Universidade Nova De Lisboa Instituto De Higiene E Medicina Tropical
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Seq2pathway Vignette
seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway. -
Master Biomedizin 2018 1) UCSC & Uniprot 2) Homology 3) MSA 4) Phylogeny
Master Biomedizin 2018 1) UCSC & UniProt 2) Homology 3) MSA 4) Phylogeny Pablo Mier 1 [email protected] Genomics *Images from: Wikipedia 1 a. Get the fasta sequence of the human (Homo sapiens) protein P53 from UniProt (https://www.uniprot.org/). Which one of all the isoforms should you download? P04637 b. Find the P53 protein from mouse (Mus musculus). As you see, there is more than one entry for mouse. Which UniProt entry should you select? P02340 c. BLAT the human P53 using “hg38” as database (in UCSC, http://genome.ucsc.edu/cgi-bin/hgBlat), and answer: How many amino acids has the query sequence? 393 aa And how many nucleotides? 1179 nt Is it a perfect alignment? No Which is the genomic locus of the target? Chr17 7669612-7676594 d. Visualize and navigate through the P53 genome region, and answer: Which genes are around? ATP1B2 and WRAP53 How many exons does it have? 9 exons e. BLAT the mouse P53 against the human genome “hg38”. What do you observe? The result is worse (85%) Human Mouse (Homo sapiens) (Mus musculus) Pablo Mier 2 [email protected] Genomics *Images from: UniProt 1 a. P04637 (P53_HUMAN). The canonical. b. P02340 (P53_MOUSE). Pablo Mier 3 [email protected] Genomics *Images from: UCSC 1 c. 393 amino acids Not a perfect alignment chr17 393*3 = 1179 nucleotides (“lpennvl”) 7669612-7676594 d. ATP1B2 and WRAP53. 9 exons (9 blocks). 9 8 7 6 5 4 3 2 1 e. The result is worse (85%). Pablo Mier 4 [email protected] UniProt database 2 a. -
Supplementary Materials
Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine -
Product Sheet CA1009
API5 Antibody Applications: WB, IHC Detected MW: 51 kDa Cat. No. CA1009 Species & Reactivity: Human, Rat Isotype: Rabbit IgG BACKGROUND APPLICATIONS The apoptosis inhibitor-5 [API5; antiapoptosis Application: *Dilution: clone 11 (AAC-11); fibroblast growth factor-2 WB 1:1000 (FGF2)-interacting factor (FIF)] is a 504-aa IP n/d nuclear protein whose expression has been shown IHC 1:50-200 to prevent apoptosis after growth factor ICC n/d deprivation. It was shown that its antiapoptotic action seems to be mediated, at least in part, by FACS n/d *Optimal dilutions must be determined by end user. the suppression of the transcription factor E2F1- induced apoptosis. Moreover, it was also reported that API5 interacts with, and negatively regulates Acinus, a protein involved in apoptotic DNA QUALITY CONTROL DATA fragmentation. API5 can form homo-oligomers, through a leucine-zipper (LZ) motif, and oligomerization-deficient mutants of AAC-11 can no longer inhibit apoptosis nor interact with Acinus.1 The API5gene has been shown to be highly expressed in multiple cancer cell lines as well as in some metastatic lymph node tissues and in B-cell chronic lymphoid leukemia. API5 expression seems to confer a poor outcome in subgroups of patients with non-small cell lung carcinoma, whereas its depletion seems to be tumor cell lethal under condition of low-serum stress. Interestingly, API5 overexpression has been reported to promote both cervical cancer cells growth and invasiveness. Combined, these observations implicate API5as a putative metastatic oncogene and suggest that API5 could constitute a therapeutic target in cancer.2 References: 1. -
API5 Confers Tumoral Immune Escape Through FGF2- Dependent Cell Survival Pathway
Published OnlineFirst April 25, 2014; DOI: 10.1158/0008-5472.CAN-13-3225 Cancer Therapeutics, Targets, and Chemical Biology Research API5 Confers Tumoral Immune Escape through FGF2- Dependent Cell Survival Pathway Kyung Hee Noh1, Seok-Ho Kim1,3, Jin Hee Kim1, Kwon-Ho Song1, Young-Ho Lee1, Tae Heung Kang4, Hee Dong Han4,6, Anil K. Sood5,6, Joanne Ng2, Kwanghee Kim2,7,9, Chung Hee Sonn2, Vinay Kumar8, Cassian Yee7,9, Kyung-Mi Lee2, and Tae Woo Kim1,2 Abstract Identifying immune escape mechanisms used by tumors may define strategies to sensitize them to immu- notherapies to which they are otherwise resistant. In this study, we show that the antiapoptotic gene API5 acts as an immune escape gene in tumors by rendering them resistant to apoptosis triggered by tumor antigen-specificT cells. Its RNAi-mediated silencing