De¢Cient Strains of the Methylotrophic Yeast Ogataea Minuta

RESEARCH ARTICLE Antibody expression in protease-de¢cient strains ofthe methylotrophic yeast Ogataea minuta Kousuke Kuroda1,2, Yoshinori Kitagawa1, Kazuo Kobayashi1, Haruhiko Tsumura1, Toshihiro Komeda3, Eiji Mori4, Kazuhiro Motoki4, Shiro Kataoka4, Yasunori Chiba5 & Yoshifumi Jigami2,5

1Kirin Brewery Co. Ltd, CMC R&D Laboratories, Gunma, Japan; 2Graduate School of Life and Environmental Science, University of Tsukuba, Ibaraki, Japan; 3Kirin Brewery Co. Ltd, Central Laboratories for Frontier Technology, Kanagawa, Japan; 4Kirin Brewery Co. Ltd, Pharmaceutical Research Laboratories, Gunma, Japan; and 5National Institute of Advanced Industrial Science and Technology (AIST), Ibaraki, Japan Downloaded from https://academic.oup.com/femsyr/article/7/8/1307/549124 by guest on 27 September 2021

Correspondence: Yoshifumi Jigami, National Abstract Institute of Advanced Industrial Science and Technology (AIST), Ibaraki 305-8566, Japan. When human antibody genes were expressed in the methylotrophic yeast Ogataea Tel.: 181 29 861 6160; fax: 181 29 861 minuta, the secreted antibody became partially degraded. To suppress the 6161; e-mail: [email protected] degradation, a vacuolar protease-deficient strain was constructed and its antibody production was evaluated. Although antibody productivity was improved in the Received 28 February 2007; revised 28 May vacuolar protease-deficient strain, the secreted antibody still became partially 2007; accepted 16 June 2007. degraded. Peptide sequencing revealed that the cleavage occurred in the CH1 First published online 23 August 2007. region of the heavy chain, implying that the cleavage was caused by an aspartic protease, Yps1p. To inhibit this cleavage, Yps1p-deficient strains were constructed DOI:10.1111/j.1567-1364.2007.00291.x and their antibody production was evaluated. As a result, the partial degradation of the antibody was suppressed in the O. minuta multiple-protease-deficient strains. Editor: Hyun Kang

Keywords Ogataea minuta ; antibody; protease; YPS1 ; PEP4 ; PRB1 .

body-dependent cellular cytotoxicity (ADCC) activity are Introduction expected to be produced by yeast that does not have Owing to advances in the technology available to obtain fucosyltransferase activity, because the removal of fucose chimeric antibodies and completely human antibodies from N-linked sugar chains of the antibody leads to high (Ishida et al., 1998), monoclonal antibodies for pharmaceu- ADCC activity (Shinkawa et al., 2003; Kanda et al., 2006). In ticals have gained a great deal of attention. In the mass fact, some researchers have already confirmed that antibo- production of therapeutic antibodies, mammalian cells have dies derived from engineered yeast have a higher affinity for been adopted as conventional hosts, because antibodies the Fcg receptor than those from the native yeast (Li et al., derived from mammalian cells have some modifications, 2006). such as glycosylation, that are similar to those in antibodies Regarding protein expression in yeast, one study achieved from humans. However, the production of these antibodies a secretion yield of 1.2 g L1 in the production of ‘scFv’, using mammalian cells poses potential problems, due to the which is composed of the variable regions of a light chain, cultivation cost. To overcome these problems, alternative VL, and a heavy chain, VH, combined through a flexible production systems using other hosts, such as transgenic linker peptide (Freyre et al., 2000). In addition, ‘Fab’ is also plants, animals, and microorganisms, have been under successfully expressed in yeast that contains both the heavy investigation (Bardor et al., 2003; Ward et al., 2004). chain domains, VH1-CH1, and the entire light chain, VL- In these trials, methylotrophic yeasts have been recog- CL, connected via disulfide bonds (Joosten et al., 2003; nized as an attractive host for the production of recombi- Gasser et al., 2006). Furthermore, engineered yeast to which nant glycoproteins, including antibodies, because they have chaperones, such as disulfide isomerase, were introduced the potential for modifications, such as sugar chain addi- showed increased secretion titers of the antibody fragments tions after protein synthesis, and also have a high ability to (Shusta et al., 1998; Gasser et al., 2006). However, antibody secrete protein. Moreover, antibodies that have higher anti- fragments are not always secreted in large quantities, and

Table 1. Ogataea minuta strains used in this study Strain Genotype Harboring plasmids Source TK3-A Doch1Dura3 Kuroda et al. (2006) TK5-3 Doch1Dura3Dade1 This study TK5-3-L Doch1Dura3Dade1 sL/pOMGPA1DSp This study TK5-3-LH Doch1Dura3Dade1 sL/pOMGPA1DSp, sH/pOMGPU1DSp This study TK9 Doch1Dpep4Dprb1Dura3Dade1 This study TK9-L Doch1Dpep4Dprb1Dura3Dade1 sL/pOMGPA1DSp This study TK9-LH Doch1Dpep4Dprb1Dura3Dade1 sL/pOMGPA1DSp, sH/pOMGPU1DSp This study YK4 Doch1Dpep4Dprb1Dyps1Dura3Dade1 This study YK4-L Doch1Dpep4Dprb1Dyps1Dura3Dade1 sL/pOMGPA1DSp This study

