Page 1 of 40 Developmental Dynamics
1 2 3 4 5 6 7 Kinesin family member 6 (kif6) is necessary for spine development in zebrafish 8 9 10 11 12 Jillian G. Buchan1, Ryan S. Gray2, John M. Gansner6, David M. Alvarado3, Lydia Burgert4, 13 14 Jonathan D. Gitlin7, Christina A. Gurnett3,4,5, Matthew I. Goldsmith1,4,* 15
16 17 Departments of 1Genetics, 2Developmental Biology, 3Orthopaedic Surgery, 4Pediatrics, 18 5 6 19 Neurology, Washington University School of Medicine, St. Louis, MO, 63110; Dana Farber 20 Cancer Institute, Boston, MA, 02215; 7Eugene Bell Center for Regenerative Biology, Marine 21 Biological Laboratory, Woods Hole, MA, 02543 22 23 24 25 26 *Corresponding author: Matthew I. Goldsmith, MD 27 28 Department of Pediatrics 29 Washington University School of Medicine 30 [email protected] 31 660 S Euclid Ave, Campus Box 8208 32 St Louis, MO 63110 33 Phone: (314) 286 2769 34 35 Fax: (314) 286 2784 36 37 38 39 Running Title: Kif6 in zebrafish spine development 40 41 Keywords: kinesin, scoliosis, Danio rerio 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Developmental Dynamics Page 2 of 40
1 2 3 ABSTRACT 4 5 6 Background: Idiopathic scoliosis is a form of spinal deformity that affects 2 3% of children and 7 8 results in curvature of the spine without structural defects of the vertebral units. The 9 10 11 pathogenesis of idiopathic scoliosis remains poorly understood, in part due to the lack of a 12 13 relevant animal model. Results: We performed a forward mutagenesis screen in zebrafish to 14 15 identify new models for idiopathic scoliosis. We isolated a recessive zebrafish mutant, called 16 17 18 skolios, which develops isolated spinal curvature that arises independent of vertebral 19 20 malformations. Using meiotic mapping and whole genome sequencing, we identified a nonsense 21 22 mutation in kinesin family member 6 (kif6gw326) unique to skolios mutants. Three additional kif6 23 24 25 frameshift alleles (gw327, gw328, gw329) were generated with transcription activator like 26 27 effector nucleases (TALENs). Zebrafish homozygous or compound heterozygous for kif6 28 29 frameshift mutations developed a scoliosis phenotype indistinguishable from skolios mutants, 30 31 32 confirming that skolios is caused by the loss of kif6. Although kif6 may play a role in cilia, no 33 34 evidence for cilia dysfunction was seen in kif6gw326 mutants. Conclusions: Overall, these 35 36 37 findings demonstrate a novel role for kif6 in spinal development and identify a new candidate 38 39 gene for human idiopathic scoliosis. 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 2
Page 3 of 40 Developmental Dynamics
1 2 3 4 INTRODUCTION 5 6 7 Idiopathic scoliosis is a multifaceted genetic disorder that causes curvature of the spine in 8 9 2 3% of humans, with about 10% of patients progressing to deformity warranting bracing or 10 11 surgical treatment (Miller, 1999). Although idiopathic scoliosis is defined by a deviation of the 12 13 14 spine from the midline in the medial lateral plane, curvature is typically complex and causes a 15 16 three dimensional deformity affecting all three planes (medial lateral, dorsal ventral and 17 18 transverse). Unlike secondary scoliosis that arises from congenital vertebral malformations or 19 20 21 scoliosis arising from other syndromic conditions, idiopathic scoliosis is poorly understood and 22 23 no obvious structural vertebral abnormalities are present. A major challenge in determining the 24 25 pathogenesis of idiopathic scoliosis has been the lack of a relevant animal model. Animal 26 27 28 models of idiopathic scoliosis have been primarily limited to experimental forms of scoliosis, 29 30 where scoliosis is induced by invasive surgical procedures, immobilization or the use of the 31 32 33 systemic agents (reviewed in (Janssen et al., 2011)). Because spinal deformity develops 34 35 secondary to harsh interventions, experimentally induced forms of scoliosis are unlikely to 36 37 recapitulate many features of human idiopathic scoliosis. 38 39 40 With the exception of humans, naturally occurring scoliosis has been described only 41 42 rarely in the animal kingdom (Ouellet and Odent, 2013). Humans ambulate in an upright 43 44 position with their center of gravity over the pelvis, a characteristic that is unique even among 45 46 47 other primates (D'Aout et al., 2002). This erect, bipedal posture significantly alters the dorsal 48 49 shear loads of the spine, which has been proposed as an important prerequisite for scoliosis 50 51 52 development (Castelein et al., 2005). In support of this model, pinealectomized rats develop 53 54 scoliosis when also made bipedal, whereas similarly treated quadrupedal rats do not (Machida et 55 56 al., 2005). Although pinealectomy and bipedalism may be important prerequisites for scoliosis 57 58 59 60 3
Developmental Dynamics Page 4 of 40
1 2 3 in some species, pinealectomy in bipedal nonhuman primates does not cause spinal deformity 4 5 6 (Cheung et al., 2005). Moreover, pinealectomy in guppy (Gorman et al., 2007) and salmon 7 8 (Fjelldal et al., 2004) induces spinal curvature, demonstrating that scoliosis induced by 9 10 11 pinealectomy does not require bipedalism. 12 13 A mutant guppy strain, curveback, is one of the few examples of an animal model with 14 15 non induced spinal deformity that parallels human idiopathic scoliosis (Gorman et al., 2007). 16 17 18 curveback mutants develop a spinal curvature sporadically in the dorsal ventral and medial 19 20 lateral plane that is not due to vertebral malformations. Sporadic spinal deformity has also been 21 22 noted in other teleosts, including medaka and swordtail, suggesting that teleosts may be ideal 23 24 25 animal models to identify and characterize naturally occurring scoliosis (reviewed in (Gorman 26 27 and Breden, 2007)). Of the teleosts, zebrafish (Danio rerio) are particularly well suited model 28 29 organisms, as zebrafish are highly tractable and have extensive genomic resources. The 30 31 32 zebrafish mutant leviathan is caused by recessive mutations in collagen type VIII alpha1a 33 34 (col8a1a) and develops scoliosis (Gray et al., 2014). However, leviathan mutants also develop 35 36 37 notochord defects and congenital vertebral malformations and it remains unknown whether 38 39 zebrafish are susceptible to naturally occurring scoliosis without vertebral malformations. 40 41 Therefore, we sought to identify novel zebrafish scoliosis mutants that could serve as a model for 42 43 44 human idiopathic scoliosis. Using an N ethyl N nitrosourea (ENU) mutagenesis forward genetic 45 46 screen, we identify and describe skolios, a zebrafish mutant with recessively inherited scoliosis 47 48 that shares several characteristics with human idiopathic scoliosis. 49 50 51 52 53 54 55 56 57 58 59 60 4
Page 5 of 40 Developmental Dynamics
1 2 3 RESULTS 4 5 6 7 Identification of skolios mutant 8 9 To identify zebrafish mutants with scoliosis, we performed an ENU mutagenesis screen 10 11 on wild type (WT) AB zebrafish. From this screen, we identified a new zebrafish mutant, 12 13 14 skolios, which develops recessively inherited curvature of the body axis. 15 16 Body curvature first develops in skolios mutants during embryonic hatching stages (2 3 17 18 days post fertilization [dpf]), causing a moderate ventral curvature of the body axis that is 19 20 21 frequently limited to the distal end of the tail (Figure 1A). This early curvature arises without 22 23 observable defects in the notochord (e.g. kinking) and is incompletely penetrant with variable 24 25 26 expressivity. Approximately 20% of homozygous skolios embryos appear normal at 3 dpf, while 27 28 the majority exhibit either moderate (~70%) or severe (~10%) ventral body curvature (Figure 29 30 1A, Figure 1B). 31 32 33 Unlike the incompletely penetrant ventral body curvature first seen during hatching 34 35 stages, curvature in the medial lateral plane becomes fully penetrant during early larval stages 36 37 (4 5 dpf) and progresses through later larval and juvenile stages (5 89 dpf) (Figure 1C). 38 39 40 Although there is large phenotypic variability in the appearance and severity of the curve, body 41 42 curvature defects are easily observed in both the dorsal ventral and medial lateral planes of all 43 44 adult skolios mutants (Figure 1D). Despite the severity of the deformity, adult skolios mutants 45 46 47 are both viable and fertile. Heterozygous mutants exhibit no overt embryonic or post embryonic 48 49 phenotype. 50 51 52 53 54 Characterization of spinal curvature in skolios mutants 55 56 57 58 59 60 5
