FUNCTIONAL CHARACTERIZATION OF EXTRACELLULAR PROTEASE INHIBITORS OF PHYTOPHTHORA SPP AND THEIR TARGETS TOMATO PROTEASES
DISSERTATION
Presented in Partial Fulfillment of the Requirements for The Degree Doctor of Philosophy in the Graduate School of The Ohio State University
By Jing Song, M.S. * * * *
The Ohio State University 2007
Dissertation Committee: Dr. Sophien Kamoun, Adviser Approved by Dr. Anne E. Dorrance Dr. Terrence L. Graham Adviser Dr. Margaret G. Redinbaugh ______Dr. Eric J. Stockinger Graduate Program in Plant Pathology
ABSTRACT
The interplay between proteases and protease inhibitors during plant- pathogen interaction represents a common strategy for defense and counter- defense. The plant pathogens Phytophthora infestans and Phytophthora mirabilis secrete effectors such as protease inhibitors that facilitate host colonization through a defense-counterdefense mechanism. The P. infestans serine protease inhibitors EPI1 and EPI10 physically bind and inhibit the tomato serine protease
P69B. On the other hand, the P. infestans cysteine protease inhibitor EPIC2B targets PIP1, a papain-like protease that has close similarity to another tomato cysteine protease Rcr3, which is required for the fungal resistance and Avr2 hypersensitivity in Cf-2 tomato. The objective of this research is to characterize these protease inhibitors and their association with specific targets in the host.
We studied the structure and activities of these protease inhibitors and their target proteases using recombinant proteins expressed in Escherichia coli and
Nicotiana benthamiana. PIP1-His was pulled down using coimmunoprecipitation with anti-FLAG resin from N. benthamiana apoplast by recombinant protein
FLAG-EPIC2B, suggesting physical interaction of EPIC2B and PIP1. Similarly, tomato protease Rcr3pim was shown to be a common target for both the
ii Cladosporium fulvum effector Avr2 and P. infestans effector EPIC2B using pull down assays and DCG-04 activity profiling. However, unlike Avr2, EPIC2B is a reversible inhibitor of Rcr3pim and does not trigger hypersensitivity on Cf-2/Rcr3pim tomato. We also found that the rcr3-3 mutant of tomato that carries a premature stop codon in the Rcr3 gene exhibits enhanced susceptibility to P. infestans, suggesting a role for Rcr3pim in basal defense. These findings are consistent with the predictions of the guard model and suggest that effectors from unrelated pathogens can target the same tomato defense protease Rcr3pim. It appears that relative to C. fulvum, P. infestans evolved a cunning effector that carries virulence activity without triggering plant innate immunity. Like EPIC1, PmEPIC1, an EPIC1 homolog from P. mirabilis, was also found to bind Rcr3pim but not PIP1.
Unlike EPIC2B, neither EPIC1 nor PmEPIC1 binds or inhibits PIP1. This work was possible by the ability to express and purify proteins in the apoplast of N. benthamiana. Three tomato proteases with C-terminal 6XHistidine tag were successfully expressed in N. benthamiana apoplast. Our findings suggest that C- terminal His-tagging of proteins in N. benthamiana apoplast is efficient enough to enable purification of functional proteins. Further studies will focus on the three dimensional structural of the protease-protease inhibitor complexes, identifying the interactors of EPIC1 and PmEPIC1 in their respective host cells, and further characterizing the biochemical activities of these protease inhibitors.
iii
Dedicated to my grandfather, my mother, my father and my love
iv ACKNOWLEDGMENTS
I would like to give my greatest appreciation to my advisor, Dr. Sophien
Kamoun for his intelligence, encouragement and full support. He gave me the opportunities not only to conduct the designed project but also to explore what I have learned to the application and the extension of our research design. With all his advices and support, I learned how to input and integrate our thoughts into the experimental performance, into the critical analysis of the designs and the results, and into the effective exclusion of the obstacles that we encountered.
I also want to thank all my other Student Advisory Committee members Dr.
Anne Dorrance, Dr. Eric Stockinger, Dr. Margaret Redinbaugh and Dr. Terrence
Graham for their stimulating discussion, technical support and all the suggestions and encouragement that they gave me during my graduate study.
Kamoun lab is my second home, where I met talented people, made many friends and shared my happiness and sadness with them. I wish to give my appreciation to our previous lab members Diane Kinney, Nicolas Champouret,
Miaoying Tian, Joe Win, Cahid Cakir, Edgar Huitema, Thirumala-devi Kanneganti,
Zhenyu Liu, Karen Liu, William Morgan, and current lab members Kerilynn
Jagger, Jorunn Bos, Sang-Keun Oh, Liliana Cano, Angela Chaparro, Carla
Garzon, Cristian Quispe, Tolga Bozkurt, for their help and discussion.
v I am grateful to those who helped me in providing the technical support and experimental recourses for my research, especially MCIC staff and Maize
Virology Group at USDA for the convenience that they provided.
Finally, I want to give my great appreciation to my family for their full support during my study.
vi VITA
Aug. 31, 1978 ...... Born in Xi’an, P. R. China
1996-2000 ...... B.S. Department of Biochemistry and Molecular Biology, Beijing Normal University, Beijing, P. R. China
2000-2003 ...... M.S. Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, P. R. China
2003-present ...... Graduate Research Associate Department of Plant Pathology, The Ohio State University, OH, USA
PUBLICATIONS
Research Publications
1. Tian, M., Win, J., Song, J., van der Hoorn, R., van der Knaap, E., and Kamoun, S. (2007). A Phytophthora infestans cystatin-like protein targets a novel tomato papain-like apoplastic protease. Plant Physiol. 143, 364-377.
2. Jing Song, Yongru Sun, Liming Zhang, and Wenbin Li. 2003. Construction of indole dioxygenase vector and expression in Escherichia coli. High Technology Letters 9, 39-42.
3. Jing Song, Hengyao Niu, Yongru Sun, Liming Zhang, and Wenbin Li. 2002. Research of Changing the Color of Cotton Fiber by Gene Engineering. High Technology Letters 7, 103-107.
vii
4. Wenbin Li, Jing Song, Yongru Sun, Liming Zhang, Yiqin Wang, Hengyao Niu. 2002. Cotton fiber specific expression vector containing bec gene. Patent 02103787.6, Chinese National Patent Office
5. Ning Liu, Jing Song, Chapter 2, << Plant Biology >>of textbook series for 21st century (ISBN7-4-007747-7), 1999, Higher Education Press, Beijing, China
FIELDS OF STUDY
Major Field: Plant Pathology
Specialty: Molecular Plant-Microbe Interactions
viii TABLE OF CONTENTS
Page Abstract ...... ii Dedication ...... iv Acknowledgments ...... v Vita ...... vii List of Tables ...... xi List of Figures ...... xii List of Abbreviations ...... xiv
Chapters:
1. Protease inhibitors in host-pathogen interactions ...... 1
1.1 Introduction ...... 1 1.2 Overview of protease inhibitors ...... 4 1.2.1 What are protease inhibitors? ...... 4 1.2.2 Classification of protease inhibitors ...... 5 1.3 Examples of protease inhibitors involved in host- pathogen interactions ...... 9 1.3.1 Protease inhibitors in hosts (plants, animals and human) ...... 9 1.3.2 Protease inhibitors in pathogens ...... 13 1.4 Summary and prospective research on PIs ...... 18 1.5 Research objectives ...... 20 1.6 References ...... 22
2. Two effectors, EPIC2B and Avr2, from unrelated pathogens target tomato defense protease Rcr3pim ...... 34
2.1 Abstract ...... 34 2.2 Introduction ...... 36 2.3 Materials and Methods ...... 41 2.4 Results ...... 47 2.5 Discussion ...... 51
ix 2.6 Acknowledgments ...... 56 2.7 References ...... 56
3. Molecular, structural and functional analysis of PmEPIC1 in P. mirabilis, a homolog of P. infestans EPIC1 ...... 71
3.1 Abstract ...... 71 3.2 Introduction ...... 73 3.3 Materials and Methods ...... 76 3.4 Results ...... 81 3.5 Discussion ...... 88 3.6 Acknowledgments ...... 92 3.7 References ...... 92
4. High level expression of stable affinity-tagged proteins in the plant apoplast ...... 109
4.1 Abstract ...... 109 4.2 Introduction ...... 111 4.3 Materials and Methods ...... 114 4.4 Results ...... 118 4.5 Discussion ...... 124 4.6 Acknowledgments ...... 129 4.7 References ...... 130
Appendix: P. infestans EPIC2B targets tomato cysteine protease PIP1 ...... 142
Bibliography ...... 143
x LIST OF TABLES
Table Page
1.1 Examples of protease inhibitors involved in host-pathogen interactions ...... 33
2.1 Table 2.1 ANOVA analysis of lesion growth rate (LGR) ...... 70
3.1 Diversifying selection analyses results of EPICs ...... 108
xi LIST OF FIGURES
Figure Page
2.1 Like Avr2, EPIC2B physically interacts Rcr3pim ...... 61
2.2 Like Avr2, EPIC2B inhibits Rcr3pim ...... 62
2.3 Unlike Avr2, EPIC2B is a reversible inhibitor to Rcr3pim ...... 63
2.4 Unlike Avr2, EPIC2B does not trigger hypersensitive response on Cf-2/Rcr3pim tomato ...... 64
2.5 Rcr3pim contributes to tomato basal defense to P. infestans ...... 65
2.6 Model of two effectors and their target Rcr3pim ...... 66
2.7 Scheme of EPIC2B, Avr2 and Rcr3pim constructs ...... 67
2.8 Expression and affinity purification of FLAG-tagged EPIC2B and Avr2 proteins ...... 68
2.9 Fluorescence microscopic detection of hypersensitive response on tomato plants ...... 69
3.1 Sequences alignment analysis of PmEPIC1 with EPIC1 and other cystatins...... 98
3.2 Protein model - active sites and polymorphic sites prediction of PmEPIC1 ...... 99
3.3 Multiple sequence alignment of four EPICs from Phytophthora infestans and Phytophthora mirabilis ...... 100
3.4 FLAG-PmEPIC1 expression and affinity purification ...... 101
3.5 Like EPIC2B, EPIC1 and PmEPIC1 physically interact with Rcr3pim ...... 102
xii
3.6 Unlike EPIC2B, neither EPIC1 nor PmEPIC1 binds PIP1 ...... 103
3.7 Like EPIC2B, EPIC1 but not PmEPIC1 inhibits Rcr3pim ...... 104
3.8 Unlike EPIC2B, neither EPIC1 or PmEPIC1 inhibits PIP1 ...... 105
3.9 Like EPIC2B and unlike Avr2, neither PmEPIC1 nor EPIC1 trigger hypersensitive response on Cf-2/Rcr3pim tomato plants ...... 106
3.10 The nucleotide multiple alignments of the corresponding genes encoding four EPICs ...... 107
4.1 Protein expression constructs used in this study ...... 136
4.2 HA tag is unstable in P69B-HA during purification ...... 137
4.3 C-terminal His-tagged proteins P69B-His, PIP1-His and Rcr3pim-His expressed in N. benthamiana apoplastic fluid ...... 138
4.4 P69B-His is stable during affinity purification ...... 140
4.5 A: Affinity purified P69B-His cleaves a recombinant protein FLAG-EPIC1 ...... 141
xiii ABBREVIATIONS
AP, alkaline phosphatase NCBI, National Center for Avr, Avirulence Biotechnology Information BLAST, Basic Local Alignment ORF, open reading frame Search Tool Ni-NTA, nickel-nitrilotriacetic acid bp, base pairs PAGE, polyacrylamide gel DNA, deoxyribonucleic acid electrophoresis DTT, dithiothreitol PBS, phosphate-buffered saline EB, ethidium bromide PCR, polymerase chain reaction EPI, Kazal-like extracellular Ser PDB, The Protein Data Bank protease inhibitors PIP1, Phytophthora Inhibited EPIC, extracellular protease Protease 1 inhibitors with cystatin-like domains PR, pathogenesis-related EST, expressed sequence tag R gene, Resistance gene GFP, green fluorescence protein Rcr3, required for Cladosporium HRP, horseradish peroxidase fulvum resistance3 IgG, immunoglobulin G RNA, ribonucleic acid kDa, kilo Dalton RT-PCR, reverse transcription - kb, kilobases polymerase chain reaction LC-MS, Liquid Chromatography SDS, sodium dodecyl sulfate Mass Spectrometry TBS, Tris-buffered saline MES, 2-(N-morpholino) VIGS, virus-induced gene silencing ethanesulphonic acid
xiv
CHAPTER 1
LITERATURE REVIEW: PROTEASE INHIBITORS IN HOST-PATHOGEN
INTERACTIONS
1.1 INTRODUCTION
General information about proteolytic process
Proteolytic processes play important roles in various processes of living organisms. During protein post-translational modification, proteases process premature peptides to form mature, functional proteins. Most proteins require removal of the signal peptide by proteases if they have been translocated into another cellular compartment or secreted into the intercellular space.
Proteosomal processing includes the degradation of substrates into nonfunctional small peptides, but sometimes yields biologically active protein fragments (Rape and Jentsch, 2002). Some proteins also need to be degraded if
1 they are not transported to their desirable destinations. To complete metabolic cycles, proteins are normally subjected to proteolytic processes to cleave useless or unnecessary proteins and peptides. Apart from these housekeeping roles, large numbers of proteases or protease inhibitors are induced under circumstances such as environment changes, pathogen attacks, and are therefore responsible for defending the cells against harmful exogenous molecules (De Gregorio et al., 2001; Irving et al., 2001; Ingvarsson, 2005). In addition, proteolytic processes are required for most virus protein processing (Xia,
2004).
Occurrence of proteolytic processes in host-pathogen interactions
Proteolytic processes are involved in many aspects of host-pathogen interactions. Proteases and protease inhibitors help hosts defend themselves and cleave or inactivate the pathogens molecules. On the other hand, microbes produce proteases and protease inhibitors to suppress host defense and facilitate their colonization on the hosts. The roles of proteases in pathogenesis and plant defense were reviewed recently (Xia, 2004; van der Hoorn and Jones,
2004), suggesting that the proteolytic processing is a widely used mechanism in plant defense or successful invading strategy used by microorganisms. Similar to proteases, protease inhibitors inactivate the proteases to benefit the hosts or the
2 microbes, thus are important components in host-microbe interaction. Even though a large number of protease inhibitors were identified from microbes, plants, animals and human, many aspects of their biology remain unknown, including their specific targets, kinetic binding, mode of inhibition and their roles during infection and defense.
3 1.2 OVERVIEW OF THE PROTEASE INHIBITORS
1.2.1 What are protease inhibitors?
In a broad view, protease inhibitors are molecules that inactivate or inhibit proteases. These molecules can be enzymes that degrade or modify the structures of the proteases so that they cannot function anymore. Protease inhibitors can also be protease substrate analogs that competitively bind to the active sites of the proteases to block the interaction between proteases with their substrates. These analogs can be either degraded by the proteases (called suicide inhibitors) or remain intact to persistently inhibit the proteases (Ye and
Goldsmith, 2001). Some proteins bind to a site other than the protease active site and block the active site or prevent the binding between the substrates and their target proteases by conformational changes. In addition, chelating agents such as o-phenanthroline (Fawcett and Housden, 1990), EDTA, N-acetylcysteine
(NAC) (Brooks and Ollivier, 2004) that tightly bind to the metal ion cofactors that are required for protease function are able to inactivate the proteases. Usage of the transition metal ions rather than substrate analogs to block active sites of these enzymes provides another example of simple protease inhibitors (Duffy et al., 1998).
Protease inhibitors have often more functions besides inhibiting proteases.
Interestingly, protease inhibitors were proved to activate proteases to catalyze the synthesis and hydrolysis of peptides because the energy of the enzyme-
4 inhibitor complex can be utilized for the proteolytic reactions (Schechter and Ziv,
2006). Some important protease inhibitors are required to maintain the regular digestion physiology of animals. For example, trypsin inhibitors were found to evoke increased pancreatic secretion both in free status and in complexes, therefore playing an important role in the normal regulation of pancreatic function
(Pusztai et al., 1997).
1.2.2 Classification of protease inhibitors
Protease inhibitors can be categorized based on types of inhibition.
Competitive protease inhibitors normally bind or block the active site to prevent the substrate binding. The covalent enzyme-substrate binding usually leads to irreversible inhibition since it is not easy to break the covalent chemical bonds. A typical example of a competitive protease inhibitor is E64 (Barrett et al., 1982), an irreversible inhibitor of cysteine proteases that covalently binds to the active sites of cysteine proteases and can impact cysteines on other proteins (Sarin et al., 1993; Sarin et al., 1994). Non-competitive protease inhibitors can either bind to the active sites or bind to the allosteric sites to either change the conformations of the proteases or block substrate binding to abolish protease activity (Gaczynska and Osmulski, 2005; Tan et al., 2006). This provides the possibility of designing protease inhibitors that have wide range of inhibition
5 abilities towards various enzymes, thus leading to more efficient drug design
(Tan et al., 2006).
Protease inhibitors can also be classified by the type of proteases that they inhibit. The protease types are distinguished by the catalytic groups such as cysteine, serine, aspartic or metallic proteases (Rawlings and Barrett, 1993).
Thus, protease inhibitors can be classified into the classes described in the following sections.
Cysteine protease inhibitors
Cysteine protease inhibitors inhibit cysteine proteases such as papain, cathepsins and caspases. Studies of inhibitors against papains revealed their roles in the physiological and pathological processes and suggested the potential use of these inhibitors as drugs for disease treatment (Turk et al., 2003).
Cystatins that were initially characterized as the inhibitors of cysteine cathepsins, have extensive functions in processing and presentation of antigens, inflammation, cancer as well as inducing tumor necrosis factor and interleukin 10 synthesis and stimulating nitric oxide production (Kopitar-Jerala, 2006). Caspase inhibitors are used in the apoptosis studies due to the vast involvement of caspases in programmed cell death (Rupinder et al., 2007). For instance, the broad-spectrum caspase inhibitor zVAD-fmk was found to modulate the three major types of cell death by interfering with the functions of various caspases
(Vandenabeele et al., 2006). Most cysteine protease inhibitors were found in
6 animals and several in plants, eukaryotic microorganisms and bacteria (Ryan,
1990). Cysteine proteases are thought to have evolved to function not only in intracellular digestion to enable cell survival but also in secretory roles to help organism adapt to environmental stresses such as pH value change or parasite attack (Ryan, 1990).
Serine protease inhibitors (serpins)
Serine protease inhibitors are widely distributed in nature and can be classified into ten or more families (Laskowski and Kato, 1980), including bovine pancreatic trypsin inhibitors (Kunitz) family (Businaro et al., 1989), pancreatic secretory trypsin inhibitor (Kazal) family (Hecht et al., 1992), etc... This class contains protease inhibitors that inhibit well characterized proteases such as trypsin (Hirota et al., 2006) and chymotrypsin (Yoshimoto and Hansch, 1976).
The topological relationships between the disulfide bridges and the locations of the reactive site is a better indicator of family characteristics than sequence similarity (Laskowski and Kato, 1980). In addition, the patterns of disulfide bridges between members in the same family are usually conserved. Plants have protease inhibitors in most of the serine protease inhibitor families (Ryan, 1990;
Christeller and Laing, 2005), some of which are responsible for plant defense against pathogenic insects (Hilder et al., 1987; Broadway, 1989). Transgenic plants expressing two trypsin protease inhibitors show enhanced resistance against insects (Johnson et al., 1989). In recent years, the broad distribution of
7 serine proteases in living organisms resulted in the development of serine protease inhibitors with pharmacological properties (Konaklieva and Plotkin,
2004).
Metalloproteinase inhibitors
Compared to the numerous metalloproteinases that have been identified and characterized, the number of the metalloproteinase inhibitors that specifically inhibit these proteases is limited (Vendrell et al., 2000). Nonetheless, metalloproteinase inhibitors have been characterized in diverse species, including streptomyces (Tanaka et al., 1988), tomato (Rancour and Ryan, 1968), potato (Graham and Ryan, 1981; Hass and Ryan, 1981), and mushroom
(Kawagishi et al., 2002). Using animal models, many studies of metalloproteinase inhibitors focus on their essential roles in immune system
(Woessner, 2002) and potential use to treat various disorders implicating proteases (Hu et al., 2007). For many years, researchers have developed synthetic matrix metalloproteinases inhibitors (MMPIs) as therapeutical agents but with little success (Nuti et al., 2007).
Aspartic protease inhibitors
Typical members of aspartic protease inhibitors are pepsin inhibitors (Abu- erreish and Peanasky, 1974), rennin inhibitors (Luther et al., 1989) and cathepsin
D inhibitors (Keilova and Tomasek, 1976; Lison et al., 2006) that exhibit inhibition to aspartic proteases including pepsin, rennin, and cathepsin D, respectively
8 (Tsukuba et al., 2000). Aspartic proteases are relatively a small group that contains only 15 families; nonetheless, they have received enormous interest because of their significant roles in human diseases (Dash et al., 2003). Despite the fact that by far only one protease inhibitor is on the market against AIDS disease, a better characterization of HIV proteases will provide potential targets for drug design using corresponding inhibitors (Eder et al., 2007).
1.3 EXAMPLES OF PROTEASE INHIBITORS INVOLVED IN HOST-
PATHOGEN INTERACTIONS
1.3.1 Protease inhibitors in hosts (plants, animals and human)
1.3.1.1 Protease inhibitors are part of the host immune system
The immune system plays a critical role in protecting organisms from unfavorable environmental changes or pathogen attack. Host cells secret toxins and proteins in order to immobilize or kill the parasites and avoid invasions.
However, parasites have evolved to produce proteases to degrade these proteins and toxins to nonfunctional peptides. Both prokaryotic and eukaryotic parasites secrete various proteases to facilitate their invasion (Armstrong, 2006).
These proteases act as virulence factors that cause damages to the hosts. To protect against these virulence proteases, host cells produce protease inhibitors
9 to inhibit and inactivate pathogen proteases. Thus, protease inhibitors are crucial components of the host immune system.
1.3.1.2 Examples of hosts protease inhibitors involved in defense
1.3.1.2.1 Plant protease inhibitors
The plant protease inhibitor database PLANT-PIs
(http://www.ba.itb.cnr.it/PLANT-PIs/) provides resources about gene information and functional properties of 351 plant protease inhibitors (De Leo et al., 2002).
Some plant protease inhibitors are induced by insects and microorganisms (Ryan,
1990) and are known to have anti-microbe activities, indicating a significant role in plant defense (Mello et al., 2006; van Loon et al., 2006). Several transgenic plants that (over)express protease inhibitor encoding genes confer resistance to various pests (Hilder et al., 1987; Jouanin et al., 1998; Vila et al., 2005). In vitro assays revealed that several serine and cysteine protease inhibitors exhibit resistance to pathogenic fungi (Valueva and Molosov, 2004; Kim et al., 2005).
However, direct evidence of anti-pathogen activity of protease inhibitors in planta is limited. A potato carboxypeptidase inhibitor gene that encodes potato carboxypeptidase inhibitor (PCI), which belongs to the metalloproteinase inhibitors, has been identified (Graham and Ryan, 1981) and used in protein expression and functional analysis (Molina et al., 1992). PCI exhibited in vitro antifungal properties against important fungal pathogens, and transgenic rice
10 expressing the pci gene showed enhanced resistance to fungal pathogens like
Magnaporthe oryzae and Fusarium verticillioides (Quilis et al., 2007), providing evidence that a protease inhibitor gene confers resistance to phytopathogenic fungi in planta.
1.3.1.2.2 Cystatins
Since the first cysteine protease inhibitor, cystatin, has been isolated from chicken egg white (Fossum and Whitaker, 1968), the cystatin superfamily has expanded to contain proteins from mammals, birds, insects, and plants (Bobek and Levine, 1992; Abrahamson et al., 2003). It is well known that cysteine proteases comprise a group of proteolytic enzymes that play key roles in physiological processes and the presence of cystatins in the host to prevent the damages caused by the cysteine proteases produced by microorganisms (Bobek and Levine, 1992). As one of the most valuable protease inhibitors, Cystatin C is an endogenous marker for glomerular filtration and an indicator of tumor invasion and metastasis, inflammatory processes (Massey, 2004) and some kidney- related diseases (Menon et al., 2007). In a recent study, cystatin C and cystatin
D inhibited the replication of virus in human epithelial (HEp-2) cells (Peri et al.,
2007). Therefore, cystatins not only participate in the regulation of normal metabolic processes in the living organisms but are also involved in host defense against microbial infections.
11 1.3.1.2.3 Roles of human protease inhibitors in disease
In humans, protease inhibitors can play protective roles against infectious and other types of disease. The Gram-negative pathogenic bacteria, Klebsiella pneumoniae, causes hospital-acquired nosocomial infections, leading to disorders of respiration system (Gaynes and Edwards, 2005). In patients with pneumonia and sepsis, the expression levels of plasminogen activator inhibitor type1 (PAI-1) are consistently increased (Rijneveld et al., 2003). In vivo studies using mouse revealed that PAI-1 protects hosts against the invasion by
Klebsiella pneumonia, indicating the essential role of PAI-1 in the host defense against severe Gram-negative pneumonia (Renckens et al., 2007).
Protease inhibitors against HIV
Human immunodeficiency virus (HIV) proteases play important role in viral protein processing and are targeted during AIDS therapy. Researchers have discovered more than ten protease inhibitors against these proteases to prevent
HIV invasion of host cells (Hsu et al., 2006; Siegel and Gulick, 2007). The host protease inhibitor, serpin A1 has been shown to function against HIV by inhibiting the crucial protease that cleave the premature peptides into mature functional proteins in HIV (Anderson et al., 1993; Congote, 2007). Another secretory leukocyte protease inhibitor SLPI has also been found in oral epithelial cells as a component in the oral mucosal response to HIV-1 (Jana et al., 2005). Even though most of the protease inhibitors drugs against HIV are produced by
12 chemical synthesis, the elucidation and the characterization of the host proteins that act as natural barrier to HIV will benefit the HIV drug design as well as the evaluation of the drug specificity.
Serine protease inhibitor 6 from cytotoxic T cells
Serine protease inhibitor (SPI)-6 was shown to protect Dendritic cells
(DCs) against cytotoxic T lymphocytes (CTL)-induced apoptosis (Banchereau and Steinman, 1998). Since DCs have an essential role in the immune system to activate CTL, this finding indicates that SPI6 is a marker of DCs, and is thus involved in the host immunity (Banchereau and Steinman, 1998). A recent study unraveled that SPI6 can protect CTL cells from self-inflicted injury because SPI6 inhibits granzyme B (GrB) which mediates breakdown of cytotoxic granules
(Zhang et al., 2006).The case of SPI6 provides an example of protease inhibitors that protect host cells from being harmed by the enzymes they produce to confer resistance to the invading pathogens.
1.3.2 Protease inhibitors in pathogens
1.3.2.1 Overview - Protease inhibitors function in counterdefense
Recent studies revealed that a diversity of proteases from human and animals are involved in host defense (Puente and Lopez-Otin, 2004; Puente et al., 2005). Plants also were shown to have large numbers of proteases that
13 contribute to immunological functions (Xia, 2004; van der Hoorn and Jones,
2004). Thus, it is not surprising that pathogens have also evolved corresponding protease inhibitors to counterdefend themselves against their hosts to stay alive and enhance invasion. To counter host defense, pathogens secrete protease inhibitors that specifically target the proteases produced by their hosts, thus facilitating their invasion and colonization in the hosts. An increasing numbers of pathogen effectors including avirulence (Avr) proteins are found to be protease inhibitors (Xia, 2004), suggesting their important roles in counterdefense.
1.3.2.2 Examples of pathogen- secreted protease inhibitors involved in host-pathogen interactions
EPI1/EPI10, serine protease inhibitors from P. infestans
The oomycete plant pathogen Phytophthora infestans, causes the devastating late blight disease on tomato and potatoes (Kamoun and Smart,
2005). P. infestans has evolved to produce proteins called effectors that play important roles during infection processes by manipulating host processes
(Kamoun, 2006; Tian et al., 2007). A family of serine protease inhibitors has been identified, and among these two inhibitors, EPI1 and EPI10, physically bind and inhibit tomato serine protease P69B (Tornero et al., 1997), suggesting the inhibition by these protease inhibitors could form a novel type of defense-
14 counterdefense mechanism between plants and microbial pathogens (Tian et al.,
2004; Tian et al., 2005).
Avr2, a cysteine protease inhibitor from fungal pathogen C. fulvum
The fungal pathogen Cladosporium fulvum contains avirulence (Avr) genes that are recognized by corresponding resistance (R) genes and trigger the hypersensitive response (HR) in the host plant tomato (Thomas et al., 1998).
These Avr genes encode Avr proteins such as Avr2 (Luderer et al., 2002), Avr4
(Westerink et al., 2002), Avr5 (Xing et al., 1996) and Avr9 (Honee et al., 1995).
These Avr proteins have been characterized for their biochemical properties, recognition specificities and targets in planta. Among these, Avr2 is an irreversible cysteine protease inhibitor of tomato cysteine protease Rcr3pim
(Kruger et al., 2002) that is required for the Avr2 triggered HR in Cf-2 tomato
(Rooney et al., 2005). Physical interaction was also demonstrated between Avr2 and Rcr3pim.
EPICs, cysteine protease inhibitor family from the oomycete pathogen P. infestans
Apart from the serine protease inhibitor family, a novel family of putative protease inhibitors with cystatin-like domains has been identified from P. infestans (Tian et al., 2007). These are cystatin-like cysteine protease inhibitors
(EPICs). Among these, the epiC1 and epiC2B genes are unique to P. infestans with no orthologs in P. sojae or P. ramorum. They are up-regulated during
15 infection of tomato, suggesting a role during P. infestans -host interactions.
Biochemical analysis revealed that recombinant EPIC2B protein physically interacts and reversibly inhibits tomato novel cysteine protease PIP1, which has closely similarity to Rcr3 (Tian et al., 2007).
HiTI, a serine protease inhibitor from Haematobia irritans irritans (Diptera:
Muscidae)
A serine protease inhibitor from the fly Haematobia irritans irritans (Diptera:
Muscidae) was cloned and characterized (Azzolini et al., 2004). In vitro studies using recombinant protein rHiTI revealed that it inhibits bovine trypsin and human neutrophil elastase, confirming the previous findings that rHiTI showed inhibitory activity against the trypsin-like enzyme of H. i. irritans and indicating the possible role of this inhibitor in the inhibition of fly endogenous proteases and pathogenic bacterial proteases (Azzolini et al., 2005). In this case, the serine protease inhibitor HiTI represents a factor that originates from a pathogen vector and positively regulates host defense.
Chagasin, the endogenous cysteine-protease inhibitor of Trypanosoma cruzi
The human pathogen Trypanosoma cruzi is a parasitic protozoan that causes Chagas disease, a potentially fatal disease of humans (Meirelles et al.,
1992). Chagasin, a novel type of tight-binding inhibitor of papain-like cysteine proteases has been cloned and characterized from T. cruzi (Monteiro et al.,
16 2001). Further studies of the effects of chagasin on endogenous proteases of T. cruzi suggested that chagasin-mediated regulation plays an important role in parasite differentiation and infectivity (Santos et al., 2004).
