ABSTRACT BROWN, JESSICA ASHLEY. Genetic Changes In

ABSTRACT

BROWN, JESSICA ASHLEY. Genetic Changes in TSWV Associated with Virus Accumulation in and Transmission Efficiency of Thrips tabaci. (Under the direction of Drs. George Kennedy and Tim Sit).

Plant viruses rely on insect vectors for transmission to new plant hosts, but many of the specifics of virus-vector interactions are not fully understood. Tomato spotted wilt virus (TSWV) is transmitted by Thrips tabaci, which has been shown to vary greatly in its ability to transmit different virus isolates. A previous study examining transmission of 89 distinct pairings between

TSWV isolates and T. tabaci isolines showed a significant effect of virus isolate, thrips isoline, and their interaction on transmission efficiency. The ability of a single isoline to transmit multiple virus isolates varied up to 18-fold, and the transmissibility of each isolate by multiple T. tabaci isolines varied up to 45-fold. In addition, significantly higher transmission rates were observed among sympatric TSWV isolate-isoline pairings than allopatric pairings, suggesting local adaptation. This study uses a subset of the 89 TSWV isolate and T. tabaci pairings to identify determinants of transmission by first examining the relationships between virus titer in source leaves, titer in individual transmitting and non-transmitting thrips, and transmission efficiency. Quantitative real-time PCR results of the TSWV L RNA segment show that virus titer in individual thrips was unrelated to the virus titers in the source leaves from which they acquired virus, and was not a significant variable underlying differences in transmission efficiency among TSWV isolates. We further investigated these virus isolate-thrips isoline pairings by sequencing the entire TSWV genome using next-generation sequencing from T. tabaci isolines, the leaf discs they fed from, and post-feeding leaves from F. occidentalis, F. fusca, and T. tabaci. Phylogenetic analysis revealed panmixia occurring in a number of the viral genes but slight geographic structuring in the GnGc and RdRp. There was lower genetic diversity and recombination in virus from plants compared to virus from T. tabaci. The analysis of variants, deviation from neutral equilibrium, and population statistics showed evidence for mutation and purifying selection being strong factors in the evolution of TSWV isolates during the transmission cycle. To test polymorphisms found in the next-generation sequencing and their effect on transmission from T. tabaci, we attempted to develop a T7 RNA polymerase-based partial reverse genetics system for TSWV. This system involves the co-infiltration of Nicotiana benthamiana leaves with Agrobacterium tumefaciens strains containing plasmids encoding the

T7 RNA polymerase, TSWV nucleocapsid, S RNA, and viral suppressors of RNA silencing as well as the S RNA encoding the green fluorescent protein in place of the nucleocapsid as a reporter gene. We successfully developed expression plasmids containing the nucleocapsid, S

RNA, and S RNA encoding GFP. Even though there was no success in planta, the plasmids developed here are large steps for future research to continue attempting a partial reverse genetics system for TSWV and identifying determinants of transmission.

by Jessica Ashley Brown

A dissertation submitted to the Graduate Faculty of North Carolina State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy

Plant Pathology

Raleigh, North Carolina 2019

APPROVED BY:

______George Kennedy Tim Sit Committee Co-Chair Committee Co-Chair

______Alana Jacobson Steven Lommel

______Ignazio Carbone

BIOGRAPHY

Jessica was born in Raleigh, North Carolina on March 1, 1990. She went to Needham B.

Broughton high school, where she first became interested in chemistry during her junior year.

She attended Meredith College for her undergraduate degree and switched from chemistry to biology sophomore year. That year was also when she first experienced research, studying the effects of secondary metabolites present in sewage water on fresh water organisms. After that she also isolated a putative protease inhibitor from a Kenyan plant that could potentially be developed as a treatment for HIV/AIDs as another undergraduate research project. Senior year she interned at The Hamner Institutes in the drug safety sciences institute, helping associate rare adverse drug reactions with genetic variants in humans. Her love of research, especially in molecular and microbiology led her to plant pathology under the guidance of Tim Sit and George

Kennedy studying vector-virus interactions.

ACKNOWLEDGMENTS

I would like to thank my committee members for guiding me throughout all these years I especially want to thank Tim Sit for his constant support, snacks, and most importantly, coffee. I am glad George Kennedy and Alana Jacobson allowed me to be a part of this research. I would like to thank the USDA for funding my research. I would like to thank Thomas Chappelle for helping me with statistics. I also want to thank everyone that has given me advice for methods and analysis including David Rasmussen, Dorith Rotenberg, Andy Baltzegar, and many others.

I am grateful for the friendships and support system I had with other graduate students in plant pathology especially, Alyssa Koehler, Katie Neufeld and my lab mate Casey Ruark. I wouldn’t be here if it weren’t for my mom and my brother supporting my career decisions even though they didn’t understand it (and still don’t). Most importantly I want to thank Scott Linak for being the most supportive, patient, and loving person in the world.

iii

TABLE OF CONTENTS

LIST OF TABLES ...... vi LIST OF FIGURES ...... viii

Chapter 1: Literature Review ...... 1 Plant-Virus Transmission ...... 1 Orthotospoviruses ...... 3 TSWV Genome Organization ...... 5 Thrips ...... 6 Thrips tabaci ...... 7 Viral Replication ...... 9 Determinants of Transmission ...... 11 TSWV Genetic Diversity ...... 12 Summary ...... 13 Literature Cited ...... 15

Chapter 2: Transmission of a persistently-propagative plant virus by its insect vector is not solely influenced by virus titer ...... 34

Abstract ...... 35 Introduction ...... 36 Materials and Methods ...... 38 Results ...... 44 Discussion ...... 47 Acknowledgements ...... 51 Literature Cited ...... 52

Chapter 3: Population genetic analysis of Tomato spotted wilt virus within its vector T. tabaci and plant host E. sonchifolia ...... 69

Abstract ...... 70 Introduction ...... 71 Materials and Methods ...... 74 Results ...... 80 iv

Discussion ...... 86 Acknowledgements ...... 92 Literature Cited ...... 93

Chapter 4: Developing a Partial Reverse Genetics System for Tomato spotted wilt virus ......

...... 116

Abstract ...... 117 Introduction ...... 118 Materials and Methods ...... 123 Results and Discussion ...... 130 Acknowledgements ...... 135 Literature Cited ...... 136

Appendices ...... 155 Appendix A: Chapter 2 Supporting Information ...... 156 Appendix B: Chapter 3 Supporting Information...... 172

LIST OF TABLES

Chapter 2: Transmission of a persistently-propagative plant virus by its insect vector is not solely influenced by virus titer

Table 2.1 TSWV isolate and T. tabaci isofemale line combinations included in this study...... 59

Table 2.2 Primers designed in this study that were used in qRT-PCR reactions ...... 60

Table 2.3 Average Ct values for the E. sonchifolia leaf tissue and T. tabaci individuals ...... 61

Table 2.4 Effects of thrips isoline and TSWV Isolate on mean probability of transmission after accounting for effects of TSWV titer in the vector ...... 62

Chapter 3: Population genetic analysis of Tomato spotted wilt virus within its vector T. tabaci and plant host E. sonchifolia

Table 3.1 TSWV isolate and T. tabaci isofemale line combinations included in this study ...102

Table 3.2 The TSWV Virus isolates and thrips species they were transmitted by, and the round of serial transmission to plants the virus were collected from, or if they were field collected isolates ...... 103

Table 3.3 The 66 Thrips virus isolate-thrips pairings pooled into 23 samples for next-generation sequencing ...... 104

Table 3.4 Primers designed for PCR amplification of the TSWV genome from E. sonchifolia leaves ...... 106

