bowed False Sailer Pilot Euptera debruynei (Hecq, 1990) Double-barred Pilot Euptera dorothea dorothea Bethune-Baker, 1904 Slender-barred Pilot Euptera dorothea warrengashi Libert, 2002 Ghost Pilot Euptera ducarmei Collins, 1998 Bioko Triple-barred Pilot Euptera elabontas canui Collins, 1995 Western Triple-barred Pilot Euptera elabontas elabontas (Hewitson, [1871]) Eastern Triple-barred Pilot Euptera elabontas mweruensis Neave, 1910 Falcate Pilot Euptera falcata Libert, 1998 Obscured False Sailer Pilot Euptera fallax Libert, 2014 60

False Sailer Pilot Euptera falsathyma Schultze, 1916 Uniform Pilot Euptera freyja freyja Hancock, 1984 Ornate Pilot Euptera freyja ornata Libert, 1998 Perplexing Pilot Euptera ginettae Libert, 2005 Western Striated Pilot Euptera grepi cameruna Libert, 2014 Eastern Striated Pilot Euptera grepi grepi Libert, 2014 Swallow Pilot Euptera hirundo Staudinger, 1891 Intricate Pilot Euptera intricata Aurivillius, 1894 Ituri Pilot Euptera ituriensis Libert, 1998 Malagasy Pilot Euptera kinugnana insularis Collins, 1995 Variable Pilot Euptera kinugnana kinugnana (Grose-Smith, 1889) Banded Falcate Pilot Euptera knoopi Libert & Chovet, 1998 Rounded False Sailer Pilot Euptera liberti Collins, 1987 Mimetic Pilot Euptera mimetica Collins & Amiet, 1998 Red Striated Pilot Euptera miranda Libert, 2014 Stunning Pilot Euptera mirifica Carpenter & Jackson, 1950 Large False Sailer Pilot Euptera mocquerysi Staudinger, 1893 Pseudo Neptune Pilot Euptera neptunoides Libert, 2017 Neptune False Sailer Pilot Euptera neptunus Joicey & Talbot, 1924 Nigerian Swallow Pilot Euptera nigeriensis Chovet, 1998 Bistre Pilot Euptera plantroui Chovet & Collins, 1998 Western Pluto Pilot Euptera pluto occidentalis Chovet, 1998 Pluto Pilot Euptera pluto pluto (Ward, 1873) Primative Pluto Pilot Euptera pluto primitiva Hancock, 1984 Half-orange Pilot Euptera rufoides Libert, 2017 White Swallow Pilot Euptera schultzei Libert & Chovet, 1998 Half-red Pilot Euptera semirufa Joicey & Talbot, 1921 Hammer Pilot Euptera zowa Fox, 1965 Speckled Lilac Commander Euryphura concordia (Hopffer, 1855) Falcate Commander Euryphura accentuata Hecq, 2010 Mottled-green Commander* Euryphura achlys (Hopffer, 1855) Pied Commander Euryphura athymoides Berger, 1981 Orange Commander Euryphura aurantiaca Aurivillius, 1898 Troop Commander Euryphura chalcis chalcis (Felder & Felder, 1860) Mpanda Troop Commander Euryphura chalcis kiellandi Hecq, 1990 Congolese Red Commander Euryphura congoensis Joicey & Talbot, 1921 Squad Commander Euryphura ducarmei Hecq, 1990 Gabonese Red Commander Euryphura grassei Bernardi, 1965 Black-and-white Commander Euryphura isuka Stoneham, 1935 Brown Commander Euryphura mediata Hecq, 2010 Platoon Commander Euryphura plautilla (Hewitson, [1865]) Eastern Red Commander Euryphura porphyrion fontainei Hecq, 1990 Western Red Commander Euryphura porphyrion porphyrion (Ward, 1871) Disguised Commander Euryphura similaris Hecq, 2010 Togolese Red Commander Euryphura togoensis Suffert, 1904 Green Commander Euryphura viridissima Hecq, 2010

Names with an asterisk are not the current placeholders.

61

TIPS (GENUS COLOTIS) WITHOUT TIPS (Mark Williams)

Left: Colotis fausta vi. Male. (Yemen). Specimen ex ABRI Collection. Right: Colotis fausta vi. Female. (Yemen). Specimen ex ABRI Collection.

Colotis calais crowleyi. Male. (Madagascar). Specimen ex J. Lawrence Collection. Colotis calais crowleyi. Female. Madagascar. Specimen ex Dobson Collection.

Left: Colotis castalis. Male. (Kenya). Specimen ex ABRI Collection. Right: Colotis castalis. Female. (Kenya). Specimen ex ABRI Collection.

Left: Colotis phisadia rothschildi. Male. (Kenya). Specimen ex ABRI Collection. Right: Colotis phisadia rothschildi. Female. (Kenya). Specimen ex ABRI Collection.

Left: Colotis ungemachi. Male. (Yemen). Specimen ex ABRI Collection. Right: Colotis ungemachi. Female. (Yemen). Specimen ex ABRI Collection.

62

Left: Colotis doubledayi. Male. (South Africa). Specimen ex Williams Collection. Right: Colotis doubledayi. Female. (South Africa). Specimen ex Williams Collection.

Left: Colotis chrysonome. Male. (Kenya). Specimen ex ABRI Collection. Right: Colotis chrysonome. Female. (Kenya). Specimen ex ABRI Collection.

Left: Colotis vesta princeps. Male. (Uganda). Specimen ex Dobson Collection. Right: Colotis vesta rhodesinus. Female. (Zambia). Specimen ex Greyling Collection.

Left: Colotis protomedia. Male. (Somalia). Specimen ex Dobson Collection. Right: Colotis protomedia Female. (Kenya). Specimen ex ABRI Collection.

63

Butterfly Index (Jeremy Dobson)

The Butterfly Index is tracking trends of butterfly abundance in South Africa, post January 2018.