Developmental Dynamics Page 6 of 40
1 2 3 MicroCT imaging of a skolios mutant and WT zebrafish was performed at 50 dpf to 4 5 6 determine if vertebral abnormalities underlie the curved body axis in skolios. Compared to WT, 7 8 the skolios mutant developed a marked curvature of the abdominal and caudal spine in both the 9 10 11 dorsal ventral and medial lateral planes (Figure 1E). To evaluate the temporal onset of curvature 12 13 and to screen for vertebral defects, we performed a two staining protocol using alcian blue, a 14 15 positively charged dye that is thought to react with the acidic mucopolysaccharides in cartilage, 16 17 18 and alizarin red, a dye that binds to mineralized bone (Walker and Kimmel, 2007). Vertebral 19 20 morphology was evaluated at several developmental time points (2 18 months post fertilization 21 22 [mpf]) for WT and skolios mutants. To track the progression of the spinal curve, curves were 23 24 25 measured in the dorsal ventral plane as shown in Figure 2A. Although human idiopathic 26 27 scoliosis is measured in the medial lateral plane, individual zebrafish vertebrae were more easily 28 29 observed when viewed laterally, which allowed for more accurate curve measurements. All 30 31 32 curves were measured at the curve apex near the transition from abdominal to caudal vertebrae. 33 34 At 2 mpf, the average spinal curve was similar in both male and female skolios mutants (Figure 35 36 37 2B). In males, spinal curvature was progressive and by 18 mpf, the average curve was 46° 38 39 (SD=15.3°, N=5), compared to an average of 28° at 2 mpf (SD=14.1°, N=10) (P=0.043, 40 41 Student’s t test). Although the curves were similar at 2 mpf, males developed more severe spinal 42 43 44 curves than females at both 7 mpf (36° versus 25°, P=0.042, Student’s t test) and 18 mpf (46° 45 46 versus 27°, P=0.037, Student’s t test). Female curves were stable and did not change between 2 47 48 and 18 mpf. In contrast, WT zebrafish rarely had spinal curvature and if present, were 49 50 51 consistently small but variable. WT zebrafish measured at 2 and 7 mpf had an average spinal 52 53 curve of 5.3° (SD=6.7°, N=8) in males and 3.4° (SD=2.1°, N=9) in females (not shown). 54 55 56 57 58 59 60 6
Page 7 of 40 Developmental Dynamics
1 2 3 Spinal curvature in skolios mutants occurred without an increased frequency of vertebral 4 5 6 fusions or malformations (Figure 2C). Although vertebral fusions and malformations were noted 7 8 in approximately 30% of all skolios mutants (Figure 2D), this was comparable to frequencies 9 10 11 observed in WT zebrafish (Figure 2E). 12 13 14 15 Identification of kinesin family member 6 nonsense mutation (kif6gw326) in skolios mutants 16 17 18 To determine the genetic basis of the skolios mutant phenotype, we performed meiotic 19 20 mapping, which localized the mutation to a region bounded by markers z8980 on one side and 21 22 either z9692 or z24344 on the other (z9692 but not z24344 was polymorphic in one WIK fish 23 24 25 used for a mapcross, while z24344 but not z9692 was polymorphic in a second WIK fish used 26 27 for a mapcross) (Figure 3A). The marker z24344 is not currently listed in Ensembl Zv9 but the 28 29 sequence can be found in GenBank (G47401.1) and can subsequently be located in Zv9. The 30 31 32 smaller region, between z8980 and z9692, mapped the phenotype to a 2.7 Mb locus at 33 34 chr17:47,500,198 50,216,501 (Zv9). 35 36 37 Although mapping limited the region harboring the mutation responsible for skolios to a 38 39 2.7Mb region on chromosome 17, approximately 20 genes remained within the locus. To 40 41 simultaneously investigate all genes within the interval, whole genome sequencing was 42 43 44 performed on a single skolios mutant. Next generation sequencing reads were aligned to the Zv9 45 46 Tübingen reference genome (Table 1). Nearly three quarters of the reference genome was 47 48 covered at ≥3X, which we deemed sufficient to identify a homozygous base change. In the 49 50 51 mapped interval, 18,941 total variants were identified. To eliminate strain specific 52 53 polymorphisms resulting from the alignment of skolios (generated on an AB background) to the 54 55 Zv9 sequence (Tübingen), variants present in sequence data from an unrelated zebrafish with a 56 57 58 59 60 7
Developmental Dynamics Page 8 of 40
1 2 3 similar genetic background (AB) were removed. Of 20 homozygous, nonsynonymous variants, 4 5 6 only one mutant allele (gw326) produced a nonsense mutation, caused by a G>T transversion at 7 8 chr17:48958292 (Zv9) in the second exon of kif6 (encoding kinesin family member 6). The 9 10 gw326 11 kif6 mutant allele, corresponding to a C>A base change at position 205 in the kif6 mRNA 12 13 (NM_001077431, kif6 is encoded on the minus strand), is predicted to truncate kif6 in the 14 15 kinesin motor domain (Tyr53X) (Figure 3B). This variant was validated in additional skolios 16 17 18 mutants using Sanger sequencing (Figure 3C). 19 20 21 22 TALEN-induced mutations in kif6 23 24 25 Transient knock down of kif6 with morpholinos targeting the translation start site or the 26 27 first exon intron boundary recapitulated the embryonic curvature defects (Figure 4); however, 28 29 kif6 morphants developed into normal adults (not shown). Because the transient nature of 30 31 32 morpholinos limits our ability to assess adult phenotypes, we generated stable germline 33 34 mutations in kif6 using TALENs (transcription activator like effector nucleases), which have 35 36 37 been shown to effectively induce new mutations in zebrafish (Sander et al., 2011). 38 39 We designed a TALEN pair targeting a region in the second exon of kif6, which flanked a 40 41 BccI restriction site and was adjacent to kif6gw326 (Figure 5A). TALENs were combined at equal 42 43 44 concentrations and injected into 1 4 cell stage WT embryos. PCR amplification and subsequent 45 46 digestion with BccI showed that all embryos injected with TALENs had some degree of 47 48 undigested product, indicating that the BccI restriction site was disrupted by an induced mutation 49 50 51 (Figure 5B). Because the F0 (injected) zebrafish are mosaic, zebrafish were outcrossed with WT 52 53 adults to create stable lines. Three new mutant alleles were identified in the F1 generation: two 8 54 55 bp deletions (gw327 and gw328) and a 4 bp deletion (gw329) (Figure 5C). Sibling crosses 56 57 58 59 60 8
Page 9 of 40 Developmental Dynamics