Table 3.5 The population statistics for all encoded TSWV genes compared between the TSWV nucleotide sequences from thrips the source plants from which they acquired virus, and the TSWV isolates serially transmitted by different thrips species ...... 107

Table 3.6 Summary of the neutrality test statistic values for all TSWV coding regions for virus extracted from thrips, source plants used in virus isolate-thrips isoline experiment, and from plants used in serial transmission by thrips experiment ...... 109

Table 3.7 Population differention due to genetic structure for all encoded genes between the serial transmitted isolates, thrips virus isolate-thrips isoline pairings, and source plant virus isolate-thrips isoline pairings ...... 110

Table 3.8 Total number of unique polymorphisms found in the nucleotide sequences for all pairings of nontransmitting and transmitting thrips ...... 111

Table 3.9 Total number of unique polymorphisms found in the nucleotide sequences for all pairings of plant sequences ...... 112

Table 3.10 Total number of unique polymorphisms found in the nucleotide sequences for all serially transmitted TSWV isolate sequences ...... 113

Chapter 4: Developing a Partial Reverse Genetics System for Tomato spotted wilt virus

Table 4.1 Primers designed for all devleoped plasmids ...... 145

vii

LIST OF FIGURES

Chapter 1: Literature Review

Figure 1.1 Tomato spotted wilt symptoms...... 28

Figure 1.2 (a) Depiction of the TSWV virion. (b) TSWV genome organization, indicating the open reading frames of the viral genes on each genomic segment...... 29

Figure 1.3 Feeding damage caused by onion thrips, T. tabaci ...... 30

Figure 1.4 TSWV dissemination pathway in thrips vectors with the internal anatomy of the salivary glands relative to the guy of F. occidentalis ...... 31

Figure 1.5 Adult onion thrips, T. tabaci ...... 32

Figure 1.6 Representation of the orthotospovirus replication cycle based off other Bunyavirales members ...... 33

Chapter 2: Transmission of a persistently-propagative plant virus by its insect vector is not solely influenced by virus titer

Figure 2.1 Log10 mean relative abundance ratio of LRNA in E. sonchifolia source leaf tissue for all virus isolate-thrips isoline pairings ...... 63

Figure 2.2 Average log10 relative abundance ratio of LRNAacross each virus isolate in thrips ...... 64

Figure 2.3 Mean log10 relative abundance ratio of LRNA in each thrips isofemale line ...... 65

Figure 2.4 Mean log10 relative abundance ratio of LRNA for all TSWV isolate – thrips isoline combinations ...... 66

Figure 2.5 Mean log10 relative abundance ratio of LRNAin sympatric and allopatric TSWV isolate-thrips isoline pairings ...... 67

Figure 2.6 Mean log10 relative abundance ratio of LRNA in transmitting thrips and nontransmitting thirps ...... 68

Chapter 3: Population genetic analysis of Tomato spotted wilt virus within its vector T. tabaci and plant host E. sonchifolia

Figure 3.1 Phylogenetic congruence of mutation, genetic reassortment and recombination in the evolution of TSWV ...... 114

viii

Figure 3.2 Alignment of NSs showing the 12 nucleotide insertion between nucleotides 788 and 789 present in plant sequences ...... 115

Chapter 4: Developing a Partial Reverse Genetics System for Tomato spotted wilt virus

Figure 4.1 Organization and expression strategy for the TSWV genome ...... 146

Figure 4.2 Depiction of the PZPRiboTerm plasmids ...... 147

Figure 4.3 Depiction of pPZP212 plasmids with a 35S promotor and terminator ...... 148

Figure 4.4 Confirmation of sGFP ligation into PZPRiboTerm by digestion with BamHI and BglII ...... 149

Figure 4.5 In vitro transcription of PZPRiboTerm-sGFP ...... 150

Figure 4.6 Confirmation of the ligations of the 3’S RNA and full length S RNA ino PZPRiboTerm ...... 151

Figure 4.7 NcoI and BamHI digests of PZPRiboTerm-GFP-S confirming ligation of the sGFP into PZPRiboTerm-S ...... 152

Figure 4.8 In vitro transcription of the PZPRiboTerm-GFP-S plasmid ...... 153

Figure 4.9 Confirmation of the nucleocapsid in the pRTL2 and pPZP212 plasmids ...... 154

Chapter 1

Literature Review

Plant Virus Transmission

Many plant-infecting viruses require insect vectors to move host-to-host. Vectors include fungi, nematodes, and arthropods, with arthropods from the order Hemiptera being the majority of vectors. The relationships between plant viruses and their vectors are quite specific with viruses of a given taxon being transmitted exclusively by a specific type of vector. Much of the early work on plant virus-vector associations was related to timing events, e.g., acquisition and inoculation periods, retention periods, and latent periods (the time between ingestion of the virus and the ability of the insect to inoculate a host) (Gray & Banerjee, 1999). Watson and Roberts

(1940) coined the terms nonpersistent viruses and persistent viruses. Nonpersistent viruses have very short retention times (up to 12 hours) while persistent viruses ranged from 12 hours to indefinitely (Ng & Falk, 2006). Nonpersistent viruses were efficiently transmitted after brief (<5 min) acquisition and inoculation access periods (AAP and IAP, respectively). Persistent viruses require longer AAP and IAP and optimum transmission efficiencies were associated with feeding. Later it was recognized there was an intermediate category, semi-persistent viruses, which are transmitted by the vector from a few hours to a few days post acquisition but are lost after molting (Hogenhout et al., 2008).

Nault (1997) expanded on the terminology to describe retention and mechanisms of plant virus transmission by Hemipteran vectors. These terms are a) nonpersistently transmitted, stylet- borne; b) semipersistently transmitted, foregut-borne; c) persistently transmitted, circulative; d) persistently transmitted, propagative. Nonpersistent and semipersistent viruses are retained in the vector mouthparts after feeding on infected plants. Vector determinants governing the

transmission of these viruses have not been identified but virus encoded determinants have been discovered: a) the capsid strategy, where the virus-encoded protein determinants that facilitate aphid transmission are exclusively specific components of the virion capsid; and b) the helper strategy, where non-capsid, virus-encoded protein, as well as virions, are essential for facilitating aphid transmission (Ng & Falk, 2006). Persistent-circulative viruses do not replicate inside their vectors but move through the body from the gut lumen into the hemolymph or other tissues and into the salivary glands from which these viruses are introduced back into the plant during insect feeding. Persistent-propagative viruses circulate in a similar way but also replicate inside their vectors usually in the midgut and salivary glands. Four-types of barriers exist for persistent viruses: 1) midgut infection barrier, 2) dissemination (midgut escape and salivary gland infection) barriers, 3) salivary gland escape barrier, and 4) transovarial transmission barriers

(Hogenhout, 2008). Viruses injected into the hemocoel are usually transmitted at a higher rate than if acquired orally because movement across the insect midgut is a significant barrier to transmission (Sylvester, 1980, Nagata, 2002; Ammar, 2005; Ammar, 2008).

All enveloped plant viruses are transmitted in a persistent propagative manner. These virus species include bunyaviruses and rhabdoviruses. Only three groups of nonenveloped viruses, the reoviruses, marafiviruses, and tenuiviruses are transmitted in a persistent propagative manner. Most propagative viruses are also transmitted by a limited number of insect species/genera e.g., leafhoppers, planthoppers, thrips, or aphids. Thrips transmit all orthotospoviruses; leafhoppers transmit all marafiviruses and phytoreoviruses; and planthoppers transmit all fijiviruses, oryzaviruses, and all tenuiviruses. However, the two rhabdovirus genera are the exception to this rule, as various species of cytorhabdoviruses and nucleorhabdoviruses are transmitted either by aphids, leafhoppers, or planthoppers. Generally, within each vector

species, certain populations/biotypes, different sexes, or different developmental stages may differ in their ability to transmit the virus (Nault, 1997).