YK4-LH Doch1Dpep4Dprb1Dyps1Dura3Dade1 sL/pOMGPA1DSp, sH/pOMGPU1DSp This study Downloaded from https://academic.oup.com/femsyr/article/7/8/1307/549124 by guest on 27 September 2021 YK6 Doch1Dyps1Dura3Dade1 This study YK6-L Doch1Dyps1Dura3Dade1 sL/pOMGPA1DSp This study YK6-LH Doch1Dyps1Dura3Dade1 sL/pOMGPA1DSp, sH/pOMGPU1DSp This study

their secretion titers vary depending on the amino acid apparatus. The Dyps1 strain is also thought to be useful for sequences. protein production in yeast. There are several other reports on full-length antibody Previously, we constructed the yeast Ogataea minuta production in yeast (Wood et al., 1985; Horwitz et al., 1988; host–vector system and achieved success in breeding the Li et al., 2006), although the productivity is low or not yeast producing a Man5GlcNAc2 high-mannose-type sugar mentioned. Moreover, no studies have succeeded in improv- chain as a prototype of a humanized sugar chain by ing full-length antibody productivity in yeast. To develop a disruption of the OmOCH1 gene and the introduction of substitute for mammalian cells for conventional antibody the a-1,2-mannosidase gene (Kuroda et al., 2006). In the production, it is necessary to manipulate yeast genetically present report, we show the usefulness of protease-deficient for the effective production of full-length antibodies. strains in the production of antibodies in the yeast In heterologous protein production in yeast, the target O. minuta. products are often degraded by proteases. Some intracellular proteases degrade not only intracellular proteins but also extracellular proteins during the cultivation or the early Materials and methods stage of purification, due to cell lysis. The contamination Yeast strains and media with proteolytic products complicates the purification process and reduces the yield and specific activities of the The strains used in this study are listed in Table 1. The yeasts product. Therefore, one effective approach is to construct were cultured at 27 1C in the following media: YPG medium both intracellular and extracellular protease-deficient strains (1% Bacto yeast extract, 2% Bacto peptone, 2% glycerol); SG for protein production. In yeast, such as Saccharomyces medium [0.67% yeast nitrogen base without amino acids cerevisiae, the main intracellular proteolytic activities are (YNB), 1% glycerol]; BYPG medium (2% Bacto peptone, attributed to vacuolar proteases, proteinases A and B, 1% Bacto yeast extract, 1.34% YNB, 0.1 M phosphate buffer, encoded by the PEP4 and PRB1 genes, respectively, which pH 6.0, 1% glycerol); and 2 BYPG medium (4% Bacto are known to activate themselves and other proteases, such peptone, 2% Bacto yeast extract, 1.34% YNB, 0.1 M phos- as carboxypeptidase Y (Van Den Hazel et al., 1996). As the phate buffer, pH 6.0, 4% glycerol). Transformants were Dpep4Dprb1 strain has lower vacuolar protease activity than selected on the SG medium plate as auxotrophic markers. the wild-type strain, a higher yield of target proteins was obtained (Gleeson et al., 1998; Komeda et al., 2002). DNA methods On the other hand, some reports have revealed that the Dyps1 strain is effective in the production of secretory Escherichia coli DH5a cells were used for the subcloning of proteins in S. cerevisiae (Copley et al., 1998; Kang et al., the plasmids. The plasmids were prepared with a QIAprep 1998; Kerry-Williams et al., 1998; Bourbonnais et al., 2000). Spin Miniprep Kit (Qiagen) from E. coli DH5a cells. DNA The Yps1p (yapsin 1) encoded by the YPS1 gene is an fragments from agarose gel were recovered with the QIA- aspartic protease that localizes at the plasma membrane quick Gel Extraction Kit (Qiagen). The DNA fragments and has overlapping substrate specificity with intracellular amplified by PCR were subjected to DNA sequence analysis endoprotease Kex2p, which is localized at the late Golgi using a DNA sequencer (Model 3700, ABI). The O. minuta

Table 2. DNA primers used to make DNA probes for molecular cloning and to select the knockout strains of ADE1 and protease genes DNA primer Nucleotide sequence Amino acid sequence ADE1 gene. Referred genes: S. cerevisiae (GenBank accession number M61209), Candida maltosa (M58322) PAD5 50-TTYGTNGCNACNGAYMGNATHWSNGCNTAYGAYGTNATHATG-30 FVATDRISAYDVIM PAD3 50-GTNARCCARTCNCKNARRAAYTGYTTRTCRTANSWRTCYTG-30 QDSYDKQFLRDWLT (complementary) PEP4 gene. Referred genes: S. cerevisiae (M13358), Pichia angusta (U67173) PPA5 50-ACNAAYTAYYTNAAYGCNCARTA-30 TNYLNAQY PPA3 50-AAYTTNACYTCCCARTANGCYTT-30 KAYWEVKF (complementary) PRB1 gene. Referred genes: S. cerevisiae (M18097), Kluyveromyces lactis (A75534)

PPB5 50-GAYBKNAAYGGNCAYGGNACNCAYTGYKCNGG-30 DG(L)NGHGTHCAG Downloaded from https://academic.oup.com/femsyr/article/7/8/1307/549124 by guest on 27 September 2021 PPB3 50-CCNRCNAYRTGNGGNWSNGCCATNWSNGTNCC-30 GTSMAS(T)PHV(I)A(V)G (complementary) YPS1 gene. Referred genes: S. cerevisiae (NP_013221), Candida albicans (AAF66711) PYP5 50-GAYACNGGHTCNTCNGAYYTNTGG-30 DTGSSDLW PYP3 50-TTYGGHGCNATYGAYCAYGCNAA-30 FGAIDHAK (complementary)