For obvious reasons there have been problems acquiring data during the last two months. Fortunately, I managed to get checklists for both Gauteng and KwaZulu-Natal in March before the lockdown; for April’s indexes, I’ve taken the best daily checklists from my garden and Steve Woodhall’s, multiplied by 1.5 and used these figures for Gauteng and KZN respectively.

A summary of the results to-date is indicated in the graph below:

2018 to 2020

6

5

4

3

2

1

0

IDEAL 2018 2019 2020

For the Butterfly Index, I require the number of species seen at a single locality in a single day. If your survey is Biome Factor superficial (less than 1-hour in duration), or based on Lowveld Savanna or Forest (L.S.) 100% observations from a suburban garden or farm, please let Highveld Savanna (H.S.) 70% me know and I’ll multiply the number obtained by 1.5. Highveld Grassland (H.G.) 50% Arid Savanna (A.S.) 35% Steve Woodhall’s Butterfly App is a great way of saving Karoo (K) 25% butterfly checklists. It will soon be possible to export Fynbos (F) 25% these lists directly to LepiBase; data submission will be a Afromontane Forest (A.F.) 50% key requirement of the new permitting system. Biome – Correction Factors

64

NUMBER OF SPECIES RECORDED FROM A SINGLE LOCALITY IN A SINGLE DAY ABUNDANCE BIOME INDEX Lowveld Highveld Highveld Arid Savanna Karoo (K) Fynbos (F) Afromontane Savanna or Savanna Grassland (A.S) Forest (A.F.) Forest (L.S.) (H.S) (H.G.)

5 Excellent >80 >56 >40 >28 >20 >20 >40

4 Good 52 to 80 37 to 56 26 to 40 19 to 28 13 to 20 13 to 20 26 to 40

3 Average 29 to 51 20 to 36 15 to 25 10 to 18 8 to 12 8 to 12 15 to 25

2 Poor 11 to 28 8 to 19 6 to 14 4 to 9 3 to 7 3 to 7 6 to 14

1 Very Poor ≤10 ≤7 ≤5 ≤3 ≤2 ≤2 ≤5

0 No Data

For information, the Abundance Index (Ax) is calculated using the following formula, where n represents the species-count from a site and F is the percentage factor from the Biome table: Ax = 1+ (n / (10 * F)) 1/1.5

Methodology

1/. Each Province receives a monthly rating between, which will be more than 1 (Very Poor) and is unlikely to exceed 5 (Excellent). Lesotho and Swaziland are included as Provinces.

2/. The rating is based on the highest recorded individual monthly species-count within the province under consideration. The numbers are based on representatives of the Papilionoidea superfamily (traditional butterflies).

3/. In instances where data is acquired from several biomes within a single Province, the highest rating will be used.

Annual prizes will be awarded to the most active provincial representatives!

Objectives

1/. To monitor long term trends in butterfly abundance throughout South Africa 2/. To compare seasonal and annual abundance indexes 3/. To compare current butterfly-counts with historical benchmarks

65

Data – March and April:

2020 PROVINCE MAR APR Index Score Locality Biome Observer Index Score Locality Biome Observer Gauteng 4.2 41 Rangeview H.S. Jeremy Dobson 3.1 15 Bryanston H.G. Jeremy Dobson KwaZulu-Natal 4.3 61 Izingolweni L.S. Jeremy Dobson 4.5 66 Gillitts L.S. Steve Woodhall Limpopo 3.9 35 Bateleur H.S. Mark Williams 0 Mpumalanga 0 0 Western Cape 0 0 Eastern Cape 0 0 Northern Cape 0 0 Southern Cape 0 0 North West 0 0 Free State 0 0 Lesotho 0 0 Swaziland 0 0

Summarized Butterfly Index Data – 2020:

2020 - SUMMARY PROVINCE Jan Feb Mar Apr May June July Aug Sep Oct Nov Dec Gauteng 5.3 3.9 4.2 3.1 KwaZulu-Natal 4.5 4.1 4.3 4.5 Limpopo 3.5 5.1 3.9 0 Mpumalanga 4.6 4 0 0 Western Cape 0 0 0 0 Eastern Cape 0 0 0 0 Northern Cape 0 0 0 0 Southern Cape 0 0 0 0 North West 0 3.7 0 0 Free State 0 0 0 0 Lesotho 0 0 0 0 Swaziland 0 0 0 0

66

CONSERVATION AND RESEARCH

LepiMAP (Les Underhill)

LepiMAP is helping to build up-to-date distribution maps for the butterflies and moths of Africa. These maps are critically important for conservation management and priority setting. Without good distribution maps, species conservation is largely guesswork. You can make your photography count for conservation by uploading your photos into the Virtual Museum

.. LepiMAPpers quietly achieved BestMarch last month. The RED line for 2020 shows that they also achieved BestJanuary and BestFebruary. The total number of records submitted to the LepiMAP section of the Virtual Museum in the first three months of the year was 12,180, which is already 38% of the total of 31,494 for 2019, which was itself the BestYearEver for LepiMAP.

This is a summary from a South African perspective. There are LepiMAP records for 1,683 of the 1,974 quarter degree grid cells in South Africa. Half of the 1,683 grid cells for which LepiMAP has data have been visited since August 2017. That's pretty neat.

The total number of species of butterflies and moths that have been recorded in grid cells is 39,878. That's adding together the number of species recorded in each grid cell. Many species have lots of records in a grid cell. We now consider only the most recent of these, the last record for each species in each grid cell. Sort the dates and find the date in the middle. Half of these most recent records were made before March 2007 and half them after March 2007. So this midpoint is now 13 years old. The LepiMAP records are getting a bit long in the tooth!

That should galvanize us into action. We need to "refresh" the old records, and replace them with new ones! To find out how to do this, have a read of this blog post:

http://thebdi.org/2019/07/02/virtual-museum-open-for-refreshments/

67

For highlights of April’s LepiMAP posts, click on the following link: http://thebdi.org/2020/05/01/lockdownapril-highlights-of-bestmonthever-for-lepimap/

Butterfly Evolutionary Diversity (BED) (Jonathan Colville)

The Butterfly Evolutionary Diversity project (BED) is a three-year research enterprise led by SANBI. The BED project seeks to map patterns of evolutionary diversity for butterflies across South African landscapes. It aims, through collecting DNA samples of all South African butterfly species, to identify areas not only of high butterfly species richness and conservation concern, but also areas of high evolutionary importance. LepSoc Africa will be the main collecting agency for this project, which will also provide the phylogenetic analyses to enable us to resolve a number of taxonomic issues.