The arthropod vectors of plant viruses have piercing-sucking mouthparts that penetrate the cell wall, either by mechanical force and/or with the help of salivary and gut enzymes

(Pollard, 1977; Bacus, 1985; Hunter and Ullman, 1992). Some vectors are specialized feeders on phloem, xylem, or mesophyll, whereas others can feed on a combination of these tissues.

Similarly, many vectored plant viruses are phloem-limited, while others are not tissue specific and exploit almost all plant tissues. The cell membrane is easily breached by mechanical force, making the cell contents available as food. Nonlethal cell feeding is critical for the survival of the virus, since it must replicate in the cell to which it is delivered. From there, plant virus genomes encode movement proteins that enable them to move to neighboring cells (Carrington et al., 1996).

Orthotospoviruses

The genus Orthotospovirus belongs to the order Bunyavirales and family Tospoviridae.

This order contains over 160 virus species divided into nine genera, most of which are human infecting viruses with the exception of the Orthotospovirus, Tenuivirus (Phenuiviridae) and

Emaravirus (Fimoviridae). Tomato spotted wilt virus (TSWV) is the type-member species of the genus, which includes 11 recognized species. For a long time tospoviruses were the only plant- infecting genus until the international committee on taxonomy of viruses changed the taxonomy in 2017 (Adams et al., 2017).

In 1915 tomato spotted wilt disease was first identified in Australia (Brittlebank, 1919), and in 1930 it was demonstrated that the causal agent was a virus (Samuel et al., 1930). There were reports of TSWV occurrence in many countries worldwide under various names reflecting

the wide variety of symptoms, depending on the host plant species, virus isolate, and the regions where the disease was found (Best, 1968; Ie, 1970; Smith, 1972). The occurrence of the disease faded in Western Europe after the Second World War, whereas in Eastern Europe and Brazil the disease remained a severe problem. It is generally accepted that the onion thrips, T. tabaci, was the main vector in the 1930s and the 1940s (Goldbach & Peters, 1994). The decline of T. tabaci in Western Europe and USA has been explained by an effective chemical control of this vector in the greenhouses (Golbach & Peters, 1994). From 1980 on, a rapid emergence and geographic spread of TSWV has occurred, which was preceded with a rapid expansion of another efficient vector, the western flower thrips (Mantel & van de Vrie, 1988; Baker, 1989; Brodsgaard, 1989;

Marchoux et al., 1991; Vaira et al., 1993). The disease is now widespread in many agricultural production areas on all continents. Until the 1990s TSWV was the only recognized species in the genus Tospovirus. Impatiens necrotic spot virus was characterized as a species (German et al.,

1992) and since then molecular analysis of virus isolates has led to a rapid expansion in knowledge.

Orthotospoviruses are considered emerging diseases because host range and geographical limits have expanded for established species and new species have been described. Due to the ubiquitous nature of thrips and the extremely wide host range of the virus, TSWV is considered one of the ten most devastating plant viruses (Scholthof et al., 2011). The economic losses associated with TSWV as well as other orthotospoviruses exceed tens of millions of dollars worldwide and have been estimated to cause crop losses of over $1.4 billion in a ten-year period in the U.S. alone (Culbreath et al., 2003; Mandal et al., 2012; Riley et al., 2011). Currently at least 15 different thrips species have been reported to vector orthotospoviruses (Rotenberg et al.,

2015). TSWV has a wide host range with over 900 plant species in 90 plant families, including

both crop and ornamental plants (Pappu H.R., 2009). TSWV can be ubiquitous in the environment since it can infect many weeds, landscape plants, and native plants (Sherwood et al.,

2003). Symptoms can include stunting, chlorotic or necrotic rings on the leaves and/or fruits, necrosis on the leaves, tip dieback, and cupping of the leaves downward (Fig 1.1).

TSWV Genome Organization

TSWV has a tripartite, negative-sense and ambisense RNA genome (Fig. 1.2). The L

RNA is 8897 nucleotides (nt) and of complete negative polarity. It contains one large open reading frame (ORF) in the viral complementary (vc) strand, coding for a 331.5 kDa protein (De

Haan et al., 1990), the RNA dependent RNA polymerase (RdRp). The M RNA is 4821 nt and of ambisense polarity, containing two nonoverlapping ORFs, in the viral (v)-strand coding for a nonstructural protein (NSm) of 33.6 kDa, the movement protein, and in the vc-strand encoding the glycoproteins (Gn and Gc) precursor of 127.4 kDa (Kormelink et al., 1992a, 1994; Storms et al., 1995). The S RNA is 2918 nt and is also of ambisense polarity, encoding a nonstructural protein (NSs) of 52.1 kDa in the v-strand that acts as a suppressor of RNA silencing, and the nucleoprotein (N) of 28.9 kDa in the vc-strand (Bucher et al., 2003; De Haan, et al., 1990;

Takeda et al., 2002). Viral RNA is often observed in excess over the vc RNA strands which may possibly reflect amounts synthesized during replication (Bouloy et al, 1973; Elliot, 1990; Eshita et al., 1985; Gentsch et al., 1977; Ihara et al., 1985; Kormelink et al., 1992b; Objieski et al.,

1976).

TSWV is a quasi-spherical, enveloped, negative-sense, single strand RNA virus. The three linear single-stranded RNAs are contained in the virion, which is 80-110 nm in diameter and incorporates an outer-membrane envelope derived from the host covered with spike-like projections consisting of two glycoproteins (Snippe et al., 2005). The RNAs form pseudocircular

structures that result from complementary base pairing at their ends that are encapsidated in nucleoprotein and associated with an RNA-dependent, RNA polymerase encoded by the L RNA.

The first stretch of 8 nucleotides at the 3’ terminal end of all orthotospoviral RNA segments are conserved and complementary to the 5’ end, a feature that is common for all the

Bunyavirales (De Haan et al., 1989). Moreover, the nucleotide sequence of the L, M, and S segments for a given Tospovirus shows total nucleotide sequence complementarity of the 5’ and

3’ terminal ends for the first 15 nucleotides (De Haan et al., 1990, 1991; Kormelink et al.,

1992c). Within each segment, this complementarity extends up to about 65 nucleotides, allowing the formation of a panhandle structure (Snippe et al., 2005). The terminal sequences are conserved among members of the same genus, but differ between genera of the Bunyavirales

(Elliot, 1996).

Thrips

TSWV is transmitted from plant to plant exclusively by thrips. Thrips are very small insects that constitute the insect order Thysanoptera. It is estimated that there are more than

6,000 thrips species (Buckman et al., 2013) but as mentioned before only 15 are known to transmit orthotospoviruses. Only three thrips species are known to be vectors of TSWV in North

Carolina: Thrips tabaci Lindeman (onion thrips), Frankliniella fusca Hinds (tobacco thrips), and

F. occidentalis Pergande (western flower thrips) (Rotenberg et al. 2015; Jacobson & Kennedy,

2013). Thrips that are orthotospovirus vectors are polyphagous, which increases the chances for acquisition and inoculation. Independent of virus transmission, thrips feeding damage to agricultural crops can cause stunting and delayed crop maturity, feeding on developing fruit causes blemishes and reduces marketability (Fig 1.3). In addition, thrips are extremely small,

highly mobile, thigmotactic, and their egg and pupal stages are often protected from pesticide exposure; making them difficult to control.