genome was prepared according to GENtorukun (Takara OmADE1 gene (submitted to DDBJ/GenBank/EMBL under Bio). accession number AB236163) from the genomic library. The 0.7-kb DNA fragment was amplified by PCR using plasmid Cloning of OmADE1,OmPEP4 ,OmPRB1 and pOMAD1 and the following primers: Dad1-5, 50- OmYPS1 genes AAAAAGCGGCCGCTCCCGGTGTCCCGCAGAAATCTTTA TGCGTAGTCTTG-30;andDad1-3,50-CCCCCAGATCTTT In order to generate a host strain containing a suitable TTTTTTAAGCTTGTTGTACTCCTTCCATGCACTTCCGGT selection marker to express the antibody genes, OmADE1,a GATG-30. The 1.0-kb DNA fragment was amplified by PCR homolog of the S. cerevisiae ADE1 gene encoding phosphor- using plasmid pOMAD1 and the following primers: Dad2-5, ibosyl-amino-imidazolesuccinocarbozamide synthetase, was 50-TTTTCACCCCGTCAAAGATCTCTGAACAAGGCGAACA cloned to disrupt the adenine auxotrophic marker. Also, CGACGAAAACATTTCCCCCGAG-30;andDad2-3,50-TTT OmPEP4,OmPRB1 and OmYPS1 were cloned to construct TTGGGCCCACCTGGGTGAAGATTTGCCAGATCAAGTTC protease-deficient strains. Ogataea minuta TK3-A cells TCC-30. Plasmid pDOMAD1 for disruption of the OmADE1 (Doch1Dura3) were used as a source of genomic DNA. gene was obtained by the introduction of the NotI–HindIII- Degenerated primers for the amplification of a part of the digested 0.7-kb amplified fragment, the ApaI–BglII-digested OmADE1,OmPEP4,OmPRB1 and OmYPS1 genes by PCR 1.0-kb amplified fragment and the HindIII–BglII-digested were synthesized on the basis of a conserved amino acid rURA3 fragment from pROMU1 (Kuroda et al., 2006) into sequence among the various yeast strains, as shown in Table pBluescript II SK –. 2. Amplified DNA fragments were cloned into pCR2.1 Plasmid pOMPA1, derived from pUC18 (Takara Bio), TOPO (Invitrogen). The obtained DNA fragments were contained a 5.9-kb BamHI fragment including the OmPEP4 digoxigenin (DIG)-labeled by DIG high prime (Roche). To gene (submitted to DDBJ/GenBank/EMBL under accession obtain a DNA fragment including the whole target genes, the number AB236164) from the genomic library. Plasmid genomic DNA of O. minuta was digested by various restric- pOMPA2 was obtained by removing both the ClaI and SacI tion enzymes, and the digested genomic DNA fragment was fragments from plasmid pOMPA1. Plasmid pDOMPA1, for inserted into a cloning vector. The resultant genomic library disruption of the OmPEP4 gene, was obtained by insertion was introduced into E. coli DH5acells. The objective DNA of the rURA3 fragment from pROMU1 into the SmaI and fragment was obtained by screening the positive clones in XbaI sites of plasmid pOMPA2. colony hybridization with the labeled DNA probe. Plasmid pOMPB1, derived from pUC18, contained a 5.7- kb BamHI fragment including the OmPRB1 gene (sub- Construction of vectors for the disruption of mitted to DDBJ/GenBank/EMBL under accession number OmADE1 and protease genes and for antibody AB236165) from the genomic library. Plasmid pOMPB2 was expression obtained by the insertion of the BamHI fragment containing The plasmid pOMAD1, derived from pBluescript II SK – , the OmPRB1 gene into pTV19 (Takara Bio), in which the contained a 5.0-kb HindIII–BamHI fragment including the SphI site was disrupted. Plasmid pDOMPB1, for disruption

FEMS Yeast Res 7 (2007) 1307–1316 c 2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved 1310 K. Kuroda et al. of the OmPRB1 gene, was obtained by insertion of the method described previously (Kuroda et al., 2006). The rURA3 fragment from pROMU1 into the ClaI and SphI sites obtained strain was designated O. minuta TK5-3 (Doc- of plasmid pOMPB2. h1Dura3Dade1). Plasmid pOMYP1, derived from pUC118 (Takara Bio), contained a 3.7-kb EcoRI fragment including the OmYPS1 Procedure for O. minuta protease gene gene (submitted to DDBJ/GenBank/EMBL under accession disruptions number AB236166) from the genomic library. Plasmid pOMYP2 was obtained by insertion of the EcoRI fragment The SacI–ClaI-digested plasmid pDOMPA1 and the Bam- containing the OmYPS1 gene into pBluescript KS1(Strata- HI-digested plasmid pDOMPB1 were introduced by the gene) and by conversion of the BsiWI site into the EcoT22I electric pulse method to generate an O. minuta vacuolar protease-deﬁcient strain. Regeneration of the OmURA3