Falstatin, an endogenous cysteine protease inhibitor of Plasmodium falciparum
Based on the homology to chagasin, falstatin was identified from the malaria parasite Plasmodium falciparum (Pandey et al., 2006). Recombinant falstatin expressed in E. coli reversibly inhibits P. falciparum cysteine protease falcipain-2 and falcipain-3 and is a weaker inhibitor of falcipain-1 and dipeptidyl aminopeptidase 1 (Pandey et al., 2006). These cysteine proteases mediate important proteolytic processes in the life cycle of P. falciparum (Wu et al., 2003).
Therefore, the inhibition of these proteases by falstatin indicates that P. falciparum has evolved a new strategy for eliminating the effects of host or parasite proteolysis during infection (Pandey et al., 2006).
Nippocystatin, a Cysteine Protease Inhibitor from Nippostrongylus brasiliensis
To evade host immunity, pathogens have evolved specific protease inhibitors. Like P. infestans, the intestinal nematode Nippostrongylus brasiliensis, human parasite, produces a cysteine protease inhibitor, named Nippocystatin
(NbCys) (Dainichi et al., 2001). Recombinant protein rNbCys was shown to strongly inhibit cysteine proteases such as cathepsin L and cathepsin B, and
17 selectively inhibit other cysteine proteases (Dainichi et al., 2001). In vivo expression of NbCys in transgenic mice also exhibit resistance to pathogen infection (Dainichi et al., 2001), providing an example of protease inhibitors that positively regulate host defense.
In recent years, in addition to the protease inhibitors described above, a number of protease inhibitors were identified in human, animals, plants as well as in pathogens and shown to be involved in host-pathogen interactions
(summarized in Table 1.1).
1.4 SUMMARY AND PROSPECTIVE RESEARCH ON PROTEASE
INHIBITORS
Summary
In recent years, an increasing number of protease inhibitors produced by hosts or pathogens were found to be involved in host defense or pathogen counterdefense mechanisms. Even though many of these inhibitors were shown to exhibit inhibition activities in vitro using recombinant proteins, some have been shown to contribute directly to host defense, suggesting a role in host-pathogen interactions. The studies from structural genomics to functional genomics enable us to elucidate the true functions of predicted protease inhibitors and if they are truly protease inhibitor, determine their targets in the hosts and their biological
18 functions during host-pathogen interactions. In combination with protease functions in the proteolytic processes, protease inhibitors will be discovered to act in various aspects of living organisms.
Protein crystallization enables structure analysis of protease-substrate complexes. In a recent report, a complete experimentally determined structure of the chagasin-cathepsin L complex elucidated their interaction precisely to the individual residue level and facilitated the design of potential drugs to treat
Chaga’s disease (Ljunggren et al., 2007). Crystallization studies on the enzyme- substrate complex for proteases-protease inhibitor pairs will also help to unravel their mode of actions and physical binding properties (Stoddard, 1996). X-ray co- crystallization studies revealed that human serine protease dipeptidyl peptidase
IV (DPP-IV) conformation is changed in one of the active sites to provide other potent area for more inhibitors binding (Sheehan et al., 2007).
Applications
The study of protease inhibitors identified from pathogens provides important knowledge to unravel their role in the infection processes (Armstrong,
2006), and the evolutionary pattern of these genes (Tiffin and Gaut, 2001). Plant protease inhibitor studies demonstrate their function in maintaining cell integrity and acting in plant defense signaling upon pathogen attacks (van der Hoorn and
Jones, 2004). It also provides valuable information for genetic manipulation of plants for resistance using protease inhibitor encoding genes. Protease inhibitors
19 in plants are able to suppress the enzymatic activities and predominantly inhibit proteases in pathogenic microorganisms (Valueva and Molosov, 2004). It was reported that more than 14 protease or protease inhibitor genes have been expressed in various plants to confer resistance to insects (Schuler et al., 1998).
Protease inhibitors have long been used in human disease therapy, such as respiratory diseases (Venkatasamy and Spina, 2007), cardiovascular diseases (Igic and Behnia, 2007), HIV diseases (Walmsley, 2007), cancers
(Montagut et al., 2006), etc... Proteases essential in pathogen metabolic or infection processes become usually targets for drug design. Nonetheless, the inhibition specificity of chemically synthesized protease inhibitors is always a big concern. Due to the lack of inhibition specificity, inappropriate usages of protease inhibitors can cause metabolic issues (Moyle, 2007), toxicity (Negredo et al.,
2006), and serious side effects (Baba, 2005). Clinical trials are the key to test the efficiency as well as the potential dangerous effects of the drugs (Sackner-
Bernstein, 2005). Ideal drugs made of protease inhibitors should exhibit strong inhibition to the targets and less toxicity to humans.
1.5 RESEARCH OBJECTIVES AND CHAPTER SUMMARIES
The objective of this thesis is to study the biochemical properties of P. infestans protease inhibitors of the EPIC class and PmEPIC1, an EPIC1 homolog from P. mirabilis , as well as of their targets proteases in tomato. The main
20 findings of this thesis are described in Chapter 2-4 and are briefly summarized below.
In Chapter 2, we test our hypothesis that two effectors, EPIC2B and Avr2, from unrelated pathogens target the same tomato defense protease Rcr3pim by studying the binding properties and inhibition patterns of these protease inhibitors and investigating their capability in triggering the hypersensitive response (HR) in the host plant tomato. Unlike Avr2, EPIC2B targets Rcr3pim but does not triggers
HR on Cf-2/Rcr3pim tomato plants, representing an example of a cunning effector that evolved in P. infestans to evade its host.
In Chapter 3, we characterize PmEPIC1, an EPIC1 homolog in
Phytophthora mirabilis. This work included comparative sequencing and active site analyses, cloning, expression and biochemical studies of PmEPIC1binding properties and inhibition of two tomato proteases Rcr3pim and PIP1.
In Chapter 4, we describe high-level expression of stable tagged proteins in the plant apoplast. Three C-terminal His-tagged proteins are successfully expressed in the N. benthamiana apoplast and the tags remain intact though both expression and affinity purification processes. In addition, the three proteins exhibited their biological activities in various functional assays.
21 1.6 REFERENCES
Abrahamson, M., Alvarez-Fernandez, M., and Nathanson, C.M. (2003) Cystatins. Biochem. Soc. Symp. 70: 179-199
Abu-erreish, G.M., and Peanasky, R.J. (1974) Pepsin Inhibitors from Ascaris Zzcmbricoides. The Journal of Biological Chemistry 249: 1566-1571
Anderson, E.D., Thomas, L., Hayflick, J.S., and Thomas, G. (1993) Inhibition ofHIV-1 gp160-dependent membrane fusion by a furin-directed alpha 1- antitrypsin variant. J. Biol. Chem. 268: 24887-24891
Armstrong, P.B. (2006) Proteases and protease inhibitors: a balance of activities in host-pathogen interaction. Immunobiology 211: 263-281
Azzolini, S.S., Santos, J.M., Souza, A.F., Torquato, R.J., Hirata, I.Y., Andreotti, R., and Tanaka, A.S. (2004) Purification, characterization, and cloning of a serine proteinase inhibitor from the ectoparasite Haematobia irritans irritans (Diptera: Muscidae). Experimental Parasitology 106: 103- 109
Azzolini, S.S., Sasaki, S.D., Campos, I.T., Torquato, R.J., M.A., J., and AS., T. (2005) The role of HiTI, a serine protease inhibitor from Haematobia irritans irritans (Diptera: Muscidae) in the control of fly and bacterial proteases. Exp. Parasitol. 111: 30-36
Baba, M. (2005) Advances in antiviral chemotherapy. Uirusu. 55: 69-75
Banchereau, J., and Steinman, R.M. (1998) Dendritic cells and the control of immunity. Nature 392: 245-252
Barrett, A.J., Kembhavi, A.A., Brown, M.A., Kirschke, H., Knight, C.G., Tamai, M., and Hanada, K. (1982) L-trans-Epoxysuccinyl-leucylamido(4- guanidino butane (E-64) and its analogues as inhibitors of cysteine proteinases including cathepsins B, H and L. Biochem. J. 201: 189-198
Bobek, L.A., and Levine, M.J. (1992) Cystatins - Inhibitors of Cysteine Proteinases. Critical Reviews in Oral Biology and Medicine 3: 307-332
22 Broadway, R.M. (1989) Characterization and ecological implications of midgut proteolytic activity in larval Pieris rapae and Trichoplusia hi. J. Chem. Ecol. 15: 2101-2113
Brooks, D.E., and Ollivier, F.J. (2004) Matrix metalloproteinase inhibition in corneal ulceration. Vet Clin North Am Small Anim Pract 34: 611-622
Businaro, R., Fioretti, E., Fumagalli, L., De Renzis, G., Fiorucci, L., and Ascoli, F. (1989) Bovine pancreatic trypsin inhibitor and related isoinhibitors in bovine liver. Journal Histochemistry and Cell Biology 93: 69-74
Christeller, J., and Laing, W. (2005) Plant serine proteinase inhibitors. Protein Pept Lett 12: 439-447
Congote, L.F. (2007) Serpin A1 and CD91 as host instruments against HIV-1 infection: are extracellular antiviral peptides acting as intracellular messengers? Virus Res. 125: 119-134
Dainichi, T., Maekawa, Y., Ishii, K., Zhang, T., Nashed, B.F., Sakai, T., Takashima, M., and Himeno, K. (2001) Nippocystatin, a Cysteine Protease Inhibitor from Nippostrongylus brasiliensis, Inhibits Antigen Processing and Modulates Antigen-Specific Immune Response. Infection and Immunity 69: 7380-7386
Dash, C., Kulkarni, A., Dunn, B., and Rao, M. (2003) Aspartic peptidase inhibitors: implications in drug development. Crit Rev Biochem Mol Biol. 38: 89-119
De Gregorio, E., Spellman, P.T., Rubin, G.M., and Lemaitre, B. (2001) Genome-wide analysis of the Drosophila immune response by using oligonucleotide microarrays. Proc Natl Acad Sci U S A. 98: 12590-12595
De Leo, F., Volpicella, M., Licciulli, F., Liuni, S., Gallerani, R., and Ceci, L.R. (2002) PLANT-PIs: a database for plant protease inhibitors and their genes. Nucleic Acids Res. 30: 347-348
Duffy, B., Schwietert, C., France, A., Mann, N., Culbertson, K., Harmon, B., and McCue, J.P. (1998) Transition metals as protease inhibitors. Biol Trace Elem Res 64: 197-213
23 Eder, J., Hommel, U., Cumin, F., Martoglio, B., and Gerhartz, B. (2007) Aspartic proteases in drug discovery. Curr Pharm Des. 13: 271-285
Fawcett, J.W., and Housden, E. (1990) The effects of protease inhibitors on axon growth through astrocytes. Development 109: 59-66
Fossum, K., and Whitaker, J.R. (1968) Ficin and Papain Inhibitor from Chicken Egg White. Arch. Biochem. Biophys. 125: 367-375
Gaczynska, M., and Osmulski, P.A. (2005) Small-molecule inhibitors of proteasome activity. Methods Mol. Biol. 301: 3-22
Gaynes, R., and Edwards, J.R. (2005) Overview of Nosocomial Infections Caused by Gram-Negative Bacilli. Clinical Infectious Diseases 41: 849- 854
Graham, J.S., and Ryan, C.A. (1981) Accumulation of metallocarboxy-peptidase inhibitor in leaves of wounded potato plants. Biochem. Biophys. Res. Commun. 101: 1164-1170
Hass, G.M., and Ryan, C.A. (1981) Carboxypeptidase inhibitor from potatoes. Methods Enzymol. 80: 778-779
Hecht, H.J., Szardenings, M., Collins, J., and Schomburg, D. (1992) Three- dimensional structure of a recombinant variant of human pancreatic secretory trypsin inhibitor (Kazal type). J. Mol. Biol. 225: 1095-1103
Hilder, V.A., Gatehouse, A.M.R., Sheerman, S.E., Barker, R.F., and Boulter, D. (1987) A novel mechanism of insect resistance engineered into tobacco. Nature 330: 160-163
Hirota, M., Ohmuraya, M., and Baba, H. (2006) The role of trypsin, trypsin inhibitor, and trypsin receptor in the onset and aggravation of pancreatitis. Review. J Gastroenterol. 41: 832-836
Honee, G., Melchers, L.S., Vleeshouwers, V.G.A.A., van Roekel, J.S.C., and de Wit, P.J.G.M. (1995) Production of the AVR9 elicitor from the fungal pathogen Cladosporium fulvum in transgenic tobacco and tomato plants. Journal Plant Molecular Biology 29: 909-920
24 Hsu, J.T., Wang, H.C., Chen, G.W., and Shih, S.R. (2006) Antiviral drug discovery targeting to viral proteases. Curr Pharm Des. 12: 1301-1314
Hu, J., Van den Steen, P.E., Sang, Q.X., and Opdenakker, G. (2007) Matrix metalloproteinase inhibitors as therapy for inflammatory and vascular diseases. Nat Rev Drug Discov. 6: 480-498
Igic, R., and Behnia, R. (2007) Pharmacological, immunological, and gene targeting of the renin-angiotensin system for treatment of cardiovascular disease. Curr Pharm Des. 13: 1199-1214
Ingvarsson, P.K. (2005) Molecular Population Genetics of Herbivore-induced Protease Inhibitor Genes in European Aspen (Populus tremula L., Salicaceae). Molecular Biology and Evolution 22: 1802-1812
Irving, P., Troxler, L., Heuer, T.S., Belvin, M., Kopczynski, C., Reichhart, J., Hoffmann, J.A., and Hetru, C. (2001) A genome-wide analysis of immune responses in Drosophila. Proc Natl Acad Sci 98: 15119-15124
Jana, N.K., Gray, L.R., and Shugars, D.C. (2005) Human immunodeficiency virus type 1 stimulates the expression and production of secretory leukocyte protease inhibitor (SLPI) in oral epithelial cells: a role for SLPI in innate mucosal immunity. J. Virol. 79: 6432-6440
Johnson, R., Narvaez, J., An, G., and Ryan, C.A. (1989) Expression of proteinase inhibitors I and I1 in transgenic tobacco plants: Effects on natural defense against Manduca sexta larvae. Proc. Natl. Acad. Sci. USA 86: 9871-9875
Jouanin, L., Bonade-Bottino, M., Girard, C., Morrot, G., and Giband, M. (1998) Transgenic plants for insect resistance. Plant Sci. 131: 1-11
Kamoun, S. (2006) A Catalogue of the Effector Secretome of Plant Pathogenic Oomycetes. Annu. Rev. Phytopathol. 44: 41-60
Kamoun, S., and Smart, C.D. (2005) Late blight of potato and tomato in the genomics era. Plant Dis. 89: 692-699
Kawagishi, H., Hamajima, K., and Inoue, Y. (2002) Novel hydroquinone as a matrix metallo-proteinase inhibitor from the mushroom, Piptoporus betulinus. Biosci Biotechnol Biochem. 66: 2748-2750
25 Keilova, H., and Tomasek, V. (1976) Isolation and properties of cathespin D inhibitor from potatoes. Collect. Czech. Chem. Commun. : 41: 489-497
Kim, J.Y., Park, S.C., Kim, M.H., Lim, H.T., Park, Y., and Hahm, K.S. (2005) Antimicrobial activity studies on a trypsin-chymotrypsin protease inhibitor obtained from potato. Biochem. Biophys. Res. Commun. 330: 921-927
Konaklieva, M.I., and Plotkin, B.J. (2004) The relationship between inhibitors of eukaryotic and prokaryotic serine proteases. Mini Rev Med Chem. 4: 721- 739
Kopitar-Jerala, N. (2006) The role of cystatins in cells of the immune system. FEBS Letters 580: 6295-6301
Kruger, J., Thomas, C.M., Golstein, C., Dixon, M.S., Smoker, M., Tang, S., Mulder, L., and Jones, J.D. (2002) A tomato cysteine protease required for Cf-2-dependent disease resistance and suppression of autonecrosis. Science 296: 744-747
Laskowski, M., and Kato, l. (1980) Protein Inhibitors of Proteinases. Ann. Rev. Biochem. 49: 593-626
Lison, P., Rodrigo, I., and Conejero, V. (2006) A novel function for the cathepsin D inhibitor in tomato. Plant Physiol. 142: 1329-1339
Ljunggren, A., Redzynia, I., Alvarez-Fernandez, M., Abrahamson, M., Mort, J.S., Krupa, J.C., Jaskolski, M., and Bujacz, G. (2007) Crystal structure of the parasite protease inhibitor chagasin in complex with a host target cysteine protease. J. Mol. Biol. 371: 137-153
Luderer, R., Takken, F.L., de Wit, P.J., and Joosten, M.H. (2002) Cladosporium fulvum overcomes Cf-2-mediated resistance by producing truncated AVR2 elicitor proteins. Mol. Microbiol. 45: 875-884
Luther, R.R., Stein, H.H., Glassman, H.N., and Kleinert, H.D. (1989) Renin inhibitors: specific modulators of the renin-angiotensin system. Arzneimittelforschung 39: 1-5
Massey, D. (2004) Commentary: clinical diagnostic use of cystatin C. J. Clin. Lab Anal. 18: 55-60
26 Meirelles, M.N., Juliano, L., Carmona, E., Silva, S.G., Costa, E.M., Murta, A.C.M., and Scharfstein, J. (1992) Inhibitors of the major cysteinyl proteinase (GP57/51) impair host cell invasion and arrest the intracellular development of Trypanosoma cruzi in vitro. Mol. Biochem. Parasitol. 52
Mello, G.C., Desouza, I.A., Marangoni, S., Novello, J.C., Antunes, E., and Macedo, M.L. (2006) Oedematogenic activity induced by Kunitz-type inhibitors from Dimorphandra mollis seeds. Toxicon 47: 150-155
Menon, V., Shlipak, M.G., Wang, X., Coresh, J., Greene, T., Stevens, L., Kusek, J.W., Beck, G.J., Collins, A.J., Levey, A.S., and Sarnak, M.J. (2007) Cystatin C as a risk factor for outcomes in chronic kidney disease. Ann Intern Med. 147: 19-27
Molina, M.A., Aviles, F.X., and Querol, E. (1992) Expression of a synthetic gene encoding potato carboxypeptidase inhibitor using a bacterial secretion vector. Gene 116: 129-138
Montagut, C., Rovira, A., and Albanell, J. (2006) The proteasome: a novel target for anticancer therapy. Clin Transl Oncol. 8: 313-317
Monteiro, A.C.S., Abrahamson, M., Lima, A.P.C.A., Vannier-Santos, M.A., and Scharfstein, J. (2001) Identification, characterization and localization of chagasin, a tight-binding cysteine proteases inhibitor in Trypanosoma cruzi. J. Cell Sci. 114: 3933-3942
Moyle, G. (2007) Metabolic issues associated with protease inhibitors. J Acquir Immune Defic Syndr. 45: 19-26
Negredo, E., Bonjoch, A., and Clotet, B. (2006) Benefits and concerns of simplification strategies in HIV-infected patients. J Antimicrob Chemother. 58: 235-242
Nuti, E., Tuccinardi, T., and Rossello, A. (2007) Matrix metalloproteinase inhibitors: new challenges in the era of post broad-spectrum inhibitors. Curr. Pharm. Des. 13: 2087-2100
Pandey, K.C., Singh, N., Arastu-Kapur, S., Bogyo, M., and Rosenthal, P.J. (2006) Falstatin, a cysteine protease inhibitor of Plasmodium falciparum, facilitates erythrocyte invasion. PLoS Pathog 2: 1031-1041
27 Peri, P., Hukkanen, V., Nuutila, K., Saukko, P., Abrahamson, M., and Vuorinen, T. (2007) The cysteine protease inhibitors cystatins inhibit herpes simplex virus type 1-induced apoptosis and virus yield in HEp-2 cells. J. Gen. Virol. 88: 2101-2105
Puente, X.S., Gutierrez-Fernandez, A., Ordonez, G.R., Hillier, L.W., and Lopez-Otin, C. (2005) Comparative genomic analysis of human and chimpanzee proteases. Genomics 86: 638-647
Puente, X.S., and Lopez-Otin, C. (2004) A Genomic Analysis of Rat Proteases and Protease Inhibitors. Genome Biol. 14: 609-622
Pusztai, A., Grant, G., Bardocz, S., Baintner, K., Gelencser, E., and Ewen, S.W. (1997) Both free and complexed trypsin inhibitors stimulate pancreatic secretion and change duodenal enzyme levels. AJP - Gastrointestinal and Liver Physiology 272: 340-350
Quilis, J., Meynard, D., Vila, L., Aviles, F.X., Guiderdoni, E., and San Segundo, B. (2007) A potato carboxypeptidase inhibitor gene provides pathogen resistance in transgenic rice. Plant Biotechnol J. 5: 537-553
Rancour, J.M., and Ryan, C.A. (1968) Isolation of a carboxypeptidase B inhibitor from potatoes. Arch. Biochem. Biophys. 125: 380-382
Rape, M., and Jentsch, S. (2002) Taking a bite: proteasomal protein processing. Nature Cell Biology 4: 113-116
Rawlings, N.D., and Barrett, A.J. (1993) Evolutionary families of peptidases. Biochem. J. 290: 205-218
Renckens, R., Roelofs, J.J., Bonta, P.I., Florquin, S., de Vries, C.J., Levi, M., Carmeliet, P., van't Veer, C., and van der Poll, T. (2007) Plasminogen activator inhibitor type 1 is protective during severe Gram-negative pneumonia. Blood 109: 1593-1601
Rijneveld, A.W., Florquin, S., Bresser, P., Levi, M., De Waard, V., Lijnen, R., Van Der Zee, J.S., Speelman, P., Carmeliet, P., and Van Der Poll, T. (2003) Plasminogen activator inhibitor type-1 deficiency does not influence the outcome of murine pneumococcal pneumonia. Blood 102: 934-939
28 Rooney, H.C., Van't Klooster, J.W., van der Hoorn, R.A., Joosten, M.H., Jones, J.D., and de Wit, P.J. (2005) Cladosporium Avr2 inhibits tomato Rcr3 protease required for Cf-2-dependent disease resistance. Science 308: 1783-1786
Rupinder, S.K., Gurpreet, A.K., and Manjeet, S. (2007) Cell suicide and caspases. Vascul. Pharmacol. 46: 383-393
Ryan, C.A. (1990) Protease Inhibitors in Plants: Genes for Improving Defenses Against Insects and Pathogens. Annu. Rev. Phytopathol. 28: 425-449
Sackner-Bernstein, J. (2005) Reducing the risks of sudden death and heart failure post myocardial infarction: utility of optimized pharmacotherapy. Clin Cardiol. 28: 19-27
Santos, C.C., Anna, C.S., Terres, A., Cunha-e-Silva, N.L., Scharfstein, J., and Lima, A.P.C.d. (2004) Chagasin, the endogenous cysteine-protease inhibitor of Trypanosoma cruzi, modulates parasite differentiation and invasion of mammalian cells. Journal of Cell Science 118: 901-915
Sarin, A., Adams, D.H., and Henkart, P.A. (1993) Protease inhibitors selectively block T cell receptor-triggered programmed cell death in a murine T cell hybridoma and activated peripheral T cells. J. Exp. Med. 178: 1693-1700
Sarin, A., Clerici, M., Blatt, S.P., Hendrix, C.W., Shearer, G.M., and Henkart, P.A. (1994) Inhibition of activation-induced programmed cell death and restoration of defective immune responses of HIV+ donors by cysteine protease inhibitors. J. Immunol. 153: 862-872
Schechter, I., and Ziv, E. (2006) Inhibitors can activate proteases to catalyze the synthesis and hydrolysis of peptides. Biochemistry 45: 14567-14572
Schuler, T.H., Poppy, G.M., Kerry, B.R., and Denholm, I. (1998) Insect resistant transgenic plants. Trends Biotechnol. 16: 168-175
Sheehan, S.M., Mest, H., and Watson, B.M., et al. (2007) Discovery of non- covalent dipeptidyl peptidase IV inhibitors which induce a conformational change in the active site. Bioorganic & Medicinal Chemistry Letters 17: 1765-1768
29 Siegel, L., and Gulick, R.M. (2007) New antiretroviral agents. Curr Infect Dis Rep. 9: 243-251
Stoddard, B.L. (1996) Intermediate trapping and laue X-ray diffraction: potential for enzyme mechanism, dynamics, and inhibitor screening. Pharmacol Ther. 70: 215-256
Tan, X., Osmulski, P.A., and Gaczynska, M. (2006) Allosteric regulators of the proteasome: potential drugs and a novel approach for drug design. Curr Med Chem. 13: 155-165
Tanaka, K., Saito, H., Oda, K., Murao, S., and Takahashi, H. (1988) Cloning and expression of the metallo-proteinase inhibitor (S-MPI) gene from Streptomyces nigrescens. Biochem Biophys Res Commun 155: 487-492
Thomas, C.M., Dixon, M.S., Parniske, M., Golstein, C., and Jones, J.D. (1998) Genetic and molecular analysis of tomato Cf genes for resistance to Cladosporium fulvum. Philos Trans R Soc Lond B Biol Sci. 353: 1413- 1424
Tian, M., Benedetti, B., and Kamoun, S. (2005) A Second Kazal-like protease inhibitor from Phytophthora infestans inhibits and interacts with the apoplastic pathogenesis-related protease P69B of tomato. Plant Physiol. 138: 1785-1793
Tian, M., Huitema, E., da Cunha, L., Torto-Alalibo, T., and Kamoun, S. (2004) A Kazal-like extracellular serine protease inhibitor from Phytophthora infestans targets the tomato pathogenesis-related protease P69B. J. Biol. Chem. 279: 26370-26377
Tian, M., Win, J., Song, J., van der Hoorn, R., van der Knaap, E., and Kamoun, S. (2007) A Phytophthora infestans cystatin-like protein targets a novel tomato papain-like apoplastic protease. Plant Physiol. 143: 364- 377
Tiffin, P., and Gaut, B.S. (2001) Molecular Evolution of the Wound-Induced Serine Protease Inhibitor wip1 in Zea and Related Genera. Molecular Biology and Evolution 18: 2092-2101
30 Tornero, P., Conejero, V., and Vera, P. (1997) Identification of a new pathogen- induced member of the subtilisin-like processing protease family from plants. J Biol Chem 272: 14412-14419
Tsukuba, T., Okamoto, K., Yasuda, Y., Morikawa, W., Nakanishi, H., and Yamamoto, K. (2000) New functional aspects of cathepsin D and cathepsin E. Mol. Cells 10: 601-611
Turk, D., Turk, B., and Turk, V. (2003) Papain-like lysosomal cysteine proteases and their inhibitors: drug discovery targets? Biochem Soc Symp. 70: 15-30
Valueva, T.A., and Molosov, V.V. (2004) Role of inhibitors of proteolytic enzymes in plant defense against phytopathogenic microorganisms. Biochemistry (Moscow) 69: 1305-1309 van der Hoorn, R.A.L., and Jones, J.D.G. (2004) The plant proteolytic machinery and its role in defence. Current Opinion in Plant Biology 7: 400- 407 van Loon, L.C., Rep, M., and Pieterse, C.M.J. (2006) Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 44: 135-162
Vandenabeele, P., Vanden, B.T., and Festjens, N. (2006) Caspase inhibitors promote alternative cell death pathways. Sci. STKE 358: pe44
Vendrell, J., Querol, E., and Aviles, F.X. (2000) Metallocarboxypeptidases and their protein inhibitors. Structure, function and biomedical properties. Biochim. Biophys. Acta. 1477: 284-298
Venkatasamy, R., and Spina, D. (2007) Protease inhibitors in respiratory disease: focus on asthma and chronic obstructive pulmonary disease. Expert Review of Clinical Immunology 3: 365-381
Vila, L., Quilis, J., Meynard, D., Breitler, J.C., Marfa, V., Murillo, I., Vassal, J.M., Messeguer, J., Guiderdoni, E., and San Segundo, B. (2005) Expression of the maize proteinase inhibitor (mpi) gene in rice plants enhances resistance against stripped stem borer (Chilo suppressalis): effects on larval growth and insect gut proteinases. Plant Biotechnol. J. 3: 187-202
31 Walmsley, S. (2007) Protease inhibitor-based regimens for HIV therapy: safety and efficacy. J Acquir Immune Defic Syndr. 45: 5-13
Westerink, N., Roth, R., Van den Burg, H.A., de Wit, P.J.G.M., and Joosten, M.H.A.J. (2002) The AVR4 Elicitor Protein of Cladosporium fulvum Binds to Fungal Components with High Affinity. MPMI 15: 1219-1227
Woessner, J.F. (2002) MMPs and TIMPs-An Historical Perspective. Molecular Biotechnology 22: 33-50
Wu, Y., Wang, X., Liu, X., and Wang, Y. (2003) Data-mining approaches reveal hidden families of proteases in the genome of malaria parasite. Genome Res. 13: 601-616
Xia, Y. (2004) Proteases in pathogenesis and plant defence. Cellular Microbiology 6: 905-913
Xing, T., Higgins, V.J., and Blumwald, E. (1996) Regulation of Plant Defense Response to Fungal Pathogens: Two Types of Protein Kinases in the Reversible Phosphorylation of the Host Plasma Membrane H+-ATPase. Plant Cell 8: 555-564
Ye, S., and Goldsmith, E.J. (2001) Serpins and other covalent protease inhibitors. Curr Opin Struct Biol 11: 740-745
Yoshimoto, M., and Hansch, C. (1976) Correlation analysis of Baker's studies on enzyme inhibition. J. Med. Chem. 19: 71-98
Zhang, M., Park, S.M., Wang, Y., Shah, R., Liu, N., Murmann, A.E., Wang, C.R., Peter, M.E., and Ashton-Rickardt, P.G. (2006) Serine protease inhibitor 6 protects cytotoxic T cells from self-inflicted injury by ensuring the integrity of cytotoxic granules. Immunity 24: 451-461
32
Type PI Name Pathogen/Host Mode of Target Refs. action /inhibition Tian et al., Serine Phytophthora P69B, tomato EPI1/EPI10 N/A 2004; Tian PI infestans serine protease et al., 2005 Azzolini et bovine trypsin and Haematobia al., 2004; HiTI N/A human neutrophil irritans irritans Azzolini et elastase al., 2005 various serine Galleria proteases including Frobius et ISPI-1, 2, 3 Inducible mellonella trypsin and toxic al., 2000 proteases Chagasin papain-like Cysteine Trypanosoma tight- Santos et cysteine proteases PI cruzi binding al., 2005 (CPs) Nippostrongylus cathepsin L and Dainichi et Nippocystatin N/A brasiliensis cathepsin B al., 2001 falcipain-2 and Plasmodium Pandey et Falstatin Reversible falcipain-3 and falciparum al., 2006 others Cladosprium Rcr3pim, tomato Renier et Avr2 Irreversible fulvum cysteine protease al., 2005 Tian et al., PIP1 and Rcr3pim , Phytophthora 2007; Song EPICs Reversible tomato cysteine infestans et al., proteases unpublished bacterial Wedde et Metallo Galleria metalloproteinases; al., 1998; IMPI1, 2 Inducible PI mellonella thermolysin-like Clermont et metalloproteinases al., 2004 Aspartyl Saccharomyces Cawley et Y1 Competitive yapsin 1; Sap9p PI cerevisiae al., 2003
Table 1.1: Examples of protease inhibitors involved in host-pathogen interactions
33 CHAPTER 2
TWO EFFECTORS, AVR2 AND EPIC2B, SECRETED BY UNRELATED
PATHOGENS TARGET THE TOMATO DEFENSE PROTEASE RCR3PIM
2.1 ABSTRACT
Current models of plant-pathogen interactions stipulate that pathogens secrete effector proteins that disable plant defense components known as virulence targets. Occasionally, the perturbations caused by these effectors trigger innate immunity via plant disease resistance proteins as described by the
“guard model”. This model is nicely illustrated by the interaction between the fungal plant pathogen Cladosporium fulvum and tomato. C. fulvum secretes a protease inhibitor Avr2 that targets the tomato cysteine protease Rcr3pim. In plants that carry the resistance protein Cf2, Rcr3pim is required for resistance to C. fulvum strains expressing Avr2, thus fulfilling one of the predictions of the guard model. The model has two other predictions that have not been tested. First, virulence targets, such as Rcr3pim are expected to directly contribute to basal defense. Second, if the virulence targets are important for basal defense, then
34 they should be disabled by different pathogen effectors. In this study we tested these two predictions using a different pathogen of tomato, the oomycete
Phytophthora infestans that is distantly related to fungi like C. fulvum. This pathogen secretes an array of protease inhibitors, one of which, EPIC2B inhibits tomato cysteine proteases. Here, we show that, similar to Avr2, EPIC2B binds and inhibits Rcr3pim. However, unlike Avr2, EPIC2B is a reversible inhibitor of
Rcr3pim and does not trigger hypersensitivity on Cf-2/Rcr3pim tomato. We also found that the rcr3-3 mutant of tomato that carries a premature stop codon in the
Rcr3 gene exhibits enhanced susceptibility to P. infestans, suggesting a role for
Rcr3pim in basal defense. In conclusion, our findings fulfill the predictions of the guard model and suggest that the effectors Avr2 and EPIC2B secreted by two unrelated pathogens of tomato target the same defense protease Rcr3pim.