Virus acquisition must occur during the larval stage for adult thrips to be able to transmit the virus (van der Wetering et al., 1996). In order for TSWV to be transmitted by thrips, it must move from the midgut after ingestion by 1st larval instars, into the circular and longitudinal muscles surrounding the midgut (MG) where replication occurs. The virus then moves via the tubular salivary glands (TSG) and the efferent duct that leads from the salivary reservoir to the principal salivary glands (PSG) (Fig 1.4) (Montero-Astúa et al., 2016). Before the TSG route was elucidated, two other routes were thought possible: 1)TSWV would travel from the MG to the salivary glands through the hemolymph similar to other circulative viruses but has been found to supportno this; 2) during larval development, organs grow larger, physically forcing the PSG into close proximity with the MG enabling the virus to move to the MG; as the thrips body grows the tissues reorganize and the PSG are no longer in direct contact with the MG (Moritz et al.,

2004).

Thrips tabaci

Onion thrips are native to the Mediterranean region but has become a major pest of agricultural crops throughout most of the world (Fig 1.5) (Mound and Walker 1982, Mound

1997). The vector competence of T. tabaci has been questioned over the years because certain populations fail to transmit TSWV, while others have been responsible for TSWV epidemics.

Due to this variation in transmission efficiency, previous research has focused on F. occidentalis and F. fusca, which are more efficient vectors in the US including North Carolina. Thrips trapping data over several years have shown that in some years and in some areas where TSWV occurs in NC, T. tabaci are caught in similar numbers as other vector species (Jacobson et al.,

2013). T. tabaci populations and their ability to transmit have been hypothesized to be related to reproductive mode. Arrhenotokous populations lay both fertilized eggs that produce females or unfertilized eggs that produce only males, while thelytokous populations propagate parthenogenetically and produce only females (Nagata, et al., 2002). Arrhenotokous individuals were believed to be capable of transmitting TSWV while thelytokous individuals are not capable or are very inefficient at transmitting TSWV (Zawirska, 1976).

Recent studies have found that some T. tabaci thelytokous populations have the capability to transmit TSWV and that reproductive mode does not define their competency as a vector (Chatzivassiliou al., 1999; Tedeschi et al., 2001; Cabrera-La Rosa and Kennedy, 2007).

Genetic evidence has emerged for these to be different species, which were characterized by

Brunner et al (2004). Lineage 1 —‘Arrhenotokous Tobacco Group’ a tobacco feeding lineage that has only been reported in Eastern Europe, is an efficient vector of TSWV, and exhibits arrhenotokous parthenogenesis. Lineage 2–‘Arrhenotokous Leek Group’ is a leek/onion associated lineage that has been reported in Europe, Japan and the United States but is uncommon, is a competent vector of TSWV, and exhibits arrhenotokous parthenogenesis. And

Lineage 3-‘Thelytokous Leek Group’ is a leek/onion associated lineage that has been reported worldwide and can be very abundant in the landscape, exhibits inter-clonal variation in its competence as a vector of TSWV, and exhibits thelytokous parthenogenesis. Jacobson et al.

(2016) found T. tabaci populations are generally structured by clonal groups but with limited gene flow occurring between these linages, and that reproductive mode is not a fixed phenotype and should not be used to characterize them. These recent insights into T. tabaci populations shed light on the variation observed over the years that include reproductive mode, ploidy, host plant preferences, vector competency, and insecticide resistance.

Viral Replication

The TSWV replication cycle is summarized by Oliver and Whitfield (2016) (Fig 1.6).

After its entrance into the host cell, the viral genome is replicated in the cytoplasm by the activity of an RdRp encoded by the L genomic RNA and packaged in the virion. The negative-sense

RNA genome is transcribed into vc RNA, which acts as a template for transcription of additional copies of genomic v RNAs. Transcription from the negative-sense RNA genome yields positive- sense full-length RNAs (for the viral RdRp) and subgenomic RNAs (sgRNAs) from which translation of the N, and Gn/Gc occurs. In the case of the viral proteins NSm and NSs, which are encoded in the opposite orientation relative to the other three viral proteins, transcription from the vc RNA yields sgRNAs for translation of these protein products. These sgRNAs are capped via cap-snatching of host mRNA 5’ caps by activity of the viral RdRp, which shows a preference for cap donors with multiple-base complementary to the viral sequence and acts as primers for transcription initiation (Plotch et al., 1981; Ulmanen et al., 1981; Braam et al., 1983; van

Kippenberg, et al., 2005a). These nonviral leaders at the 5’-ends are usually 10-20 nucleotides in length (Kormelink et al., 1992c; Duijsings et al., 1999, 2001). Bunyaviral transcripts are not polyadenylated, nor do they share a conserved sequence motif that may act as a transcription termination signal (Snippe et al., 2005). As has been shown for the two sgRNAs encoded by the

S RNA and possibly the M RNA, transcription is likely terminated by conserved sequence motifs at their 3’ end that form a predicted stem-loop structure in the intergenic regions, a structure also shown to enhance translation efficiency (de Haan et al., 1991; Maiss et al., 1991; Kormelink et al., 1992c; Van Kippenberg et al., 2005b; Geerts-Dimitriadou, et al., 2012). Overall, this process allows the virus to effectively co-opt the host translation machinery to prioritize expression of its own proteins. Transcriptome-level analysis of virus-infected host plants has shown that virus

infection also alters host DNA metabolism, potentially further impacting expression and processing of host genes during the infection process (Senthil et al., 2005; Catoni et al., 2009;

Choi et al., 2015).

The N protein encapsidates viral RNA, not viral mRNA, and is required for transcription and replication of the viral genome. The N protein is hypothesized to be involved in the switch from transcription to replication and to act as an anti-terminator of transcription (Snippe et al.,

2005). The N- and C- terminal halves of the N protein exhibit nonspecific RNA affinity in a cooperative manner (Beaton & Krug 1984, 1986; Patton et al., 1984; Richmond et al., 1998).

Within plant cells, the N protein localizes within the cytoplasm as large inclusion bodies, which can accumulate in a perinuclear manner and are associated with an actin and endoplasmic reticulum dependent network (Ribeiro et al., 2009; Dietzgen et al., 2012; Ribeiro et al., 2013;

Feng et al., 2013). The N protein interacts with genomic RNA and during particle assembly, ribonucleoproteins (RNPs) composed of RdRp, N and genomic RNA are enwrapped in golgi cisternae (Kikkert et al., 1999; Li et al., 2015). These cisternae contain Gn and Gc, which gives rise to the formation of double enveloped virus particles, likely through interactions Gn and Gc with viral RNPs. The double enveloped particles merge to form large vesicles containing an accumulation of mature singly enveloped virions after fusion with each other and with endoplasmic reticulum membranes (Kikkert et al., 2001). These assembled virus particles remain in vesicles, where they are available for uptake by insect vectors. It is hypothesized that enveloped particles are required for virus transmission by thrips but not for infection of plants, because virus isolates that no longer form enveloped particles are infectious to plants but are no longer thrips transmissible (Sin et al., 2005). The mature, enveloped form of the virus is not expected to be the form that moves from cell to cell within the plant host. The viral NSm is likely

responsible for moving viral RNPs by a tubule guided mechanism in the plasmodesmata of plant hosts, which is too small for membrane-bound viruses to move through (Storms et al., 1995; Li et al., 2009).