site. Plasmid pDOMYP1 for disruption of the OmYPS1 gene Downloaded from https://academic.oup.com/femsyr/article/7/8/1307/549124 by guest on 27 September 2021 was obtained by insertion of the rURA3 fragment from marker was carried out according to the method described pROMU1 into the EcoT22I site of plasmid pOMYP2. above. The OmPEP4 gene disruption was confirmed by PCR 0 Plasmid pOMEGPU1 DSp was constructed from plasmid using the following primers: DPA5, 5 -ACACAACT 0 0 pOMEGPU1 (Kuroda et al., 2006) by disruption of the SpeI CCCCTCTCACGAACTAC-3 ; and DPA3, 5 -CACTAGCGG 0 site and conversion of XhoI and EcoT22I into the SpeI and GAACTACCACGAGTC-3 .OmPRB1 disruption was BamHI sites, respectively. Plasmid pOMAD2 was obtained confirmed by PCR using the following primers: DPB5-2, 0 0 from plasmid pOMAD1 by conversion of the SmaI site into 5 -ACTCTAGCCGACTCTCTATCCTGCG-3 ; and DPB3, 0 0 the ApaI site, the EcoRV site into the KpnI site, and the BglII 5 -CGAAGAAAACAACGACGACGATTCT-3 . site into the NotI site, respectively. Plasmid pOMEGPA1, a The BamHI–ClaI-digested plasmid pOMYP1 was intro- heterologous gene expression vector with an adenine auxo- duced into O. minuta TK5-3 cells (Doch1Dura3Dade1) and a trophic marker, was constructed by insertion of the vacuolar protease-deficient strain, TK9 (Doch1Dpep4Dprb1- ApaI–KpnI fragment from the plasmid pOMAD2 into the Dura3Dade1) to generate the O. minuta Dyps1 strains. ApaI–KpnI-digested plasmid pOMEGPU1DSp. Regeneration of the OmURA3 marker was carried out The target antigen of the antibody used in this study was according to the method described above. OmYPS1 gene tumor necrosis factor-related apoptosis-inducing ligand disruption was confirmed by PCR using the following 0 (TRAIL). A structural gene coding the human anti-TRAIL primers: DYP5, 5 -AACATTAGAGCCAGAGGCCATGGAT- 30;andDYP3,50-AGACGGGATTCCCGAGTCGCTCACC-30. IgG1 antibody heavy chain and the light chain fused with the S. cerevisiae invertase secretion signal was synthesized on the basis of the O. minuta codon usage and inserted into a Introduction of antibody genes pPCR-script (Takara Bio) by GENEART. An antibody heavy The NotI-digested antibody light chain expression vector, chain expression vector, sH/pOMGPU1DSp, was con- sL/pOMGPA1, was introduced into O. minuta TK5-3 cells structed by insertion of the XbaI–BamHI fragment of the (Doch1Dura3Dade1), TK9 cells (Doch1Dpep4Dprb1Dura3- heavy chain gene into the SpeI–BamHI-digested plasmid Dade1), YK6 cells (Doch1Dyps1Dura3Dade1) and YK4 cells pOMGPU1DSp. The antibody light chain expression vector, (Doch1Dpep4Dprb1Dyps1Dura3Dade1) by the electric pulse sL/pOMGPA1, was constructed by insertion of the XbaI– method. The introduction of the light chain gene was BamHI fragment of the light chain gene into the SpeI–Bam- confirmed by PCR using primers L-F (50-GAGATCGTTTTG HI-digested plasmid pOMGPA1. ACCCAATCCCCAGC-30) and L-R (50-TTAGCACTC ACCTCTGTTGAAGGACTTGGTAACT-30), and the genomic Construction of Dade1 strain of O. minuta DNA. To construct whole antibody expression strains, the NotI- digested heavy chain expression vector, sH/pOMGPU1DSp, The ApaI–NotI-digested plasmid pDOMAD1 for disruption was introduced into the strains expressing the antibody light of the OmADE1 gene was introduced into O. minuta TK3-A chain gene. Also, gene introduction was confirmed by PCR cells (Doch1Dura3) by the electric pulse method (electro- using primers H-F (50-CAATTGCAGTTGCAAGAGTC poration) as described previously (Kuroda et al., 2006). As CGGTCC-30)andH-R(50-TTACTTACCTGGGGACAAGGAC strains exhibiting the Dade1 phenotype produce a red AAGGACTTTTGGGTG-30), and the genomic DNA. pigment, which is an intermediate metabolite in adenine biosynthesis, red colonies on an SGURA plate were selected. Western analysis and antibody purification The OmADE1 gene disruption was confirmed by PCR using the following primers: DAD5, 50-TCTTTCTCGTTTAG The transformants were cultured in BYPG medium at 27 1C CTCGCG-30; and DAD3, 50-AGCAAGAAGATGTTGT for 72 h. The supernatant and cell resuspension in phosphate- CCGG-30. To pop out the OmURA3 marker gene, 5- buffered saline (PBS) buffer were subjected to sodium dodecyl fluoroorotic acid-positive selection was carried out by a sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and

c 2007 Federation of European Microbiological Societies FEMS Yeast Res 7 (2007) 1307–1316 Published by Blackwell Publishing Ltd. All rights reserved Antibody production in yeast 1311 electroblotted onto a poly(vinylidene difluoride) (PVDF) of the target protein. The OmPEP4 and OmPRB1 genes membrane. The antibody was detected by horseradish perox- cloned from O. minuta consistedofanORFof1230andan idase (HRP)-conjugated anti-human Fc antibody (Sigma) and ORF of 1617 nucleotides coding for 410 and 539 amino acids, by alkaline phosphatase (AP)-conjugated anti-human kappa respectively. The levels of similarity between the proteinase A antibody (Sigma). The culture supernatant was purified with derived from O. minuta and those of the other strains, such as protein A column chromatography (Hi-Trap Protein A HP, S. cerevisiae and Pichia angusta, were 67% and 78%. The levels GE Bioscience) by elution with glycine-HCl (pH 2.8). Further- of similarity between the proteinase B derived from O. minuta more, the eluted fraction from protein A purification was and those of the other strains, such as S. cerevisiae and passed through a gel permeation chromatography column P. angusta, were 47% and 55%, respectively. equilibrated with PBS (Superdex200, GE Bioscience). The The OmPEP4 gene disruptant strain was obtained by the

control human monoclonal antibody (hmAb) (human anti- introduction of the SacI–ClaI fragment from pDOMPA1 Downloaded from https://academic.oup.com/femsyr/article/7/8/1307/549124 by guest on 27 September 2021 TRAIL-R antibody) was produced at Kirin (Takasaki, Japan) into O. minuta TK5-3 cells (Doch1Dura3Dade1). After the in Chinese hamster ovary (CHO) DG44 cells. removal of the OmUAR3 gene by 5-fluoroorotic acid- positive selection, the gene disruption was confirmed by Peptide sequencing PCR analysis (Fig. 1a and d, lanes 1 and 2). Both the OmPEP4 and the OmPRB1 gene disruptant strains were The N-terminal residue of the degraded heavy chain was obtained by the introduction of the BamHI fragment from analyzed to determine the site of cleavage. The degraded pDOMPB1 into the Doch1Dpep4Dura3Dade1 cells described antibody purified with protein A column chromatography above. The OmPRB1 gene disruption was detected by PCR was subjected to SDS-PAGE and electroblotted onto a PVDF analysis after the 5-fluoroorotic acid-positive selection (Fig. membrane. The degraded antibody on the membrane was 1b and d, lanes 3 and 4). The double vacuolar protease- analyzed by a peptide sequencer (Model PSQ-1, Shimadzu). deficient strain was designated O. minuta TK9 (Doc- h1Dpep4Dprb1Dura3Dade1). Test of binding of antibody to antigen Western analysis was used to detect the binding of the Antibody expression by the O. minuta vacuolar purified antibody to TRAIL-R as an antigen. The TRAIL-R- protease-deficient strain Fc fusion protein was subjected to SDS-PAGE and electro- The plasmid vectors sL/pOMGPA1 and sH/pOMGPU1 DSp blotted onto a PVDF membrane. To detect antibody bind- for antibody expression were introduced into O. minuta ing, the membrane was incubated with the purified antibody TK5-3 cells (Doch1Dura3Dade1) and TK9 cells (Doc- from O. minuta YK4-LH cells (Doch1Dpep4Dprb1Dyps1) h1Dpep4Dprb1Dura3Dade1), respectively. The strains in and hMab as a primary antibody and then incubated with which the antibody genes were detected by PCR were the AP-conjugated anti-human kappa antibody as a second- designated TK5-3-LH and TK9-LH, respectively. The anti- ary antibody. The antigen-Fc fusion protein used in this body secreted into the BYPG medium from these two strains study was produced at Kirin in CHO DG44 cells. was detected by Western analysis. The degradation of the secreted heavy chain was confirmed in the supernatants Protein A HPLC analysis of the secreted antibody from both strains (Fig. 2a, lanes 2 and 3), although the Protein A column chromatography (POROS A 50A, Applied H2L2 assembled antibody was also observed (Fig. 2c, lanes 2 Biosystems) was used for the quantitation of the antibody and 3). As this degradation product detected by the anti-Fc secreted from yeast cells. All separation was carried out on antibody was associated with protein A, the degradation was an AKTA–HPLC system (GE Bioscience). The mobile phase thought to occur in the CH1 or variable region of the heavy for the antibody binding was 0.2 M sodium phosphate chain. On the other hand, the signal of the intracellular heavy buffer (pH 7.0). The elution was carried out with 0.2 M chain was increased and the degradation of the intracellular sodium phosphate buffer (pH 2.8). The antibody in the heavy chain was suppressed in TK9-LH cells containing the eluted peak was quantitated by the integration of the UV Dpep4Dprb1 mutant (Fig. 3a, lanes 2 and 3). This could absorbance signal at OD215 nm (Fulton et al., 1991). indicate that a part of the antibody is sorted into the vacuole and degraded in a vacuolar protease-dependent manner. Results Identification of the cleavage site of the Construction of the vacuolar protease-deficient antibody and construction of the Dyps1 and strain of O. minuta Dpep4 Dprb1 Dyps1 strains of O. minuta An O. minuta vacuolar protease-deficient strain was con- To identify the cleavage site of the heavy chain, the degrada- structed to repress protein degradation and improve the yield tion product of the heavy chain produced by TK9-LH cells