in tumor cells expressing high levels of API5 restored antigen-specific immune sensitivity. Conversely, introducing API5 into API5low cells conferred immune resistance. Mechanistic investiga- tions revealed that API5 mediated resistance by upregulating FGF2 signaling through a FGFR1/PKCd/ERK effector pathway that triggered degradation of the proapoptotic molecule BIM. Blockade of FGF2, PKCd, or ERK phenocopied the effect of API5 silencing in tumor cells expressing high levels of API5 to either murine or human antigen-specific T cells. Our results identify a novel mechanism of immune escape that can be inhibited to potentiate the efficacy of targeted active immunotherapies. Cancer Res; 74(13); 3556–66. Ó2014 AACR. Introduction of immunosuppressive cytokines such as TGFb and IL10 and – Despite the presence of a competent immune system, tumor the accumulation of regulatory cells (1 4) can exacerbate the cells may elude detection from host immune surveillance immune inhibitory milieu, whereas intrinsic genetic instability through a process of cancer immune editing. -
Transcriptome Analysis of Signaling Pathways of Human Peritoneal
Liu et al. BMC Nephrology (2019) 20:181 https://doi.org/10.1186/s12882-019-1376-0 RESEARCH ARTICLE Open Access Transcriptome analysis of signaling pathways of human peritoneal mesothelial cells in response to different osmotic agents in a peritoneal dialysis solution Bin Liu1,2†, Shijian Feng1,3†, Ghida Dairi1,4, Qiunong Guan1, Irina Chafeeva5, Hao Wang2, Richard Liggins6, Gerald da Roza7, Jayachandran N. Kizhakkedathu5,8 and Caigan Du1,9* Abstract Background: Glucose is a primary osmotic agent in peritoneal dialysis (PD) solutions, but its long-term use causes structural alteration of the peritoneal membrane (PM). Hyperbranched polyglycerol (HPG) is a promising alternative to glucose. This study was designed to compare the cellular responses of human peritoneal mesothelial cells (HPMCs) to these two different osmotic agents in a hypertonic solution using transcriptome analysis. Methods: Cultured HPMCs were repeatedly exposed to HPG-based or Physioneal 40 (PYS, glucose 2.27%) hypertonic solutions. Transcriptome datasets were produced using Agilent SurePrint G3 Human GE 8 × 60 microarray. Cellular signaling pathways were examined by Ingenuity Pathway Analysis (IPA). Protein expression was examined by flow cytometry analysis and Western blotting. Results: The HPG-containing solution was better tolerated compared with PYS, with less cell death and disruption of cell transcriptome. The levels of cell death in HPG- or PYS- exposed cells were positively correlated with the number of affected transcripts (HPG: 128 at day 3, 0 at day 7; PYS: 1799 at day 3, 212 at day 7). In addition to more affected “biosynthesis” and “cellular stress and death” pathways by PYS, both HPG and PYS commonly affected “sulfate biosynthesis”, “unfolded protein response”, “apoptosis signaling” and “NRF2-mediated oxidative stress response” pathways at day 3. -
Apoptosis Inhibitor 5 (API5) (NM 006595) Human Untagged Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC108575 Apoptosis inhibitor 5 (API5) (NM_006595) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Apoptosis inhibitor 5 (API5) (NM_006595) Human Untagged Clone Tag: Tag Free Symbol: API5 Synonyms: AAC-11; AAC11 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 Apoptosis inhibitor 5 (API5) (NM_006595) Human Untagged Clone – SC108575 Fully Sequenced ORF: >OriGene ORF within SC108575 sequence for NM_006595 edited (data generated by NextGen Sequencing) ATGCCGACAGTAGAGGAGCTTTACCGCAATTATGGCATCCTGGCCGATGCCACGGAGCAA GTGGGCCAGCATAAAGATGCCTATCAAGTGATATTGGATGGTGTGAAAGGTGGTACTAAG GAAAAGCGATTAGCAGCTCAATTTATTCCGAAATTCTTTAAGCATTTTCCAGAATTGGCT GATTCTGCTATCAATGCACAGTTAGACCTCTGTGAGGATGAAGATGTATCTATTCGACGT CAAGCAATTAAAGAACTGCCTCAATTTGCCACTGGAGAAAATCTTCCTCGAGTGGCAGAT ATACTAACGCAACTTTTGCAGACAGATGACTCTGCAGAATTTAACCTAGTGAACAATGCC CTATTAAGTATATTTAAAATGGATGCAAAAGGGACTTTAGGTGGGTTGTTCAGCCAAATA CTTCAAGGAGAGGACATTGTTAGAGAACGAGCAATTAAATTCCTTTCTACAAAACTTAAG ACTTTACCAGATGAAGTCTTAACAAAGGAAGTGGAAGAGCTTATACTAACTGAATCCAAA AAGGTCCTAGAAGATGTGACTGGTGAAGAATTTGTTCTATTTATGAAGATACTGTCTGGG TTAAAAAGCTTACAGACAGTGAGTGGAAGACAGCAACTTGTAGAGTTGGTGGCTGAACAG -
Mir-11 Limits the Proapoptotic Function of Its Host Gene, De2f1