Determinants of Transmission

Studies of TSWV-thrips interactions provide evidence that two surface-exposed glycoproteins play an essential role in the infection of insect vectors. The two viral membrane glycoproteins, Gn and Gc, are encoded by the M RNA. The Gn and Gc are translated as a polyprotein from a single ORF and the resulting polyprotein is cleaved to produce the individual glycoproteins that are required for transmission by thrips. The two glycoproteins decorate the surface of the virion, and therefore are probably the first viral components that interact with proteins in the thrips midgut. Viral encoded proteins involved in thrips-TSWV interactions have been identified in other vector species but not in T. tabaci. In F. occidentalis the M RNA, specifically the surface glycoproteins, and the NSs encoded by the S RNA have been associated with vector transmission efficiency (Margaria et al., 2014; Whitfield et al., 2008; Sin et al.,

2005). The NSs was found to be dispensable for acquisition by larvae, but necessary for abundant accumulation in adults (Margaria et al., 2014) and has been found to suppress RNA silencing in arthropod cell lines (Garcia et al., 2006).

The glycoproteins, Gn and Gc, are hypothesized to bind to a midgut receptor programming virus entry via the endocytotic pathway where it can replicate and spread to adjacent midgut cells (Whitfield et al., 2008). The Gn protein was found to bind to a 50 kDa thrips protein found in the midgut and the Gc was found to bind to a 94 kDa thrips protein that was not localized in the midgut (Bandla et al., 1998; Kikkert et al., 1998). Sin et al (2005) found a single point mutation in the glycoprotein ORF that had no effect on the viruses’ ability to infect

plants but did impede the ability of thrips to transmit the virus. Also, it was discovered that a soluble form of the surface Gn binds to larval midgut cells and inhibits TSWV transmission

(Whitfield et al., 2008). Transgenic plants expressing the soluble form of the surface Gn has been shown to interfere with TSWV acquisition and transmission by F. occidentalis (Montero-Astúa et al., 2014).

In addition, Gn contains the highly conserved amino acid sequence Arg-Gly-Asp (RGD) near the amino terminus (Kormelink et al., 1992a; Law et al., 1992; van den Heuvel et al., 1999).

This motif is an important determinant for cellular attachment of several mammalian viruses and pathogens, including foot-and-mouth disease virus, human coxsackievirus A9, and the spirochete

Borrelia burgdorferi, which is the causal agent of Lyme disease (Berinstein et al., 1995;

Roivainen et al., 1996; Coburn et al., 1998). It is not known whether nontransmissible isolates have a mutation in this sequence.

TSWV Genetic Diversity

RNA viruses exist as quasispecies, which are genetically heterogeneous populations of highly similar genomes or mutant swarms. They have high genetic variability due to their high mutation rates, short generation times, error-prone replication, and large population size, which allows for great adaptability and rapid evolution (Steinhauer and Holland, 1987). Under these conditions, genetic variants are produced constantly, and in each infected host, the virus population displays a high degree of genetic diversity (Beerenwinkel et al., 2012). Viral diversity is advantageous when the virus faces different selection pressures that need to be overcome by evolutionary escape.

Orthotospoviruses can show considerable variation between and within species in terms of symptoms caused, virulence, and ability to overcome host resistance. Population genetic

studies of TSWV isolates have indicated high levels of genetic variability, geographical structuring of isolates, and evidence of widespread reassortment (Tsompana et al., 2005;

Tentchev et al., 2011) Reassortment involves the exchange of one or more genomic RNAs between virus isolates or between virus species. TSWV has three genome segments that can be involved in reassortment. The natural reassortment between orthotospoviruses occurred between

Groundnut ringspot virus (GRSV) and Tomato chlorotic spot virus (TCSV) in the United States and Caribbean. GRSV isolates in Florida were found to be reassortant viruses possessing an M

RNA from TCSV, but with different biological properties, including lower F. occidentalis acquisition efficiency relative to TCSV.

Orthotospoviruses are considered a distinct species if an isolate’s N protein sequence shows less than 90% amino acid identity with that of other orthotospovirus species, meaning that reassortants could easily be missed without the examination of additional viral genes found on other genomic RNAs. (Oliver and Whitfield, 2016). Relying on the N protein can lead to misdiagnosis, because reassortants can differ with respect to viral properties relevant to the management and regulation of orthotospovirus dissemination on the global scale. The polyphagous nature of thrips species suggests that mixed infections of orthotospoviruses leading to reassortments are likely to increase with continued orthotospovirus and thrips proliferation

(Gilbertson et al., 2015).

Summary

TSWV is a highly damaging plant virus that is present worldwide along with several species of thrips that transmit the virus to over 900 plant species, including many important crops.

Population genetic studies of TSWV isolates have indicated high levels of genetic variability, geographical structuring of isolates, and evidence of widespread reassortment. T. tabaci has been

found to vary greatly in its ability to transmit different isolates of TSWV but no definitive explanation has been discovered. Jacobson and Kennedy (2013) examined transmission of 89 distinct pairings between TSWV isolates and T. tabaci isolines showing a significant effect of virus isolate, thrips isoline, and their interaction on transmission efficiency. Although transmission rates ranged from 0-55% across all isolate by isoline pairings, the ability of a single isoline to transmit multiple virus isolates varied up to 18-fold, and the transmissibility of each isolate by multiple T. tabaci varied up to 45-fold. In addition, significantly higher transmission rates were observed among sympatric (originate from the same location) TSWV isolate-isoline pairings than allopatric pairings (originate from different locations), suggesting local adaptation between virus and vector resulting from antagonistic coevolution in which local virus has greater infectivity than foreign virus on local vectors. The objectives of this dissertation are to build on the findings of Jacobson and Kennedy (2013) using a subset of the same TSWV isolate-thrips isoline pairings used in their transmission study in order to 1) determine if virus titer of TSWV isolate-thrips isoline combinations explain differences in transmission of TSWV from T. tabaci;

2) Associate genetic polymorphism(s) with vector transmission efficiency phenotypes and conduct a phylogenetic analysis; 3) establish a partial reverse genetic system for TSWV that would enable us to test the effects of polymorphisms found in the second objective on transmission efficiency.

Literature Cited

Adams, M.J., Lefkowitz, E.J., King, A.M.Q., et al. 2017. Changes to taxonomy and the

international code of virus classification and nomenclature ratified by the international

committee on taxonomy of viruses (2017). Arch. Virol. 162: 2505-2538.

Ammar, E.D., Gomez-Luengo, R.G. Gordon D.T., and Hogenhout, S.A. 2005. Characterization

of Maize Iranian mosiac virus and comparison with Hawaiian and other isolates of Maize

mosaic virus (Rhabdoviridae). J. Phytopathol. 153:129-136.

Ammar, E.D., and Hogenhhout, S.A. 2008. A neurotropic route for Maize mosaic virus

(Rhabdoviridae) in its planthopper vector Peregrinus maidis. Virus Res. 131: 77-85.

Backus, E.A. 1985. Anatomical and sensory mechanisms of planthopper and leafhopper feeding

behavior, p. 163-194. In L.R. Nault and J.G. Rodriguez (ed.), The leafhoppers and

planthoppers. John Wiley and Sons, Inc. New York, N.Y.

Baker, I. 1989. Beware of spotted wilt. Grower (March 2nd):17-19.

Bandla, M.D., L.R. Campbell, D.E. Ullman, and J.L. Sherwood. (1998) Interaction of Tomato

spotted wilt Tospovirus (TSWV) Glycoproteins with a thrips midgut protein, a potential

cellular receptor for TSWV. Phytopathol. 88(2): 98-104.

Beaton, A.R. and Krug, R.M. 1984. Synthesis of the templates for Influenza virion RNA

replication in vitro. Proc. Natl. Acad. Sci. USA 81: 4682-4686.

Beaton, A.R. and Krug, R.M. 1986. Transcription antitermination during Influenza viral template

RNA synthesis requires the nucleocapsid protein and the absence of a 5'capped end. Proc.