FEMS Yeast Res 7 (2007) 1307–1316 c 2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved 1312 K. Kuroda et al. Downloaded from https://academic.oup.com/femsyr/article/7/8/1307/549124 by guest on 27 September 2021

Fig. 1. Gene disruption schemes of OmPEP4 (a), OmPRB1 (b), and OmYPS1 (c), and agarose gel electrophoresis of the PCR product (d). Identification of the OmPEP4 gene disruption in TK9 cells, and compared with TK5-3 cells (d, lanes 1 and 2), the OmPRB1 gene disruption in TK9 cells, and compared with TK5-3 cells (d, lanes 3 and 4), the OmYPS1 gene disruption in YK4 and YK6 cells, and compared with TK9 and TK5-3 Fig. 2. Detection of the secreted antibody. Supernatant (20 mL) was cells, respectively (d, lanes 5, 6 and lanes 7, 8). subjected to Western analysis under the reduced condition in the presence of dithiothreitol (DTT) (a, b) and 1 mL of supernatant was subjected to the analysis under the nonreduced condition (c). (A) HRP- conjugated anti-human Fc antibody was used for antibody detection. (b, c) AP-conjugated anti-human kappa antibody was used for antibody was purified with protein A column chromatography and detection. Lane 1: purified antibody from CHO DG44 cells. Lane 2: subjected to analysis of the N-terminal peptide sequence. supernatant from TK5-3-LH cells (Doch1). Lane 3: supernatant from TK9- This revealed that the antibody produced by TK9-LH cells LH cells (Doch1Dpep4Dprb1). Lane 4: supernatant from YK4-LH cells was degraded at the Lys–Lys bond in the CH1-hinge region (Doch1Dpep4Dprb1Dyps1). Lane 5: supernatant from YK6-LH cells (Fig. 4). As Yps1p derived from S. cerevisiae degrades the (Doch1Dyps1). extracellular proteins at the Lys–Lys bond (Reppe et al., 1991; Azaryan et al., 1993; Cawley et al., 1996), it was C-terminal region. Comparison of the deduced amino acid considered that Yps1p in O. minuta also degraded the sequences with those of other yeast species showed a high antibody. similarity (40% and 27% for Yps1p from S. cerevisiae and To construct O. minuta Yps1p-deficient strains, the Candida albicans, respectively). OmYPS1 gene was cloned. The OmYPS1 gene obtained OmYPS1-deficient strains were obtained by introduction consists of an ORF of 1839 nucleotides coding for a of the BamHI–ClaI-digested plasmid pOMYP1 into O. polypeptide of 613 amino acid residues with the glycosyl- minuta TK5-3 cells (Doch1Dura3Dade1) and TK9 cells phosphatidylinositol anchor modification signal in the (Doch1Dpep4Dprb1Dura3Dade1). The gene disruption was

c 2007 Federation of European Microbiological Societies FEMS Yeast Res 7 (2007) 1307–1316 Published by Blackwell Publishing Ltd. All rights reserved Antibody production in yeast 1313 confirmed by PCR analysis after 5-fluoroorotic acid regen- revealed that there was no significant increase in the secreted eration of the OmURA3 marker (Fig. 1c and d, lanes 5–8). antibody, although the cleavage of the antibody heavy chain The obtained O. minutaDyps1 strains were designated observed in TK5-3-LH and TK9-LH cells at 40 kDa was O. minuta YK6 (Doch1Dyps1Dura3Dade1) and YK4 suppressed in both Dyps1 strains. Also, the amount of the (Doch1Dpep4Dprb1Dyps1Dura3Dade1). intracellular antibody heavy chain was not increased in the YK4-LH and YK6-LH cells in comparison with TK9-LH and Expression of the antibody by O. minuta in TK5-3-LH cells, respectively (Fig. 3). On the other hand, Dyps1 strains protein A HPLC analysis indicated that the amount of antibody secreted from YK4-LH cells was c.10mgL1 in The antibody expression vectors sL/pOMGPA1 and sH/ the 2 BYPG medium. pOMGPU1 DSp were introduced into O. minuta YK4 cells (Doch1Dpep4Dprb1Dyps1Dura3Dade1) and YK6 cells (Doc- Downloaded from https://academic.oup.com/femsyr/article/7/8/1307/549124 by guest on 27 September 2021 h1Dyps1Dura3Dade1). The strains in which the antibody Affinity of antibody produced by O. minuta for genes were detected by PCR were designated YK4-LH and antigen YK6-LH, respectively. The supernatants including antibody secreted from YK4-LH cells and YK6-LH cells were sub- The antibody secreted from YK4-LH cells was purified by jected to Western analysis. The results shown in Fig. 2 protein A and gel permeation column chromatography. Peptide sequencing revealed that the purified antibody had a desired N-terminal sequence processed after the signal sequence (data not shown). The antibody-binding test was performed using the antigen from CHO DG44 cells and the antibodies from the O. minuta YK4-LH and CHO DG44 cells. The results shown in Fig. 5 revealed that the antibody produced in O. minuta YK4-LH cells bound to the antigen, but that the affinity was lower than that of the antibody produced from CHO DG44 cells, based on densitometry.