Downloaded from genesdev.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press mir-11 limits the proapoptotic function of its host gene, dE2f1 Mary Truscott,1 Abul B.M.M.K. Islam,2 Nu´ ria Lo´ pez-Bigas,2 and Maxim V. Frolov1,3 1Department of Biochemistry and Molecular Genetics, University of Illinois at Chicago, Chicago, Illinois 60607, USA; 2Department of Experimental and Health Sciences, Barcelona Biomedical Research Park, Universitat Pompeu Fabra (UPF), Barcelona 08003, Spain The E2F family of transcription factors regulates the expression of both genes associated with cell proliferation and genes that regulate cell death. The net outcome is dependent on cellular context and tissue environment. The mir- 11 gene is located in the last intron of the Drosophila E2F1 homolog gene dE2f1, and its expression parallels that of dE2f1. Here, we investigated the role of miR-11 and found that miR-11 specifically modulated the proapoptotic function of its host gene, dE2f1.Amir-11 mutant was highly sensitive to dE2F1-dependent, DNA damage-induced apoptosis. Consistently, coexpression of miR-11 in transgenic animals suppressed dE2F1-induced apoptosis in multiple tissues, while exerting no effect on dE2F1-driven cell proliferation. Importantly, miR-11 repressed the expression of the proapoptotic genes reaper (rpr) and head involution defective (hid), which are directly regulated by dE2F1 upon DNA damage. In addition to rpr and hid, we identified a novel set of cell death genes that was also directly regulated by dE2F1 and miR-11. Thus, our data support a model in which the coexpression of miR-11 limits the proapoptotic function of its host gene, dE2f1, upon DNA damage by directly modulating a dE2F1- dependent apoptotic transcriptional program. -
Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase
BASIC RESEARCH www.jasn.org Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase † ‡ Yifei Zhong,* Edward Y. Chen, § Ruijie Liu,*¶ Peter Y. Chuang,* Sandeep K. Mallipattu,* ‡ ‡ † | ‡ Christopher M. Tan, § Neil R. Clark, § Yueyi Deng, Paul E. Klotman, Avi Ma’ayan, § and ‡ John Cijiang He* ¶ *Department of Medicine, Mount Sinai School of Medicine, New York, New York; †Department of Nephrology, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai, China; ‡Department of Pharmacology and Systems Therapeutics and §Systems Biology Center New York, Mount Sinai School of Medicine, New York, New York; |Baylor College of Medicine, Houston, Texas; and ¶Renal Section, James J. Peters Veterans Affairs Medical Center, New York, New York ABSTRACT The Connectivity Map database contains microarray signatures of gene expression derived from approximately 6000 experiments that examined the effects of approximately 1300 single drugs on several human cancer cell lines. We used these data to prioritize pairs of drugs expected to reverse the changes in gene expression observed in the kidneys of a mouse model of HIV-associated nephropathy (Tg26 mice). We predicted that the combination of an angiotensin-converting enzyme (ACE) inhibitor and a histone deacetylase inhibitor would maximally reverse the disease-associated expression of genes in the kidneys of these mice. Testing the combination of these inhibitors in Tg26 mice revealed an additive renoprotective effect, as suggested by reduction of proteinuria, improvement of renal function, and attenuation of kidney injury. Furthermore, we observed the predicted treatment-associated changes in the expression of selected genes and pathway components. In summary, these data suggest that the combination of an ACE inhibitor and a histone deacetylase inhibitor could have therapeutic potential for various kidney diseases. -
A Systematic Genome-Wide Association Analysis for Inflammatory Bowel Diseases (IBD)
A systematic genome-wide association analysis for inflammatory bowel diseases (IBD) Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Christian-Albrechts-Universität zu Kiel vorgelegt von Dipl.-Biol. ANDRE FRANKE Kiel, im September 2006 Referent: Prof. Dr. Dr. h.c. Thomas C.G. Bosch Koreferent: Prof. Dr. Stefan Schreiber Tag der mündlichen Prüfung: Zum Druck genehmigt: der Dekan “After great pain a formal feeling comes.” (Emily Dickinson) To my wife and family ii Table of contents Abbreviations, units, symbols, and acronyms . vi List of figures . xiii List of tables . .xv 1 Introduction . .1 1.1 Inflammatory bowel diseases, a complex disorder . 1 1.1.1 Pathogenesis and pathophysiology. .2 1.2 Genetics basis of inflammatory bowel diseases . 