Natl. Acad. Sci. USA 83: 6282-6286.

Beerenwinkel, N., Günthard, H.F., Roth, V., and Metzner, K.J. 2012. Challenges and

opportunities in estimating viral genetic diversity from next-generation sequencing data.

Front. Microbiol. 3: 329-344.

Berinstein, A., Roivainen, M., Hovi, T., Mason, P.W., and Baxt, B. 1995. Antibodies to the

vitronectin receptor (integrin alpha V beta 3) inhibit binding and infection of foot-and-

mouth disease virus to cultured cells. J. Virol. 69(4): 2664-2666.

Best, R.J. 1968. Tomato spotted wilt virus. Adv. Virus Res. 13: 65-146.

Bouloy, M., Krans-Ozden, S., Horodniceanu, F., and Hannoun, C. 1973/1974. 3 segment RNA

genome of Lumbo virus bunyavirus. InterVirology 2: 173-180.

Brittlebank, C.C. 1919. Tomato diseases. J. Agr. Victoria 17: 213-235.

Braam, J., Ulmanen, I., and Krug, R.M. 1983. Molecular model of a eukaryotic transcription

complex functions and movements of Influenza P proteins during capped RNA primed

transcription. Cell 34: 609-618.

Brodsgaard, H.F. 1989. Frankliniella occidentalis (Thysanoptera:Thripidae) - a new pest in

Danish glasshouses: a review. Tidsskr Planteavl 93: 83-91

Brunner, P.C., Chatzivassiliou, E.K., Katis, N.I., and Frey, J.E. 2004. Host-associated genetic

differentiation in Thrips tabaci (Insecta; Thysanoptera), as determined from mtDNA

sequence data. Heredity 93: 364-370.

Bucher, E., Sijen, T., de Haan, P., Goldbach, R., and Prins, M. 2003. Negative-strand

tospoviruses and tenuiviruses carry a gene for a suppressor of gene silencing at analogous

genomic positions. J. Virol. 77: 1329-1336.

Buckman, R.S., Mound, L.A., and Whiting, M.F. 2013. Phylogeny of thrips (Insecta:

Thysanoptera) based on five molecular loci. Systematic Entomology 38(1): 123-133.

Cabrera-La Rosa, J.C., KennedyG.G. (2007) Thrips tabaci and tomato spotted wilt virus:

inheritance of vector competence. Entomologia Experimentalis et Applicata 124: 161-166

Carrington, J.C., Kasschau, K.D., Mahajan, S.K., and Schaad, M.C. 1996. Cell-to-cell and long

distance transport of viruses in plants. Plant Cell 8: 1669-1681.

Catoni, M., Miozzi, L., Fiorilli, V., Lanfranco, L., and Accotto, G.P. 2009. Comparitive analysis

of expression profiles in shoots and roots of tomato systemically infected by Tomato spotted

wilt virus reveals organspecific transcriptional responses. Mol. Plant-Microbe Interact. 22:

1504-1513.

Chatzivassiliou, E.K., Nagata, T., Katis, N.I., and Peters, D. (1999) Transmission of tomato

spotted wilt tospovirus by Thrips tabaci populations originating from leek. Plant Pathology

48: 700-706.

Choi, H. Jo, Y., Lian, S., Jo, K.M. Chu, H., et al. 2015. Comparative analysis of Chrysanthemum

transcriptome in response to three RNA viruses: Cucumber mosaic virus, Tomato spotted

wilt virus and Potato virus X. Plant Mol. Biol. 88: 233-248.

Coburn, J., Magoun, L., Bodary, S.C., and Leong, J.M. 1998. Integrins αvβ3 and α5β1 Mediate

Attachment of Lyme Disease Spirochetes to Human Cells. Infect. Immun. 66: 1946-1952.

Culbreath, A.K., Todd, J.W., and Brown, S.L. 2003. Epidemiology and management of tomato

spotted wilt in peanut. Annu Rev Phytopathol 41: 53-75.

De Haan, P., Wagemakers, L., Peters, D., and Goldbach, R. 1989. Molecular cloning and

terminal sequence determination of the S and M RNA species of Tomato spotted wilt virus.

J. Gen. Virol. 70: 3468-3474.

De Haan, P., Wagemakers, L., Peters, D., and Goldbach R. 1990. The S RNA segment of

Tomato spotted wilt virus has an ambisense character. J. Gen. Virol. 71: 1001-1008.

De Haan, P., Kormelink, R., Resende, D., van Poelwijk, F., Peters, D., and Goldback R. 1991.

Tomato spotted wilt virus L RNA encodes a putative RNA polymerase. J. Gen. Virol. 72:

2207-2216.

Dietzgen, R.G., Martin, K.M., Anderson, G., and Goodin, M.M. 2012. In planta localization and

interactions of impatiens necrotic spot tospovirus proteins. J. Gen. Virol. 93: 2490-2495.

Duijsings, D., Kormelink, R., and Goldbback, R. 1999. Alfalfa mosaic virus RNAs serve as cap

donors for tomato spotted wilt virus transcription during coinfection of Nicotiana

benthamiana. J. Virol. 73: 5172-5175.

Duijsings, D., Kormelink, R., and Goldbback, R. 2001. In vivo analysis of the TSWV cap-

snatching mechanism, single base complementarity and primer length requirements. EMBO

J. 20: 2545-2552.

Elliot, R.M. 1990. Molecular biology of the Bunyaviridae. J. Gen. Virol. 71: 501-522.

Elliot, R.M. 1996. The Bunyaviridae. Plenum Press, New York.

Eshita, Y., Ericson, B., Romanowski, V., and Bishop, D.H.L. 1985. Analyses of the messenger

RNA transcription processes of Snowshoe hare bunyavirus small and medium-sized RNA

species. J. Virol. 55: 681-689.

Feng, Z.K., Chen, X.J., Bao, Y.Q., Dong, J.H., Zhang, Z.K., and Tao, X.R. 2013. Nucleocapsid

of Tomato spotted wilt tospovirus forms mobile particles that traffic on an

actin/endoplasmic reticulum network driven by myosin XI-K. New Phytol. 200: 1212-1224.

Garcia, S., Billecocq, A., Crance, J.M., Prins, M., Garin, D., and Bouloy, M. 2006. Viral

suppressor of RNA interferance impair RNA silencing induced by a Semliki Forest virus

replicon in tick cells. J. Gen. Virol. 87: 1985-1989.

Geerts-Dimitriadou, C., Lu, Y.Y., Geertsema, C., Goldbach, R., and Kormelink, R. 2012.

Analysis of the Tomato spotted wilt virus ambisense S RNA-encoded hairpin structure in

translation. PLOS ONE 7: e31013.

Gentsch, J.R., Bishop, D.H.L., and Obijeski, J.F. 1977. The virus particle nucleic acids and

proteins of four bunyaviruses. J. Gen. Virol. 34: 257-268.

German, T.L, Ullman, D.E., and Moyer, J.W. 1992. Tospoviruses: diagnosis, molecular biology,

phylogeny, and vector relationships. Annu. Rev. Phytopathol. 30: 315-348.

Gilbertson, R.L., Batuman, O., Webster, C.G., and Adkins, S. 2015. Role of the insect

supervectors Bemisia tabaci and Frankliniella occidentalis in the emergence and global

spread of plant viruses. Annu. Rev. Virol. 2: 67-93.

Goldbach, R. and Peters, D. 1994. Possible causes of the emergence of tospovirus diseases.

Semin. Viral. 5: 113-120.

Gray, S. and Banerjee, N. 1999. Mechanisms of arthropod transmission of plant and animal

viruses. Microbiol. Mol. Biol. Rev. 63(1): 128-148.