Fig. 3. Detection of the intracellular antibody. Three microliters of the Fig. 5. Western analysis of the antibody used for binding to antigen. cell suspension in which the final concentration was OD600 nm 30 in PBS The antigen was subjected to SDS-PAGE and electroblotted onto a PVDF was subjected to Western analysis under the reduced condition in the membrane. AP-conjugated anti-human k antibody was used as the presence of DTT. HRP-conjugated anti-human Fc antibody (a) and AP- secondary antibody. Lanes 1 and 3: 20 ng of antigen. Lanes 2 and 4: conjugated anti-human k antibody (b) were used for antibody detection. 100 ng of antigen. Lanes 1 and 2: 1 mgmL1 purified antibody from YK4- Lane 1: purified antibody from CHO DG44 cells. Lane 2: TK5-3-LH cells LH cells (Doch1Dpep4Dprb1Dyps1) was used as the primary antibody. (Doch1). Lane 3: TK9-LH cells (Doch1Dpep4Dprb1). Lane 4: YK4-LH cells Lanes 3 and 4: 1 mgmL1 purified antibody from CHO DG44 was used as (Doch1Dpep4Dprb1Dyps1). Lane 5: YK6-LH cells (Doch1Dyps1). the primary antibody.

Fig. 4. The cleavage site of the secreted antibody heavy chain in Ogataea minuta.

FEMS Yeast Res 7 (2007) 1307–1316 c 2007 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved 1314 K. Kuroda et al. Downloaded from https://academic.oup.com/femsyr/article/7/8/1307/549124 by guest on 27 September 2021

Fig. 6. Secretory pathway and mechanism of antibody degradation in Ogataea minuta. (a) Ogataea minuta Doch1 cells. (b) Ogataea minuta triple protease-deﬁcient cells (Doch1Dpep4Dprb1Dyps1). Pep4p and Prb1p degraded the antibody sorted to the vacuole. Yps1p partially cleaved the antibody secreted to the medium.

Discussion vacuolar protein-sorting (vps) genes and other genes related to vacuolar sorting have been identified, and three pathways When human antibody genes were expressed in the methy- to the vacuole – the carboxypeptidase Y (CPY) pathway, the lotrophic yeast O. minuta, degradation of the antibody was alkaline phosphatase (ALP) pathway, and the cytoplasm-to- observed. This degradation was thought to reduce the yield vacuole targeting (Cvt) pathway – have been characterized. and complicate the downstream process of the antibody The CPY pathway carries the soluble hydrolase CPY and a production. To overcome this problem, we cloned three number of membrane proteins to the vacuole via an protease genes, OmPEP4,OmPRB1, and OmYPS1, and endosomal intermediate. In the vps mutant, CPY is secreted constructed protease-deficient strains for antibody produc- into the medium (Conibear & Stevens, 1998; Bonangelino tion. Although the degradation of the secreted antibody et al., 2002). In the ALP pathway, the ALP, a type II integral could not be repressed in the double protease-deficient vacuolar membrane protein, is sorted into the vacuole, thus strain of the OmPEP4 and OmPRB1 genes, we succeeded in bypassing the endosomal intermediate (Cowles et al., 1997; suppressing the intracellular degradation and in improving Stepp et al., 1997). The Cvt pathway overlaps genetically the antibody productivity. A part of the antibody was with autophagy, the nonselective bulk protein degradation considered to be transferred to the vacuole or the vacuole- in the vacuole (Teter & Klionsky, 2000). To improve the like compartment, and to be degraded in a proteinase A- secreted antibody productivity, it will be valuable to inter- and proteinase B-dependent manner. cept the antibody-sorting pathway to the vacuole. On the other hand, the secreted antibody was cleaved at Some reports have revealed an increase in secretion due to the CH1-hinge region. This cleavage was repressed when the the presence of multiple copies of the SSO genes encoding antibody was expressed in the OmYPS1-deficient strains. As the t-SNAREs that function in the targeting/fusion of the the protease coded by OmYPS1 is considered to be located at Golgi-derived secretory vesicles into the plasma membrane the plasma membrane, a part of the antibody not recruited in yeast (Ruohonen et al., 1997; Toikkanen et al., 2004). In into the vacuole was cleaved at the late secretory pathway. addition, the overexpression of SEC4, Rab GTPase, which is The triple protease-deficient strain was able to grow in essential for exocytosis, indicates an increase in the amount minimal medium, and will therefore be useful for the of protein secreted (Toikkanen et al., 2003; Liu et al., 2005). production of an antibody that is highly susceptible to the Therefore, the manipulation of the genes related to exocy- proteases. This is summarized in Fig. 6. tosis is considered attractive for increasing the amount of On the basis of the data presented in this report, one of the secretory protein. Especially, in the vacuolar-sorting- the bottlenecks of antibody production in yeast is thought to deficient strains, it could help secretion of the vacuolar- be the Golgi-to-vacuole (and/or the vacuole-like compart- sorting proteins, which cannot be sorted into the vacuole ment) protein traffic. In the yeast S. cerevisiae, more than 45 efficiently. The expression of the antibody genes in the