1 2 3 generated F2 zebrafish that were either homozygous or compound heterozygous for TALEN 4 5 6 induced kif6 mutant alleles. All combinations produced zebrafish with curvature of the body 7 8 axis in both embryonic and adult stages that were indistinguishable from kif6gw326 mutants, 9 10 11 providing strong support for kif6 as the genetic cause of skolios (Figure 6). The curvature 12 13 phenotype was fully penetrant by larval and adult stages for all allelic combinations. 14 15 16 17 18 Characterization of kif6 expression in zebrafish 19 20 We analyzed kif6 expression at various embryonic time points and in adult tissues using 21 22 RT PCR (Figure 7A). In WT embryos, kif6 was expressed at extremely low levels by 24 hpf and 23 24 25 expression was maintained through 120 hpf, a finding corroborated by qPCR experiments 26 27 demonstrating that kif6 is expressed several orders of magnitude below common housekeeping 28 29 genes (not shown). Maternal expression was not detected at 3 hpf. In WT adult tissues (Figure 30 31 32 7B), kif6 was expressed at low levels in brain, intestine, ovary and testis but was not detectible in 33 34 eye, kidney, spleen or fin (dermal bone). Whole mount in situ hybridization using a DIG labeled 35 36 37 antisense RNA probe showed very low level expression of kif6 in WT zebrafish embryos at 24, 38 39 48 and 72 hpf, which was diffuse and nonspecific (data not shown). In the Eurexpress 40 41 Transcriptome Atlas Database for Mouse Embryo (www.eurexpress.org), in situ hybridization 42 43 44 similarly showed diffuse, low level kif6 expression, with weak expression in the choroid plexus 45 46 in the mouse embryo (embryonic day 14.5). In the Allen Brain Atlas (www.brain map.org), kif6 47 48 localizes to the central canal of the spinal cord in both juvenile (postnatal day 4) and adult 49 50 51 (postnatal day 56) mice. 52 53 54 55 Assessment of cilia-related phenotypes in kif6 mutants 56 57 58 59 60 9
Developmental Dynamics Page 10 of 40
1 2 3 The function of kif6 is unknown, but it has been predicted to be involved in 4 5 6 cilia/flagellum assembly or function (Miki et al., 2005; Ha et al., 2013; Hameed et al., 2013), 7 8 particularly in ciliated ependymal cells (Jacquet et al., 2009). Several characteristic phenotypes 9 10 11 are common in zebrafish with defects of motile cilia, including ventral curvature of the embryo, 12 13 left right asymmetry defects, kidney cysts, hydrocephalus and otolith abnormalities (reviewed in 14 15 (Jaffe et al., 2010; Malicki et al., 2011)). Because kif6 mutants develop embryonic body 16 17 18 curvature typical of other zebrafish mutants with cilia defects, we considered if additional 19 20 ciliopathy related phenotypes were present in kif6 mutants. Normal heart positioning was 21 22 identified in 93.6% of WT embryos (N=94) and 91.9% of kif6gw326 embryos (N=173) at 30 hpf 23 24 25 (Figure 8A), suggesting that the loss of kif6 is not associated with an increased incidence of left 26 27 right asymmetry defects. Similarly, otoliths appeared normal at 48 72 hpf in 98.5% and 98.7% 28 29 of WT (N=391) and kif6gw326 mutants (N=305), respectively (Figure 8B). In addition, in situ 30 31 32 hybridization showed that two additional markers of symmetry, southpaw (Figure 8C) and 33 34 insulin (Figure 8D), were correctly expressed on the left and right sides of skolios embryos, 35 36 37 respectively. Other easily observed phenotypes that are characteristic of cilia defects, such as 38 gw326 39 hydrocephalus and kidney cysts, were never observed in kif6 mutants, suggesting that kif6 is 40 41 not globally important for cilia formation or function. 42 43 44 Because kif6 is thought to have a role in ciliated ependymal cells (Jacquet et al., 2009) 45 46 and is expressed in the central canal of the rodent spinal cord (www.brain map.org), we 47 48 evaluated the structure and function of cilia in the central canal in kif6gw326 mutants using whole 49 50 51 mount confocal immunostaining with an antibody that labels acetylated tubulin. No gross 52 53 abnormalities in ciliary number or morphology were detected in 28 hpf embryos compared to 54 55 WT (Figure 8E). To evaluate ciliary function, we assessed the movement of injected dye in the 56 57 58 59 60 10
Page 11 of 40 Developmental Dynamics
1 2 3 central canal of WT and kif6gw326 embryos at 48 hpf using a previously described assay (Kramer 4 5 gw326 6 Zucker et al., 2005). No differences in dye movement were observed in kif6 mutants 7 8 compared to WT (Figure 8F). 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 11
Developmental Dynamics Page 12 of 40
1 2 3 DISCUSSION 4 5 6 Idiopathic scoliosis affects 2 3% of the population. Despite its frequency, the 7 8 pathogenesis of idiopathic scoliosis remains elusive. Here, we describe a new zebrafish mutant, 9 10 11 called skolios, which develops spinal deformity that parallels many aspects of human idiopathic 12 13 scoliosis. 14 15 First, skolios mutants develop a complex, three dimensional curvature of the spine 16 17 18 without an increased frequency of structural vertebral abnormalities. In humans, idiopathic 19 20 scoliosis is diagnosed only after other causes of scoliosis have been ruled out, including 21 22 congenital vertebral defects or other syndromic diagnoses that can cause scoliosis (e.g. cerebral 23 24 25 palsy, Marfan syndrome). While vertebral defects were absent in approximately 70% skolios 26 27 mutants, mild vertebral defects (vertebral fusions) were noted occasionally, but were present at 28 29 the same frequency in WT, suggesting curvature is unlinked to these vertebral abnormalities in 30 31 32 skolios mutants. Moreover, spinal curvature is the only phenotype observed in skolios mutants, 33 34 suggesting that spinal curvature is not occurring secondary to a broader, systemic condition. 35 36 37 Second, like human idiopathic scoliosis, we noted sexual dimorphism in skolios for the most 38 39 severe curves. In humans, mild idiopathic scoliosis affects males and females equally, but 40 41 females develop severe deformity ten times more frequently than males (Lenke, 2004). In 42 43 44 skolios, both genders were affected, but over time, adult male mutants developed a more severe 45 46 spinal deformity compared to adult females. Although this is opposite to the female bias 47 48 observed in humans, it nevertheless demonstrates a role for gender in the progression of spinal 49 50 51 deformity but not for overall susceptibility. 52 53 Using meiotic mapping and whole genome sequencing, we identified a nonsense 54 55 mutation (gw326) in kif6, a poorly characterized member of the kinesin family, as the genetic 56 57 58 59 60 12
Page 13 of 40 Developmental Dynamics
1 2 3 basis of skolios. Our results, along with others (Bowen et al., 2012; Leshchiner et al., 2012; 4 5 6 Obholzer et al., 2012; Voz et al., 2012), demonstrate that whole genome sequencing is an 7 8 effective approach to identify mutations in zebrafish. Kif6 TALEN mutants (kif6gw327 and 9 10 gw328/gw329 11 kif6 ) recapitulated both the embryonic and post embryonic skolios phenotypes, 12 13 confirming that skolios is caused by the loss of kif6. 14 15 Kinesins are motor proteins that have diverse functions, but can be identified by their 16 17 18 highly conserved motor domain that binds to microtubules and powers movement through the 19 20 hydrolysis of ATP. Using degenerate primers designed to this conserved motor domain, kif6 was 21 22 first identified in cDNA from mouse hippocampus (Nakagawa et al., 1997). In a large mouse 23 24 25 cDNA library, kif6 was identified in spinal ganglion and cerebellum (Miki et al., 2003) and 26 27 western blotting of mouse tissues has shown kif6 expression in various tissues, including brain 28 29 and spinal cord (Hameed et al., 2013). Kif6 is expressed in the choroid plexus and central canal 30 31 32 of the rodent spinal cord in the Eurexpress Transcriptome database (www.eurexpress.org) and 33 34 Allen Brain Atlas (www.brain map.org), respectively. Our expression analysis in zebrafish 35 36 37 demonstrated complimentary results, with kif6 expressed in the brain, but also in the intestine, 38 39 ovary and testis. To our knowledge, this is the first demonstration of kif6 expression in zebrafish 40 41 and the first demonstration of a mutant phenotype resulting from a mutation in kif6. 42 43 44 Kif6 is poorly characterized and its function is unknown. Most investigations of kif6 45 46 have been limited to a common single nucleotide polymorphism (rs20455) in humans, which was 47 48 associated with coronary artery disease (Bare et al., 2007; Iakoubova et al., 2008a; Iakoubova et 49 50 51 al., 2008b; Shiffman et al., 2008a; Shiffman et al., 2008b), although a large meta analysis failed 52 53 to replicate the association (Assimes et al., 2010) and the importance of the common 54 55 polymorphism in kif6 is currently being debated. A kif6 mutant mouse was found to have normal 56 57 58 59 60 13