6 1.2.1 Genetic evidence from family and twin studies . .6 1.2.2 Single nucleotide polymorphisms (SNPs) . .7 1.2.3 Linkage studies . .8 1.2.4 Association studies . 10 1.2.5 Known susceptibility genes . 12 1.2.5.1 CARD15. .12 1.2.5.2 CARD4. .15 1.2.5.3 TNF-α . .15 1.2.5.4 5q31 haplotype . .16 1.2.5.5 DLG5 . .17 1.2.5.6 TNFSF15 . .18 1.2.5.7 HLA/MHC on chromosome 6 . .19 1.2.5.8 Other proposed IBD susceptibility genes . .20 1.2.6 Animal models. 21 1.3 Aims of this study . 23 2 Methods . .24 2.1 Laboratory information management system (LIMS) . 24 2.2 Recruitment. 25 2.3 Sample preparation. 27 2.3.1 DNA extraction from blood. 27 2.3.2 Plate design . -
Mechanisms of Resistance to Chemotherapy in Breast Cancer and Possible Targets in Drug Delivery Systems
pharmaceutics Review Mechanisms of Resistance to Chemotherapy in Breast Cancer and Possible Targets in Drug Delivery Systems Patrícia de Faria Lainetti 1, Antonio Fernando Leis-Filho 1, Renee Laufer-Amorim 2, Alexandre Battazza 3 and Carlos Eduardo Fonseca-Alves 1,4,* 1 Department of Veterinary Surgery and Animal Reproduction, Sao Paulo State University–UNESP, Botucatu-SP 18618-681, Brazil; [email protected] (P.d.F.L.); [email protected] (A.F.L.-F.) 2 Department of Veterinary Clinic, Sao Paulo State University–UNESP, Botucatu-SP 18618-681, Brazil; [email protected] 3 Department of Pathology, Botucatu Medical School, São Paulo State University–UNESP, Botucatu-SP 18618-681, Brazil; [email protected] 4 Institute of Health Sciences, Paulista University–UNIP, Bauru-SP 17048-290, Brazil * Correspondence: [email protected]; Tel.: +55-14-38802076 Received: 10 November 2020; Accepted: 4 December 2020; Published: 9 December 2020 Abstract: Breast cancer (BC) is one of the most important cancers worldwide, and usually, chemotherapy can be used in an integrative approach. Usually, chemotherapy treatment is performed in association with surgery, radiation or hormone therapy, providing an increased outcome to patients. However, tumors can develop resistance to different drugs, progressing for a more aggressive phenotype. In this scenario, the use of nanocarriers could help to defeat tumor cell resistance, providing a new therapeutic perspective for patients. Thus, this systematic review aims to bring the molecular mechanisms involved in BC chemoresistance and extract from the previous literature information regarding the use of nanoparticles as potential treatment for chemoresistant breast cancer. -
Identification of Neoepitopes Recognized by Tumor-Infiltrating Lymphocytes (Tils) from Patients with Glioma
www.oncotarget.com Oncotarget, 2018, Vol. 9, (No. 28), pp: 19469-19480 Research Paper: Immunology Identification of neoepitopes recognized by tumor-infiltrating lymphocytes (TILs) from patients with glioma Davide Valentini1, Martin Rao2, Qingda Meng2, Anna von Landenberg2, Jiri Bartek Jr3,4, Georges Sinclair4, Georgia Paraschoudi2, Elke Jäger5, Inti Harvey-Peredo4, Ernest Dodoo4 and Markus Maeurer1,2,5 1Centre for Allogeneic Stem Cell Transplantation (CAST), Karolinska University Hospital Huddinge, Stockholm, Sweden 2Therapeutic Immunology Unit (TIM), Department of Laboratory Medicine (LABMED), Karolinska Institutet, Stockholm, Sweden 3Department of Neurosurgery, Copenhagen University Hospital Rigshospitalet, Copenhagen, Denmark 4Department of Neurosurgery, Karolinska University Hospital, Stockholm, Sweden 5 Krankenhaus Nordwest, Division of Oncology and Hematology, Frankfurt, Germany Correspondence to: Markus Maeurer, email: [email protected] Keywords: tumor-infiltrating lymphocytes; immunotherapy; neoepitopes; glioblastoma; interferon gamma; Immunology Received: September 11, 2017 Accepted: February 24, 2018 Published: April 13, 2018 Copyright: Valentini et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Neoepitope-specific T-cell responses have been shown to induce durable clinical responses in patients with advanced cancers. We explored the recognition patterns of tumor-infiltrating T lymphocytes (TILs) from patients with glioblastoma multiforme (GBM), the most fatal form of tumors of the central nervous system. Whole-genome sequencing was used for generating DNA sequences representing the entire spectrum of ‘private’ somatic mutations in GBM tumors from five patients, followed by 15-mer peptide prediction and subsequent peptide synthesis.