c 2007 Federation of European Microbiological Societies FEMS Yeast Res 7 (2007) 1307–1316 Published by Blackwell Publishing Ltd. All rights reserved Antibody production in yeast 1315 vacuolar-sorting-deficient strains of O. minuta with or tions are needed to optimize the cultivation conditions and without the introduction of genes related to exocytosis is genetic manipulation of the O. minuta protease-deficient under investigation. strain. In general, the sugar chains of the antibody produced in the mammalian cells are mainly GlcNAc –Man – 2 3 Acknowledgements GlcNAc2 Fuc (G0), Gal1–GlcNAc2–Man3–GlcNAc2 Fuc (G1), and Gal2–GlcNAc2–Man3–GlcNAc2 Fuc (G2). These We would like to thank N. Kawashima, A. Ohnishi, Y. are shorter than the other glycoproteins in serum, because Yamamoto, U. Tezuka and K. Sato for their valuable they are fitted in the pocket between the CH2 regions of the assistance with this research. We are also grateful to Dr M. antibody (Jefferis & Pandalai, 2002). As the antibody Tsukahara for his helpful suggestions. This work was sup-

secreted from the engineered O. minuta cells has high- ported by the New Energy and Industrial Technology Downloaded from https://academic.oup.com/femsyr/article/7/8/1307/549124 by guest on 27 September 2021 mannan-type sugar chains that are different from those Development Organization (NEDO) as a part of the Re- from mammalian cells, the strong immunogenicity will be search and Development Projects of the Industrial Science detected (Ballou et al., 1990). On the other hand, the and Technology Frontiers Program, Japan. antibody secreted from engineered O. minuta cells showed lower antigen-binding activity than that secreted from CHO cells. Although the relationship between the antigen-binding References activity and the N-linked sugar chains is unknown, this Azaryan AV, Wong M, Friedman TC, Cawley NX, Estivariz FE, activity could be improved by the addition of human- Chen HC & Loh YP (1993) Purification and characterization compatible-type sugar chains to an antibody CH2 region, of a paired basic residue-specific yeast aspartic protease because bulky sugar chains larger than the Man5 type in O. encoded by the YAP3 gene. Similarity to the mammalian pro- minuta (Kuroda et al., 2006) might cause the antibody to opiomelanocortin-converting enzyme. J Biol Chem 268: form an incorrect structure. Therefore, it is necessary to 11968–11975. construct the engineered yeast by introducing genes respon- Ballou L, Hernandez LM, Alvarado E & Ballou CE (1990) sible for complex sugar chain production, such as a- Revision of the oligosaccharide structures of yeast carboxypeptidase Y. Proc Natl Acad Sci USA 87: 3368–3372. mannosidase-I, a-mannosidase-II, and GlcNAc transferase Bardor M, Loutelier-Bourhis C, Paccalet1 T et al. (2003) I (GnT-I). These experiments are now underway. Monoclonal C5-1 antibody produced in transgenic alfalfa In this work, we employed a constitutive expression plants exhibits a N-glycosylation that is homogenous and system with the promoter of OmTDH1 (Kuroda et al., suitable for glyco-engineering into human-compatible 2006), the homologous gene of S. cerevisiae glyceraldehyde- structures. Plant Biotechnol J 1: 451–462. 3-phosphate dehydrogenase, for antibody expression, be- Bonangelino CJ, Chavez EM & Bonifacino JS (2002) Genomic cause the amount of antibody secreted under the control of screen for vacuolar protein sorting genes in Saccharomyces the OmTDH1 promoter was larger than the amount pro- cerevisiae. Mol Biol Cell 13: 2486–2501. duced under the control of the OmAOX1 promoter, which Bourbonnais Y, Larouche C & Tremblay GM (2000) Production controls expression of the methanol-inducible alcohol oxi- of full-length human pre-elafin, an elastase specific inhibitor, dase (data not shown). Some reports have revealed that the from yeast requires the absence of a functional yapsin 1 use of the endogenous methanol-inducible promoter from (Yps1p) endoprotease. Protein Expr Purif 20: 485–491. the methyltrophic yeast confers a high expression level of the Cawley NX, Chen HC, Beinfeld MC & Loh YP (1996) Specificity target gene and high productivity (Cregg et al., 1993; and kinetic studies on the cleavage of various prohormone Cereghino & Cregg, 2000). In protein production by CHO mono- and paired-basic residue sites by yeast aspartic protease cells, high-producer cells have also been developed by the 3. J Biol Chem 271: 4168–4176. gene amplification technique, which confers a high level of Conibear E & Stevens TH (1998) Multiple sorting pathways mRNA expression (Page & Sydenham, 1991; Yoshikawa between the late Golgi and the vacuole in yeast. Biochim Biophys Acta 1404: 211–230. et al., 2000). However, in the case of the yeast expression Copley KS, Alm SM, Schooley DA & Courchesne WE (1998) system, the highest expression is not always suitable for Expression, processing and secretion of a proteolytically- protein secretion, depending on the target protein. In sensitive insect diuretic hormone by Saccharomyces cerevisiae particular, as antibodies show great diversity in the variable requires the use of a yeast strain lacking genes encoding the region, it is thought to be necessary to determine a suitable Yap3 and Mkc7 endoproteases found in the secretory pathway. expression system depending on the antibody amino acid Biochem J 330: 1333–1340. sequence in yeast. Cowles CR, Snyder WB, Burd CG & Emr SD (1997) Novel Golgi In this work, we focused on the suppression of degrada- to vacuole delivery pathway in yeast: identification of a sorting tion of antibody secreted from the yeast O. minuta.To determinant and required transport component. EMBO J 16: develop an antibody production system, further investiga- 2769–2782.