Everyone can assist with this project: for further information, go to

http://www.lepsoc.org.za/projects/butterfly-evolutionary-diversity/

Caterpillar Rearing Group (CRG) (Hermann Staude)

Anybody wishing to join, please refer to the LepSoc Africa website for details (http://www.lepsoc.org.za/) or visit the Facebook page (https://www.facebook.com/groups/caterpillarrg/).

COREL

The various custodians have submitted their COREL (Custodians of Rare and Endangered Lepidoptera) reports for the 2019 – 2020 season to Mark Williams, who is the overall coordinator of the COREL program.

If you would like to assist COREL in any capacity, please contact me at [email protected]

A link to the latest COREL guidelines is attached below:

COREL - Structure and guidelines

68

Aloeides Project (Jeremy Dobson)

You may remember from March’s newsletter that Dr Ian Richardson (author of the recently published Neptis paper – Metamorphosis Vol 30 – Part 2) and Prof Rauri Bowie (University of California, Berkeley) have agreed to become co-authors on the forthcoming Aloeides phylogeny paper; I’m pleased to add that Etienne Terblanche has volunteered to keep a special eye on the Trimeni and Almeida Groups and Dave Edge will perform a similar role with the Pallidas. Importantly, Graham Henning has volunteered to undertake genitalia dissections, which will form a vital component of the paper. With the coronavirus lockdown no new data has been coming in, but at least I’ve caught up with the paperwork. To date, we’ve captured 606 records in the Aloeides Project database, including 60 taxa-records, submitted by 22 people (I’ve included Genbank as a person, but haven’t allocated a Google-pin, as their locality information does not include coordinates: eventually, I’d like to replace all these records). I’ve attached a summary of the Aloeides Project database records below:

TAXON COUNT TAXON COUNT Aloeides damarensis damarensis 43 Aloeides almeida 6 Aloeides trimeni trimeni 40 Aloeides carolynnae carolynnae 6 Aloeides pierus 38 Aloeides caledoni 6 Aloeides henningi 35 Aloeides plowesi 6 Aloeides aranda 27 Aloeides bamptoni 6 Aloeides titei 23 Aloeides rossouwi 6 Aloeides juana 20 Aloeides dentatis maseruna 5 Aloeides macmasteri 19 Aloeides gowani 5 Aloeides dryas 19 Aloeides caffrariae 5 Aloeides penningtoni 19 Aloeides nubilus 5 Aloeides oreas 18 Aloeides mbuluensis 5 Aloeides swanepoeli 18 Aloeides pallida liversidgei 5 Aloeides taikosama 17 Aloeides apicalis 4 Aloeides pallida grandis 13 Aloeides damarensis mashona 4 Aloeides dicksoni 11 Aloeides pallida juno 4 Aloeides thyra thyra 11 Aloeides griseus 4 Aloeides pallida jonathani 10 Aloeides stevensoni 3 Aloeides barklyi 10 Aloeides barbarae 3 Aloeides pallida littoralis 10 Aloeides pallida pallida 3 Aloeides depicta 9 Aloeides clarki 3 Aloeides dentatis dentatis 9 Aloeides nollothi 3 Aloeides molomo molomo 9 Aloeides monticola 3 Aloeides thyra orientis 9 Aloeides molomo krooni 3 Aloeides margaretae 8 Aloeides kaplani 3 Aloeides arida 8 Aloeides molomo handmani 2 Aloeides quickelbergei 8 Aloeides rileyi 2 Aloeides susanae 8 Aloeides trimeni southeyae 2 Aloeides vansoni 8 Aloeides lutescens 1 Aloeides maluti 7 Aloeides egerides 1 Aloeides simplex 7 Aloeides conradsi conradsi 1 606

69

COLLECTOR COUNT Here’s a list of the various Aloeides Project contributors to Jeremy Dobson 202 date: thanks to all of you! Peter Ward 77 Alan Gardiner 76 Peter Ward has moved up into second position on the list and Dave Edge 51 there have been strong moves by Dave Edge and André André Coetzer 47 Coetzer! Harald Selb 25 Mark Williams 23 I’ve captured all your locality-records using coloured pins in Christopher Dobson 19 Google Earth and have created separate folders so that I can Peter Webb 15 display the records of individual contributors separately. Alf Curle 14 GENBANK 12 In instances where there are duplications regarding locality Andrew Morton 9 information, the pin belongs to the person who first submitted Andrew Mayer 7 Reinier Terblanche 5 the record to the Aloeides Project. Steve Woodhall 5 Graham Henning 4 As an example, I’ve indicated Peter Ward’s efforts below Hayden Warren-Gash 4 (Peter is the holder of the Green Pin): Ray Jones 4 Emmeline Topp 2 Johan Greyling 2 Etienne Terblanche 2 Alan Sinclair 1 606

70

To date I have acquired barcodes for 34 taxa from samples submitted to BOLD (University of Guelph, Canada) and from records that I’ve managed to access through Genbank. We have analysed these records as far as we can – refer to the Aloeides Project article under LATEST NEWS. The Aloeides Project database contains records for 26 taxa for which samples have been obtained but no barcodes have been acquired to date. Most of these samples will be in the BED (Butterfly Evolutionary Diversity) queue, although there are a few “new” species for which samples have been prepared and will be forwarded to BOLD shortly. In reality, we won’t achieve a 100% success rate with the sequencing and one or two samples will invariably go missing; assuming we don’t get barcodes from 5 of the taxa submitted to BED this will still represent a further 21 mtDNA species-barcodes before the end of the year, which will bring us up to 55: 73% of the current Aloeides taxonomic list. Before we publish our paper, I’ve decided that we must to reach the magic number of 64, representing 85% of the genus. These remaining 9 “targets” will include all the 5 un-sequenced BED samples (above), plus any 4 from the “Wanted” list:

BARCODES RECEIVED BARCODES AWAITED WANTED LIST Aloeides almeida Aloeides apicalis Aloeides angolensis Aloeides aranda Aloeides barbarae Aloeides argenteus Aloeides arida Aloeides caffrariae Aloeides braueri Aloeides bamptoni Aloeides clarki Aloeides carolynnae aurata Aloeides barklyi Aloeides damarensis mashona Aloeides conradsi angoniensis Aloeides caledoni Aloeides dentatis dentatis Aloeides conradsi jacksoni Aloeides carolynnae carolynnae Aloeides depicta Aloeides conradsi talboti Aloeides conradsi conradsi Aloeides egerides Aloeides merces Aloeides damarensis damarensis Aloeides gowani Aloeides molomo coalescens Aloeides dentatis maseruna Aloeides griseus Aloeides molomo kiellandi Aloeides dicksoni Aloeides macmasteri Aloeides molomo mumbuensis Aloeides dryas Aloeides maluti Aloeides mullini Aloeides henningi Aloeides mbuluensis Aloeides namibiensis Aloeides juana Aloeides molomo handmani Aloeides pringlei Aloeides kaplani Aloeides molomo krooni Aloeides tearei Aloeides lutescens Aloeides molomo molomo Aloeides margaretae Aloeides oreas Aloeides monticola Aloeides pallida grandis Aloeides nollothi Aloeides pallida juno Aloeides nubilus Aloeides plowesi Aloeides pallida jonathani Aloeides quickelbergei Aloeides pallida littoralis Aloeides rileyi Aloeides pallida liversidgei Aloeides rossouwi Aloeides pallida pallida Aloeides stevensoni Aloeides penningtoni Aloeides thyra orientis Aloeides pierus Aloeides trimeni southeyae Aloeides simplex Aloeides susanae Aloeides swanepoeli Aloeides taikosama Aloeides thyra thyra Aloeides titei Aloeides trimeni trimeni Aloeides vansoni

71

Aloeides Gallery (2019 – 2020 Season)

Aloeides stevensoni nectaring Aloeides damarensis mashona Aloeides henningi Wolkberg, Limpopo Bateleur, Limpopo Glenharvie, Gauteng Etienne Terblanche Jeremy Dobson Jeremy Dobson

Aloeides molomo molomo Aloeides aranda Aloeides nubilus Kalbosfontein, Gauteng Ruimsig, Gauteng Elandshoogte, Mpumalanga Jeremy Dobson Jeremy Dobson Jeremy Dobson

Aloeides dryas Aloeides griseus Elandshoogte, Mpumalanga Nyika, Malawi Aloeides caffrariae Jeremy Dobson Jeremy Dobson Grahamstown, Eastern Cape Lynette Knott Rudman

Aloeides quickelbergei (?) Aloeides mbuluensis Aloeides pallida jonathani Kammanassie, W Cape Tsomo, Eastern Cape Kammanassie, W Cape Raimund Schutte Raimund Schutte Jeremy Dobson

72

PUBLICATIONS

Metamorphosis

Dave Edge is the Editor of Metamorphosis; Silvia Kirkman is the Sub Editor responsible for production.

Dave recently canvassed the Metamorphosis Editorial Board about obtaining DOIs for our Metamorphosis articles. A DOI, or Digital Object Identifier, is a string of numbers, letters and symbols used to permanently identify an article or document and link to it on the web.

There was overwhelming support for making an application to African Journals Online (AJOL) which has the benefit of raising the profile of our journal. Dave has filled out the AJOL application form and submitted details of our peer review process. He has also updated the Metamorphosis policy documents, which may be viewed on the LepSoc Africa website.

Metamorphosis Volume 30 Part 1 (2019) contains 72 pages and includes 4 Editorial pages and 12 articles and notes published on the Metamorphosis website during calendar year 2019.

The price – for South African members – is R145 excluding postage.

To save money, both on printing and postage, copies of Metamorphosis for overseas members (including Africa) will be printed in the UK. The price will be advised shortly.

Metamorphosis Volume 30 Part 2 (the Neptis paper by Dr Ian Richardson) (153 pages) will be printed on a similar basis. The cost, for South African members, is R300 excluding postage.

Please order hard copies using the online shop (https://lepsocafrica.org/), or contact Dave at [email protected] or Silvia at [email protected].

73

New articles in Metamorphosis:

Volume 31 Part 1

• Notes on the life history of Epitoxis namaqua de Freina & Mey, 2011 (Lepidoptera: Erebidae: Arctiinae: Syntomini) Josef J. de Freina, Silvia Mecenero & Andrew Morton

• Further data on the butterfly fauna (Lepidoptera: Papilionoidea) of Mpanga Forest, Uganda, and the role of this forest in biodiversity conservation Szabolcs Sáfián and Tomasz W. Pyrcz

Volume 30 Part 1

• Articles: 58 - 68 Publication Date : 2019-12-31 Author/s : David A. Edge and Silvia Mecenero

Volume 30 Part 2

• Revision of the genus Neptis Fabricius, 1807 (Lepidoptera, Nymphalidae) in the Afrotropical Region: Currently described taxa Ian D. Richardson

74

REGIONAL ROUNDUP

Gauteng

Refer to Lockdown Lists under LATEST NEWS.

Before the lockdown, I visited the hills above Walter Sisulu Botanical Gardens and recorded 41 species (Abundance Index 4.6 – Good).

For the first time in a couple of years, I saw loads of Wichgraf's Hillside Brown (Stygionympha wichgrafi wichgrafi) flying among the rocky ridges.