Developmental Dynamics Page 14 of 40
1 2 3 cardiac function, while additional phenotypes were not described (Hameed et al., 2013). Kif6 4 5 6 was originally identified as an orphan kinesin (Miki et al., 2001; Miki et al., 2003), but has also 7 8 been included with kinesin family member 9 (kif9) in the Kinesin 9 superfamily. Although kif9 9 10 11 and kif6 share a region of conserved sequence near the kinesin motor domain that is specific to 12 13 the Kinesin 9 superfamily (Miki et al., 2005), the proteins are phylogenetically distant (Miki et 14 15 al., 2001). Members of the Kinesin 9 superfamily have only been identified in vertebrates and 16 17 18 protozoa, which is consistent with a role in cilia and flagella (Miki et al., 2005). 19 20 Further evidence for a role of kif6 in cilia was suggested by its down regulation in 21 22 forebrain of forkhead box J1 (FoxJ1) null mice (Jacquet et al., 2009), a transcription factor that 23 24 25 is necessary and sufficient for motile cilia generation (Stubbs et al., 2008; Yu et al., 2008). 26 27 FoxJ1 is also required for the differentiation of ependymal cells (Li et al., 2009), which are 28 29 ciliated cells that line the ventricles in the brain and the central canal in the spinal cord. 30 31 32 Ependymal cells are responsible for circulating cerebral spinal fluid, although they may have 33 34 additional functions. In the Allen Brain Atlas (www.mouse.brain map.org/), kif6 expression is 35 36 37 limited to the ependymal layer of the ventricle (Li et al., 2009) and central canal of the spinal 38 39 cord. Gross abnormalities in cilia structure or function, as assessed by movement of central 40 41 spinal fluid in the central canal, were absent, as were additional cilia related phenotypes in kif6 42 43 44 mutants (defects in left right asymmetry, otolith abnormalities, hydrocephalus or kidney cysts). 45 46 Although we did not assess ciliary function via a direct analysis of Kupffer’s vesicle, disruption 47 48 of ciliary function in Kupffer’s vesicle invariably leads to downstream defects in left right 49 50 51 symmetry, which we failed to observe. However, these results do not rule out other cilia related 52 53 functions for kif6. For example, cells in the developing neural tube must interpret sonic 54 55 hedgehog (shh) signals in order to specify cell fates and correctly pattern the neural tube (Su et 56 57 58 59 60 14
Page 15 of 40 Developmental Dynamics
1 2 3 al.). In vertebrates, the primary cilium is a shh signaling center, requiring cilia related proteins 4 5 6 to correctly localize members of the hedgehog pathway to the cilium (Goetz and Anderson; 7 8 Larkins et al.). Curvature of the body axis is a common phenotype in zebrafish embryos with 9 10 11 cilia defects (Malicki et al., 2011) and has also been observed in adult cilia mutants (Bachmann 12 13 Gagescu et al., 2011), which is consistent with a cilia related defect in kif6 mutants. Cilia defects 14 15 have been proposed as a mechanism for human idiopathic scoliosis (Burwell et al., 2006), though 16 17 18 scoliosis is not common in human ciliopathies. Future studies are needed to clarify the function 19 20 of kif6. Identifying the predominant cell types expressing kif6 may be particularly useful to 21 22 identify its molecular role and elucidate the mechanism by which it leads to spinal curvature in 23 24 25 skolios mutants. Given the absence of kif6 expression in bone (fin rays), a skeletal phenotype 26 27 autonomous to bone forming cells (osteoblasts/scleroblasts) seems unlikely. Because in situ 28 29 hybridization yielded nonspecific, low level expression of kif6, and qPCR experiments 30 31 32 demonstrate that kif6 is expressed several orders of magnitude below common housekeeping 33 34 genes, more robust methods such as knocking in a GFP tagged kif6 into WT zebrafish are likely 35 36 37 needed. It is unclear whether kif6 mutations are important in the genesis of human idiopathic 38 39 scoliosis. Efforts aimed at identifying kif6 mutations in a DNA database of pediatric patients 40 41 with musculoskeletal disorders, including scoliosis, are currently underway. 42 43 44 In summary, this study identifies skolios, a zebrafish mutant with spinal deformity. The 45 46 spinal curvature phenotype occurs isolated from other features and is not secondary to vertebral 47 48 malformations, which suggests that skolios may serve as a model for human idiopathic scoliosis 49 50 51 and could be a valuable resource to better understand this complex human condition. Moreover, 52 53 we have established zebrafish as a viable model for spinal deformity that may be of use to 54 55 confirm genetic findings in human studies of idiopathic scoliosis. Using meiotic mapping and 56 57 58 59 60 15
Developmental Dynamics Page 16 of 40
1 2 3 whole genome sequencing, we identify kif6 as genetic basis of skolios. These finding highlight a 4 5 6 new role for kif6 in spinal development and stability, expanding upon the already diverse cellular 7 8 functions of kinesins. 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 16
Page 17 of 40 Developmental Dynamics
1 2 3 EXPERIMENTAL PROCEDURES 4 5 6 Zebrafish maintenance 7 8 Zebrafish were maintained under standard conditions (Westerfield, 1993). Zebrafish 9 10 11 were bred by in vitro fertilization using adults anesthetized in 0.16% tricaine methanesulfonate 12 13 (3 amino benzoic acidethylester, Sigma Aldrich) diluted in E3 embryo medium (5 mM NaCl, 14 15 0.17 mM KCl, 0.33 mM CaCl2, 0.33 mM MgSO4 in H20) or by natural pairwise mating. With 16 17 18 the exception of WIK strains used for meiotic mapping, all wild type (WT) zebrafish were from 19 20 an AB genetic background. Zebrafish embryos were maintained in E3 embryo medium in petri 21 22 dishes (50 embryos/dish) until 5 DPF, when they were transferred to 100 ml beakers containing 23 24 25 50 ml E3 medium (25 embryos/beaker). Larvae were fed twice daily from 6 14 DPF with ~1 ml 26 27 of rotifer (Brachionis plicatilis) culture maintained on Nannochloropsis algae (Reed Mariculture, 28 29 California). After 14 DPF, larvae were fed 4 times daily with either rotifer culture or brine 30 31 32 shrimp (yourfishstuff.com). After 4 weeks juvenile zebrafish were placed on flowing water and 33 34 fed a combination of brine shrimp and Hatchfry Encapsulon (Argent Labs) until 8 weeks of age. 35 36 37 After 8 weeks, adult zebrafish were fed a combination of brine shrimp and Hikari Micro Pellets 38 39 (Aquatic Ecosystems). Experiments were carried out in accordance with the animal protocol 40 41 guidelines at Washington University. 42 43 44 45 46 Chemical Mutagenesis and Forward Genetic Screening 47 48 The generation of mutagenized F1 female fish was carried out with ENU as previously 49 50 51 described (Gansner et al., 2008). Gynogenetic diploids were subsequently derived by the early 52 53 pressure method (Obholzer et al., 2012) and screened for spinal curvature. 54 55 56 57 58 59 60 17
Developmental Dynamics Page 18 of 40