Hogenhout, S.A., Ammar, E.D., Whitfield, A.E., and Redinbaugh, M.G. 2008. Insect vector

interactions with persistently transmitted viruses. Annu. Rev. Phytopathol. 46: 327-359.

Ie, T.S. 1970. Tomato spotted wilt virus, in CMI/AAB desription of plant viruses 39.

Commonwealth Agruicultural Bureau, Slough.

Hunter, W.B. and Ullman D.E. 1992. Anatomy and utrastructure of the piercing-sucking

mouthparts and paraglossal sensilla of Frankliniella occidentalis (Pergande) (Thysanoptera:

Thripidae). Int. J. Insect Morphol. & Embryol. 21(1): 17-35.

Ihara, T., Matsura, y., and Bishop, D.H.L. 1985. Analyses of the mRNA transcription processes

of Punta Toro phlebovirus (Bunyaviridae). Virol. 147: 317-325.

Jacobson, A.L. and Kennedy, G.G. 2013. Specific Insect-Virus Interactions Are Responsible for

Variation in Competency of Different Thrips tabaci Isolines to Transmit Different Tomato

Spotted Wilt Virus Isolates. PLOS ONE 8(1): e54567

Jacobson, A.L., Booth, W., Vargo, E.L., and Kennedy, G.G. (2013) Thrips tabaci Population

Genetic Structure and Polyploidy in Relation to Competency as a vector of Tomato Spotted

Wilt Virus. PLOS ONE 8(1): 1-10.

Jacobson, A.L., Nault, B.A., Vargo, E.L., and Kennedy, G.G. 2016. Restricted gene flow among

lineages of Thrips tabaci supports genetic divergence among cryptic species groups. PLOS

ONE 11(9): e0163882.

Kikkert, M., C. Meurs, F. van de Wetering, S. Dormüller, D. Peters, R. Kormelink, and R.

Goldback. (1998) Binding of Tomato Spotted Wilt Virus to a 94-kDa Thrips Protein.

Phytopathol. 88(1): 63-69.

Kikkert, M., Van Lent, J., Storms, M., Bodegom, P., Kormelink, R., and Goldbach, R. 1999.

Tomato spotted wilt virus particle morphogenesis in plant cells. J. Virol. 73: 2288-2297.

Kikkert, M., Verschoor, A., Kormelink, R., Rottier, P., and Goldback, R. 2001. Tomato spotted

wilt virus glycoproteins exhibit trafficking and localization signals that are functional in

mammalian cells. J. Virol. 75: 1004-1012.

Kormelink, R., De Haan, P., Meurs, C., Peters, D., and Goldbach, R. 1992. The nucleotide

sequence of the M RNA segment of Tomato spotted wilt virus, A bunyavirus with two

ambisense RNA segments. J. Gen. Virol. 73: 2795-2804.

Kormelink, R., de Haan, P., Peters, D., and Goldbach, G. 1992. Viral RNA synthesis in Tomato

spotted wilt virus-infected Nicotiana rustica plants. J. Gen. Virol. 73: 687-693.

Koremelin, R., van Poelwijk, F., Peters, D., and Goldbach R. 1992. Nonviral heterogeneous

sequences at the 5' ends of tomato spotted wilt virus (TSWV) mRNAs. J. Gen. Virol. 73:

2125-2128.

Kormelink, R., Storms, M. van Lent, J., Peters, D., and Goldbach, G. 1994. Expression and

subcellular location of the NSm protein of Tomato spotted wilt virus (TSWV), a putative

viral movement protein. Virology 200: 56-65.

Law, M.D., Speck, J., and Moyer, J.W. 1992. The M RNA of Impatiens necrotic spot tospovirus

(Bunyaviridae) has an ambisense genomic organization. Virology 188: 732-741.

Li, W., Lewandowski, D.J., Hilf, M.E., and Adkins, S. 2009. Identifcation of domains of the

Tomato spotted wilt virus NSm protein involved in tubule formation, movement and

symptomology. Virology 390: 110-121.

Li, J., Feng, Z.K., Wu, J.Y., Huang, Y., Lu, G., et al. 2015. Structure and function analysis of

nucleocapsid protein of Tomato spotted wilt virus interacting with RNA using homology

modeling. J. Biol. Chem. 290: 3950-3961.

Maiss, E., Ivanova, L., Breyel, E., and Adam, G. 1991. Cloning and sequencing of the S RNA

from a Bulgarian isolate of Tomato spotted wilt virus. J. Gen. Virol. 72: 461-464.

Mandal, G., Jain, R.K., Krishnareddy, M. Kumar, N.K.K., Ravi, K.S., and Pappu, H.R. 2012.

Emerging problems of tospoviruses (Bunyaviridae) and their management in the Indian

subcontinent. Plant Dis 96: 468-479.

Mantel, W.P., van de Vrie, M. 1988. De Californische thrips, Frankliniella occidentalis, een

nieuwe schadelijke tripssoort in de tuinbouw onder glas in Nederland. Ent. Ber. Amst. 48:

140-144.

Marchoux, G., Gebre-Selassie, K., and Villevieille, M. 1991. Detection of tomato spotted wilt

virus transmission by Frankliniella occidentalis in France. Plant Pathol. 40: 347-351.

Margaria, P., L. Bosco, M. Vallino, M. Ciuffo, G.C. Mautino, L. Tavella, and M. Turina. (2014)

The NSs protein of Tomato spotted wilt virus is required for persistent infection and

transmission by Frankliniella occidentalis. J. virol. 88(10): 5788-5802.

Montero-Astúa, M., Rotenberg, D., Leach-Kieffaber, A., Schneweis, B.A., Park, S., Park, J.K.,

German, T.L., and Whitfield, A.E. (2014) Disruption of vector transmission by a plant-

expressed viral glycoprotein. Molecular Plant-Microbe Interactions 27(3): 296-304.

Montero-Astúa, M., Ullman, D.E., and Whitfield, A.E. 2016. Salivary gland morphology, tissue

tropism and the progression of Tospovirus infection in Frankliniella occidentalis. Virology.

493: 39-51.

Moritz, G., Kumm, S., and Mound, L. 2004. Tospovirus transmission depends on thrips

ontogeny. Virus Res. 100: 143-149.

Mound, L.A. and Walker, A.K. 1982. Terebrantia (Insecta: Thysanoptera). Fauna of New

Zealand NO. 1. DSIR, Wellington, New Zealand.

Mound, L.A. 1997. Bioligical Diversity, pp. 197-215. In Lewis T. (ed.) Thrips as crop pests.

CAB International, New York, NY.

Nagata, T., Inoue-Nagata, A.K., van Lent, J., Goldbach, R., and Peters, D. 2002. Factors

determining vector competence and specificity for transmission of Tomato spotted wilt

virus. J. Gen. Virol. 83: 663-671.

Nault, L.R. 1997. Arthropod transmission of plant viruses: a new synthesis. Ann. Entomol. Soc.

Am. 90: 522-541.

NG, J.C.K. and Falk, B.W. 2006. Virus-vector interactions mediating nonpersistent transmission

of plant viruses. Annu. Rev. Phytopathol. 44: 183-212.

Objieski, J.F., Bishop, D.H.L., Palmer, E.L., and Murphy, F.A. 1976. Segmented genome and

nucleocapsid of La Crosse Virus. J. Gen. Virol. 20: 664-675.

Oliver, J.E. and Whitfield, A.E. 2016. The genus Tospovirus: Emerging Bunyaviruses that

threaten food security. Annu. Rev. Virol. 3: 101-24.