Nervia nerva nerva Catacroptera cloanthe cloanthe Stygionympha wichgrafi wichgrafi Rangeview, Gauteng Rangeview, Gauteng Rangeview, Gauteng

Free State

I visited the Heilbron area in early March, to look for Heilbron Cupid (Orachrysops mijburghi) – I am the COREL custodian for this species. I didn’t find any at the usual spot (which is becoming increasingly infested with Cosmos), or at a few promising sites nearby. A visit to Heilbron Dam to look for Maseru Toothed Russet (Aloeides dentatis maseruna) was also unsuccessful.

There were a few Hillside Russet (Aloeides henningi) and Brown Russet (Aloeides trimeni trimeni) near Petrus Steyn.

Telchinia rahira rahira Afrogegenes letterstedti Lepidochrysops patricia Heilbron, Free State Heilbron, Free State Frankfort, Free State

75

Mpumalanga

Peter Ward and I visited Loding on 8 March. We recorded 51 species (Abundance Index 4.6 - Good).

Although we got a reasonable species-count, butterflies were fairly scarce. Peter found Ragged Skipper (Caprona pillaana) and we both saw a solitary Lygus Acraea (Acraea lygus). Peter is certain that he saw Lowveld Grass Yellow (Eurema hecabe solifera), which is a new record for Loding and for the region.

Aloeides taikosama Axiocerses amanga amanga Zintha hintza hintza Loding, Mpumalanga Loding, Mpumalanga Loding, Mpumalanga

I revisited Loding the day before the lockdown. There were slightly fewer species: 46 (Abundance Index 4.4 – Good), but many more butterflies, mainly African Migrant (Catopsilia florella), which was swarming.

Axiocerses tjoane tjoane Byblia anvatara acheloia Catopsilia florella Loding, Mpumalanga Loding, Mpumalanga Loding, Mpumalanga

Limpopo

Mark Williams and Raimund Schutte visited Bateleur in early March. They saw 35 species (Abundance Index 3.5 – Average), including Marsh Sylph (Metisella meninx), Secucuni Shadelfy (Coenyra rufiplaga) and Savanna Large Ringlet (Neita extensa).

76

KZN

Refer to KZN Holiday by Jeremy Dobson, under LATEST NEWS

Mark Liptrot visited Zululand in March, before the coronavirus lockdown and took these great photos:

Acraea satis Acraea acrita acrita Acraea boopis boopis Zululand, KZN Zululand, KZN Zululand, KZN Mark Liptrot Mark Liptrot Mark Liptrot

Graphium colonna Bicyclus ena Graphium angolanus angolanus Zululand, KZN Zululand, KZN Zululand, KZN Mark Liptrot Mark Liptrot Mark Liptrot

Iolaus sidus Euphaedra neophron neophron Papilio constantinus constantinus Zululand, KZN Zululand, KZN Zululand, KZN Mark Liptrot Mark Liptrot Mark Liptrot

77

Steve Woodhall took these pictures in his garden in Gillitts, KwaZulu-Natal:

Cacyreus lingeus Acraea natalica Charaxes brutus natalensis Gillits, KZN Gillits, KZN Gillits, KZN Steve Woodhall Steve Woodhall Steve Woodhall

Charaxes ethalion ethalion Paralethe dendrophilus indosa Sarangesa motozi Gillits, KZN Gillits, KZN Gillits, KZN Steve Woodhall Steve Woodhall Steve Woodhall

Alicia Culverwell, who lives near Dalton, KwaZulu-Natal, has posted the following pictures on Facebook:

Belenois creona severina Dixeia spilleri Lampides boeticus Fawn Leas, KZN Fawn Leas, KZN Fawn Leas, KZN Alicia Culverwell Alicia Culverwell Alicia Culverwell

78

Eastern Cape

Lynette Knott Rudman posted these photos, taken from the Grahamstown area:

Belenois gidica abyssinica Belenois creona severina Spialia spio Grahamstown, Eastern Cape Grahamstown, Eastern Cape Grahamstown, Eastern Cape Lynette Rudman Lynette Rudman Lynette Rudman

… and from Marie Delport, who lives near Colchester:

Belenois zochalia zochalia Papilio demodocus demodocus Hippotion celerio Colchester, Eastern Cape Colchester, Eastern Cape Colchester, Eastern Cape Marie Delport Marie Delport Marie Delport

Western Cape

And finally, some photos from the Western Cape

Cassionympha perissinottoi Afrogegenes ocra Dira clytus clytus Pringle Bay, Western Cape Stellenbosch, Western Cape Nature’s Valley, Western Cape Fanie Rautenbach Daryl de Beer Michael Bridgeford

79

OTHER BUTTERFLIES

Johan Heyns has a large collection of photographs, which we will include as a regular feature in this newsletter.

More from the Eribidae family; these belong to the Boletobiinae subfamily:

Eublemma parva Eublemma lentirosea Eublemma ornatula Johan Heyns Johan Heyns Johan Heyns

Eustrotia bryophilina Eublemma rivula Eublemma staudingeri Johan Heyns Johan Heyns Johan Heyns

80

AFRICA DESK

Uganda

Before the corona virus lock-down in Uganda, Rogers was given an opportunity to present, to a large team of fellow guides, a talk about butterflies of Uganda. Over 40 participants attended the three-week guide course, which was held at Lake Mburo National Park in western Uganda.

Butterflies on the road Group photo at Lake Mburo Rogers presenting at Lake Mburo

Amauris albimaculata magnimacula Hypolimnas salmacis magnifica Euphaedra olivacea (Rogers Muhwezi) (Rogers Muhwezi) (Rogers Muhwezi)

Madagascar

Sudheer Kommana visited Madagascar fairly recently; I’ve attached a few more photos below:

Papilio dardanus meriones Takliades ramanatek ramanatek Junonia rhadama Suheer Kommana Suheer Kommana Suheer Kommana

81

Ghana

Sudheer – who certainly gets around – also visited Ghana:

Euryphura chalcis chalcis Eagris denuba denuba Apallaga galenus (Ghana) (Ghana) (Ghana) Suheer Kommana Suheer Kommana Suheer Kommana

Bebearia phantasina Euphaedra janetta Junonia chlorinome (Ghana) (Ghana) (Ghana) Suheer Kommana Suheer Kommana Suheer Kommana

Pseudacraea lucretia lucretia (Ghana) Suheer Kommana Aterica galene galene (left: female, right: male) (Ghana) Suheer Kommana

82

Zimbabwe Brian Ashby posted these photos – from the Victoria Falls area – on Facebook.