1 2 3 Analysis of spinal and vertebral morphology 4 5 6 MicroCT imaging was performed using a VivaCt40 machine (ScanCo) as previously 7 8 described (Gray et al., 2014). Zebrafish observations were imaged using an Olympus DP70 9 10 11 Digital Microscope Camera fixed to an Olympus MVX10 MacroView fluorescence microscope 12 13 with MicroSuite Basic Edition software (Olympus). For bone and cartilage staining, zebrafish at 14 15 various time points were euthanized with tricaine methanesulfonate and fixed in 4% PFA/PBS. 16 17 18 Fixed zebrafish were immersed in 0.1% alcian blue in 7:3 EtOH:glacial acetic acid for 24 19 20 48 hours and destained for 0.5 2 hours in 7:3 EtOH/glacial acetic acid to visualize cartilage. 21 22 Bones were then stained with alizarin red S in 0.5% KOH for 6 24 hours and destained in 0.5% 23 24 25 KOH. Stained zebrafish were stored in glycerol. The spinal curvature was quantified by 26 27 imaging zebrafish positioned laterally. For consistency, spinal curvature was only quantified 28 29 near the transition from abdominal (rib vertebrae) to caudal vertebrae (vertebrae posterior of 30 31 32 ribs), which excluded the most rostral and caudal vertebrae. The apex of the curve was identified 33 34 within the defined region and lines were drawn through the center of the two vertebrae adjacent 35 36 37 to the apex. The angle of the two intersecting lines was measured using Photoshop CS3 38 39 (Adobe). Measured angles were subtracted from 180° to calculate the spinal curve. 40 41 42 43 44 Meiotic mapping 45 46 The skolios mutation was localized to chromosome 17 using centromeric linkage analysis 47 48 (Johnson et al., 1995; Johnson et al., 1996). Fine mapping was achieved by mapcrossing to the 49 50 51 polymorphic WIK strain and assessing for recombination along chromosome 17 by sequence 52 53 length polymorphism analysis (Shimoda et al., 1999). 54 55 56 57 58 59 60 18
Page 19 of 40 Developmental Dynamics
1 2 3 Whole genome sequencing 4 5 6 Genomic DNA from a skolios mutant was extracted using Proteinase K (Roche) and 7 8 25:24:1 phenol:chloroform:isoamyl (Roche) according to the manufacturer’s instructions. 9 10 11 Whole genome sequencing was performed by the Genome Technology Access Center at 12 13 Washington University using 3 µg DNA from a single skolios mutant. One lane of a HiSeq 2000 14 15 sequencer (Illumina) was used to generate 101 bp paired end reads. Raw sequencing reads were 16 17 18 aligned to the Zv9 genome assembly using Novoalign (Novocraft Technologies). Variants were 19 20 identified using SAMtools software (Li et al., 2009) and annotated using SnpEff software 21 22 (Cingolani et al., 2012). Variants were validated by Sanger sequencing using an ABI 3730 23 24 25 Sequencer (Life Technologies) and visualized using Sequencher DNA Sequencing software 26 27 (Gene Codes). 28 29 30 31 32 RT-PCR of adult zebrafish tissues 33 34 Tissue samples were harvested from adult zebrafish euthanized in tricaine methanesulfonate. 35 36 37 Tissue samples were dissected and pooled from 5 10 zebrafish and total RNA was extracted 38 39 using Trizol Reagent (Invitrogen). RNA concentrations were measured using a NanoDrop 2000 40 41 UV Vis spectrophotometer. cDNA synthesis was performed using SuperScript II Reverse 42 43 44 Transcriptase (Invitrogen) using 1 µg of RNA according to the manufacturer’s instructions. As a 45 46 negative control, cDNA synthesis reactions were also performed with the reverse transcriptase 47 48 omitted. PCR reactions were performed with Bullseye Taq Polymerase (Midsci) using 1 µl of 49 50 51 cDNA and 35 40 amplification cycles with a 58° annealing temperature and 30 second 52 53 extension. The following primers were used: 54 55 kif6 (exon 1 3) 5’ CGTGCAGGTAAACAGTAAAAGC 3’ 56 57 58 59 60 19
Developmental Dynamics Page 20 of 40
1 2 3 5’ CAGCAACAGGTTTTGCAATG 3’ 4 5 6 kif6 (exon 16 18) 5’ GCGGAGAGAACACAGGAAAC 3’ 7 8 5’ GTGCTGTTGAGCAGGTTGTG 3’ 9 10 11 β actin 5’ TACAATGAGCTCCGTGTTGC 3’ 12 13 5’ AAGGAAGGCTGGAAGAGAGC 3’ 14 15 16 17 18 In Situ Hybridization 19 20 Embryos were manually dechorionated at the indicated developmental stages, fixed in 21 22 4% paraformaldehyde–PBS overnight at 4 °C, and dehydrated by methanol series. DIG labeled 23 24 25 antisense RNA probes were synthesized using a DIG labeling kit (Roche), and whole mount in 26 27 situ hybridization was performed as previously described (Thisse and Thisse, 2008). 28 29 30 31 32 Microinjection of morpholinos 33 34 Morpholinos (MOs) were purchased from Gene Tools, LLC to transiently knockdown 35 36 37 zebrafish kif6. MOs were designed to target the translation start site (trans block) and the 38 39 boundary between exon 1 and intron 1 (splice block). An additional MO targeting the 40 41 translation start site but containing a 5 base mismatch served as a negative control (mismatch). 42 43 44 The 3’ end of the splice blocking and mismatch MOs were modified with a fluorescein tag. The 45 46 sequences of the MOs are as follows: 47 48 trans block 5’ TTGCTTTTACTGTTTACCTGCACGT 3’ 49 50 51 splice block 5’ ACAAAAGCAAAACACTCACCGAGGT 3’ 52 53 mismatch 5’ TGCTTAACGATCTTAATCATCGCTT 3’ 54 55 56 57 58 59 60 20
Page 21 of 40 Developmental Dynamics
1 2 3 MOs were prepared at concentrations ranging from 0.05 mM to 3 mM and approximately 500 pL 4 5 6 were injected in 1 4 cell stage embryos. 7 8 9 10 11 Transcription activator-like effector nuclease (TALEN) design and assembly 12 13 Two TALENs (left and right) were designed to target the second exon of kif6. These 14 15 sites flanked a BccI restriction site that was used for mutation screening. TALENs were 16 17 18 generated using the Golden Gate method as previously described (Cermak et al., 2011). 19 20 Plasmids were acquired from the Golden Gate TALEN and TAL Effector Kit (AddGene) and 21 22 RVD repeat arrays were cloned into pCS2TAL3DD and pCS2TAL3RR (AddGene). Plasmids 23 24 25 were transformed into DH5α competent cells (Invitrogen) and isolated using the QIAprep Spin 26 27 Miniprep Kit (Qiagen). 28 29 The following sequence targets and RVD sites were used to generate kif6 TALENs: 30 31 32 Left target DNA TCCCTCTTATTGTTG 33 34 Left RVD sequence NG HD HD HD NG HD NG NG NI NG NG NN NG NG NN 35 36 37 Right target DNA GCATCTCTGGGAACC 38 39 Right RVD sequence NN NN NG NG HD HD HD NI NN NI NN NI NG NN HD 40 41 42 43 44 Injection of TALEN RNA in zebrafish embryos 45 46 Complete plasmids (containing the scaffold and RVD arrays) were linearized using XhoI 47 48 and 5’ capped mRNA was generated by in vitro transcription using the mMESSAGE 49 50 51 mMACHINE SP6 Transcription Kit (Life Technologies). Capped mRNA was purified using the 52 53 RNeasy Mini Kit (Qiagen). Left and right TALENs were combined at equal concentrations. 54 55 WT embryos were collected and 40 50 pg of pooled TALENs were injected into the yolk of 1 4 56 57 58 59 60 21
Developmental Dynamics Page 22 of 40
1 2 3 cell stage embryos. Injected embryos and progeny were screened for TALEN induced mutations 4 5 6 by digesting PCR amplified DNA with BccI (New England Biolabs). The following primers 7 8 were used for screening the BccI restriction site: 9 10 11 BccI 5’ TGCAATAAATGGAAACAAGAACC 3’ 12 13 5’ TTCGCACATTTGTTCAGTGAC 3’ 14 15 16 17 18 Evaluation of cilia and cilia-related phenotypes 19 20 Defects in left right asymmetry were determined by visualizing the position of the heart 21 22 in 30 hpf embryos. Abnormal left right asymmetry was classified as ambiguous when the heart 23 24 25 was positioned at the midline and as situs inversus when the heart was positioned left of the 26 27 midline when viewed ventrally (the right side of the embryo). Otoliths were evaluated by 28 29 visualizing zebrafish laterally between 48 72 hpf. Immunofluorescence staining was performed 30 31 32 as previously described (Ha et al., 2013) using embryos collected at 28 hours post fertilization 33 34 (hpf). Embryos were dechorionated in protease type XIV (Sigma) and fixed in 4% 35 36 37 paraformaldehyde for immunostaining with anti acetylated tubulin monoclonal antibody 6 11 B1 38 39 (Sigma). Fluid flow in the central canal was measured as previously stated (Kramer Zucker et 40 41 al., 2005). Live 48 hpf zebrafish were anesthetized in tricaine methanesulfonate and imaged at 42 43 44 various time points after injection of 5% tetramethylrhodamine conjugated to 70,000 molecular 45 46 weight dextran into the brain ventricle. 47 48 49 50 51 Statistical analysis 52 53 A one tailed Student’s t test was used for all statistical analyses. 54 55 56 57 58 59 60 22
Page 23 of 40 Developmental Dynamics
1 2 3 ACKNOWLEDGEMENTS 4 5 6 7 8 We would like to thank Douglas Oppedal for assistance with zebrafish husbandry. 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 23
Developmental Dynamics Page 24 of 40