Cereghino JL & Cregg JM (2000) Heterologous protein Li H, Sethuraman N, Stadheim TA et al. (2006) Optimization of expression in the methylotrophic yeast Pichia pastoris. FEMS humanized IgGs in glycoengineered Pichia pastoris. Nat Microbiol Rev 24: 45–66. Biotechnol 24: 210–215. Cregg JM, Vedvick TS & Raschke WC (1993) Recent advances in Liu SH, Chou WI, Sheu CC & Chang MD (2005) Improved the expression of foreign genes in Pichia pastoris. Biotechnology secretory production of glucoamylase in Pichia pastoris by (New York) 11: 905–910. combination of genetic manipulations. Biochem Biophys Res Freyre FM, Vazquez JE, Ayala M, Canaan-Haden L, Bell H, Commun 326: 817–824. Rodriguez I, Gonzalez A, Cintado A & Gavilondo JV (2000) Page MJ & Sydenham MA (1991) High level expression of the Very high expression of an anti-carcinoembryonic antigen humanized monoclonal antibody Campath-1H in Chinese single chain Fv antibody fragment in the yeast Pichia pastoris. hamster ovary cells. Biotechnology (NY) 9: 64–68. J Biotechnol 76: 157–163. Reppe S, Gabrielsen OS, Olstad OK et al. (1991) Characterization Fulton SP, Meys M, Varady L, Jansen R & Afeyan NB (1991) of a K26Q site-directed mutant of human parathyroid Downloaded from https://academic.oup.com/femsyr/article/7/8/1307/549124 by guest on 27 September 2021 Antibody quantitation in seconds using affinity perfusion hormone expressed in yeast. J Biol Chem 266: 14198–14201. chromatography. Biotechniques 11: 226–231. Ruohonen L, Toikkanen J, Tieaho V, Outola M, Soderlund H & Gasser B, Maurer M, Gach J, Kunert R & Mattanovich D (2006) Keranen S (1997) Enhancement of protein secretion in Engineering of Pichia pastoris for improved production of Saccharomyces cerevisiae by overproduction of Sso protein, a antibody fragments. Biotechnol Bioeng 94: 353–361. late-acting component of the secretory machinery. Yeast 13: Gleeson MA, White CE, Meininger DP & Komives EA (1998) 337–351. Generation of protease-deficient strains and their use in Shinkawa T, Nakamura K, Yamane N et al. (2003) The absence of heterologous protein expression. Methods Mol Biol 103: 81–94. fucose but not the presence of galactose or bisecting N- Horwitz AH, Chang CP, Better M, Hellstrom KE & Robinson RR acetylglucosamine of human IgG1 complex-type oligosaccharides shows the critical role of enhancing antibody- (1988) Secretion of functional antibody and Fab fragment dependent cellular cytotoxicity. J Biol Chem 278: 3466–3473. from yeast cells. Proc Natl Acad Sci USA 85: 8678–8682. Shusta EV, Raines RT, Pluckthun A & Wittrup KD (1998) Ishida I, Yoshida H & Tomizuka K (1998) Production of a diverse Increasing the secretory capacity of Saccharomyces cerevisiae repertoire of human antibodies in genetically engineered mice. for production of single-chain antibody fragments. Nat Microbiol Immunol 42: 143–150. Biotechnol 16: 773–777. Jefferis R & Pandalai SG (2002) Glycosylation of human IgG Stepp JD, Huang K & Lemmon SK (1997) The yeast adaptor antibodies: relevance to therapeutic applications. Recent protein complex, AP-3, is essential for the efficient delivery of Research Developments in Immunology. Vol. 4, Part II,pp. alkaline phosphatase by the alternate pathway to the vacuole. 769–780. Research Signpost, Kerala, India. J Cell Biol 139: 1761–1774. Joosten V, Lokman C, Van Den Hondel CA & Punt PJ (2003) The Teter SA & Klionsky DJ (2000) Transport of proteins to the yeast production of antibody fragments and antibody fusion vacuole: autophagy, cytoplasm-to-vacuole targeting, and role proteins by yeasts and filamentous fungi. Microb Cell Fact 2:1. of the vacuole in degradation. Semin Cell Dev Biol 11: 173–179. doi: 10.1186/1475-2859-2-1. Toikkanen JH, Miller KJ, Soderlund H, Jantti J & Keranen S Kanda Y, Yamane-Ohnuki N, Sakai N et al. (2006) Comparison of (2003) The beta subunit of the Sec61p endoplasmic reticulum cell lines for stable production of fucose-negative antibodies translocon interacts with the exocyst complex in with enhanced ADCC. Biotechnol Bioeng 94: 680–688. Saccharomyces cerevisiae. J Biol Chem 278: 20946–20953. Kang HA, Kim SJ, Choi ES, Rhee SK & Chung BH (1998) Efficient Toikkanen JH, Sundqvist L & Keranen S (2004) Kluyveromyces production of intact human parathyroid hormone in a lactis SSO1 and SEB1 genes are functional in Saccharomyces Saccharomyces cerevisiae mutant deficient in yeast aspartic cerevisiae and enhance production of secreted proteins when protease 3 (YAP3). Appl Microbiol Biotechnol 50: 187–192. overexpressed. Yeast 21: 1045–1055. Kerry-Williams SM, Gilbert SC, Evans LR & Balance DJ (1998) Van Den Hazel HB, Kielland-Brandt MC & Winther JR (1996) Disruption of the Saccharomyces cerevisiae YAP3 gene reduces Review: biosynthesis and function of yeast vacuolar proteases. the proteolytic degradation of secreted recombinant human Yeast 12: 1–16. albumin. Yeast 14: 161–169. Ward M, Lin C, Victoria DC et al. (2004) Characterization of Komeda T, Sakai Y, Kato N & Kondo K (2002) Construction of humanized antibodies secreted by Aspergillus niger. Appl protease-deficient Candida boidinii strains useful for Environ Microbiol 70: 2567–2576. recombinant protein production: cloning and disruption of Wood CR, Boss MA, Kenten JH, Calvert JE, Roberts NA & proteinase A gene (PEP4) and proteinase B gene (PRBI). Biosci Emtage JS (1985) The synthesis and in vivo assembly of Biotechnol Biochem 66: 628–631. functional antibodies in yeast. Nature 314: 446–449. Kuroda K, Kobayashi K, Tsumura H, Komeda T, Chiba Y & Yoshikawa T, Nakanishi F, Itami S, Kameoka D, Omasa T, Jigami Y (2006) Production of Man5GlcNAc2-type sugar Katakura T, Kishimoto M & Suga K (2000) Evaluation of stable chain by the methylotrophic yeast Ogataea minuta. FEMS and highly productive gene amplified CHO cell line based on Yeast Res 6: 1052–1062. the location of amplified genes. Cytotechnology 33: 37–46.