Charaxes brutus natalensis Graphium leonidas leonidas Melanitis leda (Vic Falls, Zimbabwe) (Vic Falls, Zimbabwe) (Vic Falls, Zimbabwe) Brian Ashby Brian Ashby Brian Ashby

Namibia (Katharina Reddig)

Prior to the Lockdown, Katharina forwarded some pictures from the Erongo area:

Axiocerses amanga amanga Cigaritis phanes Myrina silenus suzannae (Erongo, Namibia) (Erongo, Namibia) (Erongo, Namibia) Katharina Reddig Katharina Reddig Katharina Reddig

83

LEPSOC AFRICA COUNCIL

Elected Executive Councillors and LSA Directors: • Jeremy Dobson (Chairman) • Justin Bode (Secretary) • Peter Ward (Treasurer)

Co-opted Councillors

• Dave Edge (Editor of Metamorphosis) • Reinier Terblanche (Conservation, Research and Permits)

Branch Chairmen

• Andre Coetzer (Highveld – Gauteng, North West and Free State) • Kevin Cockburn (KwaZulu-Natal) • Andrew Morton (Western Cape) • Ernest Pringle (Eastern Cape) • Dave Edge (Southern Cape) • Vaughan Jessnitz (Limpopo) • Michael Ochse (Germany)

The price of Metamorphosis Volume 30 (2019) – Part 1 is R145 for SA members, excluding postage. Part 2 will cost R300. Various postage options, with different pricing, are available.

Annual subscription fee Metamorphosis printed copy Annual subscriptions, plus printed copy (Until 31 Dec 2020) (Volume 30:1 2019) of Metamorphosis Category South Africa Inter- South Africa Inter- South Africa Inter- Africa national Africa national Africa national

Sponsor* R1 200.00 R1 200.00 R1 400.00 Included Included Included R1 200 R1 200 R1 400 Ordinary R 290.00 R 290.00 R 360.00 TBA TBA TBA TBA TBA TBA Pensioner (over 60 R 220.00 R 220.00 R 270.00 TBA TBA TBA TBA TBA TBA years)

Student (under 23 R 150.00 R 150.00 R 200.00 TBA TBA TBA TBA TBA TBA years)

Family Membership** R 450.00 R - R - TBA TBA TBA TBA TBA TBA Family (Pensioners) R 350.00 R - R - TBA TBA TBA TBA TBA TBA

*Sponsor members are entitled to a free copy of Metamorphosis, but not supplementary, stand- alone publications, such as the CRG results or the SALCA assessments.

**Family Membership is available to married couples or life partners, plus dependent children under the age of 18.

MEMBERSHIP OF LEPSOC AFRICA IS FREE TO ANYONE UNDER THE AGE OF 16

Subscriptions are due on 01 January each year; to renew your membership, click on the following link: LepSoc Africa subscriptions

84

FOCUS ON…

Michael Ochse, LepSoc Africa’s German branch chairman is featured this month

Michael Ochse is the Chairman of the German branch of LepSoc Africa. With eighteen members (and rising!), Germany is the second largest international branch of LepSoc Africa, behind the UK.

Michael has been passionate about African moths for almost 20 years. His main interest is the large family, Geometridae (as of 2018, this family contained 4057 Afrotropical species of which 1074 are found in South Africa); within the Geometridae, he concentrates on the second largest subfamily, Ennominae.

His travels have mostly led him to West Africa, with a few visits to the central and eastern parts of the continent. He collects and sorts his specimens and also gives some of them to specialists for taxonomic studies. As this is a global cooperative undertaking, he also receives material for own species descriptions or genus revisions.

Much of the study related to Geometridae is coordinated at the Zoological State Collection in Munich (ZSM), Germany, with world-renowned specialist Axel Hausmann being the core person involved in this work. The ZSM itself houses the largest Lepidoptera collection in the world; Michael’s collection will be bequeathed to it someday.

In addition to his LepSoc Africa role, Michael is president of POLLICHIA, a natural history and nature protection organisation, which was founded in southwest Germany in 1840. There he not only searches and databases moths within his region, Palatina, but also actively supports some nature projection programs.

His professional life is very different, as he works as a medicinal chemist; he is the global project leader for a large American pharmaceutical research company.

85

PHOTOGRAPH OF THE MONTH

Please forward any photographs that you would like to display in this Newsletter, with your identification and the month that the photograph was taken, to [email protected]. There will be a Photograph of the Month (two in each episode); the season runs from August to July and the annual winner is announced in September’s edition. The decision, by the editor, is final and will be based on photographic merit, but may be swayed by donations to the Society. Entries for March

Colotis vesta argillaceus Parosmodes morantii morantii Acraea acrita acrita Kobus Pienaar Lourens Erasmus Mark Liptrot (Modimole, Limpopo) (Magaliesberg, Gauteng) (Zululand, KZN)

Colotis euippe omphale Coenyra aurantiaca Acraea natalica Sudheer Komanna Jeremy Dobson Jeremy Dobson (Tanzania) (Oribi Gorge, KZN) (Oribi Gorge, KZN)

MARCH

March’s winner is KZN’s Mark Liptrot, an avid - and very active - butterfly photographer.

Mark took this photo of the Gold-banded Forester (Euphaedra neophron neophron) during a visit to Zululand in March.

During this visit he recorded 162 species, including East-coast Acraea (Acraea satis) and Streaked Sailer (Neptis goochii).