Compared to C. fulvum, P. infestans appears to have evolved a cunning effector that carries virulence activity but does not trigger plant innate immunity.
35 2.2 INTRODUCTION
Plant pathogens secrete effectors into the apoplast and cytoplasm of plants to facilitate colonization and suppress host defense (Jones and Dangl,
2006). However, in some plant cultivars, effectors are recognized by disease resistance (R) proteins resulting in a programmed cell death, a defense response, known as the hypersensitive response (HR) (Jia et al., 2000). In such cases, effectors are said to have an avirulence (Avr) activity and their interactions with the R proteins typically follow the gene-for gene hypothesis with resistance only occurring when the cognate R-Avr pair interact (Scofield et al., 1996; Jia et al.,
2000).
Recognition of Avr proteins by R proteins can be direct. For instance,
Pseudomonas syringae avirulence gene product AvrPto directly interacts with the resistance gene product Pto in tomato, providing an explanation of gene-for-gene specificity in bacterial speck disease resistance (Scofield et al., 1996; Tang et al.,
1996). The rice blast fungus Magnaporthe grisea effector protein Avr-Pita176 binds directly to the Pi-ta Leucine rich domain (LRD) region inside the plant cell to initiate the defense response in planta (Jia et al., 2000). Fungal pathogen
Melampsora lini AvrL567 avirulence genes are expressed in haustoria and their encoding proteins are recognized directly by L5, L6, and L7 resistance genes products inside plant cells and these trigger the hypersensitive response-like necrosis (Dodds et al., 2004).
36
In many other cases, however, there is no evidence of a direct interaction between R gene and its corresponding avr gene (Luderer et al., 2002). Unlike the direct recognition gene for gene model (Keen, 1990; Thompson and Burdon,
1992; Scofield et al., 1996; Tang et al., 1996; Jia et al., 2000), indirect recognition of plant pathogen effectors by plant resistant genes (R genes) is mediated by the so-called “virulence target” during infection described by the guard model (van der Biezen and Jones, 1998; Dangl and Jones, 2001). Virulence targets are host proteins that are targeted by pathogen effectors, which are guarded by R proteins that mediate the resistance response. In the absence of a corresponding
R protein, the manipulation by the Avr protein of its virulence target(s) leads to the virulence function of Avr in a susceptible host. Examples of such virulence targets are Pto in AvrPto-Prf recognition in Pseudomonas syringae - tomato interaction (Rathjen et al., 1999), RIN4 in AvrB/AvrRpm1-RPM1 recognition in
Pseudomonas syringae - Arabidopsis interaction (Mackey et al., 2003), and
Rcr3pim in Avr2-Cf-2 recognition in Cladosporium fulvum - tomato interaction
(Rooney et al., 2005).
The guard model is illustrated by the interaction between the fungal plant pathogen Cladosporium fulvum and its host tomato. Tomato (Solanum esculentum) lines that contain the R-gene Cf-2 express resistance to the fungal pathogen Cladosporium fulvum that carries avirulence gene avr2, whereas C.
37 fulvum causes disease on Cf-0 tomato lines containing no known Cf genes.
Mutational analysis of genes required for Cf-2 function identified Rcr3 (required for Cladosporium fulvum resistance3), which was located on tomato chromosome 2 (Dixon et al., 2000). The Solanum pimpinellifolium allele of Rcr3 encodes Rcr3pim, required for Avr2-triggered hypersensitive response on Cf-
2/Rcr3pim tomato. The role of Rcr3 in the perception of Avr2 by Cf-2 is consistent with the guard hypothesis that the Rcr3-Avr2 complex, not other Avr2-cysteine protease complexes, activates Cf-2 (Rooney et al., 2005). Rcr3 may be guarded by Cf-2 and Cf-2 activates defense following the physical interaction of Rcr3pim with Avr2 and the inhibition of Rcr3pim by Avr2 (Jones and Dangl, 2006). However, the roles of Rcr3 protease activity in tomato as well as the role of inhibition by
Avr2 during infection process remain unknown (Rooney et al., 2005). Even though Rcr3 is required specifically for Cf-2 function (Dixon et al., 2000), whether or not Rcr3 contributes to tomato defense against C. fulvum was not reported.
Both proteases and protease inhibitors play important roles in host- microbe interactions. In the hosts, proteases cleave proteins secreted by pathogens as a defense strategy (Xia, 2004). Inversely, protease inhibitors produced by pathogens target the host proteases to suppress the host defense to facilitate their evasion (van der Hoorn and Jones, 2004). The plant pathogen,
Phytophthora infestans, causes the late blight disease on both potato and tomato, and belongs to oomycete group which is distantly related to fungi like C. fulvum
38 (Baldauf, 2003; Kamoun, 2003). P. infestans secretes effectors such as the extracellular cystatin-like cysteine protease inhibitor family (EPICs) (Tian et al.,
2007). Among these, EPIC2B physically interacts and inhibits the recently- identified tomato protease PIP1 (Phytophthora inhibited protease 1), which is closely related to Rcr3 (Tian et al., 2007). Thus, Rcr3pim is potentially targeted by effectors such as EPIC2B or other EPICs from other pathogens. Sequence analysis revealed that EPIC2B and Avr2 bear no similarity. Although EPIC2B has significant similarity to cystatins, Avr2 appears to be a novel type of inhibitor and the only similarity with EPIC2B is the presence of cysteine disulfide bridges.
Therefore EPIC2B and Avr2 are two effectors from two unrelated pathogens that potentially target the same protease in tomato.
The guard model has two other predictions that have not been tested in the Avr2/Rcr3/Cf-2 system. First, if the virulence targets are important for basal defense, then they should be disabled by different pathogen effectors. For example, RIN4, a virulence target from Arabidopsis thaliana, is targeted by three different bacterial type III effectors (Reviewed by Jones and Dangl, 2006). Two of these effectors, AvrRpm1 and AvrB, interact with and induce the phosphorylation of RIN4 (Mackey et al., 2002) whereas AvrRpt2 cleaves RIN4 into two parts
(Chisholm et al., 2005; Kim et al., 2005). Similarly, the tomato serine-threonine protein kinase Pto is directly targeted by two unrelated P. syringae effectors,
AvrPto and AvrPtoB (Abramovitch and Martin, 2005). Second, virulence targets,
39 such as Rcr3pim are thought to directly contribute to basal defense. Upon infection by C. fulvum, rcr3-3 mutant appeared significantly less susceptible than wild-type plants, suggesting that rcr3-3 is required for Cf-2 function (Dixon et al.,
2000). Although genetic evidence demonstrates that Rcr3 is not a component of a conserved Cf signal transduction pathway (Dixon et al., 2000), the fact that
Rcr3pim may contribute to tomato basal defense to P. infestans cannot be ruled out.
In this study we tested the two predictions of the guard model using a different pathogen of tomato, P. infestans. Our in vitro studies indicated that, like
Avr2, recombinant EPIC2B (rEPIC2B) targeted and inhibited tomato cysteine protease Rcr3pim. However, unlike Avr2, EPIC2B is a reversible inhibitor of
Rcr3pim. In addition, our results show that Rcr3pim contributes to tomato basal defense to P. infestans. These results suggest that Rcr3pim is targeted by two different effectors from unrelated pathogens. To our knowledge, this is the first report of a virulence target targeted by two effectors from unrelated pathogens. It appears that P. infestans secretes a cunning effector that inhibits the defense protease in tomato without triggering the plant innate immunity.
40 2.3 MATERIALS AND METHODS
Plants, plasmids and strains
Tomato (Solanum esculentum) plants Cf-0 (Moneymaker), Cf-2/Rcr3pim,
Cf-2/rcr3-3 (rcr3 mutant), and Cf-9 were used in protein infiltration assays.
Tomato and Nicotiana benthamiana plants were grown at 25°C, 60% humidity, and under 16 hour-light/8 hour-dark cycles.
Binary vector pCB302-3 (Xiang et al., 1999) was used to clone pCB302-
Rcr3pim-His (see plasmid structure below) for agro-infiltration and transient expression in N. benthamiana. Rcr3pim-His fragment was amplified by PCR with
SpeI and His-XbaI anchored primers (RCR3Spe: 5’-
GCGACTAGTATGGCTATGAAAGTTGATTTGATG - 3’ and RCR3Xba_R: 5’-
GCGTCTAGATTAgtgatggtgatggtgatgCGCTATGTTTGGATAAGAAGAC - 3’) from pMWBinRcr3pim: His: HA plasmid (Rooney et al., 2005) (Provided by Dr.
Jonathan Jones) and clone into SpeI-XbaI digested pCB302-3. Plasmid pFLAG-
Avr2 was constructed by cloning the overlap PCR product encoding Avr2 into the vector pFLAG-ATS (Sigma, St. Louis, MO). The codon usage of Avr2 was modified to favor protein expression in E. coli.
Escherichia coli DH5α, BL21 and Agrobacterium tumefaciens GV3101 used in this study were routinely grown in LB medium (Sambrook et al., 1989) at
37°C and 28°C, respectively.
41 Protein expression and purification
Expression of FLAG-EPIC2B (rEPIC2B), FLAG-Avr2 (rAvr2) and FLAG-
EPI1 (rEPI1) in E. coli using plasmids pFLAG-EPIC2B, pFLAG-Avr2 and pFLAG-
EPI1 was conducted as described, a cystatin-like protease inhibitor of
Phytophthora infestans (Kamoun et al., 1997; Tian et al., 2004). Purification of
FLAG-EPIC1, FLAG-Avr2 and FLAG-EPI1 was performed as described earlier
(Kamoun et al., 1997; Tian et al., 2004). Protein concentrations were determined using the BioRad protein assay (BioRad Laboratories, Hercules, CA). To access purity, eluted fractions of purified protein were subjected on a SDS-PAGE gel followed by silver nitrate staining (Leck and Wiese, 2004).
Transient expression in N. benthamiana by agro-infiltration
Transient expression of Rcr3pim-His in planta was performed according to the methods described previously (Kruger et al., 2002). A. tumefaciens strains
GV3101 carrying plasmids pCB302-Rcr3pim-His, empty vector pCB302-3 (Xiang et al., 1999) and pJL3-p19-55 (provided by Lindbo et al.) were used. pJL3-p19-
55 is a construct expressing P19 protein of tomato bushy stunt virus (TBSV), a suppressor of post-transcriptional gene silencing in Nicotiana benthamiana
(Voinnet et al., 2003). Overnight Agrobacterium cultures were harvested by centrifugation at 2000 g for 20 min, and resuspended in 10 mM MgCl2, 10 mM
MES (pH 5.6) and 150 μM acetosyringone. Resuspended Agrobacterium culture of pCB302-Rcr3pim-His or pCB302-3 with an optical density (OD600) of 1.0 was
42 mixed with equal volume of Agrobacterium culture of pJL3-p19-55 with an optical density (OD600) of 1.0. The mixtures were kept at room temperature for 3 hours and then infiltrated into leaves of 6-week-old N. benthamiana plants. Apoplastic fluids from infiltrated leaves were isolated 4 days after infiltration. Apoplast fluids were prepared from N. benthamiana leaves according to the method of de Wit and Spikeman (1982). For leaves from N. benthamiana, a solution of 300 mM
NaCl, 50 mM NaPO4 pH 7.0 (Kruger et al., 2002) was used as extraction buffer.
The collected apoplastic fluids were filter sterilized (0.45 μM), and were used immediately or stored at -80°C.
SDS-PAGE and western blot analysis
Proteins were subjected to 15% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). After, gel was either stained with Coomassie
Brilliant Blue or transferred to nitrocellulose membrane (BioRad Laboratories,
Hercules, CA) using a Mini trans-Blot apparatus (BioRad Laboratories, Hercules,
CA). Western blot was used to detect the protein using alkaline phosphatase kit
(BioRad Laboratories, Hercules, CA). Anti-His alkaline phosphatase conjugated antisera and anti-FLAG antisera were purchased from Sigma (St. Louis, MO).
Coimmunoprecipitation (Co-IP)
Coimmunoprecipitation of rEPIC2B/rAvr2 and N. benthamiana intercellular fluids was performed using the FLAG-tagged protein immunoprecipitation kit
43 (Sigma, St. Louis, MO) as described previously (Tian et al., 2004). 800 pmol of purified rEPIC1/2B was preincubated with 500 µl of N. Benthamiana intercellular fluids expressing Rcr3pim-His for 30 min at 25°C. 40 µl of anti-FLAG M2 resin was added and incubated at 4°C for 2 hours with gentle shaking. The precipitated protein complexes were eluted in 60 µl of 150 ng/µl FLAG peptide solution and were analyzed by SDS-PAGE and Western blot.
DCG-04 profiling assay
Activity profiling of Rcr3pim and other cysteine proteases in N. benthamiana intercellular fluids was performed as described elsewhere (van der
Hoorn et al., 2004; Rooney et al., 2005) using DCG-04 (supplied by Michiel
Leeuwenburgh, Leiden University), a biotinylated analog of the irreversible cysteine protease inhibitor E-64 (Greenbaum et al., 2000). For N. benthamiana intercellular fluids expressing Rcr3pim-His, 50 µl of intercellular fluids were diluted ten-fold in DCG-04 assay buffer (50 mM sodium acetate, 10 mM L-cysteine, pH
5.0) to a final volume of 500 µl. The diluted samples were pre-incubated with an excess of E64 (1020 nM, Sigma, St Louis, MO) or rEPIC2B (2 μM) or rEPI1 (2
μM) or rAvr2 (2 μM) for one hour at room temperature. Biotin-labeled DCG-04
(220 nM) was added to each reaction to label cysteine proteases. The reaction mixtures were then incubated for 30 min at room temperature. Proteins were precipitated by adding one ml ice-cold acetone in -20°C followed by centrifugation at 13000x g for 30 min at 4°C. The pellets were washed with ice-
44 cold 70% (w/w) acetone, air-dried, and resuspended in 500 µl TBS buffer (50 mM
Tris/HCl, 150 mM NaCl, and pH 7.5). To capture the biotinylated proteins, 20 µl
Ni-NTA magnetic beads (Qiagen, Madison, WI) were added to each reaction and incubated for 16 hours at 4°C. The Ni-NTA beads were washed with 1 ml TBS buffer using a magnetic stand (Promega, Madison, WI) to remove non- specifically bound proteins. Biotin labeled proteins were harvested by boiling the magnetic beads in 25 µl Laemmli SDS loading buffer, and subjected to SDS-
PAGE (12%) and western blotting. Biotin labeled proteins were detected by probing the membrane with streptavidin horseradish peroxidase (HRP) polymers
(Sigma, St Louis, MO) followed by color development using the substrate 3,3’- diaminobenzidine (Sigma, St Louis, MO).
Time course DCG-04 profiling assay
Protein samples E64 (1020 nM, Sigma, St Louis, MO), rEPIC2B (2 μM) and Avr2 (2 μM) were pre-incubated with ten times DCG-04 assay buffer that was diluted N. benthamiana apoplast fluids expressing Rcr3pim-His for half an hour in room temperature. DCG-04 (220 nM) was added to each reaction to label cysteine proteases with biotin. Instead of using 30 min DCG-04 labeling time, ice cold acetone was added after 0, 10, 20, 30, 60 or 120 minutes after DCG-04 labeling to stop the labeling reaction and precipitate the protein complex. Further procedures and detection were described above.
45 Protein infiltration assay
FLAG-tagged proteins rEPIC2B and rAvr2 were used in the protein infiltration assay. After affinity purification, rEPIC2B and rAvr2 proteins were cleaned and concentrated by Microcon YM-3 Centrifugal Filter Unit (Millipore,
Billerica, MA; 3 kDa cut off) and diluted to 0.4 µM final concentration in double distilled water before infiltrating on Cf-0, Cf-2/Rcr3pim, and Cf-2/rcr3-3 tomato leaves. The photos of treated plants were taken five days after infiltration.
Virulence assay
P. infestans strain 88069H was regularly cultured on Rye medium at 18°C in the dark for 2 weeks before zoospores are collected. After 14 days, plates were flooded with chilled ddH2O and incubated at 4°C for at least two hours.
Zoospores released into the ddH2O under such condition mimicking their natural condition. The suspension medium was then measured for spore concentration using a hemacytometer and the concentration was adjusted to 105 zoospores per milliliter water for inoculation. We took 10 μl droplets containing P. infestans zoospores suspension (103) to inoculate the underside of detached tomato leaves. Inoculated leaves were incubated in the moist trays at 18°C with 16 hour- light/8 hour-dark cycle. For each plant with P. infestans inoculation, we measured the disease lesions size (mm) at 3, 4, 5 days after inoculation and calculated the lesion growth rate (LGR) for the day 3-4 and the day 4-5 periods. All disease
46 score data were subject to statistical analysis using Origin7.0 for Windows and one-way ANOVA, and means were compared at 0.01 probability level.
2.4 RESULTS
Like Avr2, EPIC2B physically interacts with Rcr3pim
Because the tomato cysteine protease PIP1 is related to another tomato cysteine protease Rcr3pim and is inhibited by P. infestans EPIC2B, we hypothesized that Rcr3pim is also targeted by EPIC2B. To test this hypothesis, we used co-immunoprecipitation to investigate the interaction between EPIC2B with
Rcr3pim. We expressed His tagged Rcr3pim in N. benthamiana apoplast using
Agrobacterium tumefaciens-mediated transient protein expression (Chapter 4) and recombinant proteins FLAG tagged EPIC2B and Avr2 (rEPIC2B and rAvr2, respectively) in E. coli (Fig. 2.7; Fig. 2.8). The FLAG antibody agarose bead immunoprecipitations resulted in the recovery of the rEPIC2B and rAvr2 proteins in all samples except the control lane without protease inhibitors (Fig. 2.1 top panel and bottom panel). In addition to rEPIC2B or rAvr2, a 30-kD protein corresponding to Rcr3pim-His was pulled down in the presence of rEPIC2B/rAvr2
(Fig. 2.1 top panel). Western blot analyses showed that α-His antisera interacts with both bands (Fig. 2.1 middle panel), suggesting a physical interaction between Rcr3pim and rEPIC2B/rAvr2. In addition, there was no degradation of
EPIC2B during incubation with Rcr3pim, indicating that like Avr2, EPIC2B is not a substrate for Rcr3pim.
47
Like Avr2, EPIC2B inhibits Rcr3pim
Because rEPIC2B physically interacts with Rcr3pim, we tested whether rEPIC2B inhibits Rcr3pim by DCG-04 protease profiling assay as described before
(Rooney et al., 2005; Tian et al., 2007). DCG-04 is a biotinylated probe that covalently binds to cysteine proteases of the papain family and can be detected by HRP-streptavidin (Greenbaum et al., 2000; Greenbaum et al., 2002). E-64, an irreversible cysteine protease inhibitor (Barrett et al., 1982), is used here as a positive inhibition control. Protease activity profiling with 220nM DCG-04 was performed in the absence of an inhibitor (–) or in the presence of E-64 (0.2µM),
FLAG-EPI1 (EPI1) (2 µM), FLAG-Avr2 (Avr2) (2 µM), or FLAG-EPIC2B (EPIC2B)
(2 µM). Rcr3pim-His was captured (pulled down) by Ni–nitrilotriacetic acid (NTA)
(binding to His tag) beads, electrophoresed on an SDS gel, and detected with streptavidin horseradish peroxidase (streptavidin-HRP). The DCG-04 labeling reactions were stopped at 30 min by adding ice-cold acetone. Detection with streptavidin-HRP revealed that the labeling of Rcr3pim by DCG-04 was strongly reduced by rEPIC2B, whereas Rcr3pim was not biotinylated in the presence of
E64 or rAvr2 as positive inhibition controls (Fig. 2.2). This indicates that rEPIC2B inhibits Rcr3pim cysteine protease activity albeit to a slightly lesser degree than
E64 and rAvr2. rEPI1 (Tian et al., 2004), a serine protease inhibitor form P. infestans was used as a negative inhibition control.
48 Unlike Avr2, EPIC2B is a reversible inhibitor to Rcr3pim
To test whether the inhibition of Rcr3pim by EPIC2B is reversible or not, we performed a time course of DCG-04 protease activity profiling. Acetone was added after 0, 10, 20, 30, 60 or 120 minutes after DCG-04 labeling to stop the labeling reaction and precipitate the protein complexes. In the absence of inhibitors, biotinylated Rcr3pim-His became clearly detectable 10 min after addition of DCG-04 and reached a maximal level at 120 min (Fig. 2.3). In contrast, preincubation with rEPIC2B blocked DCG-04 labeling of Rcr3pim-His at
30 min and reduced labeling at 60 to 120 min, suggesting that Rcr3pim inhibition by rEPIC2B is reversible compared to the irreversible inhibition by rAvr2 and E64.
Unlike Avr2, EPIC2B does not trigger HR on Cf-2/Rcr3pim tomato
To investigate whether rEPIC2B triggers hypersensitive response (HR) on
Cf-2/Rcr3pim tomato, we infiltrated the leaves of tomato plants with purified
EPIC2B side by side with purified Avr2. Our results showed that unlike Avr2,
EPIC2B does not cause visible HR symptoms on Cf-2/Rcr3pim tomato plants 5 days after infiltration (Fig. 2.4; Fig. 2.9). In another test, we found that unlike rAvr2, neither low (0.4 µM) nor high (2 µM) concentration of purified rEPIC2B trigger HR on Cf-2/Rcr3pim tomato (data not shown). These results indicate that although EPIC2B inhibits Rcr3pim, it does not activate Cf2-mediated hypersensitivity in contrast to Avr2.
49 Rcr3pim mutant tomato shows enhanced susceptibility to P. infestans
To test whether Rcr3pim contributes to tomato defense to P. infestans, we used a standard zoospore inoculation assay on detached tomato leaves.
Zoospore suspensions (103/ml) were obtained from 10-14 days old P. infestans culture after adding ice cold water with additional two hours incubation and inoculated underside of tomato leaves 10 µl per spot. Lesions were measured at
3, 4 and 5 days post-inoculation. Lesion growth rate (mm/day, LGR) from two time periods (day3-4 and day 4-5) was used to quantify the susceptibility of different types of tomato plants to P. infestans. The difference of the LGR between the Cf-2/Rcr3pim and Cf-2/rcr3-3 and between Cf-2/Rcr3pim and Cf-0 are statistically significant at P<0.01 level (Table 2.1). Analysis of lesion growth rate revealed that tomato plants carrying rcr3 mutant (Cf-2/rcr3-3) exhibited enhanced susceptibility to P. infestans compared to the tomatoes carrying Rcr3 wild type
(Cf-2/Rcr3pim). Tomato rcr3-3 mutant carries a premature stop codon in Rcr3pim. It seems that Rcr3pim contributes to the basal defense of tomato plants to pathogen
P. infestans. In addition, Cf-2 tomato showed enhanced resistance to
Phytophthora infestans than Cf-0 tomato, which means Cf-2 or a linked gene in the introgressed region contributes to the basal defense of tomato plants against
P. infestans (Fig. 2.5).
50 2.5 DISCUSSION
The interactions between proteases and their inhibitors are likely to represent a defense-counterdefense mechanism in the host-pathogen interplay due to the widespread occurrences of proteolytic processes. In recent years, increasing number of proteases and protease inhibitors were shown to be implicated in both pathogen infection and host defense processes (van der Hoorn and Jones, 2004; Xia, 2004). One example is the tomato protease Rcr3pim which is a virulence target of protease inhibitor Avr2 that is indirectly recognized by Cf-2, in accordance with the guard model. However, there are two predictions of the guard model that have not yet been tested: (i) virulence targets, such as Rcr3pim are expected to directly contribute to basal defense and (ii) if the virulence targets are important for basal defense, then they should be disabled by different pathogen effectors. In this study, we tested these two predictions by investigating the biochemical properties of another effector EPIC2B from a different pathogen
P. infestans and its relationship to the tomato protease Rcr3pim. Our findings fulfill the predictions of the guard model and suggest that two effectors, EPIC2B and
Avr2, secreted by two unrelated pathogens of tomato target the same defense protease Rcr3pim. Like Avr2, EPIC2B targets and inhibits Rcr3pim in the in vitro assays. However, unlike Avr2, EPIC2B is a reversible inhibitor to Rcr3pim in the experimental conditions in this study and does not trigger the hypersensitive response on Cf-2/Rcr3pim tomato. Furthermore, our data suggested that Rcr3pim contributes to basal defense to P. infestans in tomato.
51
Our findings lead us to suggest a model illustrating the targeting and inhibition of a common tomato defense protease by unrelated effectors from two different pathogens (Fig. 2.6). We propose that P. infestans effector EPIC2B targets Rcr3pim in Cf-2 tomato, leading to a reversible inhibition of Rcr3pim and the suppression of plant defense. On the other side, C. fulvum secretes Avr2, a cysteine protease inhibitor that also targets and inhibits Rcr3pim, causing the hypersensitive response in Cf-2 tomato. Unlike Avr2-Rcr3pim interaction, the
EPIC2B-Rcr3pim interaction suppresses the host defense without triggering plant innate immunity. The model depicted in Figure 2.6 is likely to represent a simplified version since more components could be involved in protein complexes and the signaling pathway downstream of Cf-2. It is probable that there are more effectors from P. infestans or other pathogens that target Rcr3pim.
In summary, compared to C. fulvum, P. infestans has evolved a cunning effector,
EPIC2B that reversibly inhibits the virulence target in the host but avoids being recognized by Cf-2.
Infection assays with the rcr3-3 mutant indicated that Rcr3pim clearly contributes to basal defense to P. infestans. However, we were unable to test whether the defense function of Rcr3pim requires Cf-2 due to the lack of Rcr3pim tomato plants that also do not contain Cf-2. In addition, in cultivated tomato (S. esculentum), Rcr3esc confers an autonecrosis in the presence of Cf-2. This
52 phenotype is caused by S. esculentum allele Rcr3esc (also known as ne, necrosis), which will spread to all the leaves of the plants (Kruger et al., 2002). In addition, the mechanism behind the enhanced susceptibility of Cf-0 tomato remains unknown, due to the fact that more genes are present in the introgression segment between Cf-2/Rcr3pim and Cf-0.
The fact that P. infestans protease inhibitors target different apoplastic cysteine proteases provides an example of effectors’ contribution to virulence though manipulation of several host targets (Jones and Dangl, 2006). Therefore more than one target of EPIC2B is possible. Biochemical studies unraveled that
EPIC2B binds and inhibits PIP1 which is another target of EPIC2B in tomato, although PIP1 showed weaker physical binding to EPIC2B (Tian et al., 2007).
This suggests that similar to the possible role of Rcr3pim in Avr2-Cf2 association,
Rcr3pim might be one of the virulence targets of P. infestans cysteine protease
EPIC2B in tomato. Similar to the fact that EPIC2B reversibly inhibits PIP1,
EPIC2B is a reversible inhibitor to Rcr3pim.
We expect that there are other effectors, such as other cystatin-like cysteine protease inhibitors in the EPIC family or orthologs of these EPICs from other Phytophthora species or other oomycetes that could trigger the HR on Cf-
2/Rcr3pim upon targeting to Rcr3pim. Another P. infestans cystatin-like cysteine protease inhibitor, EPIC1, physically interacts with Rcr3pim, even though it doesn’t
53 seem to directly bind to PIP1 (Data not shown). Test of these effectors’ targeting and inhibition patterns as well as the HR response assay will help address these questions. Despite the likelihood that multiple cysteine proteases are targeted by both EPIC2B and Avr2, here we clearly showed that the mutual target Rcr3pim contributes to defense against P. infestans. Whether Rcr3pim also contributes to defense against C. fulvum is unclear. Thus the effective target of Avr2 could be a different protease than Rcr3pim. In that case Rcr3pim serves as a decoy that Cf2 detects to activate hypersensitivity and resistance.
Why is inhibition of Rcr3pim different between EPIC2B and Avr2? It is possible that EPIC2B-Rcr3pim interaction forms a different three-dimensional conformation than the structure in the Avr2-Rcr3pim interaction caused by different binding sites. EPIC2B possibly inhibits Rcr3pim by non-covalent binding such as substrate-binding, partially substrate-binding, or backward binding (Rzychon et al., 2004). These associations could lead to the blockage of active site center of protease Rcr3pim. In contrast, Avr2 could inhibits Rcr3pim by covalent binding, causing active site distortion or active site center blockage (Rzychon et al., 2004).
Similarly, in the protein infiltration assay, the weaker, non-covalent binding of
EPIC2B to Rcr3pim may lead to transient complexes between EPIC2B and
Rcr3pim. Thus, perhaps Cf-2 cannot recognize this transient complex, resulting in no HR on Cf-2/Rcr3pim tomatoes. Many cystatins were reported to inhibit their targets reversibly such as chicken cystatin (Kos et al., 1992), Cystatin E (Ni et al.,
54 1997), Cystatin F (Ni et al., 1998), and cystatin C (Zore et al., 2001). Our data suggested that similar to these cystatins, EPIC2B could have evolved as a reversible inhibitor possibly to evade Cf2 recognition.
It was proposed that inhibition of Rcr3pim by Avr2 induces a conformation change in Rcr3pim that triggers the Cf-2 protein to active HR (Rooney et al., 2005).