1 2 3 4 5 BIBLIOGRAPHY 6 7 8 Assimes TL, Holm H, Kathiresan S, Reilly MP, Thorleifsson G, Voight BF, Erdmann J, 9 Willenborg C, Vaidya D, Xie C, Patterson CC, Morgan TM, Burnett MS, Li M, Hlatky 10 MA, Knowles JW, Thompson JR, Absher D, Iribarren C, Go A, Fortmann SP, Sidney S, 11 Risch N, Tang H, Myers RM, Berger K, Stoll M, Shah SH, Thorgeirsson G, Andersen K, 12 Havulinna AS, Herrera JE, Faraday N, Kim Y, Kral BG, Mathias RA, Ruczinski I, 13 Suktitipat B, Wilson AF, Yanek LR, Becker LC, Linsel Nitschke P, Lieb W, Konig IR, 14 15 Hengstenberg C, Fischer M, Stark K, Reinhard W, Winogradow J, Grassl M, 16 Grosshennig A, Preuss M, Schreiber S, Wichmann HE, Meisinger C, Yee J, Friedlander 17 Y, Do R, Meigs JB, Williams G, Nathan DM, MacRae CA, Qu L, Wilensky RL, Matthai 18 WH, Jr., Qasim AN, Hakonarson H, Pichard AD, Kent KM, Satler L, Lindsay JM, 19 Waksman R, Knouff CW, Waterworth DM, Walker MC, Mooser VE, Marrugat J, Lucas 20 21 G, Subirana I, Sala J, Ramos R, Martinelli N, Olivieri O, Trabetti E, Malerba G, Pignatti 22 PF, Guiducci C, Mirel D, Parkin M, Hirschhorn JN, Asselta R, Duga S, Musunuru K, 23 Daly MJ, Purcell S, Eifert S, Braund PS, Wright BJ, Balmforth AJ, Ball SG, Myocardial 24 Infarction Genetics C, Wellcome Trust Case Control C, Cardiogenics, Ouwehand WH, 25 Deloukas P, Scholz M, Cambien F, Huge A, Scheffold T, Salomaa V, Girelli D, Granger 26 CB, Peltonen L, McKeown PP, Altshuler D, Melander O, Devaney JM, Epstein SE, 27 28 Rader DJ, Elosua R, Engert JC, Anand SS, Hall AS, Ziegler A, O'Donnell CJ, Spertus 29 JA, Siscovick D, Schwartz SM, Becker D, Thorsteinsdottir U, Stefansson K, Schunkert 30 H, Samani NJ, Quertermous T. 2010. Lack of association between the Trp719Arg 31 polymorphism in kinesin like protein 6 and coronary artery disease in 19 case control 32 studies. J Am Coll Cardiol 56:1552 1563. 33 34 Bachmann Gagescu R, Phelps IG, Stearns G, Link BA, Brockerhoff SE, Moens CB, Doherty D. 35 2011. The ciliopathy gene cc2d2a controls zebrafish photoreceptor outer segment 36 development through a role in Rab8 dependent vesicle trafficking. Hum Mol Genet 37 20:4041 4055. 38 Bare LA, Morrison AC, Rowland CM, Shiffman D, Luke MM, Iakoubova OA, Kane JP, Malloy 39 MJ, Ellis SG, Pankow JS, Willerson JT, Devlin JJ, Boerwinkle E. 2007. Five common 40 41 gene variants identify elevated genetic risk for coronary heart disease. Genet Med 9:682 42 689. 43 Bowen ME, Henke K, Siegfried KR, Warman ML, Harris MP. 2012. Efficient mapping and 44 cloning of mutations in zebrafish by low coverage whole genome sequencing. Genetics 45 190:1017 1024. 46 47 Burwell RG, Dangerfield PH, Freeman BJ, Aujla RK, Cole AA, Kirby AS, Pratt RK, Webb JK, 48 Moulton A. 2006. Etiologic theories of idiopathic scoliosis: the breaking of bilateral 49 symmetry in relation to left right asymmetry of internal organs, right thoracic adolescent 50 idiopathic scoliosis (AIS) and vertebrate evolution. Stud Health Technol Inform 123:385 51 390. 52 53 Castelein RM, van Dieen JH, Smit TH. 2005. The role of dorsal shear forces in the pathogenesis 54 of adolescent idiopathic scoliosis a hypothesis. Med Hypotheses 65:501 508. 55 Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, 56 Bogdanove AJ, Voytas DF. 2011. Efficient design and assembly of custom TALEN and 57 other TAL effector based constructs for DNA targeting. Nucleic Acids Res 39:e82. 58 59 60 24
Page 25 of 40 Developmental Dynamics
1 2 3 Cheung KM, Wang T, Poon AM, Carl A, Tranmer B, Hu Y, Luk KD, Leong JC. 2005. The 4 5 effect of pinealectomy on scoliosis development in young nonhuman primates. Spine 6 (Phila Pa 1976) 30:2009 2013. 7 Cingolani P, Platts A, Wang le L, Coon M, Nguyen T, Wang L, Land SJ, Lu X, Ruden DM. 8 2012. A program for annotating and predicting the effects of single nucleotide 9 polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; 10 11 iso 2; iso 3. Fly (Austin) 6:80 92. 12 D'Aout K, Aerts P, De Clercq D, De Meester K, Van Elsacker L. 2002. Segment and joint angles 13 of hind limb during bipedal and quadrupedal walking of the bonobo (Pan paniscus). Am J 14 Phys Anthropol 119:37 51. 15 Fjelldal PG, Grotmol S, Kryvi H, Gjerdet NR, Taranger GL, Hansen T, Porter MJ, Totland GK. 16 2004. Pinealectomy induces malformation of the spine and reduces the mechanical 17 18 strength of the vertebrae in Atlantic salmon, Salmo salar. J Pineal Res 36:132 139. 19 Gansner JM, Madsen EC, Mecham RP, Gitlin JD. 2008. Essential role for fibrillin 2 in zebrafish 20 notochord and vascular morphogenesis. Dev Dyn 237:2844 2861. 21 Goetz SC, Anderson KV. The primary cilium: a signalling centre during vertebrate development. 22 Nat Rev Genet 11:331 344. 23 24 Gorman KF, Breden F. 2007. Teleosts as models for human vertebral stability and deformity. 25 Comp Biochem Physiol C Toxicol Pharmacol 145:28 38. 26 Gorman KF, Tredwell SJ, Breden F. 2007. The mutant guppy syndrome curveback as a model 27 for human heritable spinal curvature. Spine (Phila Pa 1976) 32:735 741. 28 Gray RS, Wilm TP, Smith J, Bagnat M, Dale RM, Topczewski J, Johnson SL, Solnica Krezel L. 29 2014. Loss of col8a1a function during zebrafish embryogenesis results in congenital 30 31 vertebral malformations. Dev Biol 386:72 85. 32 Ha K, Buchan JG, Alvarado DM, McCall K, Vydyanath A, Luther PK, Goldsmith MI, Dobbs 33 MB, Gurnett CA. 2013. MYBPC1 mutations impair skeletal muscle function in zebrafish 34 models of arthrogryposis. Hum Mol Genet 22:4967 4977. 35 Hameed A, Bennett E, Ciani B, Hoebers LP, Milner R, Lawrie A, Francis SE, Grierson AJ. 36 37 2013. No evidence for cardiac dysfunction in Kif6 mutant mice. PLoS One 8:e54636. 38 Iakoubova OA, Sabatine MS, Rowland CM, Tong CH, Catanese JJ, Ranade K, Simonsen KL, 39 Kirchgessner TG, Cannon CP, Devlin JJ, Braunwald E. 2008a. Polymorphism in KIF6 40 gene and benefit from statins after acute coronary syndromes: results from the PROVE 41 IT TIMI 22 study. J Am Coll Cardiol 51:449 455. 42 Iakoubova OA, Tong CH, Rowland CM, Kirchgessner TG, Young BA, Arellano AR, Shiffman 43 44 D, Sabatine MS, Campos H, Packard CJ, Pfeffer MA, White TJ, Braunwald E, Shepherd 45 J, Devlin JJ, Sacks FM. 2008b. Association of the Trp719Arg polymorphism in kinesin 46 like protein 6 with myocardial infarction and coronary heart disease in 2 prospective 47 trials: the CARE and WOSCOPS trials. J Am Coll Cardiol 51:435 443. 48 Jacquet BV, Salinas Mondragon R, Liang H, Therit B, Buie JD, Dykstra M, Campbell K, 49 50 Ostrowski LE, Brody SL, Ghashghaei HT. 2009. FoxJ1 dependent gene expression is 51 required for differentiation of radial glia into ependymal cells and a subset of astrocytes 52 in the postnatal brain. Development 136:4021 4031. 53 Jaffe KM, Thiberge SY, Bisher ME, Burdine RD. 2010. Imaging cilia in zebrafish. Methods Cell 54 Biol 97:415 435. 55 Janssen MM, de Wilde RF, Kouwenhoven JW, Castelein RM. 2011. Experimental animal 56 57 models in scoliosis research: a review of the literature. Spine J 11:347 358. 58 59 60 25
Developmental Dynamics Page 26 of 40