86

Entries for April

Elymnias bammakoo bammakoo Euphaedra ceres and Euphaedra janetta Charaxes druceanus druceanus Sudheer Kommana Sudheer Kommana Steve Woodhall (Ghana) (Ghana) (Gillets, KZN)

Axiocerses amanga amanga Hippotion celerio Nepheronia buquetii buquetii Christopher Hines Rick Nuttall Marie Delport (Hoedspruit, Mpumalanga) Bloemfontein, Free State (Colchester, KZN)

APRIL

April’s winner is Reinier Terblanche, with this photograph of Cephonodes hylas virescens, the Oriental Bee Hawk.

This species has a very wide distribution and is found in southern Asia, Australia and much of sub-Saharan Africa and islands.

Reiner took this photo at his home in Potchefstroom during the lockdown.

87

TRAWLING THE ARCHIVES…

RAMBLINGS OF RUTH SOUTHEY By Ruth J.G. Southey Notes from my diary on a trip to Rhodesia (Zimbabwe) and Portuguese East Africa (Mozambique) with Ken and Ruth Pennington for 3 months from mid-July to mid-October 1957. We were joined on the trip by Harold and David Cookson, and Claire and Neville Vissian. These recollections are as from a "handlanger" collector for Ken - I only started my own collection some six years later, hence lack of generic or specific names will hopefully be overlooked. Where do I start? From the highlands of the upper Karroo, where the ground was white with frozen sleet, via frozen Molteno, to Queenstown, to clement Umkomaas in Natal, or my early childhood days? This last, I think. My parents were good friends of the Penningtons and I grew up, in and out of the Pennington home in Greytown, Natal, where Ken's father was Vicar of St James' Church and lovingly known as "large". Canon Pennington, and later Archdeacon in Pietermaritzburg, was a great naturalist, birds, butterflies, insects and fish among others all being of intense interest to him. Ken inherited this lifelong interest and went on to be among the "greats" in lepidoptery and a very successful fisherman. Ken was the second of five sons, all of whom were my seniors and I only came to know him and Ruth, his lovely, smiling, laughing wife properly after my marriage when they came to scout round for butterflies. To go back, Archdeacon Pennington came to my parents' home in Port Elizabeth to officiate at our wedding, and he exhorted us to look out for, and catch any butterflies that we thought might be uncommon. Years later he spent a short time with us on our farm Southwell, altitude 5 500 feet (about 1 500 metres) in the Steynsburg district under the Stormberg Mountains. This was a semi- arid region and he was most interested in all the fauna and flora he saw. Ken and Ruth and son Rex called in for a few days on one of their cross country travels. Ken was always on the lookout with his net. In 1952 they came again, and we took a trip to Barkly East; en-route my husband netted a 'fly that Ken thought was new, and later he described it and named it Pseudonympha southeyi. It was caught on Joubert Pass at an altitude of 7 600 feet (about 2 500 metres). The following day more of these butterflies were found on Jack Green's farm - and so after this long preamble I start with the beginnings of the trip of 1957. In 1952 Ken and Ruth went to Rhodesia and Portuguese east Africa on a hunting expedition, and I think, that in 1957, with the same trip in view, Ruth felt she would like a companion, and so it was that I was invited to join the Penningtons. For me, the Great Trek began on the 15th July 1957. Leaving a frozen world with some of my family, we made for Queenstown via Molteno where I joined up with Canon and Mrs Short, who were moving to Umkomaas. After farewells we left for Natal via Umtata, and so to Umkomaas, to the Penningtons' seaside home. Here I met Kit Cottrell and Charlie Dickson who has been my good friend and mentor through the years after I started my own collection in 1963. On the 18th July, Ken, Ruth and I left for Michaelhouse, Balgowan and feverish days of preparation, making and fixing nets and trapnets, laying in supplies, packing utensils, food, my tent and stretcher, partyings and farewells until , with Gypsey caravan loaded we were ready to leave for our trip on the 24th. With Celestine, our invaluable major domo, we started early and went, as fast as caravan would allow, to St John's College in Johannesburg getting there just in time for the christening of Mick's son at 3:30 pm. After this happy occasion we were warmly welcomed at the home of Harry and Ernestine Rissik where we met son Peter and his wife, and Oliver, a budding civil engineer. After