Future study on the conformation status of Rcr3pim before and after being targeted by EPIC2B/Avr2 would test various models behind the findings that unlike Avr2, EPIC2B inhibits Rcr3pim but is not recognized by Cf-2. The structure of tomato protease Rcr3pim as well as effector Avr2 is unknown at this moment even though the 3D structures of the EPICs can be generated by Comparative
Modeling (Song et al., unpublished) using Modeler9v1 (Sali and Blundell, 1993;
Marti-Renom et al., 2000). Since the identification of the active sites by homology to other proteins or from known biochemical data is not always possible or successful, it will be necessary to analyze purified proteins via NMR
Spectroscopy (Wuthrich, 2001). The success of transient protein expression in
Nicotiana benthamiana apoplast provides us opportunities to obtain sufficient amount of purified Rcr3pim protein for crystal structure analysis. Further studies of the binding and inhibition sites of both proteins will help us understand the mechanism of their specific binding properties and inhibition of these proteins.
55 2.6 ACKNOWLEDGEMENT
We thank Dr. Joe Win for critical reading and editing, Dr. John Lindbo for providing the pJL13-p19-55 vector, Dr. Jonathan Jones for providing the Cf-
2/Rcr3pim and Cf-2/rcr3-3 tomato seeds and Kerilynn Jagger for preparing the N. benthamiana and tomato plants in the green house. This work was supported by the by National Research Initiative Competitive Grant 2005-35319-15305 from the USDA Cooperative State Research, Education, and Extension Service.
Salaries and research support were provided by State and Federal Funds appropriated to the Ohio Agricultural Research and Development Center, the
Ohio State University.
2.7 REFERENCES
Abramovitch, R.B., and Martin, G.B. (2005). AvrPtoB: a bacterial type III effector that both elicits and suppresses programmed cell death associated with plant immunity. FEMS Microbiol. Lett. 245, 1-8.
Baldauf, S.L. (2003). The Deep Roots of Eukaryotes. Science 300, 1703-1706.
Barrett, A.J., Kembhavi, A.A., Brown, M.A., Kirschke, H., Knight, C.G., Tamai, M., and Hanada, K. (1982). L-trans-Epoxysuccinyl-leucylamido(4- guanidino butane (E-64) and its analogues as inhibitors of cysteine proteinases including cathepsins B, H and L. Biochem. J. 201, 189-198.
Chisholm, S.T., Dahlbeck, D., Krishnamurthy, N., Day, B., Sjolander, K., and Staskawicz, B.J. (2005). Molecular characterization of proteolytic cleavage sites of the Pseudomonas syringae effector AvrRpt2. Proc. Natl Acad. Sci. USA 102, 2087-2092.
56 Dangl, J.L., and Jones, J.D.G. (2001). Plant pathogens and integrated defence responses to infection. Nature 411, 826-833.
Dixon, M.S., Golstein, C., Thomas, C.M., van Der Biezen, E.A., and Jones, J.D. (2000). Genetic complexity of pathogen perception by plants: the example of Rcr3, a tomato gene required specifically by Cf-2. Proc. Natl. Acad. Sci. U S A 97, 8807-8814.
Dodds, P.N., Lawrence, G.J., Catanzariti, A., Ayliffe, M.A., and Ellis, J.G. (2004). The Melampsora lini AvrL567 Avirulence Genes Are Expressed in Haustoria and Their Products Are Recognized inside Plant Cells. The Plant Cell 16, 755-768.
Greenbaum, D., Medzihradszky, K.F., Burlingame, A., and Bogyo, M. (2000). Epoxide electrophiles as activity-dependent cysteine protease profling and discovery tools. Chem. Biol. 7, 569-581.
Greenbaum, D., Arnold, W., Lu, F., Hayrapetian, L., Baruch, A., Krumrine, J., Toba, S., Chehade, K., Bromme, D., Kuntz, I.D., and Bogyo, M. (2002). Small Molecule Affinity Fingerprinting: a Tool for Enzyme Family Subclassification, Target Identification, and Inhibitor Design. Chem. Biol. 9, 1085-1094.
Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P., and Valent, B. (2000). Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. EMBO J. 19, 4004-4014.
Jones, J.D.G., and Dangl, J.L. (2006). The plant immune system. Nature Reviews 444, 323-329.
Kamoun, S. (2003). Molecular genetics of pathogenic oomycetes. Eukaryotic Cell 2, 191-199.
Kamoun, S., van West, P., de Jong, A.J., de Groot, K., Vleeshouwers, V., and Govers, F. (1997). A gene encoding a protein elicitor of Phytophthora infestans is down-regulated during infection of potato. Mol Plant Microbe Interact 10, 13-20.
Keen, N.T. (1990). Gene-for-gene complementarity in plant-pathogen interactions. Annu. Rev. Genet. 24, 447-463.
57 Kim, H.S., Desveaux, D., Singer, A.U., Patel, P., Sondek, J., and Dangl, J.L. (2005). The Pseudomonas syringae effector AvrRpt2 cleaves its C- terminally acylated target, RIN4, from Arabidopsis membranes to block RPM1 activation. Proc. Natl Acad. Sci. USA 102.
Kos, J., Dolinar, M., and Turk, V. (1992). Isolation and characterisation of chicken L- and H-kininogens and their interaction with chicken cysteine proteinases and papain. Agents Action. Suppl. 38, 331-339.
Kruger, J., Tomas, C.M., Golstein, C., Dixon, M.S., Smoker, M., Tang, S., Mulder, L., and Jones, J.D.G. (2002). A Tomato Cysteine Protease Required for Cf-2-Dependent Disease Resistance and Suppression of Autonecrosis. Science 296, 745-747.
Leck, J.R., and Wiese, T.J. (2004). Purification and characterization of the L- fucose transporter. Protein Expression and Purification 37, 288-293.
Luderer, R., Takken, F.L., de Wit, P.J., and Joosten, M.H. (2002). Cladosporium fulvum overcomes Cf-2-mediated resistance by producing truncated AVR2 elicitor proteins. Molecular Microbiology 45, 875-884.
Mackey, D., Holt, B.F., Wiig, A., and Dangl, J.L. (2002). RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1 mediated disease resistance in Arabidopsis. Cell 108, 743-754.
Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R., and Dangl, J.L. (2003). Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance. Mol Cell. 11, 284-286.
Marti-Renom, M.A., Stuart, A., Fiser, A., Sanchez, R., Melo, F., and Sali, A. (2000). Comparative protein structure modeling of genes and genomes. Annu. Rev. Biophys. Biomol. Struct. 29, 291-325.
Ni, J., Abrahamson, M., and Zhang, M., et al. (1997). Cystatin E is a Novel Human Cysteine Proteinase Inhibitor with Structural Resemblance to Family 2 Cystatins. Journal of Biological Chemistry 272, 10853-10858.
Ni, J., Fernandez, M.A., Danielsson, L., Chillakuru, R.A., Zhang, J., Grubb, A., Su, J., Gentz, R., and Abrahamson, M. (1998). Cystatin F is a glycosylated human low molecular weight cysteine proteinase inhibitor. J. Biol. Chem. 273, 24797-24804.
58 Rathjen, J.P., Chang, J.H., Staskawicz, B.S., and Michelmore, R.W. (1999). Constitutively expressed Pto induces a Prf-dependent hypersensitive response in the absence of avrPto. EMBO J. 18, 3232-3240.
Rooney, H.C.E., van't Klooster, J.W., van der Hoorn, R.A.L., Joosten, M.H.A.J., Jones, J.D.G., and de Wit, P.J.G.M. (2005). Cladosporium Avr2 Inhibits Tomato Rcr3 Protease Required for Cf-2-Dependent Disease Resistance. Science 308, 1785-1786.
Rzychon, M., Chmiel, D., and Stec-Niemczyk, J. (2004). Modes of inhibition of cysteine proteases. Acta Biochimica Polonica 51, 861-873.
Sali, A., and Blundell, T.L. (1993). Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234, 779-815.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Scofield, S.R., Tobias, C.M., Rathjen, J.P., Chang, J.H., Lavelle, D.T., Michelmore, R.W., and Staskawicz, B.J. (1996). Molecular basis of gene- for- gene specificity in bacterial speck disease of tomato. Science 274, 2063-2065.
Tang, X., Frederick, R.D., Zhou, J., Halterman, D.A., Jia, Y., and Martin, G.B. (1996). Initiation of plant disease resistance by physical interaction of AvrPto and Pto kinase. Science 274, 2060-2063.
Thompson, J.N., and Burdon, J.J. (1992). Gene-forgene coevolution between plants and parasites. Nature 360, 121-125.
Tian, M., Huitema, E., Da, C., L., Torto-Alalibo, T., and Kamoun, S. (2004). A Kazal-like extracellular serine protease inhibitor from Phytophthora infestans targets the tomato pathogenesis-related protease P69B. J Biol Chem 279, 26370-26377.
Tian, M., Win, J., Song, J., van der Hoorn, R., van der Knaap, E., and Kamoun, S. (2007). A Phytophthora infestans cystatin-like protein targets a novel tomato papain-like apoplastic protease. Plant Physiol. 143, 364- 377.
59 van der Biezen, E.A., and Jones, J.D.G. (1998). Plant disease-resistance proteins and the gene-forgene concept. Trends Biochem. Sci. 23, 454-456. van der Hoorn, R.A., Leeuwenburgh, M.A., Bogyo, M., Joosten, M.H., and Peck, S.C. (2004). Activity profiling of papain-like cysteine proteases in plants. Plant Physiology 135, 1170-1178. van der Hoorn, R.A.L., and Jones, J.D.G. (2004). The plant proteolytic machinery and its role in defence. Current Opinion in Plant Biology 7, 400- 407.
Voinnet, O., Rivas, S., Mestre, P., and Baulcombe, D. (2003). An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J 33, 949- 956.
Wuthrich, K. (2001). The way to NMR structures of proteins. Nature Struct. Biol. 8, 923-925.
Xia, Y. (2004). Proteases in pathogenesis and plant defence. Cellular Microbiology 6, 905-913.
Xiang, C., Han, P., Lutziger, I., Wang, K., and Oliver, D.J. (1999). A mini binary vector series for plant transformation. Plant Mol Biol 40, 711-717.
Zore, I., Kraovec, M., Cimerman, N., Kuhelj, R., Werle , B., Nielsen, H.J., Brunner, N., and Kos, J. (2001). Cathepsin B/Cystatin C Complex Levels in Sera from Patients with Lung and Colorectal Cancer. Biol. Chem. 382, 805-810.
60
Figure 2.1 Like Avr2, EPIC2B physically interacts Rcr3pim Coimmunoprecipitation (Co-IP) of rEPIC2B/rAvr2 and Rcr3pim-His using FLAG antisera. Eluates from Coimmunoprecipitations of rEPIC2B or rAvr2 with proteins in apoplastic fluids from N. benthamiana leaves infiltrated with Agrobacterium tumefaciens carrying the binary vector pCB302-Rcr3pim-His (Rcr3pim-His +) or pCB302-3 (Rcr3pim-His -) were analyzed on SDS-PAGE gel followed by silver staining or Western blot. The + and – signs refer to the presence or absence of Rcr3pim-His, respectively. Western blot with α-FLAG showed the recovery of rEPIC2B and rAvr2 from the elution fractions, while blot with α-His showed the presence of the Rcr3pim-His in the elution fractions. The ca. 30 kDa band that was pulled down with rEPIC2B or rAvr2 corresponds to Rcr3pim-His. The size in kDa of the molecular weight markers is shown on the left.
61
Figure 2.2 Like Avr2, EPIC2B inhibits Rcr3pim Inhibition of Rcr3pim produced in N. benthamiana apoplast by rEPIC2B and rAvr2. Apoplastic fluid was isolated from N. benthamiana expressing Rcr3pim-His. Protease activity profiling with 220nM DCG-04 was performed in the absence (–) of inhibitor or in the presence (+) of E-64, FLAG-EPI1 (rEPI1), FLAG-Avr2 (rAvr2), or FLAGEPIC2B (rEPIC2B). Rcr3pim-His was captured (pulled down) by Ni-NTA beads, electrophoresed on an SDS gel, and detected with streptavidin-HRP. The DCG-04 labeling reactions were stopped at 30min by adding ice-cold acetone into the reaction mix. Detection with streptavidin-HRP reveals that Rcr3pim-His is not biotinylated in the presence of E-64 or rAvr2, whereas biotinylation of Rcr3pim occurs without inhibitor or with rEPI1, indicating that, like E-64 and rAvr2, rEPIC2B inhibits Rcr3pim cysteine protease activity. Approximate molecular weights of the labeled Rcr3pim-His proteins are shown on the left side.
62
Figure 2.3 Unlike Avr2, EPIC2B is a reversible inhibitor to Rcr3pim Time course of DCG-04 labeling was used to analyze the inhibition of Rcr3pim by rEPIC2B, rAvr2, or E64. Protease activity profiling with 220nM DCG-04 was performed in the absence (–) of inhibitor or in the presence (+) of E-64, FLAG- Avr2 (rAvr2) or FLAG-EPIC2B (rEPIC2B). Rcr3pim-His was captured (pulled down) by Ni-NTA beads, electrophoresed on an SDS gel, and detected with streptavidin-HRP. Acetone was added after 0, 10, 20, 30, 60 or 120 minutes after DCG-04 labeling to stop the labeling reaction and precipitate the protein complex. Approximate molecular weights of the labeled Rcr3pim-His proteins are shown on the left side.
63
Figure 2.4 Unlike Avr2, EPIC2B does not trigger hypersensitive response on Cf-2/Rcr3pim tomato Purified proteins rAvr2 and rEPIC2B were cleaned and diluted to concentration of 0.4 µM and then were infiltrated into tomato leaves. rAvr2 triggered hypersensitive response (HR) on Cf-2/Rcr3pim not on Cf-2/rcr3-3 or Cf-0 tomato plants. rEPIC2B didn’t trigger HR on any of these tomato plants under certain concentration (0.4µM). Cleaned buffer solution with neither rAvr2 nor rEPIC2B protein was used as a negative control for agroinfiltration, and the experiment was repeated three times with the same results.
64 5.0 Cf-2/Rcr3pim 4.8 Cf-2/rcr3-3 4.6 Cf-0 4.4 4.2 4.0 3.8 3.6 3.4 3.2 3.0 Lesion Growth Rate (LGR) (mm/day) (LGR) Rate Growth Lesion Day 3-4 Day 4-5 Time course post inoculation
Figure 2.5 Rcr3pim contributes to tomato basal defense to P. infestans Graphic view of the lesion growth rate along the time course revealed that Cf- 2/rcr3-3 showed enhanced susceptibility to P. infestans. Lesions were measured at 3 to 5 days post-inoculation. Lesion growth rate (mm/day) was used to quantify the susceptibility of different genotype tomato plants to P. infestans. Data was analyzed by Microsoft Excel and Origin 7.0. The experiment was repeated three times.
65
Figure 2.6 Model of two effectors and their target Rcr3pim Two unrelated effectors, EPIC2B from Oomycete pathogen Phytophthora infestans and Avr2 of fungal pathogen Cladosporium fulvum, physically interact with tomato cysteine protease Rcr3pim. Avr2 inhibits Rcr3pim irreversibly and the protein complex is recognized by tomato resistance protein Cf-2 to trigger hypersensitive response in the host. In contrast, EPIC2B reversibly inhibits Rcr3pim to suppress the host defense without triggering host innate immunity.
66
Figure 2.7 Scheme of EPIC2B, Avr2 and Rcr3pim constructs N-terminal FLAG-tagged EPIC2B and Avr2 constructs were used in the protein expression in E.coli supernatant. C-terminal His-tagged Rcr3pim construct was used to transient express the protein in N. benthamiana apoplast.
67
ME1E2E3E4E5E6E7 ME1E2E3E4E5E6 [kDa] [kDa] 50.4 - 50.4 - 37.4 - 29.0 - 37.4 - 29.0 - 17.4 - 17.4 - 6.9 - 6.9 -
Figure 2.8 Expression and affinity purification of FLAG-tagged EPIC2B and Avr2 proteins FLAG-EPIC2B and FLAG-Avr2 were expressed in the E. coli and supernatant were collected for protein expression by Western blot (data not shown) before applying to the affinity chromatography. Affinity purification of pFLAG-EPIC2B (left) and pFLAG-Avr2 (right) by anti-FLAG risen are shown. Six elution fractions (E1 - E6) were analyzed on 15% SDS-PAGE gel followed by silver staining. The size in kDa of the molecular weight markers (M) is shown on the left.
68
Figure 2.9 Fluorescence microscopic detection of hypersensitive response on tomato plants Fluorescence microscopic visualization of infiltrated sites on tomato leaves confirmed rAvr2 triggered HR on Cf-2/Rcr3pim tomato. Tomato leaves with the inoculation area (marked by dark marker pen) were placed under the fluorescence UV light for forty seconds before the photos were taken (lower lane of each panel). Similarly, photos were taken after the leaves were exposed to the normal bright light (upper lane of each panel).
69
Table 2.1 ANOVA analysis of lesion growth rate (LGR) Statically significance of the LGR difference between each treatment in the zoospore inoculation assay was measured by ANOVA analysis. Six comparisons were made for six data sets from Cf-2/Rcr3pim, Cf-2/rcr3-3, Cf-0 in the days post inoculation (DPI) 3-4 and DPI 4-5. P values were generated by ANOVA in Origin 7.0. Data sets that have P value less than 0.01 were considered to have significant difference.
70 CHAPTER 3
MOLECULAR, STRUCTURAL AND FUNCTIONAL ANALYSIS OF P.
INFESTANS EPIC1 HOMOLOG IN P. MIRABILIS
3.1 ABSTRACT
The plant pathogen Phytophthora mirabilis, which is closely related to
Phytophthora infestans, infects primarily one host Mirabilis japala. Previous studies revealed that P. infestans secretes extracellular effectors, serine and cysteine protease inhibitors that target tomato serine and cysteine proteases, respectively, suggesting a counterdefense strategy for this plant pathogen to infect its host. We identified an effector from P. mirabilis, PmEPIC1, a P. infestans EPIC1 homolog. Sequence analysis revealed that PmEPIC1 has 13 polymorphic sites compared to EPIC1. The coding sequence corresponding to the mature PmEPIC1 protein was cloned into the pFLAG-ATS vector for protein expression in Escherichia coli. Co-immunoprecipitation assay and DCG-04
71 protease activity profiling indicated that PmEPIC1 physically interacts with tomato protease Rcr3pim, but not PIP1. However, PmEPIC1 did not inhibit Rcr3pim nor
PIP1. Phylogenic analyses of the different EPICs enabled us to understand the evolutionary history of these effectors in two closely related Phytophthora species. Further studies on PmEPIC1 physical association with molecules in the hosts and the inhibition specificity of PmEPIC1 will provide useful information about PmEPIC1 biochemical properties.
72 3.2 INTRODUCTION
The plant pathogen, Phytophthora mirabilis, is specific to the host Mirabilis japala in Mexico and is not a pathogen of potato (Galindo and Hohl, 1985). Like
P. infestans, P. mirabilis belongs to the oomycetes, a distinct group separate from the true fungi (Kamoun, 2006). Previous molecular phylogenetic studies using ribosomal and mitochondrial DNA suggested that P. infestans and P. mirabilis are very closely related (Falkenstein et al., 1991; Moller et al., 1993).
Moller et al. 1993 suggested that P. mirabilis should be considered a forma specialis of P. infestans. The results of Trout et al. 1997 support the findings of other studies, in that P. infestans and P. mirabilis appear to have very similar ribosomal DNA (rDNA) ITS sequences (Trout et al., 1997). Further studies using cytochrome oxidase I and II genes suggested that P. mirabilis shares the highest similarity to P. infestans among Phytophthora species (Martin and Tooley, 2003).
Their host plants, however, are from distinct botanical families. Potato belongs to the family Solanaceae, is one of the world's most widely grown tuber crop.
Mirabilis japala, an ornamental flowering plant, belongs to the family
Nyctaginaceae. It is an excellent model for molecular studies of mechanisms controlling fast petal expansion and senescence phenomenon and a model plant to study scent production (Gookin et al., 2003; Effmert et al., 2005).
73 A P. infestans extracellular cystatin-like cysteine protease inhibitor family was identified from an EST database (Tian et al., 2007). Among its four family members, two genes epiC1 and epiC2B that encode protease inhibitors EPIC1 and EPIC2B are up regulated during P. infestans infection on tomato plants.
EPIC2B physically interacts with and inhibits the tomato cysteine proteases
Rcr3pim (Chapter 2) and PIP1 (Tian et al., 2007). Further studies revealed that two effectors, EPIC2B and Avr2, from unrelated plant pathogens, P. infestans and C. fulvum, respectively, target the same tomato defense protease Rcr3pim
(Chapter 2). Consistent with the prediction of the “guard model”, Rcr3pim appears to be the target of multiple pathogen effectors. EPIC1, which shares 92.4% homology to EPIC2B, may also target Rcr3pim. Thus, Rcr3pim can be disabled by multiple effectors to suppress host innate immunity or mediate plant defenses associated with R gene function.
Considering the genetic distance between the hosts of P. infestans and P. mirabilis, co-evolution of PmEPIC1 and EPIC1 with their target proteases in different hosts is expected to impact the activity of these proteins. Co- evolutionary interplay between host and pathogen is thought to generate the evolutionary forces that shape the genes involved in these interactions (Dawkins and Krebs, 1979; Stahl and Bishop, 2000; Yang and Swanson, 2002; Dodds et al., 2004; Liu et al., 2005). Effectors that co-evolve with their host targets are
74 expected to exhibit significant sequence variation within populations of the pathogen, especially if their encoding genes are undergoing diversifying selection
(Stahl and Bishop, 2000; Bos et al., 2003; Allen et al., 2004; Liu et al., 2005). For example, previous studies revealed significantly higher nonsynonymous nucleotide substitution rates in sequences encoding putative protease contact residues than in those encoding noncontact residues in another P. infestans effector family Kazal-Like Extracellular Protease Inhibitors (EPIs), suggesting that these residues are under diversifying selection (Tian et al., unpublished).
Diversifying selection detected in key contact residues of P. infestans EPIs, probably driven by coevolution with target proteases, may have resulted in novel inhibitory specificities (Tian et al., unpublished). We, therefore, propose that adaptive nucleotide substitution changes may occur in the epic genes driven by diversifying selection during the pathogen-host co-evolution.
In this study, we identified PmEPIC1, a homolog of the P. infestans effector EPIC1, from P. mirabilis via shotgun cloning. We then performed sequence alignments and the polymorphisms analyses between PmEPIC1 and
EPIC1/C2B. The close relationship between the predicted cysteine protease inhibitor active sites and the polymorphic sites suggested possible differences in level of specificity of the binding properties of these three different effectors. We then examined the occurrence of diversifying selection in the four protease inhibitors EPIC1, EPIC2A, EPIC2B and PmEPIC1. To investigate the physical
75 interaction between these effector proteins and the tomato proteases Rcr3pim and
PIP1, we used a co-immunoprecipitation approach. DCG-04 activity profiling was also used to determine protease inhibitor activity and the inhibition patterns of these effectors to the tomato proteases Rcr3pim and PIP1.
3.3 MATERIALS AND METHODS
Plasmids and strains
Mirabilis japala and Nicotiana benthamiana plants were grown in pots at
25°C, 60% humidity, under 16 hour-light/8 hour-dark cycles. E. coli DH5α and
Agrobacterium tumefaciens GV3101 were routinely grown in LB medium
(Sambrook et al., 1989) at 37°C and 28°C, respectively. Cloning of pCB302-
Rcr3pim-His and pCB302-PIP1-His plasmids was performed as described before
(Chapter 2). PmEPIC1 fragment was obtained by PCR with HindIII and EcoRI anchored primers (pF-epiCM-F: 5’-
GGCCAAGCTTCAAATGGACGGCGCGTACACGAAGAAGGAA-3’ and EPICMR:
5’-GGCCGAATTCTTATTATTAACTGGGGTAATCGACGTCACC-3’) from P. mirabilis genomic DNA and clone into HindIII-EcoRI digested pFLAG-ATS
(Sigma).
76 Protein expression and purification
Expression and affinity purification of FLAG-PmEPIC1 (rPmEPIC1) in E. coli using plasmids pFLAG-PmEPIC1 was conducted according to the methods published earlier (Kamoun et al., 1997; Tian et al., 2004) and as described previously (Chapter 2). Protein concentrations were determined using the BioRad protein assay (BioRad Laboratories, Hercules, CA). To determine purity, 0.5 μg of purified protein was run on a SDS-PAGE gel followed by staining with silver nitrate.
Transient expression in N. benthamiana by agro-infiltration
Transient expression of Rcr3pim-His and PIP1-His in planta was performed according to the methods described previously (Kruger et al., 2002). A. tumefaciens strains GV3101 carrying plasmids pCB302-Rcr3pim-His, pCB302-
PIP1-His, empty vector pCB302-3 (Xiang et al., 1999) and pJL3-p19-55
(contributed by John Lindbo, OSU) were used. pJL3-p19-55 is a construct expressing P19 protein of tomato bushy stunt virus (TBSV), a suppressor of post- transcriptional gene silencing in Nicotiana benthamiana (Voinnet et al., 2003).
Overnight Agrobacterium cultures were harvested by centrifugation at 2000 g for
20 min, and resuspended in 10 mM MgCl2, 10 mM MES (pH 5.6) and 150 μM acetosyringone. Resuspended Agrobacterium culture of pCB302-Rcr3pim-His, pCB302-PIP1-His or pCB302-3 with an optical density (OD600) of 1.0 was mixed
77 with equal volume of culture of pJL3-p19-55 with an optical density (OD600) of
1.0. The mixtures were kept at room temperature for 3 hours and then infiltrated into leaves of 6-week-old N. benthamiana plants. Intercellular fluids from infiltrated leaves were isolated 4 days after infiltration. Intercellular fluids were prepared from N. benthamiana leaves according to the method of de Wit and
Spikeman (1982). For leaves from N. benthamiana, a solution of 300 mM NaCl,
50 mM NaPO4 pH 7.0 (Kruger et al., 2002) was used as extraction buffer. The intercellular fluids were filter sterilized (0.45 μm), and were used immediately or stored at -20°C.
SDS-PAGE and western blot analysis
Proteins were subjected to 15% sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE). Afterwards, gel was either stained with Coomassie
Brilliant Blue or transferred to nitrocellulose membranes (BioRad Laboratories,
Hercules, CA) using a Mini trans-Blot apparatus (BioRad Laboratories, Hercules,
CA). Western blot was used to detect the protein using alkaline phosphatase kit
(BioRad Laboratories, Hercules, CA). Anti-His alkaline phosphatase conjugated antisera and anti-FLAG antisera were purchased from Sigma (St. Louis, MO).
78 Coimmunoprecipitation (Co-IP)
Coimmunoprecipitation of rEPIC2B/rAvr2 and N. benthamiana intercellular fluids was performed using the FLAG-tagged protein immunoprecipitation kit
(Sigma, St. Louis, MO) as described previously (Tian et al., 2004). 800 pmol of purified rEPIC1/2B were preincubated with 500 µl of N. benthamiana intercellular fluids expressing Rcr3pim-His for 30 min at 25°C. Next, 40 µl of anti-FLAG M2 resin was added and incubated at 4°C for 2 hours with gentle shaking. The precipitated protein complexes were eluted in 60 µl of FLAG peptide solution
(150 ng/µl) and were analyzed by SDS-PAGE and Western blot analyses.
DCG-04 profiling assay
Activity profiling of Rcr3pim and other cysteine proteases in N. benthamiana intercellular fluids was performed as described elsewhere (van der
Hoorn et al., 2004; Rooney et al., 2005), using DCG-04 (supplied by Michiel
Leeuwenburgh, Leiden University), a biotinylated analog of the irreversible cysteine protease inhibitor E- 64 (Greenbaum et al., 2000). For N. benthamiana intercellular fluids expressing Rcr3pim-His and PIP1-His, 50 μl of intercellular fluids were diluted ten-fold in DCG-04 assay buffer (50 mM sodium acetate,
10mM L-cysteine, pH 5.0) to a final volume of 500 µl. The diluted samples were pre-incubated with an excess of E64 (1020 nM, Sigma, St Louis, MO) or rEPIC2B (2 µM) or rEPIC1 (2 µM) or rPmEPIC1 (2 µM) for one hour at room
79 temperature. DCG-04 (220 nM) was added to each reaction to label cysteine proteases with biotin. The reaction mixtures were incubated for 30 min at room temperature. Proteins were precipitated by adding one ml ice-cold acetone in -
20°C followed by centrifugation at 13000x g for 30 min at 4°C. The pellets were washed with ice-cold 70% (w/w) acetone, air-dried, and resuspended in 500 μl
TBS buffer (50 mM Tris/HCl, 150 mM NaCl, pH 7.5). To capture the biotinylated proteins, 20 µl Ni-NTA magnetic beads (Qiagen, Madison, WI) were added to each reaction and incubated for 16 hours at 4°C. The magnetic beads were washed with one ml TBS buffer using a magnetic stand (Promega, Madison, WI) to remove non-specifically bound proteins. Biotin labeled proteins were harvested by boiling the magnetic beads in 30 µl Laemmli SDS loading buffer, and subjected to SDS-PAGE (12%) and western blotting. Biotin labeled proteins were detected by probing the membrane with streptavidin horseradish peroxidase
(HRP) polymers (Sigma, St Louis, MO) followed by color development using the substrate 3,3’-diaminobenzidine (Sigma, St Louis, MO).
Protein 3D structure and active sites and polymorphic sites prediction
ClustalW (Thompson et al., 1994) and BioEdit 7.0.0 (Hall, 1999) were used to perform the sequence analysis and alignment. NCBI software DeepView
- Swiss-Pdb Viewer (Guex and Peitsch, 1997) and Cn3D 4.1
80 (http://www.ncbi.nlm.nih.gov/) were used to analyze the protein 3D structure and active site and polymorphic site labeling.
Diversifying Selection Analyses
The rate of nonsynonymous nucleotide substitutions per nonsynonymous site (dN) and the rate of synonymous nucleotide substitutions per synonymous site (dS) across all the amino acids sites in pairwise comparisons between nucleotide sequences were estimated using the approximate method of Nei and
Gojoborit (Nei and Gojoborit, 1986) implemented in the YN00 program in the
PAML (Phylogenetic Analysis by Maximum Likelihood) software package (Yang,
1997).
3.4 RESULTS
Sequences analysis of PmEPIC1
Sequence analysis of amplicons obtained from P. mirabilis genomic DNA revealed EPIC1 homologes. One of the four EPIC1 homologues, m1-07-12-14-
15-m9-03-07-08-09-11-12-15-16, in P. mirabilis has 13 polymorphic sites compared to EPIC1. ClustalW alignments determined that PmEPIC1 has 13 polymorphic sites (12 nonsynonymous mutations and 1 insertion mutation) compared to EPIC1, which leads to 11 amino acid substitution and 1 amino acid
81 insertion. PmEPIC1 has 17 polymorphic sites (16 nonsynonymous mutations and
1 insertion mutation) compared to EPIC2B, leading to 16 amino acid substitutions and 1 amino acid insertion. Thus PmEPIC1 is closer to EPIC1 than EPIC2B
(Fig.3.1 and 3.3).