1 2 3 Johnson SL, Africa D, Horne S, Postlethwait JH. 1995. Half tetrad analysis in zebrafish: 4 5 mapping the ros mutation and the centromere of linkage group I. Genetics 139:1727 6 1735. 7 Johnson SL, Gates MA, Johnson M, Talbot WS, Horne S, Baik K, Rude S, Wong JR, 8 Postlethwait JH. 1996. Centromere linkage analysis and consolidation of the zebrafish 9 genetic map. Genetics 142:1277 1288. 10 11 Kramer Zucker AG, Olale F, Haycraft CJ, Yoder BK, Schier AF, Drummond IA. 2005. Cilia 12 driven fluid flow in the zebrafish pronephros, brain and Kupffer's vesicle is required for 13 normal organogenesis. Development 132:1907 1921. 14 Larkins CE, Aviles GD, East MP, Kahn RA, Caspary T. Arl13b regulates ciliogenesis and the 15 dynamic localization of Shh signaling proteins. Mol Biol Cell 22:4694 4703. 16 Lenke L. 2004. Idiopathic scoliosis. Philadelphia: Lippincot, Williams & Wilkins 3. 17 18 Leshchiner I, Alexa K, Kelsey P, Adzhubei I, Austin Tse CA, Cooney JD, Anderson H, King 19 MJ, Stottmann RW, Garnaas MK, Ha S, Drummond IA, Paw BH, North TE, Beier DR, 20 Goessling W, Sunyaev SR. 2012. Mutation mapping and identification by whole genome 21 sequencing. Genome Res 22:1541 1548. 22 Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, 23 24 Genome Project Data Processing S. 2009. The Sequence Alignment/Map format and 25 SAMtools. Bioinformatics 25:2078 2079. 26 Machida M, Saito M, Dubousset J, Yamada T, Kimura J, Shibasaki K. 2005. Pathological 27 mechanism of idiopathic scoliosis: experimental scoliosis in pinealectomized rats. Eur 28 Spine J 14:843 848. 29 Malicki J, Avanesov A, Li J, Yuan S, Sun Z. 2011. Analysis of cilia structure and function in 30 31 zebrafish. Methods Cell Biol 101:39 74. 32 Miki H, Okada Y, Hirokawa N. 2005. Analysis of the kinesin superfamily: insights into structure 33 and function. Trends Cell Biol 15:467 476. 34 Miki H, Setou M, Hirokawa N, Group RG, Members GSL. 2003. Kinesin superfamily proteins 35 (KIFs) in the mouse transcriptome. Genome Res 13:1455 1465. 36 37 Miki H, Setou M, Kaneshiro K, Hirokawa N. 2001. All kinesin superfamily protein, KIF, genes 38 in mouse and human. Proc Natl Acad Sci U S A 98:7004 7011. 39 Miller NH. 1999. Cause and natural history of adolescent idiopathic scoliosis. Orthop Clin North 40 Am 30:343 352, vii. 41 Nakagawa T, Tanaka Y, Matsuoka E, Kondo S, Okada Y, Noda Y, Kanai Y, Hirokawa N. 1997. 42 Identification and classification of 16 new kinesin superfamily (KIF) proteins in mouse 43 44 genome. Proc Natl Acad Sci U S A 94:9654 9659. 45 Obholzer N, Swinburne IA, Schwab E, Nechiporuk AV, Nicolson T, Megason SG. 2012. Rapid 46 positional cloning of zebrafish mutations by linkage and homozygosity mapping using 47 whole genome sequencing. Development 139:4280 4290. 48 Ouellet J, Odent T. 2013. Animal models for scoliosis research: state of the art, current concepts 49 50 and future perspective applications. Eur Spine J 22 Suppl 2:S81 95. 51 Sander JD, Cade L, Khayter C, Reyon D, Peterson RT, Joung JK, Yeh JR. 2011. Targeted gene 52 disruption in somatic zebrafish cells using engineered TALENs. Nat Biotechnol 29:697 53 698. 54 Schultz J, Milpetz F, Bork P, Ponting CP. 1998. SMART, a simple modular architecture research 55 tool: identification of signaling domains. Proc Natl Acad Sci U S A 95:5857 5864. 56 57 58 59 60 26
Page 27 of 40 Developmental Dynamics
1 2 3 Shiffman D, Chasman DI, Zee RY, Iakoubova OA, Louie JZ, Devlin JJ, Ridker PM. 2008a. A 4 5 kinesin family member 6 variant is associated with coronary heart disease in the 6 Women's Health Study. J Am Coll Cardiol 51:444 448. 7 Shiffman D, O'Meara ES, Bare LA, Rowland CM, Louie JZ, Arellano AR, Lumley T, Rice K, 8 Iakoubova O, Luke MM, Young BA, Malloy MJ, Kane JP, Ellis SG, Tracy RP, Devlin 9 JJ, Psaty BM. 2008b. Association of gene variants with incident myocardial infarction in 10 11 the Cardiovascular Health Study. Arterioscler Thromb Vasc Biol 28:173 179. 12 Shimoda N, Knapik EW, Ziniti J, Sim C, Yamada E, Kaplan S, Jackson D, de Sauvage F, Jacob 13 H, Fishman MC. 1999. Zebrafish genetic map with 2000 microsatellite markers. 14 Genomics 58:219 232. 15 Stubbs JL, Oishi I, Izpisua Belmonte JC, Kintner C. 2008. The forkhead protein Foxj1 specifies 16 node like cilia in Xenopus and zebrafish embryos. Nat Genet 40:1454 1460. 17 18 Su CY, Bay SN, Mariani LE, Hillman MJ, Caspary T. Temporal deletion of Arl13b reveals that a 19 mispatterned neural tube corrects cell fate over time. Development 139:4062 4071. 20 Thisse C, Thisse B. 2008. High resolution in situ hybridization to whole mount zebrafish 21 embryos. Nat Protoc 3:59 69. 22 Voz ML, Coppieters W, Manfroid I, Baudhuin A, Von Berg V, Charlier C, Meyer D, Driever W, 23 24 Martial JA, Peers B. 2012. Fast homozygosity mapping and identification of a zebrafish 25 ENU induced mutation by whole genome sequencing. PLoS One 7:e34671. 26 Walker MB, Kimmel CB. 2007. A two color acid free cartilage and bone stain for zebrafish 27 larvae. Biotech Histochem 82:23 28. 28 Westerfield M. 1993. The zebrafish book : a guide for the laboratory use of zebrafish 29 (Brachydanio rerio). Eugene, OR: M. Westerfield. 30 31 Yu X, Ng CP, Habacher H, Roy S. 2008. Foxj1 transcription factors are master regulators of the 32 motile ciliogenic program. Nat Genet 40:1445 1453. 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 27
Developmental Dynamics Page 28 of 40
1 2 3 Figure 1: Skolios mutants develop recessively-inherited curvature of the body axis 4 5 6 (A) Ventral curvature phenotypes observed in skolios mutant embryos at 3 dpf. (B) Relative 7 8 frequencies of ventral curvature phenotypes in WT and skolios embryos (3 dpf). (C) Dorsal 9 10 11 view of embryonic (4 dpf) and juvenile (17 dpf) zebrafish showing development of sagittal body 12 13 curvature in skolios mutants. (D) Severe body curvature in both the medial lateral and dorsal 14 15 ventral planes of an adult skolios mutant. (E) MicroCT imaging at approximately 50 dpf shows 16 17 18 marked curvature of the abdominal (rib vertebrae) and caudal (vertebrae posterior to ribs) spine 19 20 in skolios mutants. 21 22 23 24 25 Figure 2: Spinal curvature in skolios mutants occurs independent of major vertebral 26 27 abnormalities and is progressive through adult stages in males 28 29 (A) Method of measuring spinal curve in zebrafish using skeletal histomorphology. Lines were 30 31 32 drawn through the middle of the two vertebrae adjacent to the apex of the curve. The measured 33 34 angle from the intersection was subtracted from 180° to calculate the spinal curve. (B) Spinal 35 36 37 curves measured for female skolios mutants at 2 (N=11), 5 (N=9), 7 (N=5) and 18 (N=5) mpf 38 39 and male skolios mutants at 2 (N=10), 5 (N=8), 7 (N=5) and 18 (N=5) mpf. The average spinal 40 41 curve is shown for each time point. At 2 mpf, males and females are similarly affected; 42 43 44 however, by later stages, males continue to progress in severity. *P<0.05. (C) Skeletal 45 46 histomorphology of a 2 mpf female WT and a skolios mutant with a 35° spinal curve near the 47 48 transition from abdominal to caudal vertebrae that developed in the absence of vertebral fusions 49 50 51 or other major vertebral abnormalities. Box identifies region shown in A. (D) Zebrafish 52 53 between 2 7 mpf were stained with Alizarin red to visualize individual vertebrae. Staining 54 55 56 57 58 59 60 28
Page 29 of 40 Developmental Dynamics
1 2 3 shows vertebral fusions (arrows) identified in WT and skolios mutants. (E) The overall 4 5 6 frequency of vertebral fusions in skolios mutants is similar to WT. 7 8 9 10 11 12 13 Figure 3: Meiotic mapping and whole genome sequencing identifies a kif6 nonsense 14 15 mutation (kif6gw326) as candidate for skolios 16 17 18 (A) Summary of mapping experiments. Two map crosses identified a ~3 Mb region on 19 20 chromosome 17 harboring the causative genetic lesion for skolios. (B) Gene and protein 21 22 schematic with corresponding location of the kif6 nonsense mutation (kif6gw326). The C>A 23 24 25 mutation in the second exon of kif6 causes a premature stop early in the kif6 protein sequence. 26 27 Kif6 protein domains are drawn according to the simple modular architecture research tool 28 29 (SMART) (Schultz et al., 1998). The kinesin motor domain is shown, with grey bars indicating 30 31 gw326 32 coiled coil regions. (C) Sanger sequencing validation of kif6 (arrow) in skolios. 33 34 35 36 37 Figure 4: Transient knockdown of kif6 using morpholinos 38 39 WT zebrafish were injected with morpholinos targeting either the translation start site or a splice 40 41 site, at the 1 4 cell stage. A morpholino targeting the kif6 translation start site but containing a 5 42 43 44 base mismatch (mismatch MO) served as a negative control. Both translation start site and splice 45 46 site morphants recapitulated the early embryonic curvature of skolios. 47 48 49 50 51 Figure 5: Design and efficiency of kif6 TALENs 52 53 (A) Genomic sequence showing left and right TALENs that were designed in the second exon of 54 55 kif6 near the gw326 mutant allele. The TALEN pair flank a BccI restriction site. (B) BccI 56 57 58 59 60 29