88 wining and dining we went early to bed after a long first day of the Great Trek. Ken had a very wide acquaintance, and on our trip we met and stayed with, or camped in the grounds of many of his friends, and everywhere the net and often trapnets were to the fore. Next day the Rissiks took us to their citrus farm Uitkyk, below the Hartebeespoort Dam, where the trees were laden with golden and yellow fruits; hundreds of avocado trees were in fruit and blossom. On returning we called in at the fabulous, fantastic Erikssen mansion at Witkoppen. Leaving next morning we called in on Dr van Son at the Transvaal Museum in Pretoria where he was Director of Entomology, and a long-time friend and associate of Ken's. May I include a tribute that I made to Dr Georges van Son (whom I happily had come to know quite well later and Elfreda his dear wife) in the Queenstown Daily Rep. in June 1967, after his death? "... Dr van Son was a scientist of international repute. His interests were wide and diversified, and whatever he did, he did with keenest interest and great energy. For a period he was associated with the famous palaeontologist, Dr Robert Broom. He was a keen orchid grower and breeder, and had a superlative collection of his own. He was also renowned for his comprehensive collection of South African succulents and cacti. Born of a Hollander father who was Imperial Veterinarian to the last Tsar of Russia, and a mother of noble birth, young Georges was caught up in the revolution of 1917. He and his mother were placed under duress, but they eventually managed to flee Russia, aided chiefly by the magic of the young boy's musical gift on the violin. In the Transvaal Museum, always busy in his large room occupied by dozens of drawer cabinets of butterflies, he never failed to give a warm welcome, even to the most humble of collectors. Always excited to see uncommon specimens, and helpful in solving others' problems; alert and nimble, he would dash from cabinet to cabinet, giving and showing the answers to lepidopteran problems and puzzles. Scholar, linguist, scientist, naturalist, musician and withal a very human person, Dr Georges van Son will be greatly missed and long remembered by associates and a host of friends....” Great Trek again. On leaving Pretoria we drove on, to camp at Wylliespoort. We were woken, bitterly cold, before 6 am with coffee. Breakfast, then on the road through mopane and baobab featureless country to Beit Bridge, and from there to the banks of the Nuanetsi where the country began to change with frequent granite outcrops. That night we camped just north of the lovely Lundi River, where msasa country began, and where the trees were beginning to show their wonderful spring colours - pale yellow to copper, to pink and red. En route we also saw fever trees, impala and nyala buck. Ken climbed the local granite hill of about 300-400 feet in search of butterflies, with some success but our night was restless with the cry of bush babies throughout. Next day the 28th, we called in at the Hulett's farm, Brucehame, and were generously loaded with fruit and vegetables, and speeded on our way to the vast, silent Zimbabwe ruins. From there, taking a cross-country road, bypassing Glendivet, to the Fort Victoria main road, we found the country more heavily populated than any so far seen. There were endless granite outcrops round which huts clustered, oddly constructed of poles, mud and thatch, and mostly raised on stones or logs from 30 to 45 cm above ground. This was all msasa country interspersed with dry patches of thorn and other bush, and we travelled in unending avenues until we reached the Birchenough Bridge, an awe-inspiring sight, and reputed to be the largest single span bridge in the world (1957). We passed through an agricultural settlement for Africans, Nyanadzi, where we saw a profusion of grain, fruit and vegetables growing. Hot Springs happily was our next camp, and bathing in the waters at 134°F (about 50°C) was blissful. Next morning Ken took several skippers, and we moved on to Umtali. Here we were entertained to lunch by the Finlays in their lovely home overlooking the whole town and far beyond. We met Mr Cookson at 3 pm and we drove out to his beautiful home (Lawrenceville) perched on a hillside in the Vumba Mountains, 12 miles out of Umtali. His son David arrived late after a painful dental appointment. Both Harold and David, as is well known, were keen 89 entomologists, and so I came to meet and know two more collectors who were to join forces with us in P.E.A. A happy evening was spent with Ken's and Ruth's old friends, then hot baths - what luxury - and most comfortable beds, and a good night was enjoyed by all, before a heavy day of preparation for the trip. Next day the men to Bamponi with all nets, and Ruth and I move to Umtali where we bought basic provisions for a month’s stay in the Dondo Forest for seven collectors plus two helpers (for believe it or not 28 pound!). The car was serviced, and on return we packed as far as possible for the 31st our D day for moving to P.E.A. Leaving in a heavy "guti" - swirling mist - to join up with Claire and Neville Vissian, and Gideon, their major domo, we drove on to the Customs Barrier and happily no problems. So, high up in the hills we looked down from bush, sloping down to fiats where trees were in fine condition. We passed through Vila Pery, a small town where Portuguese houses were interestingly different. Gondola came next, where we stocked up with fresh fruit, and over the Pungwe River on a rickety wooden bridge, at 5 mph, we saw the new, as yet unusable, concrete bridge. On reaching the Dondo Forest, after scouting round, the men found a good open glade. Tents were pitched, mine being near the caravan for a feeling of security. Our living space was swept clean and thankfully tea, sundowners, luscious dinner and bed, everyone exhausted. Trees of many varieties made up our canopy - pod bearers, msasas and many more, all lofty with moderately thick undergrowth. We were mercilessly wakened into 1st August by Ken with coffee at 5.45 am. Ken, David and Neville went off in the Vissian lorry with a 44-gallon drum, a 14-galloner and more receptacles to fetch water in Dondo kindly given by the hotel. After a late breakfast the men went out with all paraphernalia while Ruth and I sorted, and lazed in camp. Hunters came back any time for a lunch snack and were off again. Ken returned jubilant at 4 pm with 2 specimens of a new skipper. David followed with 2 small blues which Ken judged to be a new species to the Southern African subregion. A very successful first day, added to which Ken had found what he took to be charcoal- burning mounds about half a mile from camp. I had a very interesting talk with Major Vissian, who, while in Ceylon was doing pathological research on parasitology and insectology. He was now attached to the Southern Rhodesian government, compiling a tribal history of Africans in Southern Rhodesia. This was to be used in putting into operation a new five year plan for settlement of the natives, who had to decide in that time whether they wished to be domiciled in the urban areas, or in tribal reserves, each to be given so much land. Our first full day at Dondo ended with sundowners and toasts to the fine bag, then dinner and bed most thankfully. (To be continued in July’s newsletter) METAMORPHOSIS, VOL. 2, No. 3

90

FOOTNOTE

This newsletter is compiled by Jeremy Dobson and is edited by Mark Williams, who endeavours to correct grammatical or taxonomic errors, while retaining the style and tone of the original article as submitted by the author.

This magazine relies on material from you, the members of LepSoc Africa. Please forward any news or photographs that might be of interest to [email protected].

If anyone has any ideas regarding future format or content, please feel free to make suggestions.

PDF’s of previous editions of African Butterfly News can be downloaded here:

EDITION DATE LINK EDITION DATE LINK

2016-5 Sep 2016 ABN 2016-5 2020-1 Jan 2020 ABN 2020-1

2016-6 Nov 2016 ABN 2016-6 2020-2 Mar 2020 ABN 2020-2

2017-1 Jan 2017 ABN 2017-1

2017-2 Mar 2017 ABN 2017-2

2017-3 May 2017 ABN 2017-3

2017-4 Jul 2017 ABN 2017-4

2017-5 Sep 2017 ABN 2017-5

2017-6 Nov 2017 ABN 2017-6

2018-1 Jan 2018 ABN 2018-1

2018-2 Mar 2018 ABN 2018-2

2018-3 May 2018 ABN 2018-3

2018-4 Jul 2018 ABN 2018-4

2018-5 Sep 2018 ABN 2018-5

2018-6 Nov 2018 ABN 2018-6

2019-1 Jan 2019 ABN 2019-1

2019-2 Mar 2019 ABN 2019-2

2019-3 May 2019 ABN 2019-3

2019-4 July 2019 ABN 2019-4

2019-5 Sep 2019 ABN 2019-5

2019-6 Nov 2019 ABN 2019-6

91