Protein structure modeling of EPIC inhibitors
Cystatin is known to be a natural inhibitor of cysteine proteases and to be conserved in eukaryotes. Protein 3D structure is widely used to provide clues to protein function. The 3D structures of some cystatin-like cysteine protease inhibitors are known, such as human cystatin D (Alvarez-Fernandez et al., 2005) and human cystatin C (Janowski et al., 2001) and we exploited these structures to further characterize Phytophthora EPICs. PmEPIC1 was found to have high similarity to human cystatin (PDB: 1G96) (Janowski et al., 2001) and other cystatin-like cysteine protease inhibitors, such as chicken cystatin (Dieckmann et al., 1993), chicken egg white cystatin (Bode et al., 1988), Oryzacystatin-I (Nagata et al., 2000), cystatin A2-98 M65L (Tate et al., 1995). The similarity was highest within and around the active site of human cystatin (PDB: 1G96) (Fig.3.1). We labeled on the human cystatin structure the cystatin active sites as well as the polymorphic sites between PmEPIC1 and EPIC1. The distribution of the polymorphic sites between PmEPIC1 and EPIC1 in the 3D structure showed that
8 out of 13 polymorphic sites are either within or around the active sites (Fig.3.2).
82 These sites are also exposed to the protein surface, suggesting their possible association with target proteases. Other polymorphic sites that are either far from the conserved regions NT, L1 and L2 or buried inside other amino acids in the three dimensional structure may not to be associated directly with the interacting proteases.
Sequence alignments and diversifying selection analyses
Multiple sequence alignments of four proteins, PmEPIC1, EPIC1, EPIC2A and EPIC2B, revealed the conserved regions that define the cystatin (Fig. 3.3).
The nucleotide multiple alignments of the corresponding encoding genes are shown in Fig. 3.10. Within the signal peptide region (position 1 to 21), there is no polymorphic site between PmEPIC1 and EPIC1. Interestingly, all 13 polymorphic sites between PmEPIC1 and EPIC1 locate in the mature protein. The extracellular mature protein region has various numbers of amino acids for the four proteins (position 21 to 125/126/127). Amino acid substitution involved different chemical classes of amino acid, such as charged amino acids, including arginine (R) and lysine (K), and hydrophobic amino acids including leucine (L), alanine (A) and valine (V).
To investigate the selection pressures underlying sequence diversification in the four protease inhibitors PmEPIC1, EPIC1, EPIC2A and EPIC2B, we calculated the rate of nonsynonymous nucleotide substitutions per
83 nonsynonymous site (dN) and the rate of synonymous nucleotide substitutions per synonymous site (dS) across all the amino acids sites in pairwise comparisons between nucleotide sequences. We found that dN value was greater than dS (ω=dN/dS>1) only in the pairwise sequence comparison between PmEPIC1 and EPIC1 (Table 3.1). These results suggest that diversifying selection acted on PmEPIC1 and EPIC1.
PmEPIC1 protein expression in E.coli and affinity purification
To express PmEPC1 in E.coli and perform functional analysis, we cloned the PmEPIC1 fragment into the vector pFLAG-ATS to generate N-terminal FLAG tagged protein FLAG-PmEPIC1. After plasmid construction cloning and DNA sequencing confirmation, we transformed the plasmid into the E.coli BL21 (DE3).
By western blot detection using anti-FLAG antisera, we observed the expression of PmEPIC1 in E.coli supernatant (Fig.3.4A). After affinity purification by anti-
FLAG resin, purified PmEPIC1 was subjected to SDS-PAGE gel followed by silver staining to test the protein purity. The 19 kDa band was observed on the silver stained gel is the mature rPmEPIC1. The band above it is the rPmEPIC1 with uncleaved signal peptide while the band below it is thought to be a degradation product of rPmEPIC1 (Fig.3.4B). rPmEPIC1 was then cleaned and concentrated to 0.1mg/ml (measured by Nanodrop using 1mg/ml BSA standard) and stored at -80°C for further analysis.
84 EPIC1 and PmEPIC1 physically interact with Rcr3pim but not PIP1
To investigate the physical interaction of PmEPIC1 with Rcr3pim/PIP1, two tomato proteases that are targeted by EPIC2B, we transiently expressed Rcr3pim and PIP1 in the apoplast of Nicotiana benthamiana (Chapter 4). The FLAG antibody agarose bead immunoprecipitations were successful and resulted in the recovery of the rEPIC1 or rEPIC2B or rPmEPIC1 proteins in all samples (Fig.3.5 and 3.6). In addition, a 30-kD protein corresponding to Rcr3pim-His was recovered with rEPIC1 or rEPIC2B or rPmEPIC1 from Rcr3pim-His expressing extracts but not from the control sample, confirming all three proteins rEPIC1, rEPIC2B and rPmEPIC1 interact with tomato cysteine protease Rcr3pim (Fig.3.5). In contrast, both Co-IP and the following western blot analysis by anti-His antisera revealed that PIP1-His was only pulled down by rEPIC2B, but not by rEPIC1 or PmEPIC1
(Fig.3.6), suggesting a lack of interaction between rEPIC1 or PmEPIC1 and PIP1.
EPIC1 but not PmEPIC1 inhibits Rcr3pim
To determine whether PmEPIC1 inhibits tomato proteases Rcr3pim, DCG-
04 Cysteine protease activity profiling (van der Hoorn et al., 2004) was used as described before (Chapter 2). DCG-04 is a biotinylated analog of the irreversible cysteine protease inhibitor E-64 that can be detected with streptavidin
(Greenbaum et al., 2000). First, we examined whether rEPIC1 and rPmEPIC1 can inhibit the cysteine proteases Rcr3pim expressed in N. benthamiana
85 intercellular fluids. DCG-04 labeling of N. benthamiana intercellular fluid proteins revealed one major band of approximately 30 kDa (Fig.3.7). EPIC2B was used here as a positive control of inhibition to Rcr3pim (Chapter 2). As expected,
EPIC2B inhibited Rcr3pim in the DCG-04 activity profiling assay. Pretreatment of the samples with E-64 eliminated almost all DCG-04 labeling, indicating that
Rcr3pim was specifically labeled. Detection with streptavidin-HRP reveals that
Rcr3pim-His is not biotinylated in the presence of E-64, whereas biotinylation of
Rcr3pim occurred without inhibitor or with rPmEPIC1, indicating that, like rEPIC2B,
EPIC1 inhibits Rcr3pim; however, PmEPIC1 doesn’t inhibit Rcr3pim. This suggested that like EPIC2B, EPIC1 inhibits DCG-04 labeled Rcr3pim, however, unlike EPIC2B, PmEPIC1 doesn’t inhibit Rcr3pim (Fig.3.7).
Unlike EPIC2B, neither EPIC1 nor PmEPIC1 inhibits PIP1
To determine whether PmEPIC1 inhibits tomato proteases PIP1, DCG-04 cysteine protease activity profiling (van der Hoorn et al., 2004) was used as described before (Chapter 2). DCG-04 is a biotinylated analog of the irreversible cysteine protease inhibitor E-64 that can be detected with streptavidin
(Greenbaum et al., 2000). First, we examined whether rEPIC1 and rPmEPIC1 can inhibit the PIP1, an Rcr3pim homolog, expressed in the N. benthamiana intercellular fluids. DCG-04 labeling of N. benthamiana intercellular fluid proteins revealed one major band of approximately 30 kDa (Fig.3.8). rEPIC2B was used
86 here as a positive control of PIP1 inhibition (Chapter 2). As expected, EPIC2B inhibited PIP1 in the DCG-04 activity profiling assay. Detection with streptavidin-
HRP revealed that PIP1-His is not biotinylated in the presence of E-64, whereas biotinylation of PIP1 occurs without inhibitor or with rEPIC1 or rPmEPIC1, indicating that, unlike rEPIC2B, neither EPIC1 nor PmEPIC1 inhibits PIP1
(Fig.3.8).
Like EPIC2B and unlike Avr2, neither PmEPIC1 nor EPIC1 trigger hypersensitive response on Cf-2/Rcr3pim tomato plants
To investigate whether PmEPIC1 or EPIC1 triggers hypersensitive response (HR) on Cf-2/Rcr3pim tomato, we infiltrated tomato leaves with purified
PmEPIC1 and EPIC1 as well as purified EPIC2B and Avr2 as negative and positive controls, respectively. Although Avr2 caused visible HR symptoms on Cf-
2/Rcr3pim tomato plants as expected, PmEPIC1, EPIC1 and EPIC2B did not
(Fig.3.9). This indicates that even though PmEPIC1 and EPIC1 physically bind to
Rcr3pim in the Co-IP experiments, the interaction between PmEPIC1/EPIC1 and
Rcr3pim is not recognized by Cf-2 under tested experimental conditions.
87 3.5 DISCUSSION
In summary, we identified and cloned PmEPIC1 from P. mirabilis, a homolog of the P. infestans cysteine protease inhibitor EPIC1. Using pFLAG-
ATS protein expression system in E. coli, we successfully obtained recombinant protein FLAG-PmEPIC1 in the E. coli supernatant. After affinity purification, we used rFLAG-PmEPIC1 in protein-protein interaction assay by coimmunoprecipitation and protease inhibition assay by DCG-04 profiling.
PmEPIC1 physically bound Rrc3pim, a cysteine protease that is also targeted by
P. infestans effector EPIC2B and C. fulvum effector Avr2 (Chapter 2). However,
PmEPIC1 did not inhibit Rcr3pim based on the DCG-04 assay and under the conditions we tested. This indicates that either the pH in these tested conditions is not favorable for PmEPIC1 inhibition to Rcr3pim or there may be other protease targets of PmEPIC1.
Several effectors are critical players in host-microbe interactions for instance by triggerring plant innate immunity or suppressing plant defense. For example, EPI1 and EPI10, members of Kazal-like serine protease inhibitor family, contain active Kazal domains (Tian and Kamoun, 2005) and target tomato defense serine protease P69B, suggesting a role in counterdefense (Tian et al.,
2004; Tian et al., 2005). Cystatin-like cysteine protease inhibitor EPIC2B targets tomato cysteine protease Rcr3pim without triggering Cf-2 mediated hypersensitive
88 response (HR) in the host, representing a cunning effector evolved by P. infestans to facilitate host invasion (Chapter 2). Another cysteine protease inhibitor, C. fulvum effector Avr2, also inhibits Rcr3pim and triggers HR in Cf-
2/Rcr3pim tomato plants (Rooney et al., 2005). Similarly, the P. mirabilis effector
PmEPIC1 might be involved in targeting host protease(s) to facilitate host colonization. In our studies, we could only test PmEPIC1 with proteases from tomato, a nonhost plant for P. mirabilis. rPmEPIC1 did not inhibits PIP1 and
Rcr3pim, even though we demonstrated that rPmEPIC1 physically binds Rcr3pim but not PIP1. Also, like rEPIC1 and rEPIC2B, rPmEPIC1 did not trigger the HR on Cf-2/Rcr3pim tomato plants even though it binds to Rcr3pim. Further characterizations of PmEPIC1 interactor(s) and target proteases in P. mirabilis host plant Mirabilis japala will provide us more information about the role of
PmEPIC1 in plant-pathogen interaction.
We investigated overlap between the polymorphic sites and active sites for the PmEPIC1/EPIC1 pair, and observed that one polymorphic site is inside the active site NT and seven other polymorphic sites locate close to the three conserved amino acids regions NT, L1 and L2. These differences may result in the variation in binding and inhibition specificity between PmEPIC1 and
EPIC1/C2B. We also found that unlike EPIC2B, neither EPIC1 nor PmEPIC1 physically binds or inhibits PIP1. However, even though EPIC1 but not PmEPIC1
89 inhibits Rcr3pim, they both physically interact with Rcr3pim. By far, the only difference in the biochemical properties between EPIC1 and PmEPIC1 is that
EPIC1 binds and inhibits Rcr3pim whereas PmEPIC1 binds without inhibiting
Rcr3pim. Hopefully, by using apoplastic fluid from Mirabilis japala and tomato plants, we will be able to identify differences in inhibition patterns between these three protease inhibitors.
The binding status of a substrate to an enzyme is often thought to be associated with inhibitory activity. In the case of L-serine inhibition to phosphoglycerate dehydrogenase, the sequential binding of ligands changes the conformation of the enzyme so that the interface becomes more favorable for another ligand binding (Grant et al., 1999). At the same time, the inhibition level increases each time more ligands bind to the enzyme (Grant et al., 1999). This is possibly why PmEPIC1 could pull down Rcr3pim in the coimmunoprecipitation assay whereas it did not inhibit Rcr3pim in the DCG-04 assay. Elucidating the binding specificity of PmEPIC1 to Rcr3pim and the conformation changes caused by this binding will help to provide an explanation for the lack of inhibition.
We can classify the polymorphic EPIC sites based on their position
(embedded or exposed) and their relationship to the active sites (close or far away). Point mutations of these polymorphic sites can be used to investigate the
90 contribution of the twelve amino acids (PmEPIC1 vs. EPIC1) to protein activity. In this study, we couldn’t detect any inhibition activity for PmEPIC1 to the two known tomato cysteine proteases Rcr3pim and PIP1. An alternative approach would be to use apoplastic extracts from tomato or Mirabilis in protease inhibition assays. Proteases that are inhibited by EPIC1/C2B or PmEPIC1 can then be analysis by two dimensional SDS-PAGE gels and detected by streptavidin labeling with HRP. In addition, the protease inhibitor activities of PmEPIC1, we can be tested using commercial cysteine proteases such as Bromelain
(pineapple stem extract, Sigma), Ficin (fig tree latex, Sigma) and Papain (papaya latex, Sigma).
Host protein interactors are keys to unravel the functions of effectors, such as PmEPIC1. Commonly used methods for protein-protein interaction study are yeast two hybrid (Luban and Goff, 1995; Uetz et al., 2000; Effmert et al., 2005;
Berggard et al., 2007) and coimmunoprecipitation (Berggard et al., 2007). In the future, we propose to use coimmunoprecipitation to identify PmEPIC1 interactor(s) in its host plant Mirabilis and contrast them to the targets of EPIC1 in tomato. We will focus on apoplastic extracts from either pathogen-infected or
BTH-treated plants. Further characterization of the interactor(s) will include peptide identification by Mass Spectrometry (Chang, 2006), followed by genetic and biochemical analysis.
91 3.6 ACKNOWLEDGEMENT
I would like to thank Dr. Katherine Bruce for initial sequence analysis of the EPIC1 homologes in P. mirabilis, Dr. Joe Win for diversifying selection analyses, Dr. John Lindbo for providing the pJL13-p19-55 vector and Kerilynn
Jagger for taking care of the plants in green house. This work was supported by the by National Research Initiative Competitive Grant from the USDA
Cooperative State Research, Education, and Extension Service. Salaries and research support were provided by State and Federal Funds appropriated to the
Ohio Agricultural Research and Development Center, the Ohio State University.
3.7 REFERENCES
Allen, R.L., Bittner-Eddy, P.D., Grenville-Briggs, L.J., Meitz, J.C., Rehmany, A.P., Rose, L.E., and Beynon, J.L. (2004). Host-parasite coevolutionary conflict between Arabidopsis and downy mildew. Science 306, 1957-1960.
Alvarez-Fernandez, M., Liung, Y.H., Abrahamson, M., and Su, X.D. (2005). Crystal structure of human cystatin D, a cysteine peptidase inhibitor with restricted inhibition profile. J. Biol. Chem. 280, 18221-18228.
Berggard, T., Linse, S., and James, P. (2007). Methods for the detection and analysis of protein-protein interactions. Proteomics.
Bode, W., Engh, R., Musil, D., Thiele, U., Huber, R., Karshikov, A., Brzin, J., Kos, J., and Turk, V. (1988). The 2.0 A X-ray crystal structure of chicken egg white cystatin and its possible mode of interaction with cysteine proteinases. EMBO J. 7, 2593-2599.
Bos, J.I.B., Armstrong, M., Whisson, S.C., Torto, T.A., Ochwo, M., Birch, P.R.J., and Kamoun, S. (2003). Intraspecific comparative genomics to identify avirulence genes from Phytophthora. New Phytologist 159, 63-72.
92 Chang, I.F. (2006). Mass spectrometry-based proteomic analysis of the epitope- tag affinity purified protein complexes in eukaryotes. Proteomics 6, 6158- 6166.
Dawkins, R., and Krebs, J.R. (1979). Arms races between and within species. Proc R Soc Lond B Biol Sci 205, 489-511.
Dieckmann, T., Mitschang, L., Hofmann, M., Kos, J., Turk, V., Auerswald, E.A., Jaenicke, R., and Oschkinat, H. (1993). The structures of native phosphorylated chicken cystatin and of a recombinant unphosphorylated variant in solution. J. Mol. Biol. 234, 1048-1059.
Dodds, P.N., Lawrence, G.J., Catanzariti, A.M., Ayliffe, M.A., and Ellis, J.G. (2004). The Melampsora lini AvrL567 avirulence genes are expressed in haustoria and their products are recognized inside plant cells. Plant Cell 16, 755-768.
Effmert, U., Grobe, J., Rose, U.S.R., Ehrig, F., Kagi, R., and Piechulla, B. (2005). Volatile composition, emission pattern and localization of floral scent emission in Mirabilis jalapa (Nyctaginaceae). Am. J. Bot. 92, 2-12.
Falkenstein, K.F., Tooley, P.W., Goodwin, S.B., and Fry, W.E. (1991). Differentiation of group IV Phytophthora species by PCR amplification of nuclear ribosomal DNA internal transcribed spacer region. (Abstr.). Phytopathology 81, 1157.
Galindo, A.J., and Hohl, H.R. (1985). Phytophthora mirabilis, a new species of Phytophthora. Sydowia Ann. Mycol. 38, 87-96.
Gookin, T., Hunter, D., and Reid, M. (2003). Temporal analysis of alpha and beta-expansion expression during floral opening and senescence. Plant Sci. 164, 769-781.
Grant, G.A., Xu, X.L., and Hu, Q. (1999). The relationship between effector binding and inhibition of activity in d-3-phosphoglycerate dehydrogenase. Protein Science 8, 2501-2505.
Greenbaum, D., Medzihradszky, K.F., Burlingame, A., and Bogyo, M. (2000). Epoxide electrophiles as activity-dependent cysteine protease profiling and discovery tools. Chem. Biol. 7, 569-581.
93 Guex, N., and Peitsch, M.C. (1997). SWISS-MODEL and the Swiss-PdbViewer: An environment for comparative protein modeling. Electrophoresis 18, 2714-2723.
Hall, T.A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41, 95-98.
Janowski, R., Kozak, M., Jankowska, E., Grzonka, Z., Grubb, A., Abrahamson, M., and Jaskolski, M. (2001). Human cystatin C, an amyloidogenic protein, dimerizes through three-dimensional domain swapping. Nat. Struct. Biol. 8, 316-320.
Kamoun, S. (2006). A Catalogue of the Effector Secretome of Plant Pathogenic Oomycetes. Annu. Rev. Phytopathol. 44, 41-60.
Kamoun, S., van West, P., de Jong, A.J., de Groot, K., Vleeshouwers, V., and Govers, F. (1997). A gene encoding a protein elicitor of Phytophthora infestans is down-regulated during infection of potato. Mol. Plant Microbe. Interact. 10, 13-20.
Kruger, J., Tomas, C.M., Golstein, C., Dixon, M.S., Smoker, M., Tang, S., Mulder, L., and Jones, J.D.G. (2002). A Tomato Cysteine Protease Required for Cf-2-Dependent Disease Resistance and Suppression of Autonecrosis. Science 296, 745-747.
Liu, Z., Bos, J.I., Armstrong, M., Whisson, S.C., da Cunha, L., Torto-Alalibo, T., Win, J., Avrova, A.O., Wright, F., Birch, P.R., and Kamoun, S. (2005). Patterns of diversifying selection in the phytotoxin-like scr74 gene family of Phytophthora infestans. Mol Biol Evol 22, 659-672.
Luban, J., and Goff, S.P. (1995). The yeast two-hybrid system for studying protein-protein interactions. Curr Opin Biotechnol 6, 59-64.
Martin, F.N., and Tooley, P.W. (2003). Phylogenetic relationships among Phytophthora species inferred from sequence analysis of mitochondrially encoded cytochrome oxidase I and II genes. Mycologia. 95, 269-284.
Moller, E.M., de Cock, A.W.A.M., and Prell, H.H. (1993). Mitochondrial and nuclear DNA restriction enzyme analysis of the closely related
94 Phytophthora species P. infestans, P. mirabilis, and P. phaseoli. J. Phytopathol. 139, 309-321.
Nagata, K., Kudo, N., Abe, K., Arai, S., and Tanokura, M. (2000). Three- dimensional solution structure of oryzacystatin-I, a cysteine proteinase inhibitor of the rice, Oryza sativa L. japonica. Biochemistry 39, 14753- 14760.
Nei, M., and Gojoborit, T. (1986). Simple Methods for Estimating the Numbers of Synonymous and Nonsynonymous Nucleotide Substitutions. Mol. Biol. Evol. 3, 418-426.
Rooney, H.C.E., van't Klooster, J.W., van der Hoorn, R.A.L., Joosten, M.H.A.J., Jones, J.D.G., and de Wit., P.J.G.M. (2005). Cladosporium Avr2 Inhibits Tomato Rcr3 Protease Required for Cf-2-Dependent Disease Resistance. Science 308, 1785-1786.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Stahl, E.A., and Bishop, J.G. (2000). Plant-pathogen arms races at the molecular level. Curr Opin Plant Biol 3, 299-304.
Tate, S., Ushioda, T., Utsunomiya-Tate, N., Shibuya, K., Ohyama, Y., Nakano, Y., Kaji, H., Inagaki, F., Samejima, T., and Kainosho, M. (1995). Solution structure of a human cystatin A variant, cystatin A2-98 M65L, by NMR spectroscopy. A possible role of the interactions between the N- and C-termini to maintain the inhibitory active form of cystatin A. Biochemistry 34, 14637-14648.
Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.
Tian, M., and Kamoun, S. (2005). A two disulfide bridge Kazal domain from Phytophthora exhibits stable inhibitory activity against serine proteases of the subtilisin family. BMC Biochem. 6, 15.
95 Tian, M., Benedetti, B., and Kamoun, S. (2005). A Second Kazal-like protease inhibitor from Phytophthora infestans inhibits and interacts with the apoplastic pathogenesis-related protease P69B of tomato. Plant Physiol. 138, 1785-1793.
Tian, M., Huitema, E., Da Cunha, L., Torto-Alalibo, T., and Kamoun, S. (2004). A Kazal-like extracellular serine protease inhibitor from Phytophthora infestans targets the tomato pathogenesis-related protease P69B. J. Biol. Chem. 279, 26370-26377.
Tian, M., Win, J., Song, J., van der Hoorn, R., van der Knaap, E., and Kamoun, S. (2007). A Phytophthora infestans cystatin-like protein targets a novel tomato papain-like apoplastic protease. Plant Physiol. 143, 364- 377.
Trout, C.L., Ristaino, J.B., Madritch, M., and Wangsomboondee, T. (1997). Rapid Detection of Phytophthora infestans in Late Blight-Infected Potato and Tomato Using PCR. Plant Disease 81, 1042-1048.
Uetz, P., Giot, L., Cagney, G., Mansfield, T.A., Judson, R.S., Knight, J.R., Lockshon, D., Narayan, V., Srinivasan, M., Pochart, P., Qureshi-Emili, A., Li, Y., Godwin, B., Conover, D., Kalbfleisch, T., Vijayadamodar, G., Yang, M., Johnston, M., Fields, S., and Rothberg, J.M. (2000). A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisiae. Nature 403, 623-627. van der Hoorn, R.A., Leeuwenburgh, M.A., Bogyo, M., Joosten, M.H., and Peck, S.C. (2004). Activity profiling of papain-like cysteine proteases in plants. Plant Physiology 135, 1170-1178.
Voinnet, O., Rivas, S., Mestre, P., and Baulcombe, D. (2003). An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J 33, 949- 956.
Xiang, C., Han, P., Lutziger, I., Wang, K., and Oliver, D.J. (1999). A mini binary vector series for plant transformation. Plant Mol Biol 40, 711-717.
Yang, Z. (1997). PAML: a program package for phylogenetic analysis by maximum likelihood. Comput Appl Biosci 13, 555-556.
96 Yang, Z., and Swanson, W.J. (2002). Codon-substitution models to detect adaptive evolution that account for heterogeneous selective pressures among site classes. Mol Biol Evol 19, 49-57.
97
Figure 3.1 Sequences alignment analysis of PmEPIC1 with EPIC1 and other cystatins.
PmEPIC1 protein sequence is aligned with seven other cystatin-like cysteine protease inhibitors or cystatins including EPIC1 (gi62910928), Chain A of human cystatin C (gi14278690), Chicken egg white cystatin (gi3212399). Among these, the three dimensional structure of Human cystatin C Chain A is known as 1G96 in PDB database. Three conserved regions NT (N-terminal truck), L1 (first binding loop) and L2 (second binding loop) are labeled above the sequences and the amino acids that define cystatin are labeled with stars below the sequence. Polymorphic sites between PmEPIC1 and EPIC1 are labeled with triangles under the sequence.
98
Figure 3.2 Protein model - active sites and polymorphic sites prediction of PmEPIC1
Based on the sequence alignment, the three dimensional structure of the active sites and polymorphic sites were labeled on the known PDB 1G96. Orange: conserved regions NT, L1 and L2; Purple: polymorphic sites between PmEPIC1 and EPIC1; Red: overlap of active sites and polymorphic sites. Front view (left panel) and side view (right panel) were shown.
99
Figure 3.3 Multiple sequence alignment of four EPICs from Phytophthora infestans and Phytophthora mirabilis. Single-letter amino acid codes were used. Identical amino acids are indicated by dots. The amino acids that define a cystatin are indicated by stars under sequences. The predicted signal peptide stars from the first residue and consists of 21 residues. Sequence starts from the twenty-second to the last residue represents the mature proteins.
100
A B
Figure 3.4 FLAG-PmEPIC1 expression and affinity purification
(A) N-terminal FLAG-tagged PmEPIC1 construct was used in the protein expression in E.coli supernatant. Three E. coli strains BL21, XL-1 blue and Dh5α were tested for protein expression and secretion. Western blot analysis (Right) by anti-FLAG antisera of fractions B (supernatant, before IPTG induction), A (supernatant, after IPTG induction) and P (pellet) are showed. The size in kDa of the molecular weight markers is shown on the left.
(B) Six elution fractions (E1 - E6) of purification of pFLAG-PmEPIC1 by anti- FLAG affinity column were analyzed on 15% SDS-PAGE gel followed by silver staining. The size in kDa of the molecular weight markers (M) is shown on the left.
101
Figure 3.5 Like EPIC2B, EPIC1 and PmEPIC1 physically interact with Rcr3pim
Coimmunoprecipitation (Co-IP) of rEPIC2B/rEPIC1/rPmEPIC1 and Rcr3pim-His using FLAG antisera. Eluates from coimmunoprecipitation of rEPIC2B/rEPIC1 /rPmEPIC1 with proteins in intercellular fluids from N. benthamiana leaves infiltrated with Agrobacterium tumefaciens carrying the binary vector pCB302- Rcr3pim-His (Rcr3pim-His +) or pCB302-3 (Rcr3pim-His -) were analyzed on SDS- PAGE gel followed by silver staining or Western blot. Western blot analyses used either α-His or α-FLAG antisera. The + and – signs refer to the presence or absence of Rcr3pim-His, respectively. The size in kDa of the molecular weight markers is shown on the left.
102
Figure 3.6 Unlike EPIC2B, neither EPIC1 nor PmEPIC1 binds PIP1
Coimmunoprecipitation (Co-IP) of rEPIC2B/rPmEPIC1 and PIP1-His using FLAG antisera. Eluates from coimmunoprecipitation of rEPIC2B/rPmEPIC1 with proteins in intercellular fluids from N. benthamiana leaves infiltrated with Agrobacterium tumefaciens carrying the binary vector pCB302-PIP1-His (PIP1+) or pCB302-3 (PIP1-) were analyzed on SDS-PAGE gel followed by silver staining or Western blot. The + and – signs refer to the presence or absence of PIP1-His, respectively. Western blot analyses used either with α-His or α-FLAG antisera. The size in kDa of the molecular weight markers is shown on the left.
103
Figure 3.7 Like EPIC2B, EPIC1 but not PmEPIC1 inhibits Rcr3pim
Inhibition of Rcr3pim produced in N. benthamiana apoplast by recombinant proteins rEPIC2B/rEPIC1/rPmEPIC1. Apoplastic fluid was isolated from N. benthamiana expressing Rcr3pim-His. Protease activity profiling with 220nM DCG-04 was performed in the absence (–) of inhibitor or in the presence (+) of E- 64, FLAG-EPIC1 (rEPIC1), FLAG-PmEPIC1 (rPmEPIC1), or FLAG-EPIC2B (rEPIC2B). Rcr3pim-His was captured (pulled down) by Ni-NTA beads, electrophoresed on an SDS gel, and detected with streptavidin-HRP. The DCG- 04 labeling reactions were stopped at 30min by adding ice-cold acetone into the reaction mix. Approximate molecular weights of the labeled Rcr3pim-His proteins are shown on the left side.
104
Figure 3.8 Unlike EPIC2B, neither EPIC1 or PmEPIC1 inhibits PIP1
Inhibition of PIP1-His produced in N. benthamiana apoplast by recombinant proteins rEPIC2B/rEPIC1/rPmEPIC1. Apoplastic fluid was isolated from N. benthamiana expressing PIP1-His. Protease activity profiling with 220nM DCG- 04 was performed in the absence (–) of inhibitor or in the presence (+) of E-64, FLAG-EPIC1 (rEPIC1), FLAG-PmEPIC1 (rPmEPIC1), or FLAG-EPIC2B (rEPIC2B). PIP1-His was captured (pulled down) by Ni-NTA beads, electrophoresed on an SDS gel, and detected with streptavidin-HRP. The DCG- 04 labeling reactions were stopped at 30min by adding ice-cold acetone into the reaction mix. Approximate molecular weights of the labeled PIP1-His proteins are shown on the left side.
105
Figure 3.9 Like EPIC2B and unlike Avr2, neither PmEPIC1 nor EPIC1 trigger hypersensitive response on Cf-2/Rcr3pim tomato plants
Purified proteins rAvr2/rEPIC2B/rEPIC1/rPmEPIC1 was cleaned and diluted to concentration of 0.4 µM and then were infiltrated into tomato (Cf-2/Rcr3pim, Cf- 2/rcr3-3 or Cf-0) leaves. Protein infiltrated areas on tomato leaves are labeled with black marker. The photos were taken five days after infiltration. N. benthamiana apoplastic fluid containing Rcr3pim was used as a negative control for agroinfiltration, and the experiment was repeated three times.