Developmental Dynamics Page 30 of 40
1 2 3 restriction digest of PCR amplified DNA from WT embryos. Embryos 1 3 were not injected 4 5 6 with kif6 TALENs and BccI cleaves the PCR product completely. Embryos 4 13 were injected 7 8 with kif6 TALENs at the 1 4 cell stage and all embryos had varying levels of uncut product, 9 10 11 indicating a mutation was induced at the BccI restriction site. (C) Three mutations identified in 12 13 TALEN injected embryos. 14 15 16 17 18 Figure 6: TALEN-induced mutations in kif6 recapitulate the skolios phenotype 19 20 Zebrafish with TALEN induced mutations in kif6 (gw327, gw328, gw329) develop both 21 22 embryonic and adult body axis curvature, similar to kif6gw326 mutants. 23 24 25 26 27 Figure 7: RT-PCR expression of kif6 in WT embryos and WT adult tissues 28 29 (A) RT PCR in WT zebrafish embryos shows low levels of kif6 between 24 120 hpf. (B) RT 30 31 32 PCR of zebrafish tissues shows kif6 expression primarily in brain, intestine and reproductive 33 34 organs. 35 36 37 38 gw326 39 Figure 8: Cilia structure and function are normal in kif6 mutants 40 41 (A) Defects in left right asymmetry were evaluated by visualizing the position of the heart in 30 42 43 hpf embryos for WT (N=94) and kif6gw326 mutants (N=173). Normally, zebrafish hearts are 44 45 46 located to the left of the midline (right side when viewed ventrally) at 30 hpf. In zebrafish with 47 48 ambiguous heart positioning, hearts appear at the midline and to the right side (left side when 49 50 51 viewed ventrally) in zebrafish with situs inversus. Ambiguous and inversed orientations of the 52 gw326 53 heart were observed at similar frequencies in WT and kif6 embryos. (B) Otoliths were 54 55 observed laterally in in 48 72 hpf zebrafish embryos. Normal otolith numbers (two) and 56 57 gw326 58 abnormal otolith numbers (one or three) were quantified WT (N=371) and kif6 mutants 59 60 30
Page 31 of 40 Developmental Dynamics
1 2 3 (N=305). (C) In situ hybridization for southpaw (spw) to highlight LR patterning and no 4 5 6 tail (ntl) to highlight the midline shows no defect in left right patterning in kif6 sko/sko mutants 7 8 (n= 39 WT and 90 kif6 sko/sko mutants). (D) In situ hybridization for insulin (ins) to highlight 9 10 11 LR patterning in the pancreas shows no defect in the normally rightward place of the pancreas in 12 13 kif6 sko/sko mutants (n= 11 WT and 34 kif6 sko/sko mutants). (E) Whole mount confocal 14 15 immunostaining of 28 hpf WT and kif6gw326 mutant embryos shows normal appearance of cilial 16 17 gw326 18 in the central canal (arrows). (F) Live 48 hpf WT and kif6 embryos were injected with 5% 19 20 tetramethylrhodamine conjugated to 70,000 molecular weight dextran. Sixty minutes after 21 22 injection, the dye has migrated similar distances in skolios mutants compared to WT embryos. 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 31
Developmental Dynamics Page 32 of 40
1 2 3 4 5 6 Table 1: Identification of candidate gene for skolios phenotype 7 using whole genome sequencing 8 9 Sequencing and variant identification 10 11 101 bp paired end reads 98,289,069 12 13 Aligned paired end reads 65,990,507 14 15 ≥3X coverage 74% 16 17 Total genomic variants 8,043,651 18 19 Variant filtering 20 21 Total variants in 2.7 Mb mapped locus 18,941 22 and absent in unrelated zebrafish with similar 23 4,166 24 genetic background 25 26 and homozygous 3,156 27 and causing a nonsynonymous amino acid 28 20 29 change 30 and causing a nonsense mutation (gene) 1 (kif6) 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 32
Page 33 of 40 Developmental Dynamics
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Figure 1: Skolios mutants develop recessively-inherited curvature of the body axis 45 (A) Ventral curvature phenotypes observed in skolios mutant embryos at 3 dpf. (B) Relative frequencies of 46 ventral curvature phenotypes in WT and skolios embryos (3 dpf). (C) Dorsal view of embryonic (4 dpf) and 47 juvenile (17 dpf) zebrafish showing development of sagittal body curvature in skolios mutants. (D) Severe 48 body curvature in both the medial-lateral and dorsal-ventral planes of an adult skolios mutant. (E) MicroCT imaging at approximately 50 dpf shows marked curvature of the abdominal (rib vertebrae) and caudal 49 (vertebrae posterior to ribs) spine in skolios mutants. 50 127x142mm (300 x 300 DPI) 51 52 53 54 55 56 57 58 59 60 Developmental Dynamics Page 34 of 40
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 Figure 2: Spinal curvature in skolios mutants occurs independent of major vertebral abnormalities and is 37 progressive through adult stages in males 38 (A) Method of measuring spinal curve in zebrafish using skeletal histomorphology. Lines were drawn 39 through the middle of the two vertebrae adjacent to the apex of the curve. The measured angle from the 40 intersection was subtracted from 180° to calculate the spinal curve. (B) Spinal curves measured for female 41 skolios mutants at 2 (N=11), 5 (N=9), 7 (N=5) and 18 (N=5) mpf and male skolios mutants at 2 (N=10), 5 42 (N=8), 7 (N=5) and 18 (N=5) mpf. The average spinal curve is shown for each time point. At 2 mpf, males and females are similarly affected; however, by later stages, males continue to progress in 43 severity. *P<0.05. (C) Skeletal histomorphology of a 2 mpf female WT and a skolios mutant with a 35° 44 spinal curve near the transition from abdominal to caudal vertebrae that developed in the absence of 45 vertebral fusions or other major vertebral abnormalities. Box identifies region shown in A. (D) Zebrafish 46 between 2-7 mpf were stained with Alizarin red to visualize individual vertebrae. Staining shows vertebral 47 fusions (arrows) identified in WT and skolios mutants. (E) The overall frequency of vertebral fusions in 48 skolios mutants is similar to WT. 49 50 173x152mm (300 x 300 DPI) 51 52 53 54 55 56 57 58 59 60 Page 35 of 40 Developmental Dynamics
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Figure 3: Meiotic mapping and whole genome sequencing identifies a kif6 nonsense mutation (kif6gw326) as candidate for skolios 48 (A) Summary of mapping experiments. Two map-crosses identified a ~3 Mb region on chromosome 17 49 harboring the causative genetic lesion for skolios. (B) Gene and protein schematic with corresponding 50 location of the kif6 nonsense mutation (kif6gw326). The C>A mutation in the second exon of kif6 causes a 51 premature stop early in the kif6 protein sequence. Kif6 protein domains are drawn according to the simple 52 modular architecture research tool (SMART) (Schultz et al., 1998). The kinesin motor domain is shown, with 53 grey bars indicating coiled-coil regions. (C) Sanger sequencing validation of kif6gw326 (arrow) in skolios.
54 69x114mm (300 x 300 DPI) 55 56 57 58 59 60 Developmental Dynamics Page 36 of 40
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Figure 4 63x76mm (300 x 300 DPI) 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 37 of 40 Developmental Dynamics
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Figure 5 31 111x76mm (300 x 300 DPI) 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Developmental Dynamics Page 38 of 40
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Figure 6 34 121x95mm (300 x 300 DPI) 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 39 of 40 Developmental Dynamics
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Figure 7 50x63mm (300 x 300 DPI) 48 49 50 51 52 53 54 55 56 57 58 59 60 Developmental Dynamics Page 40 of 40
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 For Peer Review 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Figure 8 45 198x224mm (150 x 150 DPI) 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60