106
Figure 3.10 The nucleotide multiple alignments of the corresponding genes encoding four EPICs
107 seq. seq. S N omega dN +-SE dS +-SE
EPIC2B EPIC2A 63.2 311.8 0.1644 0.0261 +-0.0093 0.1588 +-0.0549
EPIC1 EPIC2A 68.8 306.2 0.1131 0.0403 +-0.0118 0.3566 +-0.0928
EPIC1 EPIC2B 68.2 306.8 0.0945 0.0368 +-0.0112 0.3891 +-0.1012
PmEPIC1 EPIC2A 69 306 0.1875 0.0613 +-0.0146 0.3272 +-0.0849
PmEPIC1 EPIC2B 68.3 306.7 0.2152 0.0719 +-0.0159 0.334 +-0.088
PmEPIC1 EPIC1 73.7 301.3 1.3549 0.0374 +-0.0114 0.0276 +-0.0196
Table 3.1 Diversifying selection analyses results of EPICs
108 CHAPTER 4
HIGH LEVEL EXPRESSION OF TAGGED PROTEINS IN THE PLANT
APOPLAST
4.1 ABSTRACT
The plant apoplast is the first site of contact with a plant pathogen upon infection and plays crucial roles in initiation and coordination of many defense responses. It is essential to express secreted proteins in the apoplast in order to elucidate their biological functions. However, to obtain affinity tagged proteins in the apoplast is problematic for several reasons. Expression level may not be high enough to enable purification, immunoprecipitation or even detection of the protein. The tags may also be removed after the proteins are expressed in some plants or the tagged proteins may be unstable and nonfunctional. Here we demonstrate that by combining C-terminal His-tagged protein expression constructs with successful transient protein expression system mediated by agroinfiltration, we were able to express stable and functional C-terminal His- tagged proteins P69B-His, PIP1-His and Rcr3pim-His in Nicotiana benthamiana
109 apoplast. Following purification by affinity chromatography, the tags remained attached to the proteins and the purified proteins maintained their biological activities. Our data suggest that by utilizing this protein expression system, C- terminal His-tagged proteins in N. benthamiana apoplast are efficient enough to enable purification of functional proteins.
110 4.2 INTRODUCTION
The apoplast is an important physiological compartment that acts as a bridge between plant cells and their environment. The plant apoplast contains many proteins that are involved in different biological processes such as cell wall biogenesis (Kwon et al., 2005), ion diffusion (Lopez-Millan et al., 2000), cell-to- cell communication (Brenner et al., 2006) and defense following pathogen infection (Jones and Dangl, 2006). In addition, several fungal and oomycete pathogens secrete proteins that appear to accumulate and function in the apoplast (Tian et al., 2004; Rooney et al., 2005; Tian et al., 2005; Tian et al.,
2007). Many of the apoplastic proteins, whether of plant or pathogen origin, have particular structures, such as two or more cysteine disulfide bridges, which presumably enable them to remain intact in the harsh acidic and protease-rich apoplast environment. In addition, many secreted apoplastic proteins, such as proteases, undergo specific processing that does not always occur when expressed in heterologous systems. Therefore, it is essential to develop reliable methods to express proteins in the plant apoplast. Epitope tagged apoplastic proteins enable the study of many biological functions, such as identification of interacting partners, activity assays, or large scale protein purification.
111 The Solanaceous species Nicotiana benthamiana is now considered a model organism for plant research due to several advantages in genetics as well as biochemical studies. It is a model system for virus-induced gene silencing
(VIGS) studies (Ruiz et al., 1998; Burch-Smith et al., 2004; Anand et al., 2007). It is a valuable tool for rapid evaluation of transgene function in higher plants
(Clemente, 2006) and it is an excellent target plant for functional genomics studies mediated by agroinfiltration (Liu et al., 2002; Escobar et al., 2003; Gils et al., 2005; Hellens et al., 2005; Sawers et al., 2006). Transient expression in N. benthamiana enables the production of epitope tagged proteins, such as the cre recombinase (Kopertekh and Schiemann, 2005), and the Cf resistance proteins
(Rooney et al., 2005). In addition, oomycete and fungal effector proteins were successfully expressed by agroinfiltration in N. benthamiana and were noted to cause symptoms such as cell death in plants (Kanneganti et al., 2006).
Transient expression of apoplastic proteins in N. benthamiana apoplast by agroinfiltration facilitates purification and characterization of these proteins to unravel their biological functions. Agroinfiltration (van der Hoorn et al., 2000; Lee and Yang, 2006) uses Agrobacteria that contain binary vectors with gene expression cassettes within the T-DNA region (Gelvin, 2000) to be transferred into the plant cells where the transcription and translation of the transgene occur.
Commonly used binary vectors are Potato virus X (PVX) (Ruiz et al., 1998) vector pGR106 (Jones et al., 1999; Lu et al., 2003), pBin19 (Bevan, 1984),
112 pBinPlus (van Engelen et al., 1995), and mini binary vector pCB302-3 (Xiang et al., 1999).
The expression of epitope tagged proteins in the plant apoplast is reputed to be problematic. In a recent report, several epitope tagged proteins were shown to be unstable in the tomato apoplast due to protein degradation or removal of affinity-tags preventing detection and affinity purification (van Esse et al., 2006).
However, the affinity-tag remained intact when the fusion proteins were expressed in Arabidopsis (van Esse et al., 2006). Unstable protein tags are often associated with two processes, expression and purification. During the protein expression in heterologous hosts, some host proteases might degrade the exogenous proteins because the overexpressed proteins may be toxic to the cells (Medina et al., 2000). In some cases, tag-derived sequences become the targets of proteases, leading to the removable tags. Alternatively, affinity tags are cleaved or removed from the proteins during affinity purification, resulting in tags that are undetectable after protein purification. Also, tagged proteins may be unstable in the plant apoplast due to improper folding (Nilsson and Anderson,
1991), improper cysteine disulfide bridge formation (Park et al., 2002), propeptide processing (Anderson et al., 2002; Jean et al., 2003) or the interference by large size tags (Waugh, 2005). To overcome these obstacles, a reliable vector system to obtain stable and functional epitope tagged apoplastic proteins is needed.
113 In this study, we investigated the expression of heterologous protein in the apoplast of N. benthamiana. We successfully expressed C-terminal epitope tagged derivatives of three tomato proteins, P69B-His, PIP1-His and Rcr3pim-His.
Western blot analysis revealed that the His tag remained stable under various conditions enabling protein purification by affinity chromatography of all three proteins. All three purified proteins displayed the expected biochemical functions, i.e. serine protease activity for P69B-His and cysteine protease activity for PIP1-
His and Rcr3pim-His. We conclude that C-terminal 6XHis tagged proteins are stably expressed in N. benthamiana apoplast and anticipate that this method will enable large-scale purification and analysis of secreted plant proteins and pathogen effectors.
4.3 MATERIALS AND METHODS
Plant growth, Bacterial Strains and Plasmids
Nicotiana benthamiana plants were grown in pots at 25°C, 60% humidity, under 16 hour-light/8 hour-dark cycle.
E. coli DH5α and A. tumefaciens GV3101 were used in this study, and routinely grown in LB medium (Sambrook et al., 1989) at 37°C and 28°C, respectively.
Plasmid pCB302-P69B-HA, pCB302-P69B-His, pCB302-PIP1-His and pCB302-Rcr3pim-His were constructed according to the methods described
114 elsewhere (Tian et al., 2004; Tian et al., 2005) and are derived from the A. tumefaciens binary vector pCB302-3 (Xiang et al., 1999). Plasmid pCB302-
P69B-HA contains the open reading frame of the P69B gene (GenBank accession number Y17276) fused with a HA tag (YPYDVPDY) at the C-terminus, whereas pCB302-P69B-His, pCB302-PIP1-His and pCB302-Rcr3pim-His contain a C-terminal 6XHis tag fused to the P69B gene, the open reading frame of the
Pip1 cDNA (TIGR accession number TC118154) and the Rcr3pim gene (GenBank accession number AF493232), respectively.
Transient protein expression assay by agroinfiltration in planta
Transient expression of P69B, PIP1-His and Rcr3pim-His in N. benthamiana was performed by agroinfiltration as described elsewhere (Tian et al., 2004; Tian et al., 2007). To enhance gene expression, all constructs were co- infiltrated with pJL3-p19-55 obtained from John Lindbo (The Ohio State
University). pJL3-p19-55 is an A. tumefaciens binary vector expressing the P19 protein of Tomato bushy stunt virus (TBSV), a suppressor of post-transcriptional gene silencing in N. benthamiana (Voinnet et al., 2003). A. tumefaciens GV3101 that contain different constructs were grown on selective media, collected by centrifugation and resuspended in agroinfiltration solution to the final OD600 of 1.0.
The Agrobacteria suspension was then infiltrated into the underside of six-week old N. benthamiana leaves. The leaves were collected four days after inoculation for apoplast extraction. Apoplastic fluids were prepared from N. benthamiana
115 leaves according to the method of de Wit and Spikeman (1982). A solution of 300 mM NaCl, 50 mM NaPO4 (pH 7.0) was used as extraction buffer (Kruger et al.,
2002). The apoplastic fluids were filter sterilized (0.45 µM) and used immediately or stored at –20°C.
Affinity chromatography purification
We used Ni-NTA affinity columns (Promega, Madison, WI) for purification of P69B-His from N. benthamiana apoplastic fluids. The column was settled by gravity and equilibrated with the equilibration buffer (pH 8.0). A total of 4ml of apoplastic fluids containing P69B-His was loaded inside the column and the flow through fraction was collected. The column was then washed with the equilibration buffer (pH 8.0), wash buffer 1 (10 mM imidazole) and wash buffer 2
(20 mM imidazole), sequentially. Finally an elution buffer consisting of an imidazole concentration gradient (50 mM imidazole to 200 mM imidazole) was added to the column to recover P69B-His protein. Afterward, 10 μl of the eluted fractions were run on SDS-PAGE gel followed by silver staining or western blotting to check for purity. The fractions used consisted of essentially a single band corresponding to P69-His.
SDS-PAGE and western blot analysis
Protein samples were subjected to 15% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The gel was then either stained
116 with Coomassie Brilliant Blue or transferred to nitrocellulose membranes (BioRad
Laboratories, Hercules, CA) using a Mini trans-Blot apparatus (BioRad
Laboratories, Hercules, CA). Western blot was used to detect the protein using alkaline phosphatase kit (BioRad Laboratories, Hercules, CA). Anti-His alkaline phosphatase conjugated antisera and anti-FLAG antisera were purchased from
Sigma (St. Louis, MO).
Protein degradation assay
Protein degradation assays were conducted by incubating a three-fold serials dilution with maximum amount 300 ng (33 pmol) of purified protein P69B with purified proteins rEPIC1 or rEPI1 for 60 min at 25°C, followed by SDS-PAGE and Coomassie Brilliant Blue staining.
Liquid Chromatography Mass Spectrometry (LC-MS)
LC-MS sequencing of cleaved peptides was performed at the proteomics facility of The Cleveland Clinic Foundation (Cleveland, OH). For protein digestion, the bands were cut from the gel as closely as possible to minimize excess polyacrylamide, divided into a number of smaller pieces, washed/destained in
50% ethanol, 5% acetic acid, and reduced and alkylated with DTT and iodioacetamide. The gel pieces were then dehydrated in acetonitrile and dried in a Speed-vac. In-gel proteolytic digestion using trypsin was accomplished by adding 50 mM ammonium bicarbonate containing 5 µl 20 ng/µl trypsin and
117 incubating overnight at room temperature to achieve complete digestion. The peptides that were formed were extracted from the polyacrylamide in two aliquots of 30 µl 50% acetonitrile with 5% formic acid. These extracts were combined and evaporated to <30 µl for LC-MS analysis. The digest was analyzed using the data dependent multitask capability of the instrument acquiring full scan mass spectra to determine peptide molecular weights and product ion spectra to determine amino acid sequence in successive instrument scans. The data were analyzed by using all CID spectra collected in the experiment to search the NCBI non-redundant database with the search program Mascot. All matching spectra were verified by manual interpretation. The interpretation process was aided by additional searches using the programs Sequest and Blast as needed.
4.4 RESULTS
Some epitope tags are unstable in N. benthamiana apoplast or during affinity purification
We observed that epitope tagged tomato proteins were unstable in the apoplast of N. benthamiana confirming a previous report by van Esse et al. (2006) that several epitope tags are unstable in tomato apoplast. To study tomato subtilisin-like serine protease P69B (Tornero et al., 1997; Jorda and Vera, 2000), we expressed P69B fused to epitope tag HA at the C terminus in N. benthamiana
118 apoplast using the construct pCB302-P69B-HA (Fig. 4.1). We detected the presence of P69B-HA in N. benthamiana apoplast by α-HA antisera in western blot. However, following purification by affinity chromatography using α-HA column, we could not detect P69B-HA in the recovered protein fractions by western blot using α-HA antisera (Fig. 4.2). We suspected that the HA tag was unstable and was removed from P69B during the purification process. In a different experiment in which we studied biochemical properties of the effector proteins EPIC1 and EPIC2B from the plant pathogen P. infestans, we expressed recombinant proteins FLAG-EPIC1 (rEPIC1) and FLAG-EPIC2B (rEPIC2B) in
E.coli supernatant using pFLAG-ATS (Sigma) (Tian et al., 2007). FLAG tags were removed from the proteins when we incubated rEPIC1 and rEPIC2B in the apoplastic fluid of the salicylic acid analog BTH-treated tomato (Tian et al., 2004), or N. benthamiana apoplast containing expressed P69B-HA (data not shown), suggesting that FLAG tags are unstable in these effector proteins when exposed to N. benthamiana apoplast.
P69B-His, PIP1-His and Rcr3pim-His can be highly expressed in N. benthamiana apoplast
To address the issue of tag stability, we tested several variations and settled on constructs with a C-terminal 6XHis tag (referred to as His tag). We therefore made binary constructs containing tomato serine protease P69B (Tian et al., 2004), as well as the cysteine proteases PIP1 (Phytophthora Inhibited
119 Protease 1) (Tian et al., 2007) and Rcr3pim (Rooney et al., 2005) with His tags at the C terminus (Fig. 4.1). These constructs were then used in N. benthamiana transient protein expression assays by agroinfiltration. We infiltrated the
Agrobacterium tumefaciens GV3101 stains containing the three constructs into N. benthamiana leaves. Four to five days after infiltration, the apoplast fluids from the infiltrated leaves were extracted and were subjected to SDS-PAGE followed by Coomassie brilliant staining (left panels) or Western blot with α-His antisera
(right panels) to detect P69B-His, PIP1-His and Rcr3pim-His (Fig. 4.3). A distinct band of ~ 80 kDa was detected in apoplast fluids from leaves infiltrated with A. tumefaciens carrying the plasmid pCB302-P69B-His, but not from leaves infiltrated with A. tumefaciens containing the empty binary vector pCB302-3, indicating that the mature form of P69B-His was successfully expressed.
Similarly, a distinct band of ~ 30 kDa was detected in apoplast fluids from leaves infiltrated with A. tumefaciens carrying the plasmid pCB302-PIP1-His and pCB302-Rcr3pim-His, but not from leaves infiltrated with A. tumefaciens containing the empty binary vector pCB302-3, indicating that the mature forms of
PIP1-His and Rcr3pim-His were successfully expressed. In addition, the detectable His-tags from all three proteins indicated that the C-terminal His-tag is stable in planta during the expression, post-translational modification and protein maturation processes.
120 P69B-His is stable during affinity purification
We used Ni-NTA affinity chromatography to purify P69B-His from apoplastic fluids of N. benthamiana. The elution fractions were subjected to SDS-
PAGE followed by either silver staining to check the amount and purity of the protein or western blot using α-His antisera to test the stability of the His tag.
Unlike the HA tag, the His tag remained stable during the purification process and P69B-His was readily detected in the elution fractions (Fig. 4.4). We quantified P69B-His by running our samples on SDS-PAGE and comparing to the BSA standard on Coomassie-stained SDS-PAGE gel (data not shown) and by using BioRad protein assay. From 10 ml total N. benthamiana apoplastic extract, we obtained about 40 µg purified P69B-His protein. These results show that a C-terminal His tag is stable and could be used to effectively tag and purify proteins from the N. benthamiana apoplast.
Purified P69B-His is active and exhibits specific cleavage activity
As described above, while assaying protease inhibitors, we noted that the recombinant protein FLAG-EPIC1 (Tian et al., 2007) was degraded by apoplastic extracts containing P69B (data not shown). However, we encountered some difficulties on purifying P69B-HA to study its cleavage activity and specificity. To determine whether the purified P69B-His is also active, we performed protein degradation assays using affinity purified P69B-His. Three purified recombinant
121 proteins FLAG-EPI1a (rEPI1) (Tian and Kamoun, 2005), rEPIC1 and rEPIC2B
(Tian et al., 2007) from the oomycete pathogen P. infestans were used as substrates in the degradation reactions. Incubation of these three peptides with purified P69B-His consistently resulted in undetectable FLAG tags of rEPIC1/C2B but not that of rEPI1a (data not shown). To determine whether degradation of rEPIC1 is dependent on the concentration of P69B-His, we incubated decreasing amounts of P69B-His with either rEPIC1 or rEPI1a. A degradation product was visible for rEPIC1 at the highest P69B-His concentration tested (33 pmol). Degradation of rEPIC1 was observed at concentrations as low as 3.7 pmol (Fig. 4.5A). No degradation of rEPI1a was observed which was not surprising because rEPI1a is a known inhibitor of P69B
(Tian and Kamoun, 2005). These experiments suggested that affinity purified C- terminal His-tagged P69B is functional and sufficient for the degradation of rEPIC1.
To identify P69B-His cleavage site in rEPIC1, we used LC-MS Mass
Spectrometry. The uncleaved and cleaved bands (Fig. 4.5A) were cut from a
Coomassie blue-stained gel and were reduced, alkylated, and digested with trypsin. The digest was analyzed by capillary column LC-tandem MS and the CID spectra searched against the EPIC1 sequence. The N-terminal sequences of both the uncleaved peptide and the cleaved peptide indicated that the P69B-His cleavage site is at Leu12-Glu13 (Fig. 4.5B). The fact that P69B cleaves FLAG tag
122 associated sequences, derived from the vector, represents an example of a reason behind unstable affinity tags in plant apoplast.
PIP1-His and Rcr3pim-His display cysteine protease activity
PIP1 (Phytophthora inhibited protease 1), a tomato PR protein closely related to Rcr3pim (required for Cladosporium fulvum resistance3) (Dixon et al.,
2000; Rooney et al., 2005), has been identified as one of the interactors of
EPIC2B using co-immunoprecipitation (Tian et al., 2007). To investigate the activities of these two proteases, we used N. benthamiana apoplastic extracts containing expressed PIP1-His and Rcr3pim-His in the DCG-04 protease activity profiling. DCG-04 is a biotinylated probe that covalently targets cysteine proteases of the papain family (Kocks et al., 2003). PIP1-His was successfully labeled with DCG-04 and detected by HRP-streptavidin, suggesting that it has cysteine protease activity (Tian et al., 2007). When we incubated rEPIC2B, a P. infestans cysteine protease inhibitor with PIP1-His before DCG-04 labeling, the protease activity was abolished, indicating that PIP1-His was inhibited by rEPIC2B (Tian et al., 2007). Similarly, Rcr3pim-His showed cysteine protease activity in the DCG-04 assay and was inhibited by both rEPIC1 and rEPIC2B
(Chapter 2). These results indicate that in planta expressed tomato cysteine proteases PIP1 and Rcr3pim with His tags at the C terminus are stable in N. benthamiana apoplast and retain their biological activities.
123 4.5 DISCUSSION
Epitope tags are crucial for detection, purification and functional analysis of important proteins expressed in the plant apoplast. In this study, we expressed apoplastic proteins with C-terminal His tags in N. benthamiana apoplast and achieved stability of His tags at the proteins C termini during expression and purification. In addition, the expressed proteins were functional before and after affinity purification. Our results indicate that C-terminal epitope His-tagged proteins in N. benthamiana apoplast enable detection, purification and biological functional studies. This represents a powerful tool for studying plant or microbial secreted proteins in planta.
We confirmed the previous observation of van Esse et al. that several tags are unstable in the apoplast of Solanaceous plants (van Esse et al., 2006). In this study, both HA and FLAG tags were unstable in N. benthamiana apoplast but C- terminal His tags were successfully used with three proteins. The His tag has many advantages, which makes it one of the most commonly used affinity tags for high-throughput protein purification (Schafer et al., 2002; Scheich et al., 2003;
Listwan et al., 2004). These advantages are i) the His-tag is small (6XHis) for easy handling and allows rapid purification on Ni-NTA agarose or agarose magnetic beads (Qiagen, CA); ii) the elution conditions are mild (pH 8.0, uncharged His tag) and flexible which allows purification under both native and
124 denaturing conditions; iii) in most cases, it doesn’t interfere with protein folding and function. However, the 6XHis tag also has disadvantages: i) unlike maltose binding protein (MBP), or glutathione S-transferase fusion (GST) that often enhance the protein solubility, His-tag sometimes contributes to protein insolubility; ii) the elution process requires gradient imidazole which causes inconsistent elution conditions for different proteins that have various binding capacities to the Ni-NTA matrices; iii) protease treatments are needed to remove the His tag (Kenig et al., 2006).
Tomato protease P69B, a member of the P69 family, belongs to subtilisin- like pathogenesis-related (PR) protease (Tornero et al., 1997). P69B is induced upon bacterial pathogen attack and salicylic acid-treatment (Jorda and Vera,
2000), suggesting a role in plant defense. We identified a specific P69B-His cleavage site on the linker region of protein FLAG-EPIC1, leading to the removal of N-terminal FLAG tags and causing undetectable tags for further evaluation.
Thus, P69B cleavage of target proteins expressed in the plant apoplast indicates that it is essential to use an appropriate linker sequences between tags and mature protein sequences to avoid proteolytic degradation. However, we cannot rule out the fact that P69B may recognize multiple cleavage sites in its substrate protein sequences for degradation.
125 Identification of the P69B cleavage site specificity will help to investigate whether P69B could be the tomato protease that cleaves the tags of several effectors as reported by van Esse et al., 2006. The presence of P69B orthologs in tomato (Jorda et al., 1999) is possibly one of the reasons why several effectors were undetectable after being expressed in tomato apoplast (van Esse et al.,
2006). However, no P69B orthologs were found in A. thaliana (van Loon et al.,
2006), which could be one of the reasons why A. thaliana apoplast has no impact on protein stability (van Esse et al., 2006). Another explanation could be the presence of an indigenous inhibitor.
HA tags were stable in the apoplast but didn’t survive purification of P69B-
HA in our experiments. We have observed the self-processing of P69B protein either during storage or co-immunoprecipitation processes before (data not shown), so it is possible that under favorable conditions, self-processing by P69B itself during purification causes the cleavage of the P69B-HA, leading to the undetectable HA tags by α-HA antisera. Thus, even though HA tags are suitable for other apoplast proteins, there is potential risk that these proteins will be processed by some proteases like P69B homologs in N. benthamiana apoplast.
The transient apoplast expression system we described in this study has several advantages. First, high yield of target proteins can be obtained from N. benthamiana apoplast with the help of P19 (Voinnet et al., 2003), a gene
126 silencing suppressor that functions well in the agroinfiltration assay. In addition, the 35S promoter and the omega enhancer at the N terminus contribute to higher expression efficiency for the target genes inserted in the multiple cloning sites
(MCS). In a typical trial, we were able to get ~6 ml of crude apoplastic extract from twenty N. benthamiana plants with an average of six leaves per plant, from which ~40 μg purified protein are generated. Thus, this method can be easily applied to large-scale protein expression and purification of milligrams of proteins.
Second, the expressed proteins are able to maintain their tag stability and biological property for functional analysis. As we demonstrated before, the C- terminus His tags remain intact during expression in apoplast and survive the affinity purification procedures. Protease activity assay of P69B-His, PIP1-His and Rcr3pim-His also provide an example of detectable His tags on target proteins even after inhibition assays. Third, the plant apoplast is a less complex environment than plant cytoplasm since fewer components are involved including proteins, chemical molecules, cell organs. Examples of the use of apoplastic extracts to purify from various plants (de Wit and Spikman, 1982; Holden and
Rohringer, 1985; Kanofsky and Sima, 1995; Kruger et al., 2002) indicate that it is more effective and less intense to extract proteins from plant apoplast than soluble protein extraction from plant cytoplasm (http://www.protocol-online.org/).
Last, most proteins exist in a soluble status in the apoplast, which facilitates the following affinity purification. Compared to the other protein expression systems, this system requires no pre-treatment on the crude extracts such as breaking the
127 cells, extracting the soluble fractions, etc. Besides, in contrast to extraction buffers that contain high quantity of reducing agents, chelating chemicals or detergents from other systems, simple extraction buffers in this system cause less damage to the target proteins and maintain protein stability by providing a neutral pH environment.
In practice, however, there are some limitations of using N. benthamiana apoplast for heterologous protein expression. First, this system is probably not suitable for cytosolic protein expression because these proteins can be easily degraded in harsh acidic and protease-rich apoplast; Second, the His tag may interfere with the function of some proteins. For example, an affinity His-tag
(6XHis) that is directly attached to the protein caused the loss of enzyme activity of Vibrio mimicus arylesterase, a multifunctional enzyme with thioesterase and chymotrypsin-like activities (Lee et al., 1997). However, the spacing peptide between His-tag and arylesterase successfully prevented the interference of the
His-tag to the enzyme functions (Lee et al., 1997). In another case, post- translational modification of the N-terminal His tag interfered with the crystallization of the wild-type and mutant SH3 domains from chicken src tyrosine kinase (Kim et al., 2001). An alternative way to solve this problem is to use other affinity tags on wither N-terminal or C-terminal of the proteins, depending on the stability and functional integrity of the proteins. Third, the elution process from Ni-
NTA columns requires 10 mM to 250 mM imidazole gradient, which could
128 generate potential protein mix in the elution fractions if more complicated crude extracts are applied.
In summary, our data shows that expression of C-terminal His-tagged proteins in N. benthamiana apoplast is efficient enough to enable purification of functional proteins. This method can be scaled up to enable high levels of protein expression and affinity purification. In brief, in planta apoplastic protein expression provide a simple tool for expression and purification of both apoplastic plant proteins and pathogen effectors to facilitate plant-microbe interaction studies.
4.6 ACKNOWLEDGEMENTS
We thank Dr. Joe Win and Dr. William Morgan for critical reading and editing, Dr.
John Lindbo for providing the pJL13-p19-55 vector, Dr. Jonathan Jones for providing the pMWBin19Rcr3pimHisHA plasmid for Rcr3pim cloning, Dr. Catherine
Bruce and Dr. Mike Kinter for peptide sequencing and Kerilynn Jagger for preparing the N. benthamiana plants in the green house. This work was supported by the by National Research Initiative Competitive Grant from the
USDA Cooperative State Research, Education, and Extension Service. Salaries and research support were provided by State and Federal Funds appropriated to
129 the Ohio Agricultural Research and Development Center, the Ohio State
University.
4.7 REFERENCES
Anand, A., Vaghchhipawala, Z., Ryu, C.M., Kang, L., Wang, K., del-Pozo, O., Martin, G.B., and Mysore, K.S. (2007) Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Mol Plant Microbe Interact. 20: 41-52
Anderson, E.D., Molloy, S.S., Jean, F., Fei, H., Shimamura, S., and Thomas, G. (2002) The Ordered and Compartment-specific Autoproteolytic Removal of the Furin Intramolecular Chaperone Is Required for Enzyme Activation. The Journal of Biological Chemistry 277: 12879-12890
Bevan, M.W. (1984) Binary Agrobacterium vectors for plant transformation. Nucleic Acids Res. 12: 8711-8721
Brenner, E.D., Stahlberg, R., Mancuso, S., Vivanco, J., F., B., and Van Volkenburgh, E. (2006) Plant neurobiology: an integrated view of plant signaling. TRENDS in Plant Science 11: 1360-1385
Burch-Smith, T.M., Anderson, J.C., Martin, G.B., and Dinesh-Kumar, S.P. (2004) Applications and advantages of virus-induced gene for gene function studies in plants. The Plant Journal 39: 734-746
Clemente, T. (2006) Nicotiana (Nicotiana tobaccum, Nicotiana benthamiana). Methods Mol Biol. 343: 143-154 de Wit, P.J.G.M., and Spikman, G. (1982) Evidence for the occurrence of race and cultivar-specific elicitors of necrosis in intercellular fluids of compatible interactions of Cladosporium fulvum and tomato. Physiol Plant Pathol 21: 1-11
Dixon, M.S., Golstein, C., Thomas, C.M., van Der Biezen, E.A., and Jones, J.D. (2000) Genetic complexity of pathogen perception by plants: the example of Rcr3, a tomato gene required specifically by Cf-2. Proc. Natl. Acad. Sci. U S A 97: 8807-8814
130 Escobar, C., Hernandez, L.E., Jimenez, A., Creissen, G., Ruiz, M.T., and Mullineaux, P.M. (2003) Transient expression of Arabidopsis thaliana ascorbate peroxidase 3 in Nicotiana benthamiana plants infected with recombinant potato virus X. Plant Cell Rep. 21: 699-704
Gelvin, S.B. (2000) Agrobacterium and Plant Genes Involved in T-DNA Transfer and Integration. Annual Review of Plant Physiology and Plant Molecular Biology 51: 223-256
Gils, M., Kandzia, R., Marillonnet, S., Klimyuk, V., and Gleba, Y. (2005) High- yield production of authentic human growth hormone using a plant virus- based expression system. Plant Biotechnol. J. 3: 613-620
Hellens, R.P., Allan, A.C., Friel, E.N., Bolitho, K., Grafton, K., Templeton, M.D., Karunairetnam, S., Gleave, A.P., and Laing, W.A. (2005) Transient expression vectors for functional genomics, quantification of promoter activity and RNA silencing in plants. Plant Methods 1: 13
Holden, D.W., and Rohringer, R. (1985) Peroxidases and Glycosidases in Intercellular Fluids from Noninoculated and Rust-Affected Wheat Leaves. Plant Physiol. 79: 820-824
Jean, L., Hackett, F., Martin, S.R., and Blackman, M.J. (2003) Functional Characterization of the Propeptide of Plasmodium falciparum Subtilisin- like Protease-1. The Journal of Biological Chemistry 278: 28572-28579
Jones, J.D.G., and Dangl, J.L. (2006) The plant immune system. Nature Reviews 444: 323-329
Jones, L., Hamilton, A.J., Voinnet, O., Thomas, C.L., Maule, A.J., and Baulcombe, D.C. (1999) RNA-DNA interactions and DNA methylation in post-transcriptional gene silencing. Plant Cell Physiol. 11: 2291-2301
Jorda, L., Coego, A., Conejero, V., and Vera, P. (1999) A genomic cluster containing four differentially regulated subtilisin-like processing protease genes is in tomato plants. J Biol Chem 274: 2360-2365
Jorda, L., and Vera, P. (2000) Local and Systemic Induction of Two Defense- Related Subtilisin-Like Protease Promoters in Transgenic Arabidopsis Plants. Luciferin Induction of PR Gene Expression. Plant Physiology 124: 1049-1057
131 Kanneganti, T., Huitema, E., and S., K. (2006) In planta Expression of Oomycete and Fungal Genes. Methods Mol Biol. 354: 35-44
Kanofsky, J.R., and Sima, P.D. (1995) Singlet Oxygen Generation from the Reaction of Ozone with Plant Leaves. The Journal of Biological Chemistry 14: 7850-7852
Kenig, M., Peternel, S., Gaberc-Porekar, V., and Menart, V. (2006) Influence of the protein oligomericity on final yield after affinity tag removal in purification of recombinant proteins. J Chromatogr A 1101: 293-306
Kim, K.M., Yi, E.C., Baker, D., and Zhang, K.Y.J. (2001) Post-translational modification of the N-terminal His tag interferes with the crystallization of the wild-type and mutant SH3 domains from chicken src tyrosine kinase. Acta Cryst. D57: 759-762
Kocks, C., Maehr, R., Overkleeft, H.S., Wang, E.W., Iyer, L.K., Lennon- Dumenil, A., H.L., P., and Kessler, B.M. (2003) Functional Proteomics of the Active Cysteine Protease Content in Drosophila S2 Cells. Molecular & Cellular Proteomics: 1188-1197
Kopertekh, L., and Schiemann, J. (2005) Agroinfiltration as a Tool for Transient Expression of cre Recombinase in vivo. Transgenic Research 14: 793-798
Kruger, J., Tomas, C.M., Golstein, C., Dixon, M.S., Smoker, M., Tang, S., Mulder, L., and Jones, J.D.G. (2002) A Tomato Cysteine Protease Required for Cf-2-Dependent Disease Resistance and Suppression of Autonecrosis. Science 296: 745-747
Kwon, H.K., Yokoyama, R., and Nishitani, K. (2005) A proteomic approach to apoplastic proteins involved in cell wall regeneration in protoplasts of Arabidopsis suspension-cultured cells. Plant Cell Physiol. 46: 843-857
Lee, M.W., and Yang, Y. (2006) Transient expression assay by agroinfiltration of leaves. Methods Mol Biol. 323: 225-229
Lee, Y.L., Chang, R.C., and Shaw, J.F. (1997) Facile purification of a C-terminal extended his-tagged Vibrio mimicus arylesterase and characterization of the purified enzyme : Biotechnology. Journal of the American Oil Chemists' Society 74: 1343-1455
132 Listwan, P., Martin, J., B., K., and Cowieson, N. (2004) Methods for High- Throughput Protein Expression, Purification and Structure Determination Adapted for Structural Genomics. Australian Biochemist 35: 43-46
Liu, Z.M., Liu, Z.Z., Bai, Q.W., and Fang, R.X. (2002) Agroinfiltration, a useful technique in plant molecular biology research. Sheng Wu Gong Cheng Xue Bao 18: 411-414
Lopez-Millan, A.F., Morales, F., Andaluz, S., Gogorcena, Y., Abadia, A., Rivas, J.D.L., and Abadia, J. (2000) Responses of Sugar Beet Roots to Iron Deficiency. Changes in Carbon Assimilation and Oxygen Use. Plant Physiology 124: 885-897
Lu, R., Malcuit, I., Moffett, P., Ruiz, M.T., Peart, J., Wu, A.J., Rathjen, J.P., Bendahmane, A., Day, L., and Baulcombe, D.C. (2003) High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO J. 22: 5690-5699
Medina, D., Moskowitz, N., Khan, S., Christopher, S., and Germino, J. (2000) Rapid purification of protein complexes from mammalian cells. Nucleic Acids Res 28: E61
Nilsson, B., and Anderson, S. (1991) Proper and improper folding of proteins in the cellular environment. Annu Rev Microbiol 45: 607-635
Park, S., Kim, H., Kim, C., Yun, H., Choi, E., and Lee, B. (2002) Role of proline, cysteine and a disulphide bridge in the structure and activity of the anti- microbial peptide gaegurin 5. Biochem. J. 368: 171-182
Rooney, H.C.E., van't Klooster, J.W., van der Hoorn, R.A.L., Joosten, M.H.A.J., Jones, J.D.G., and de Wit, P.J.G.M. (2005) Cladosporium Avr2 Inhibits Tomato Rcr3 Protease Required for Cf-2-Dependent Disease Resistance. Science 308: 1785-1786
Ruiz, M.T., Voinnet, O., and Baulcombe, D.C. (1998) Initiation and maintenance of virus-induced gene silencing. Plant Cell 10: 937-946
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
133 Sawers, R.J.H., Farmer, P.R., Moffett, P., and Brutnell, T.P. (2006) In planta transient expression as a system for genetic and biochemical analyses of chlorophyll biosynthesis. Plant Methods 2: 15
Schafer, F., Romer, U., Emmerlich, M., Blumer, J., Lubenow, H., and Steinert, K. (2002) Automated high-throughput purification of 6xHis-tagged proteins. Journal of Biomolecular Techniques 13: 131-142
Scheich, C., Sievert, V., and Bussow, K. (2003) An automated method for high-throughput protein purification applied to a comparison of His-tag and GST-tag affinity chromatography. BMC Biotechnology 3: 1-8
Tian, M., Benedetti, B., and Kamoun, S. (2005) A Second Kazal-like protease inhibitor from Phytophthora infestans inhibits and interacts with the apoplastic pathogenesis-related protease P69B of tomato. Plant Physiol. 138: 1785-1793
Tian, M., Huitema, E., Da, C., L., Torto-Alalibo, T., and Kamoun, S. (2004) A Kazal-like extracellular serine protease inhibitor from Phytophthora infestans targets the tomato pathogenesis-related protease P69B. J Biol Chem 279: 26370-26377
Tian, M., and Kamoun, S. (2005) A two disulfide bridge Kazal domain from Phytophthora exhibits stable inhibitory activity against serine proteases of the subtilisin family. BMC Biochem. 6: 15
Tian, M., Win, J., Song, J., van der Hoorn, R., van der Knaap, E., and Kamoun, S. (2007) A Phytophthora infestans cystatin-like protein targets a novel tomato papain-like apoplastic protease. Plant Physiol. 143: 364- 377
Tian, M., Win*, J., Song*, J., van der Hoorn, R., van der Knaap, E., and Kamoun, S. (2007) A cascade of inhibition of tomato proteases during infection by Phytophthora infestans. (*Equal second author). Plant Physiology 143: 1-14
Tornero, P., Conejero, V., and Vera, P. (1997) Identification of a new pathogen- induced member of the subtilisin-like processing protease family from plants. J Biol Chem 272: 14412-14419
134 van der Hoorn, R.A.L., Laurent, F., Roth, R., and de Wit, P.J.G.M. (2000) Agroinfiltration Is a Versatile Tool That Facilitates Comparative Analyses of Avr9/Cf-9-Induced and Avr4/Cf-4-Induced Necrosis. MPMI 13: 439-446 van Engelen, F.A., Molthoff, J.W., Conner, A.J., Nap, J.P., Pereira, A., and Stiekema, W.J. (1995) pBINPLUS: an improved plant transformation vector based on pBIN19. Transgenic Res. 4: 288-290 van Esse, H.P., Thomma, B.P.H.J., van't Klooster, J.W., and de Wit, P.J.G.M. (2006) Affinity-tags are removed from Cladosporium fulvum effector proteins expressed in the tomato leaf apoplast. Journal of Experimental Botany 57: 599-608 van Loon, L.C., Rep, M., and Pieterse, C.M. (2006) Significance of inducible defense-related proteins in infected plants. Annu Rev Phytopathol 44: 135-162
Voinnet, O., Rivas, S., Mestre, P., and Baulcombe, D. (2003) An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J 33: 949- 956
Waugh, D.S. (2005) Making the most of affinity tags. TRENDS in Biotechnology 23: 316-320
Xiang, C., Han, P., Lutziger, I., Wang, K., and Oliver, D.J. (1999) A mini binary vector series for plant transformation. Plant Mol Biol 40: 711-717
135
Figure 4.1 Protein expression constructs used in this study. Schematic structures of T-DNA regions in protein expression constructs pCB302-3 (Vector control), pCB302-Rcr3pim-His, pCB302-PIP1-His, pCB302-P69B-His and pCB302-P69B-HA are shown. LB is left border; RB is right border; Tnos refers to terminator; 35S is 35S promoter; His and HA refer to C-terminal 6XHis tag and
HA tag, respectively. Four thin bars after RB represent the selective marker region of the binary vector.
136
Affinity Purification M Before After [kDa] 93.6- P69B-HA 50.4- 37.4- 29.0-
17.4-
6.9-
Figure 4.2 HA tag is unstable in P69B-HA during purification. Following transient expression in N. benthamiana apoplast, Protein P69B-HA fractions before and after purification were subjected to 15% SDS-PAGE gel followed by Western blot analysis using α-HA antisera. The single band corresponding to P69B-HA is indicated. The size in kDa of the molecular weight markers is shown on the left.
137
Figure 4.3 P69B-His, PIP1-His and Rcr3pim-His are highly expressed in N. benthamiana apoplast.
138 (A) Expression of P69B-His in N. benthamiana using agroinfiltration. Intercellular fluids were isolated from N. benthamiana leaves infiltrated with Agrobacterium tumefaciens containing the binary vector pCB302-P69B-His (P69B+) or pCB302-
3 (P69B-). (B) Expression of PIP1-His in N. benthamiana using agroinfiltration.
Intercellular fluids were isolated from N. benthamiana leaves infiltrated with
Agrobacterium tumefaciens containing the binary vector pCB302-PIP1-His
(PIP1+) or pCB302-3 (PIP1-). (C) Expression of Rcr3pim-His in N. benthamiana using agroinfiltration. Intercellular fluids were isolated from N. benthamiana leaves infiltrated with Agrobacterium tumefaciens containing the binary vector pCB302-Rcr3pim-His (Rcr3+) or pCB302-3 (Rcr3-). A. tumefaciens carrying the gene silencing suppressor P19 was always coinfiltrated in order to enhance protein expression. The intercellular fluids were used in Western blot with α-His antisera. Coomassie blue staining is shown on the left and Western blot is on the right. The black dot points to the different band corresponding to the expressed target protein. The size in kDa of the molecular weight markers is shown on the left.
139 M E1 E2 E3 E4 E5 E6 E7 [kDa] P69B-His 93.6- 50.4- 37.4- 29.0-
17.4-
6.9-
93.6- P69B-His 50.4-
Figure 4.4 P69B-His is stable during affinity purification. After affinity purification by Ni-NTA column, seven elution fractions (E1 to E7) of P69B-His are subjected to 15% SDS-PAGE gel followed by silver staining (top) or Western blot analysis
(bottom) by anti-His antisera. Single band corresponding to P69B-His is indicated.
The size in kDa of the molecular weight markers is shown on the left.
140
Figure 4.5 Purified P69B-His is active and exhibits specific cleavage activity. (A) Affinity purified P69B-His cleaves the recombinant protein FLAG-EPIC1. Recombinant proteins FLAG-EPIC1 (rEPIC1) and FLAG-EPI1a (rEPI1a) were incubated with three-fold serial dilutions of purified P69B starting with 33 pmol (second lane from left). The compositions of the reaction mixes are indicated by the +/- signs. Equal amounts of rEPIC1 and rEPI1a were loaded in all lanes. All the samples were electrophoresed in SDS-PAGE gel followed by staining with Coomassie blue. The intact and degradation (deg) products of the rEPI proteins are indicated by arrows. (B) LC-MS sequencing result of cleavage site of cleaved product indicates the cleavage specificity of P69B-His. Incubation of affinity purified P69B-His with FLAG-EPIC1 results in the cleavage of FALG-EPIC1 to a shorter peptide Deg.FLAG-EPIC1. Coomassie blue staining of SDS-PAGE gel loaded with the uncleaved FLAG-EPIC1 and cleaved products (top). FLAG tag and EPIC1 mature protein sequence are indicated by boxes. Red arrow indicates the cleavage site of FLAG-EPIC1 by P69B-His (bottom).
141
APPENDIX
P. INFESTANS EPIC2B TARGETS TOMATO CYSTEINE PROTEASE PIP1
Reference:
Tian, M., Win, J., Song, J., van der Hoorn, R., van der Knaap, E., and Kamoun, S. (2007). A Phytophthora infestans cystatin-like protein targets a novel tomato papain-like apoplastic protease. Plant Physiol. 143, 364-377.
142 BIBLIOGRAPHY
Abrahamson, M., Alvarez-Fernandez, M., and Nathanson, C.M. (2003). Cystatins. Biochem. Soc. Symp. 70, 179-199.
Abramovitch, R.B., and Martin, G.B. (2005). AvrPtoB: a bacterial type III effector that both elicits and suppresses programmed cell death associated with plant immunity. FEMS Microbiol. Lett. 245, 1-8.
Abu-erreish, G.M., and Peanasky, R.J. (1974). Pepsin Inhibitors from Ascaris Zzcmbricoides. The Journal of Biological Chemistry 249, 1566-1571.
Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K., and Watson, J.D. (1994). Chapter 5: Protein Function. Molecular Biology of the Cell 3rd Ed. Garland Publishing, New York., 213-215.
Altincicek, B., Linder, M., Linder, D., Preissner, K.T., and Vilcinskas, A. (2007). Microbial Metalloproteinases Mediate Sensing of Invading Pathogens and Activate Innate Immune Responses in the Lepidopteran Model Host Galleria mellonella. Infect Immun. 75, 175-183.
Alvarez-Fernandez, M., Liung, Y.H., Abrahamson, M., and Su, X.D. (2005). Crystal structure of human cystatin D, a cysteine peptidase inhibitor with restricted inhibition profile. J. Biol. Chem. 280, 18221-18228.
Anand, A., Vaghchhipawala, Z., Ryu, C.M., Kang, L., Wang, K., del-Pozo, O., Martin, G.B., and Mysore, K.S. (2007). Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing. Mol Plant Microbe Interact. 20, 41-52.
143 Anderson, E.D., Molloy, S.S., Jean, F., Fei, H., Shimamura, S., and Thomas, G. (2002). The Ordered and Compartment-specific Autoproteolytic Removal of the Furin Intramolecular Chaperone Is Required for Enzyme Activation. The Journal of Biological Chemistry 277, 12879-12890.
Anderson, E.D., Thomas, L., Hayflick, J.S., and Thomas, G. (1993). Inhibition ofHIV-1 gp160-dependent membrane fusion by a furin-directed alpha 1-antitrypsin variant. J. Biol. Chem. 268, 24887-24891.
Armstrong, P.B. (2006). Proteases and protease inhibitors: a balance of activities in host-pathogen interaction. Immunobiology 211, 263-281.
Azzolini, S.S., Santos, J.M., Souza, A.F., Torquato, R.J., Hirata, I.Y., Andreotti, R., and Tanaka, A.S. (2004). Purification, characterization, and cloning of a serine proteinase inhibitor from the ectoparasite Haematobia irritans irritans (Diptera: Muscidae). Experimental Parasitology 106, 103-109.
Azzolini, S.S., Sasaki, S.D., Campos, I.T., Torquato, R.J., M.A., J., and AS., T. (2005). The role of HiTI, a serine protease inhibitor from Haematobia irritans irritans (Diptera: Muscidae) in the control of fly and bacterial proteases. Exp. Parasitol. 111, 30-36.
Baba, M. (2005). Advances in antiviral chemotherapy. Uirusu. 55, 69-75.
Baldauf, S.L. (2003). The Deep Roots of Eukaryotes. Science 300, 1703-1706.
Banchereau, J., and Steinman, R.M. (1998). Dendritic cells and the control of immunity. Nature 392, 245-252.
Barrett, A.J., Kembhavi, A.A., Brown, M.A., Kirschke, H., Knight, C.G., Tamai, M., and Hanada, K. (1982). L-trans-Epoxysuccinyl-leucylamido(4-guanidino butane (E-64) and its analogues as inhibitors of cysteine proteinases including cathepsins B, H and L. Biochem. J. 201, 189-198.
Berggard, T., Linse, S., and James, P. (2007). Methods for the detection and analysis of protein-protein interactions. Proteomics.
144 Bevan, M.W. (1984). Binary Agrobacterium vectors for plant transformation. Nucleic Acids Res. 12, 8711-8721.
Bobek, L.A., and Levine, M.J. (1992). Cystatins - Inhibitors of Cysteine Proteinases. Critical Reviews in Oral Biology and Medicine 3, 307-332.
Bode, W., Engh, R., Musil, D., Thiele, U., Huber, R., Karshikov, A., Brzin, J., Kos, J., and Turk, V. (1988). The 2.0 A X-ray crystal structure of chicken egg white cystatin and its possible mode of interaction with cysteine proteinases. EMBO J. 7, 2593-2599.
Brenner, E.D., Stahlberg, R., Mancuso, S., Vivanco, J., F., B., and Van Volkenburgh, E. (2006). Plant neurobiology: an integrated view of plant signaling. TRENDS in Plant Science 11, 1360-1385.
Broadway, R.M. (1989). Characterization and ecological implications of midgut proteolytic activity in larval Pieris rapae and Trichoplusia hi. J. Chem. Ecol. 15, 2101-2113.
Burch-Smith, T.M., Anderson, J.C., Martin, G.B., and Dinesh-Kumar, S.P. (2004). Applications and advantages of virus-induced gene for gene function studies in plants. The Plant Journal 39, 734-746.
Businaro, R., Fioretti, E., Fumagalli, L., De Renzis, G., Fiorucci, L., and Ascoli, F. (1989). Bovine pancreatic trypsin inhibitor and related isoinhibitors in bovine liver. Journal Histochemistry and Cell Biology 93, 69-74.
Cawley, N.X., Chino, M., Maldonado, A., Rodriguez, Y.M., Loh, Y.P., and Ellman, J.A. (2003). Synthesis and characterization of the first potent inhibitor of yapsin 1. Implications for the study of yapsin-like enzymes. J Biol Chem. 278, 5523-5530.
Chang, I.F. (2006). Mass spectrometry-based proteomic analysis of the epitope-tag affinity purified protein complexes in eukaryotes. Proteomics 6, 6158-6166.
Chisholm, S.T., Dahlbeck, D., Krishnamurthy, N., Day, B., Sjolander, K., and Staskawicz, B.J. (2005). Molecular characterization of proteolytic cleavage sites
145 of the Pseudomonas syringae effector AvrRpt2. Proc. Natl Acad. Sci. USA 102, 2087-2092.
Christeller, J., and Laing, W. (2005). Plant serine proteinase inhibitors. Protein Pept Lett 12, 439-447.
Christie, S.R., and Crawford, W.E. (1978). Plant virus range of Nicotiana benthamiana. Plant Dis. Rep. 62, 20-22.
Clemente, T. (2006). Nicotiana (Nicotiana tobaccum, Nicotiana benthamiana). Methods Mol Biol. 343, 143-154.
Clermont, A., Wedde, M., Seitz, V., Podsiadlowski, L., Lenze, D., Hummel, M., and Vilcinskas, A. (2004). Cloning and expression of an inhibitor of microbial metalloproteinases from insects contributing to innate immunity. Biochem J. 382, 315-322.
Congote, L.F. (2007). Serpin A1 and CD91 as host instruments against HIV-1 infection: are extracellular antiviral peptides acting as intracellular messengers? Virus Res. 125, 119-134.
Cutt, J.R., Dixon, D.C., Carr, J.P., and Klessig, D.F. (1988). Isolation and nucleotide sequence of cDNA clones for the pathogenesis-related proteins PR1a, PR1b and PR1c of Nicotiana tabacum cv. Xanthi nc induced by TMV infection. Nucleic Acids Research 16, 9861.
Dainichi, T., Maekawa, Y., Ishii, K., Zhang, T., Nashed, B.F., Sakai, T., Takashima, M., and Himeno, K. (2001). Nippocystatin, a Cysteine Protease Inhibitor from Nippostrongylus brasiliensis, Inhibits Antigen Processing and Modulates Antigen-Specific Immune Response. Infection and Immunity 69, 7380-7386.
Dangl, J.L., and Jones, J.D.G. (2001). Plant pathogens and integrated defence responses to infection. Nature 411, 826-833.
Dash, C., Kulkarni, A., Dunn, B., and Rao, M. (2003). Aspartic peptidase inhibitors: implications in drug development. Crit Rev Biochem Mol Biol. 38, 89-119.
146 De Gregorio, E., Spellman, P.T., Rubin, G.M., and Lemaitre, B. (2001). Genome-wide analysis of the Drosophila immune response by using oligonucleotide microarrays. Proc Natl Acad Sci U S A. 98, 12590-12595.
De Leo, F., Volpicella, M., Licciulli, F., Liuni, S., Gallerani, R., and Ceci, L.R. (2002). PLANT-PIs: a database for plant protease inhibitors and their genes. Nucleic Acids Res. 30, 347-348. de Wit, P.J.G.M., and Spikman, G. (1982). Evidence for the occurrence of race and cultivar-specific elicitors of necrosis in intercellular fluids of compatible interactions of Cladosporium fulvum and tomato. Physiol. Plant Pathol. 21, 1-11.
Deshapriya, R.M., Takeuchi, A., Shirao, K., Isa, K., Watabe, S., Murakami, R., Tsujimura, H., and Yamamoto, Y. (2007). Drosophila CTLA-2-like protein (D/CTLA-2) inhibits cysteine proteinase 1 (CP1), a cathepsin L-like enzyme. Zoolog Sci. 24, 21-30.
Dieckmann, T., Mitschang, L., Hofmann, M., Kos, J., Turk, V., Auerswald, E.A., Jaenicke, R., and Oschkinat, H. (1993). The structures of native phosphorylated chicken cystatin and of a recombinant unphosphorylated variant in solution. J. Mol. Biol. 234, 1048-1059.
Dixon, M.S., Golstein, C., Thomas, C.M., van Der Biezen, E.A., and Jones, J.D. (2000). Genetic complexity of pathogen perception by plants: the example of Rcr3, a tomato gene required specifically by Cf-2. Proc. Natl. Acad. Sci. U S A 97, 8807-8814.
Dodds, P.N., Lawrence, G.J., Catanzariti, A., Ayliffe, M.A., and Ellis, J.G. (2004). The Melampsora lini AvrL567 Avirulence Genes Are Expressed in Haustoria and Their Products Are Recognized inside Plant Cells. The Plant Cell 16, 755-768.
Eder, J., Hommel, U., Cumin, F., Martoglio, B., and Gerhartz, B. (2007). Aspartic proteases in drug discovery. Curr Pharm Des. 13, 271-285.
Escobar, C., Hernandez, L.E., Jimenez, A., Creissen, G., Ruiz, M.T., and Mullineaux, P.M. (2003). Transient expression of Arabidopsis thaliana ascorbate peroxidase 3 in Nicotiana benthamiana plants infected with recombinant potato virus X. Plant Cell Rep. 21, 699-704.
147 Falkenstein, K.F., Tooley, P.W., Goodwin, S.B., and Fry, W.E. (1991). Differentiation of group IV Phytophthora species by PCR amplification of nuclear ribosomal DNA internal transcribed spacer region. (Abstr.). Phytopathology 81, 1157.
Fossum, K., and Whitaker, J.R. (1968). Ficin and Papain Inhibitor from Chicken Egg White. Arch. Biochem. Biophys. 125, 367-375.
Frobius, A.C., Kanost, M.R., Gotz, P., and Vilcinskas, A. (2000). Isolation and characterization of novel inducible serine protease inhibitors from larval hemolymph of the greater wax moth Galleria mellonella. European Journal of Biochemistry 267, 2046-2053.
Gaczynska, M., and Osmulski, P.A. (2005). Small-molecule inhibitors of proteasome activity. Methods Mol. Biol. 301, 3-22.
Galindo, A.J., and Hohl, H.R. (1985). Phytophthora mirabilis, a new species of Phytophthora. Sydowia Ann. Mycol. 38, 87-96.
Gaynes, R., and Edwards, J.R. (2005). Overview of Nosocomial Infections Caused by Gram-Negative Bacilli. Clinical Infectious Diseases 41, 849-854.
Gelvin, S.B. (2000). Agrobacterium and Plant Genes Involved in T-DNA Transfer and Integration. Annual Review of Plant Physiology and Plant Molecular Biology 51, 223-256.
Gils, M., Kandzia, R., Marillonnet, S., Klimyuk, V., and Gleba, Y. (2005). High-yield production of authentic human growth hormone using a plant virus-based expression system. Plant Biotechnol. J. 3, 613-620.
Graham, J.S., and Ryan, C.A. (1981). Accumulation of metallocarboxy-peptidase inhibitor in leaves of wounded potato plants. Biochem. Biophys. Res. Commun. 101, 1164-1170.
Grant, G.A., Xu, X.L., and Hu, Q. (1999). The relationship between effector binding and inhibition of activity in d-3-phosphoglycerate dehydrogenase. Protein Science 8, 2501-2505.
148 Greenbaum, D., Arnold, W., Lu, F., Hayrapetian, L., Baruch, A., Krumrine, J., Toba, S., Chehade, K., Bromme, D., Kuntz, I.D., and Bogyo, M. (2002). Small Molecule Affinity Fingerprinting: a Tool for Enzyme Family Subclassification, Target Identification, and Inhibitor Design. Chem. Biol. 9, 1085-1094.
Greenbaum, D., Medzihradszky, K.F., Burlingame, A., and Bogyo, M. (2000). Epoxide electrophiles as activity-dependent cysteine protease profiling and discovery tools. Chem. Biol. 7, 569-581.
Guex, N., and Peitsch, M.C. (1997). SWISS-MODEL and the Swiss-PdbViewer: An environment for comparative protein modeling. Electrophoresis 18, 2714-2723.
Hall, T.A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41, 95-98.
Hass, G.M., and Ryan, C.A. (1981). Carboxypeptidase inhibitor from potatoes. Methods Enzymol. 80, 778-779.
Hecht, H.J., Szardenings, M., Collins, J., and Schomburg, D. (1992). Three-dimensional structure of a recombinant variant of human pancreatic secretory trypsin inhibitor (Kazal type). J. Mol. Biol. 225, 1095-1103.
Hellens, R.P., Allan, A.C., Friel, E.N., Bolitho, K., Grafton, K., Templeton, M.D., Karunairetnam, S., Gleave, A.P., and Laing, W.A. (2005). Transient expression vectors for functional genomics, quantification of promoter activity and RNA silencing in plants. Plant Methods 1, 13.
Herrmann, L., Erkelenz, M., Aldag, I., Tiedtke, A., and Hartmann, M.W.W. (2006). Biochemical and molecular characterisation of Tetrahymena thermophila extracellular cysteine proteases. BMC Microbiology 6, 19-27.
Hilder, V.A., Gatehouse, A.M.R., Sheerman, S.E., Barker, R.F., and Boulter, D. (1987). A novel mechanism of insect resistance engineered into tobacco. Nature 330, 160-163.
Hirota, M., Ohmuraya, M., and Baba, H. (2006). The role of trypsin, trypsin inhibitor, and trypsin receptor in the onset and aggravation of pancreatitis.
149 Review. J Gastroenterol. 41, 832-836.
Holden, D.W., and Rohringer, R. (1985). Peroxidases and Glycosidases in Intercellular Fluids from Noninoculated and Rust-Affected Wheat Leaves. Plant Physiol. 79, 820-824.
Honee, G., Melchers, L.S., Vleeshouwers, V.G.A.A., van Roekel, J.S.C., and de Wit, P.J.G.M. (1995). Production of the AVR9 elicitor from the fungal pathogen Cladosporium fulvum in transgenic tobacco and tomato plants. Journal Plant Molecular Biology 29, 909-920.
Hsu, J.T., Wang, H.C., Chen, G.W., and Shih, S.R. (2006). Antiviral drug discovery targeting to viral proteases. Curr Pharm Des. 12, 1301-1314.
Hu, J., Van den Steen, P.E., Sang, Q.X., and Opdenakker, G. (2007). Matrix metalloproteinase inhibitors as therapy for inflammatory and vascular diseases. Nat Rev Drug Discov. 6, 480-498.
Igic, R., and Behnia, R. (2007). Pharmacological, immunological, and gene targeting of the renin-angiotensin system for treatment of cardiovascular disease. Curr Pharm Des. 13, 1199-1214.
Ingvarsson, P.K. (2005). Molecular Population Genetics of Herbivore-induced Protease Inhibitor Genes in European Aspen (Populus tremula L., Salicaceae). Molecular Biology and Evolution 22, 1802-1812.
Irving, P., Troxler, L., Heuer, T.S., Belvin, M., Kopczynski, C., Reichhart, J., Hoffmann, J.A., and Hetru, C. (2001). A genome-wide analysis of immune responses in Drosophila. Proc Natl Acad Sci 98, 15119-15124.
Jana, N.K., Gray, L.R., and Shugars, D.C. (2005). Human immunodeficiency virus type 1 stimulates the expression and production of secretory leukocyte protease inhibitor (SLPI) in oral epithelial cells: a role for SLPI in innate mucosal immunity. J. Virol. 79, 6432-6440.
Janowski, R., Kozak, M., Abrahamson, M., Grubb, A., and Jaskolski, M. (2005). 3D Domain-swapped human cystatin C with amyloid-like intermolecular a-sheets. Proteins 61, 570-578.
150 Janowski, R., Kozak, M., Jankowska, E., Grzonka, Z., Grubb, A., Abrahamson, M., and Jaskolski, M. (2001). Human cystatin C, an amyloidogenic protein, dimerizes through three-dimensional domain swapping. Nat. Struct. Biol. 8, 316-320.
Jean, L., Hackett, F., Martin, S.R., and Blackman, M.J. (2003). Functional Characterization of the Propeptide of Plasmodium falciparum Subtilisin-like Protease-1. The Journal of Biological Chemistry 278, 28572-28579.
Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P., and Valent, B. (2000). Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. EMBO J. 19, 4004-4014.
Johnson, R., Narvaez, J., An, G., and Ryan, C.A. (1989). Expression of proteinase inhibitors I and I1 in transgenic tobacco plants: Effects on natural defense against Manduca sexta larvae. Proc. Natl. Acad. Sci. USA 86, 9871-9875.
Jones, J.D.G., and Dangl, J.L. (2006). The plant immune system. Nature Reviews 444, 323-329.
Jones, L., Hamilton, A.J., Voinnet, O., Thomas, C.L., Maule, A.J., and Baulcombe, D.C. (1999). RNA-DNA interactions and DNA methylation in post-transcriptional gene silencing. Plant Cell Physiol. 11, 2291-2301.
Jorda, L., and Vera, P. (2000). Local and Systemic Induction of Two Defense-Related Subtilisin-Like Protease Promoters in Transgenic Arabidopsis Plants. Luciferin Induction of PR Gene Expression. Plant Physiology 124, 1049-1057.
Jouanin, L., Bonade-Bottino, M., Girard, C., Morrot, G., and Giband, M. (1998). Transgenic plants for insect resistance. Plant Sci. 131, 1-11.
Kamoun, S. (2003). Molecular genetics of pathogenic oomycetes. Eukaryotic Cell 2, 191-199.
Kamoun, S. (2006). A Catalogue of the Effector Secretome of Plant Pathogenic Oomycetes. Annu. Rev. Phytopathol. 44, 41-60.
151 Kamoun, S., Klucher, K.M., Coffey, M.D., and Tyler, B.M. (1993). A gene encoding a host-specific elicitor protein of Phytophthora parasitica. Mol. Plant Microbe Interact. 6, 573-581.
Kamoun, S., and Smart, C.D. (2005). Late blight of potato and tomato in the genomics era. Plant Dis. 89, 692-699.
Kamoun, S., van West, P., de Jong, A.J., de Groot, K., Vleeshouwers, V., and Govers, F. (1997). A gene encoding a protein elicitor of Phytophthora infestans is down-regulated during infection of potato. Mol. Plant Microbe. Interact. 10, 13-20.
Kanneganti, T., Huitema, E., and S., K. (2006). In planta Expression of Oomycete and Fungal Genes. Methods Mol Biol. 354, 35-44.
Kanofsky, J.R., and Sima, P.D. (1995). Singlet Oxygen Generation from the Reaction of Ozone with Plant Leaves. The Journal of Biological Chemistry 14, 7850-7852.
Kawagishi, H., Hamajima, K., and Inoue, Y. (2002). Novel hydroquinone as a matrix metallo-proteinase inhibitor from the mushroom, Piptoporus betulinus. Biosci Biotechnol Biochem. 66, 2748-2750.
Keen, N.T. (1990). Gene-for-gene complementarity in plant-pathogen interactions. Annu. Rev. Genet. 24, 447-463.
Keilova, H., and Tomasek, V. (1976). Isolation and properties of cathespin D inhibitor from potatoes. Collect. Czech. Chem. Commun. : 41, 489-497.
Kim, H.S., Desveaux, D., Singer, A.U., Patel, P., Sondek, J., and Dangl, J.L. (2005). The Pseudomonas syringae effector AvrRpt2 cleaves its C-terminally acylated target, RIN4, from Arabidopsis membranes to block RPM1 activation. Proc. Natl Acad. Sci. USA 102.
Kim, J.Y., Park, S.C., Kim, M.H., Lim, H.T., Park, Y., and Hahm, K.S. (2005). Antimicrobial activity studies on a trypsin-chymotrypsin protease inhibitor obtained from potato. Biochem. Biophys. Res. Commun. 330, 921-927.
152 Kim, K.M., Yi, E.C., Baker, D., and Zhang, K.Y.J. (2001). Post-translational modification of the N-terminal His tag interferes with the crystallization of the wild-type and mutant SH3 domains from chicken src tyrosine kinase. Acta Cryst. D57, 759-762.
Kocks, C., Maehr, R., Overkleeft, H.S., Wang, E.W., Iyer, L.K., Lennon-Dumenil, A., H.L., P., and Kessler, B.M. (2003). Functional Proteomics of the Active Cysteine Protease Content in Drosophila S2 Cells. Molecular & Cellular Proteomics, 1188-1197.
Kocks, C., Maehr, R., Overkleeft, H.S., Wang, E.W., Iyer, L.K., Lennon-Dumenil, A., Ploegh, H.L., and Kessler, B.M. (2003). Functional Proteomics of the Active Cysteine Protease Content in Drosophila S2 Cells. Molecular & Cellular Proteomics 2, 1188-1197.
Konaklieva, M.I., and Plotkin, B.J. (2004). The relationship between inhibitors of eukaryotic and prokaryotic serine proteases. Mini Rev Med Chem. 4, 721-739.
Kopertekh, L., and Schiemann, J. (2005). Agroinfiltration as a Tool for Transient Expression of cre Recombinase in vivo. Transgenic Research 14, 793-798.
Kopitar-Jerala, N. (2006). The role of cystatins in cells of the immune system. FEBS Letters 580, 6295-6301.
Kos, J., Dolinar, M., and Turk, V. (1992). Isolation and characterisation of chicken L- and H-kininogens and their interaction with chicken cysteine proteinases and papain. Agents Action. Suppl. 38, 331-339.
Kruger, J., Thomas, C.M., Golstein, C., Dixon, M.S., Smoker, M., Tang, S., Mulder, L., and Jones, J.D. (2002). A tomato cysteine protease required for Cf-2-dependent disease resistance and suppression of autonecrosis. Science 296, 744-747.
Kruger, J., Tomas, C.M., Golstein, C., Dixon, M.S., Smoker, M., Tang, S., Mulder, L., and Jones, J.D.G. (2002). A Tomato Cysteine Protease Required for Cf-2-Dependent Disease Resistance and Suppression of Autonecrosis. Science 296, 745-747.
153 Kumagai, M.H., Donson, J., Della-Cioppa, G., Harvey, D., Hanley, K., and Grill, L.K. (1995). Cytoplasmic inhibition of carotenoid biosynthesis with virus-derived RNA. Proc. Natl Acad. Sci. USA 92, 1679-1683.
Kwon, H.K., Yokoyama, R., and Nishitani, K. (2005). A proteomic approach to apoplastic proteins involved in cell wall regeneration in protoplasts of Arabidopsis suspension-cultured cells. Plant Cell Physiol. 46, 843-857.
Lamb, C., and Dixon, R.A. (1997). The oxidative burst in plant disease resistance. Annu Rev Plant Physiol Plant Mol Biol 48, 251-275.
Laskowski, M., and Kato, l. (1980). Protein Inhibitors of Proteinases. Ann. Rev. Biochem. 49, 593-626.
Lee, M., and Sano, H. (2007). Suppression of salicylic acid signaling pathways by an ATPase associated with various cellular activities (AAA) protein in tobacco plants. Plant Biotechnology 24, 209-215.
Lee, M.W., and Yang, Y. (2006). Transient expression assay by agroinfiltration of leaves. Methods Mol Biol. 323, 225-229.
Lee, Y.L., Chang, R.C., and Shaw, J.F. (1997). Facile purification of a C-terminal extended his-tagged Vibrio mimicus arylesterase and characterization of the purified enzyme : Biotechnology. Journal of the American Oil Chemists' Society 74, 1343-1455.
Lison, P., Rodrigo, I., and Conejero, V. (2006). A novel function for the cathepsin D inhibitor in tomato. Plant Physiol. 142, 1329-1339.
Listwan, P., Martin, J., B., K., and Cowieson, N. (2004). Methods for High-Throughput Protein Expression, Purification and Structure Determination Adapted for Structural Genomics. Australian Biochemist 35, 43-46.
Liu, Z.M., Liu, Z.Z., Bai, Q.W., and Fang, R.X. (2002). Agroinfiltration, a useful technique in plant molecular biology research. Sheng Wu Gong Cheng Xue Bao 18, 411-414.
Ljunggren, A., Redzynia, I., Alvarez-Fernandez, M., Abrahamson, M., Mort,
154 J.S., Krupa, J.C., Jaskolski, M., and Bujacz, G. (2007). Crystal structure of the parasite protease inhibitor chagasin in complex with a host target cysteine protease. J. Mol. Biol. 371, 137-153.
Lopez-Millan, A.F., Morales, F., Andaluz, S., Gogorcena, Y., Abadia, A., Rivas, J.D.L., and Abadia, J. (2000). Responses of Sugar Beet Roots to Iron Deficiency. Changes in Carbon Assimilation and Oxygen Use. Plant Physiology 124, 885-897.
Lu, R., Malcuit, I., Moffett, P., Ruiz, M.T., Peart, J., Wu, A.J., Rathjen, J.P., Bendahmane, A., Day, L., and Baulcombe, D.C. (2003). High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO J. 22, 5690-5699.
Luban, J., and Goff, S.P. (1995). The yeast two-hybrid system for studying protein-protein interactions. Curr Opin Biotechnol 6, 59-64.
Luderer, R., Takken, F.L., de Wit, P.J., and Joosten, M.H. (2002). Cladosporium fulvum overcomes Cf-2-mediated resistance by producing truncated AVR2 elicitor proteins. Mol. Microbiol. 45, 875-884.
Luther, R.R., Stein, H.H., Glassman, H.N., and Kleinert, H.D. (1989). Renin inhibitors: specific modulators of the renin-angiotensin system. Arzneimittelforschung 39, 1-5.
Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R., and Dangl, J.L. (2003). Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance. Mol Cell. 11, 284-286.
Mackey, D., Holt, B.F., Wiig, A., and Dangl, J.L. (2002). RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1 mediated disease resistance in Arabidopsis. Cell 108, 743-754.
Mark, S., Dixon, C.G., Thomas, C.M., van der Biezen, E.A., and Jones, J.D.G. (2000). Genetic complexity of pathogen perception by plants: The example of Rcr3, a tomato gene required specifically by Cf-2. PNAS 97, 8807-8814.
Martin, F.N., and Tooley, P.W. (2003). Phylogenetic relationships among
155 Phytophthora species inferred from sequence analysis of mitochondrially encoded cytochrome oxidase I and II genes. Mycologia. 95, 269-284.
Marti-Renom, M.A., Stuart, A., Fiser, A., Sanchez, R., Melo, F., and Sali, A. (2000). Comparative protein structure modeling of genes and genomes. Annu. Rev. Biophys. Biomol. Struct. 29, 291-325.
Massey, D. (2004). Commentary: clinical diagnostic use of cystatin C. J. Clin. Lab Anal. 18, 55-60.
Meirelles, M.N., Juliano, L., Carmona, E., Silva, S.G., Costa, E.M., Murta, A.C.M., and Scharfstein, J. (1992). Inhibitors of the major cysteinyl proteinase (GP57/51) impair host cell invasion and arrest the intracellular development of Trypanosoma cruzi in vitro. Mol. Biochem. Parasitol. 52.
Mello, G.C., Desouza, I.A., Marangoni, S., Novello, J.C., Antunes, E., and Macedo, M.L. (2006). Oedematogenic activity induced by Kunitz-type inhibitors from Dimorphandra mollis seeds. Toxicon 47, 150-155.
Menon, V., Shlipak, M.G., Wang, X., Coresh, J., Greene, T., Stevens, L., Kusek, J.W., Beck, G.J., Collins, A.J., Levey, A.S., and Sarnak, M.J. (2007). Cystatin C as a risk factor for outcomes in chronic kidney disease. Ann Intern Med. 147, 19-27.
Molina, M.A., Aviles, F.X., and Querol, E. (1992). Expression of a synthetic gene encoding potato carboxypeptidase inhibitor using a bacterial secretion vector. Gene 116, 129-138.
Moller, E.M., de Cock, A.W.A.M., and Prell, H.H. (1993). Mitochondrial and nuclear DNA restriction enzyme analysis of the closely related Phytophthora species P. infestans, P. mirabilis, and P. phaseoli. J. Phytopathol. 139, 309-321.
Montagut, C., Rovira, A., and Albanell, J. (2006). The proteasome: a novel target for anticancer therapy. Clin Transl Oncol. 8, 313-317.
Monteiro, A.C.S., Abrahamson, M., Lima, A.P.C.A., Vannier-Santos, M.A., and Scharfstein, J. (2001). Identification, characterization and localization of chagasin, a tight-binding cysteine proteases inhibitor in Trypanosoma cruzi. J.
156 Cell Sci. 114, 3933-3942.
Morel, J.B., and Dangl, J.L. (1997). The hypersensitive response and the induction of cell death in plants. Cell Death and Different 19, 17-24.
Moyle, G. (2007). Metabolic issues associated with protease inhibitors. J Acquir Immune Defic Syndr. 45, 19-26.
Nagata, K., Kudo, N., Abe, K., Arai, S., and Tanokura, M. (2000). Three-dimensional solution structure of oryzacystatin-I, a cysteine proteinase inhibitor of the rice, Oryza sativa L. japonica. Biochemistry 39, 14753-14760.
Negredo, E., Bonjoch, A., and Clotet, B. (2006). Benefits and concerns of simplification strategies in HIV-infected patients. J Antimicrob Chemother. 58, 235-242.
Nei, M., and Gojoborit, T. (1986). Simple Methods for Estimating the Numbers of Synonymous and Nonsynonymous Nucleotide Substitutions. Mol. Biol. Evol. 3, 418-426.
Ni, J., Abrahamson, M., and Zhang, M., et al. (1997). Cystatin E is a Novel Human Cysteine Proteinase Inhibitor with Structural Resemblance to Family 2 Cystatins. Journal of Biological Chemistry 272, 10853-10858.
Ni, J., Fernandez, M.A., Danielsson, L., Chillakuru, R.A., Zhang, J., Grubb, A., Su, J., Gentz, R., and Abrahamson, M. (1998). Cystatin F is a glycosylated human low molecular weight cysteine proteinase inhibitor. J. Biol. Chem. 273, 24797-24804.
Nilsson, B., and Anderson, S. (1991). Proper and improper folding of proteins in the cellular environment. Annu Rev Microbiol 45, 607-635.
Nuti, E., Tuccinardi, T., and Rossello, A. (2007). Matrix metalloproteinase inhibitors: new challenges in the era of post broad-spectrum inhibitors. Curr. Pharm. Des. 13, 2087-2100.
Pandey, K.C., Singh, N., Arastu-Kapur, S., Bogyo, M., and Rosenthal, P.J. (2006). Falstatin, a cysteine protease inhibitor of Plasmodium falciparum,
157 facilitates erythrocyte invasion. PLoS Pathog 2, 1031-1041.
Park, S., Kim, H., Kim, C., Yun, H., Choi, E., and Lee, B. (2002). Role of proline, cysteine and a disulphide bridge in the structure and activity of the anti-microbial peptide gaegurin 5. Biochem. J. 368, 171-182.
Peri, P., Hukkanen, V., Nuutila, K., Saukko, P., Abrahamson, M., and Vuorinen, T. (2007). The cysteine protease inhibitors cystatins inhibit herpes simplex virus type 1-induced apoptosis and virus yield in HEp-2 cells. J. Gen. Virol. 88, 2101-2105.
Puente, X.S., Gutierrez-Fernandez, A., Ordonez, G.R., Hillier, L.W., and Lopez-Otin, C. (2005). Comparative genomic analysis of human and chimpanzee proteases. Genomics 86, 638-647.
Puente, X.S., and Lopez-Otin, C. (2004). A Genomic Analysis of Rat Proteases and Protease Inhibitors. Genome Biol. 14, 609-622.
Pusztai, A., Grant, G., Bardocz, S., Baintner, K., Gelencser, E., and Ewen, S.W. (1997). Both free and complexed trypsin inhibitors stimulate pancreatic secretion and change duodenal enzyme levels. AJP - Gastrointestinal and Liver Physiology 272, 340-350.
Quilis, J., Meynard, D., Vila, L., Aviles, F.X., Guiderdoni, E., and San Segundo, B. (2007). A potato carboxypeptidase inhibitor gene provides pathogen resistance in transgenic rice. Plant Biotechnol J. 5, 537-553.
Rancour, J.M., and Ryan, C.A. (1968). Isolation of a carboxypeptidase B inhibitor from potatoes. Arch. Biochem. Biophys. 125, 380-382.
Rape, M., and Jentsch, S. (2002). Taking a bite: proteasomal protein processing. Nature Cell Biology 4, 113-116.
Rathjen, J.P., Chang, J.H., Staskawicz, B.S., and Michelmore, R.W. (1999). Constitutively expressed Pto induces a Prf-dependent hypersensitive response in the absence of avrPto. EMBO J. 18, 3232-3240.
Rawlings, N.D., and Barrett, A.J. (1993). Evolutionary families of peptidases.
158 Biochem. J. 290, 205-218.
Renckens, R., Roelofs, J.J., Bonta, P.I., Florquin, S., de Vries, C.J., Levi, M., Carmeliet, P., van't Veer, C., and van der Poll, T. (2007). Plasminogen activator inhibitor type 1 is protective during severe Gram-negative pneumonia. Blood 109, 1593-1601.
Rijneveld, A.W., Florquin, S., Bresser, P., Levi, M., De Waard, V., Lijnen, R., Van Der Zee, J.S., Speelman, P., Carmeliet, P., and Van Der Poll, T. (2003). Plasminogen activator inhibitor type-1 deficiency does not influence the outcome of murine pneumococcal pneumonia. Blood 102, 934-939.
Rooney, H.C.E., van't Klooster, J.W., van der Hoorn, R.A.L., Joosten, M.H.A.J., Jones, J.D.G., and de Wit, P.J.G.M. (2005). Cladosporium Avr2 Inhibits Tomato Rcr3 Protease Required for Cf-2-Dependent Disease Resistance. Science 308, 1785-1786.
Ruiz, M.T., Voinnet, O., and Baulcombe, D.C. (1998). Initiation and maintenance of virus-induced gene silencing. Plant Cell 10, 937-946.
Rupinder, S.K., Gurpreet, A.K., and Manjeet, S. (2007). Cell suicide and caspases. Vascul. Pharmacol. 46, 383-393.
Ryan, C.A. (1990). Protease Inhibitors in Plants: Genes for Improving Defenses Against Insects and Pathogens. Annu. Rev. Phytopathol. 28, 425-449.
Rzychon, M., Chmiel, D., and Stec-Niemczyk, J. (2004). Modes of inhibition of cysteine proteases. Acta Biochimica Polonica 51, 861-873.
Sackner-Bernstein, J. (2005). Reducing the risks of sudden death and heart failure post myocardial infarction: utility of optimized pharmacotherapy. Clin Cardiol. 28, 19-27.
Sali, A., and Blundell, T.L. (1993). Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234, 779-815.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring
159 Harbor, NY.
Santangelo, E., Fonzo, V., Astolfi, S., Zuchi, S., Caccia, R., Mosconi, P., Mazzucato, A., and Soressi, G.P. (2003). The Cf-2/Rcr3esc gene interaction in tomato (Lycopersicon esculentum) induces autonecrosis and triggers biochemical markers of oxidative burst at cellular level. Functional Plant Biology 30, 1117-1125.
Santos, C.C., Anna, C.S., Terres, A., Cunha-e-Silva, N.L., Scharfstein, J., and Lima, A.P.C.d. (2004). Chagasin, the endogenous cysteine-protease inhibitor of Trypanosoma cruzi, modulates parasite differentiation and invasion of mammalian cells. Journal of Cell Science 118, 901-915.
Sarin, A., Adams, D.H., and Henkart, P.A. (1993). Protease inhibitors selectively block T cell receptor-triggered programmed cell death in a murine T cell hybridoma and activated peripheral T cells. J. Exp. Med. 178, 1693-1700.
Sarin, A., Clerici, M., Blatt, S.P., Hendrix, C.W., Shearer, G.M., and Henkart, P.A. (1994). Inhibition of activation-induced programmed cell death and restoration of defective immune responses of HIV+ donors by cysteine protease inhibitors. J. Immunol. 153, 862-872.
Sawers, R.J.H., Farmer, P.R., Moffett, P., and Brutnell, T.P. (2006). In planta transient expression as a system for genetic and biochemical analyses of chlorophyll biosynthesis. Plant Methods 2, 15.
Schafer, F., Romer, U., Emmerlich, M., Blumer, J., Lubenow, H., and Steinert, K. (2002). Automated high-throughput purification of 6xHis-tagged proteins. Journal of Biomolecular Techniques 13, 131-142.
Schechter, I., and Ziv, E. (2006). Inhibitors can activate proteases to catalyze the synthesis and hydrolysis of peptides. Biochemistry 45, 14567-14572.
Scheich, C., Sievert, V., and Bussow, K. (2003). An automated method for high-throughput protein purification applied to a comparison of His-tag and GST-tag affinity chromatography. BMC Biotechnology 3, 1-8.
Schuler, T.H., Poppy, G.M., Kerry, B.R., and Denholm, I. (1998). Insect
160 resistant transgenic plants. Trends Biotechnol. 16, 168-175.
Scofield, S.R., Tobias, C.M., Rathjen, J.P., Chang, J.H., Lavelle, D.T., Michelmore, R.W., and Staskawicz, B.J. (1996). Molecular basis of gene- for- gene specificity in bacterial speck disease of tomato. Science 274, 2063-2065.
Sheehan, S.M., Mest, H., and Watson, B.M., et al. (2007). Discovery of non-covalent dipeptidyl peptidase IV inhibitors which induce a conformational change in the active site. Bioorganic & Medicinal Chemistry Letters 17, 1765-1768.
Siegel, L., and Gulick, R.M. (2007). New antiretroviral agents. Curr Infect Dis Rep. 9, 243-251.
Solomon, M., Belenghi, B., Delledonne, M., Menachem, E., and Levine, A. (1999). The Involvement of Cysteine Proteases and Protease Inhibitor Genes in the Regulation of Programmed Cell Death in Plants. The Plant Cell 11, 431-443.
Stoddard, B.L. (1996). Intermediate trapping and laue X-ray diffraction: potential for enzyme mechanism, dynamics, and inhibitor screening. Pharmacol Ther. 70, 215-256.
Tan, X., Osmulski, P.A., and Gaczynska, M. (2006). Allosteric regulators of the proteasome: potential drugs and a novel approach for drug design. Curr Med Chem. 13, 155-165.
Tanaka, K., Saito, H., Oda, K., Murao, S., and Takahashi, H. (1988). Cloning and expression of the metallo-proteinase inhibitor (S-MPI) gene from Streptomyces nigrescens. Biochem Biophys Res Commun 155, 487-492.
Tang, X., Frederick, R.D., Zhou, J., Halterman, D.A., Jia, Y., and Martin, G.B. (1996). Initiation of plant disease resistance by physical interaction of AvrPto and Pto kinase. Science 274, 2060-2063.
Tate, S., Ushioda, T., Utsunomiya-Tate, N., Shibuya, K., Ohyama, Y., Nakano, Y., Kaji, H., Inagaki, F., Samejima, T., and Kainosho, M. (1995). Solution structure of a human cystatin A variant, cystatin A2-98 M65L, by NMR spectroscopy. A possible role of the interactions between the N- and C-termini to
161 maintain the inhibitory active form of cystatin A. Biochemistry 34, 14637-14648.
Thomas, C.M., Dixon, M.S., Parniske, M., Golstein, C., and Jones, J.D. (1998). Genetic and molecular analysis of tomato Cf genes for resistance to Cladosporium fulvum. Philos Trans R Soc Lond B Biol Sci. 353, 1413-1424.
Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.
Thompson, J.N., and Burdon, J.J. (1992). Gene-forgene coevolution between plants and parasites. Nature 360, 121-125.
Thordal-Christensen, H., Zhang, Z., Wei, Y., and Collinge, D.B. (1997). Subcellular localization of H2O2 in plants: H2O2 accumulation in papillae and hypersensitive response during the barley-powdery mildew interaction. Plant Journal 11, 1187-1194.
Tian, M., Benedetti, B., and Kamoun, S. (2005). A Second Kazal-like protease inhibitor from Phytophthora infestans inhibits and interacts with the apoplastic pathogenesis-related protease P69B of tomato. Plant Physiol. 138, 1785-1793.
Tian, M., Huitema, E., Da, C., L., Torto-Alalibo, T., and Kamoun, S. (2004). A Kazal-like extracellular serine protease inhibitor from Phytophthora infestans targets the tomato pathogenesis-related protease P69B. J Biol Chem 279, 26370-26377.
Tian, M., and Kamoun, S. (2005). A two disulfide bridge Kazal domain from Phytophthora exhibits stable inhibitory activity against serine proteases of the subtilisin family. BMC Biochem. 6, 15.
Tian, M., Win, J., Song, J., van der Hoorn, R., van der Knaap, E., and Kamoun, S. (2007). A Phytophthora infestans cystatin-like protein targets a novel tomato papain-like apoplastic protease. Plant Physiol. 143, 364-377.
Tiffin, P., and Gaut, B.S. (2001). Molecular Evolution of the Wound-Induced Serine Protease Inhibitor wip1 in Zea and Related Genera. Molecular Biology
162 and Evolution 18, 2092-2101.
Tornero, P., Conejero, V., and Vera, P. (1997). Identification of a new pathogen-induced member of the subtilisin-like processing protease family from plants. J Biol Chem 272, 14412-14419.
Trout, C.L., Ristaino, J.B., Madritch, M., and Wangsomboondee, T. (1997). Rapid Detection of Phytophthora infestans in Late Blight-Infected Potato and Tomato Using PCR. Plant Disease 81, 1042-1048.
Tsukuba, T., Okamoto, K., Yasuda, Y., Morikawa, W., Nakanishi, H., and Yamamoto, K. (2000). New functional aspects of cathepsin D and cathepsin E. Mol. Cells 10, 601-611.
Turk, D., Turk, B., and Turk, V. (2003). Papain-like lysosomal cysteine proteases and their inhibitors: drug discovery targets? Biochem Soc Symp. 70, 15-30.
Uetz, P., Giot, L., Cagney, G., Mansfield, T.A., Judson, R.S., Knight, J.R., Lockshon, D., Narayan, V., Srinivasan, M., Pochart, P., Qureshi-Emili, A., Li, Y., Godwin, B., Conover, D., Kalbfleisch, T., Vijayadamodar, G., Yang, M., Johnston, M., Fields, S., and Rothberg, J.M. (2000). A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisiae. Nature 403, 623-627.
Valueva, T.A., and Molosov, V.V. (2004). Role of inhibitors of proteolytic enzymes in plant defense against phytopathogenic microorganisms. Biochemistry (Moscow) 69, 1305-1309. van der Biezen, E.A., and Jones, J.D.G. (1998). Plant disease-resistance proteins and the gene-forgene concept. Trends Biochem. Sci. 23, 454-456. van der Hoorn, R.A., Leeuwenburgh, M.A., Bogyo, M., Joosten, M.H., and Peck, S.C. (2004). Activity profiling of papain-like cysteine proteases in plants. Plant Physiology 135, 1170-1178. van der Hoorn, R.A.L., and Jones, J.D.G. (2004). The plant proteolytic machinery and its role in defence. Current Opinion in Plant Biology 7, 400-407.
163 van der Hoorn, R.A.L., Laurent, F., Roth, R., and de Wit, P.J.G.M. (2000). Agroinfiltration Is a Versatile Tool That Facilitates Comparative Analyses of Avr9/Cf-9-Induced and Avr4/Cf-4-Induced Necrosis. MPMI 13, 439-446. van Engelen, F.A., Molthoff, J.W., Conner, A.J., Nap, J.P., Pereira, A., and Stiekema, W.J. (1995). pBINPLUS: an improved plant transformation vector based on pBIN19. Transgenic Res. 4, 288-290. van Esse, H.P., Thomma, B.P.H.J., van't Klooster, J.W., and de Wit, P.J.G.M. (2006). Affinity-tags are removed from Cladosporium fulvum effector proteins expressed in the tomato leaf apoplast. Journal of Experimental Botany 57, 599-608. van Loon, L.C., Rep, M., and Pieterse, C.M.J. (2006). Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 44, 135-162.
Vandenabeele, P., Vanden, B.T., and Festjens, N. (2006). Caspase inhibitors promote alternative cell death pathways. Sci. STKE 358, pe44.
Vendrell, J., Querol, E., and Aviles, F.X. (2000). Metallocarboxypeptidases and their protein inhibitors. Structure, function and biomedical properties. Biochim. Biophys. Acta. 1477, 284-298.
Venkatasamy, R., and Spina, D. (2007). Protease inhibitors in respiratory disease: focus on asthma and chronic obstructive pulmonary disease. Expert Review of Clinical Immunology 3, 365-381.
Vila, L., Quilis, J., Meynard, D., Breitler, J.C., Marfa, V., Murillo, I., Vassal, J.M., Messeguer, J., Guiderdoni, E., and San Segundo, B. (2005). Expression of the maize proteinase inhibitor (mpi) gene in rice plants enhances resistance against stripped stem borer (Chilo suppressalis): effects on larval growth and insect gut proteinases. Plant Biotechnol. J. 3, 187-202.
Voinnet, O., Rivas, S., Mestre, P., and Baulcombe, D. (2003). An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J 33, 949-956.
Waigmann, E., Chen, M.H., Bachmaier, R., Ghoshroy, S., and Citovsky, V.
164 (2000). Regulation of plasmodesmal transport by phosphorylation of tobacoo mosaic virus cell-to-cell movement protein. EMBO J. 19, 4875-4884.
Walmsley, S. (2007). Protease inhibitor-based regimens for HIV therapy: safety and efficacy. J Acquir Immune Defic Syndr. 45, 5-13.
Wang, Y., and Kumar, P.P. (2007). Characterization of two ethylene receptors PhERS1 and PhETR2 from petunia: PhETR2 regulates timing of anther dehiscence. J. Exp. Bot. 58, 533-544.
Waugh, D.S. (2005). Making the most of affinity tags. TRENDS in Biotechnology 23, 316-320.
Wedde, M., Weise, C., Kopacek, P., Franke, P., and Vilcinskas, A. (1998). Purification and characterization of an inducible metalloprotease inhibitor from the hemolymph of greater wax moth larvae, Galleria mellonella. Eur. J. Biochem. 255, 535-543.
Westerink, N., Roth, R., Van den Burg, H.A., de Wit, P.J.G.M., and Joosten, M.H.A.J. (2002). The AVR4 Elicitor Protein of Cladosporium fulvum Binds to Fungal Components with High Affinity. MPMI 15, 1219-1227.
Woessner, J.F. (2002). MMPs and TIMPs-An Historical Perspective. Molecular Biotechnology 22, 33-50.
Wroblewski, T., Tomczak, A., and Michelmore, R. (2005). Optimization of Agrobacterium-mediated transient assays of gene expression in lettuce, tomato and Arabidopsis. Plant Biotechnology Journal 3, 259-273.
Wu, Y., Wang, X., Liu, X., and Wang, Y. (2003). Data-mining approaches reveal hidden families of proteases in the genome of malaria parasite. Genome Res. 13, 601-616.
Wuthrich, K. (2001). The way to NMR structures of proteins. Nature Struct. Biol. 8, 923-925.
Xia, Y. (2004). Proteases in pathogenesis and plant defence. Cellular Microbiology 6, 905-913.
165 Xiang, C., Han, P., Lutziger, I., Wang, K., and Oliver, D.J. (1999). A mini binary vector series for plant transformation. Plant Mol Biol 40, 711-717.
Xing, T., Higgins, V.J., and Blumwald, E. (1996). Regulation of Plant Defense Response to Fungal Pathogens: Two Types of Protein Kinases in the Reversible Phosphorylation of the Host Plasma Membrane H+-ATPase. Plant Cell 8, 555-564.
Yang, Z. (1997). PAML: a program package for phylogenetic analysis by maximum likelihood. Comput Appl Biosci 13, 555-556.
Yang, Z., and Bielawski, J.P. (2000). Statistical methods for detecting molecular adaptation. Trends Ecol Evol 15, 496-503.
Yang, Z., and Nielsen, R. (2000). Estimating synonymous and nonsynonymous substitution rates under realistic evolutionary models. Mol Biol Evol 17, 32-43.
Yang, Z., Nielsen, R., Goldman, N., and Pedersen, A.M. (2000). Codon-substitution models for heterogeneous selection pressure at amino acid sites. Genetics 155, 431-449.
Yoshimoto, M., and Hansch, C. (1976). Correlation analysis of Baker's studies on enzyme inhibition. J. Med. Chem. 19, 71-98.
Zhang, M., Park, S.M., Wang, Y., Shah, R., Liu, N., Murmann, A.E., Wang, C.R., Peter, M.E., and Ashton-Rickardt, P.G. (2006). Serine protease inhibitor 6 protects cytotoxic T cells from self-inflicted injury by ensuring the integrity of cytotoxic granules. Immunity 24, 451-461.
Zore, I., Kraovec, M., Cimerman, N., Kuhelj, R., Werle , B., Nielsen, H.J., Brunner, N., and Kos, J. (2001). Cathepsin B/Cystatin C Complex Levels in Sera from Patients with Lung and Colorectal Cancer. Biol. Chem. 382, 805-810.
166