Pappu, H.R., Jones, R.A., and Jain, R.K. 2009. Global status of tospovirus epidemics in diverse

cropping systems: successes achieved and challenges ahead. Virus Res. 141(2): 219-236.

Patton, J.T., Davis, N.L., and Wertz, G.W. 1984. Nucleocapsid protein alone satisfies the

requirement for protein synthesis during RNA replication of Vesicular stomatitis virus. J.

Virol. 49: 303-309.

Plotch, S.J., Bouley, M., Ulmanen, I., and Krug, R.M. 1981. A unique cap 7 methyl guanosine 5'

tri phosphoryl 5'-2-O methyl nucleoside dependent Influenza virion endo nuclease cleaves

capped RNA to generate the primers that initiate viral RNA transcription. Cell 23: 847-858.

Pollard, D.G. 1977. Aphid penetration of plant tissues, P. 165-220. In K.F. Harris and K.

Maramorosch (ed.), Aphids as virus vectors. Academic Press, Inc. New York, N.Y.

Ribeiro, D., Borst, J.W., Goldback, R., and Kormelink, R. 2009. Tomato spotted wilt virus

nucleocapsid protein interacts with both viral glycoproteins Gn and Gc in planta. Virology

383: 121-130.

Ribeiro, D., Jung, M., Moling, S., Borst J.W., Goldback, R., and Kormelink, R. 2013. The

cystosolic nucleoprotein of the plant-infecting bunyavirus Tomato spotted wilt virus

endoplasmic reticulum-resident proteins to endoplasmic reticulum export sites. Plant Cell

25: 3602-3614.

Richmond, K.E., Chenault, K., Sherwood, J.L., and German, T.L. 1998. Characterization of the

nucleic acid binding properties of tomato spotted wilt virus nucleocapsid protein. Virology

248: 6-11.

Riley, D.G., Joseph, S.V., Srinivasan, R., and Diffie, S. 2011. Thrips vectors of tospoviruses. J.

Integrat Pest Manage 1:1-10

Roivainen, M., Piirainen, L., and Hovi, T. 1996. Efficient RGD-independent entry process of

coxsackievirus A9. Arch. Virol. 141: 1909-1919

Rotenberg, D., Jacobson, A.L., Schneweis, D.J., and Whitfield, A.E. 2015 Thrips transmission of

tospoviruses. Current Opinion in Virology 15: 80-89.

Samuel, G., Bald, J.G., and Pittman, H.A. 1930. Spotted wilt of tomatoes. Council Sci Ind Res

(Austr) Bull 44: 64.

Scholthof, K.B.G., Adkins, S., Czosnek, H., Palukaitis, P., Jacquot, E., Hohn, T., Hohn, B.,

Saunders, K., Candresse, T., Ahlquist, P., Hemenway, C., and Foster, G.D. 2011. Top 10

plant viruses in molecular plant pathology. Mol Plant Pathol 12: 938-954.

Senthil, G., Liu, H., Puram, V.G., Clark, A., Stromberg, A., and Goodin, M.M. 2005. Specific

and common changes in Nicotiana benthamiana gene expression in response to infection by

enveloped viruses. J. Gen. Virol. 86: 2615-2625.

Sherwood, J.L., German, T.L., Moyer, J.W. and D.E. Ullman. 2003. Tomato spotted wilt. The

Plant Health Instructor. DOI:10.1094/PHI-I-2003-0613-02

Sin, S., B.C. McNulty, G.G. Kennedy, J.W. Moyer. 2005. Viral genetic determinants for thrips

transmission of Tomato spotted wilt virus. PNAS 102(14): 5168-5173.

Smith, K.M. 1972. Tomato spotted wilt virus, in a textbook of plant virus diseases, 3rd edn pp

545-549. Longman, London.

Snippe, M., Golbach , R., and Kormelink, R. 2005. Tomato spotted wilt virus particle assembly

and the prospects of fluorescence microscopy to study protein-protein interactions involved.

Advances in Virus Research 65: 63-120.

Steinhauer, D.A. and Holland, J.J. 1987. Rapid evolution of RNA viruses. Ann. Rev. Microbiol.

41: 409-433.

Storms, M.M.H., Kormelink, R., Peters, D., van Lent, J.W.M. and Goldbach, R.W. 1995. The

nonstructural NSm protein of Tomato spotted wilt virus induces tubular structures in plant

and insect cells. Virology 214: 485-493.

Sylvester, E.S. 1980. Circulative and propagative virus transmission by aphids. Annu. Rev.

Entomol. 25: 257-286.

Takeda, A., Sugiyama, K., Nagano, H., Mori, M., Kaido, M., Mise, K., Tsuda, S., and Okuno, T.

2002. Identification of a novel RNA silencing suppressor, NSs protein of Tomato spotted

wilt virus. FEBS lett. 532: 75-79.

Tedeschi, R., Ciuffo, M., Mason, G., Roggero, P., and Tavella, L. (2001) Transmissibility of four

tospoviruses by a thelytokous population of Thrips tabaci from Liguria, Northwestern Italy.

Phytoparasitica 29(1): 37-45.

Tentchev, D., Verdin, E., Marchal, C., Jacquet, M., Aguilar, J.M., and Moury, B. 2011.

Evolution and structure of Tomato spotted wilt virus populations: evidence of extensive

reassortment and insights ino emergence process. J. Gen. Virol. 92: 961-973.

Tsompana, M., Abad, J., Purugganan, M., and Moyer, J.W. 2004. The molecular population

genetics of the Tomato spotted wilt virus (TSWV) genome. Molecular Ecology 14(1): 53-

66.

Ulmanen, I., Broni, B.A., and Krug, R.M. 1981. Role of 2 of the Influenza virus core P proteins

in recognizing cap 1 structures on RNA and in initiating viral RNA transcription. Proc. Natl.

Acad. Sci. USA 78: 7355-7359.

Vaira, a.M., Roggero, P., Luisoni, E., Masenga, V., Milne, R.G., and Lisa, V. 1993.

Characterization of two tospoviruses in Italy: tomato spotted wilt virus and impatiens

necrotic spot virus. Plant Pathol. 42: 530-542.

Van den Heuvel, J.F.J.M., Hogenhout, S.A., and van der Wilk, F. 1999. Recognition and

receptors in virus transmission by arthropods. Trends in Microbiology 71(2): 71-76.

Van Kippenberg, I., Golback R., and Kormelink, R. 2002. Purified Tomato spotted wilt virus

particles support both genome replication and transcription in vitro. Virology 303: 278-286.

Van Kippenberg, I., Lamin, M., Goldbach, R., and Kormelink, R. 2005. Tomato spotted wilt

virus transcriptase in vitro displays a preference for cap donors with multiple base

complementarity to the viral template. Virology 335: 122-130.

Van Kippenberg, I., Goldback, R., and Kormelink, R. 2005. Tomato spotted wilt virus S-segment

mRNAs have overlapping 3’-ends containing a predicted stem-loop structure and conserved

sequence motif. Virus Res. 110: 125-131.

Van Poelwijk, T., Kolkman, J., and Goldbach, R. 1996. Sequence analysis of the 5' ends of

Tomato spotted wilt virus N mRNAs. Arch. Virol. 141: 177-184.

Van de Wetering, F., Goldbach, R., and Peters, D. 1996. Tomato spotted wilt tospovirus

ingestion by first instar larvae of Frankliniella occidentalis is a prerequisite for transmission.

Phytopathol. 86(9): 901-905.

Watson, M.A. and Roberts, F.M. 1939. A comparative study of the transmission of Hyoscyamus

virus 3, Potato virus Y, and Cucumber virus 1 by the vectors Myzus persicae (Sulz), M.

circumflex (Buckton), and Macrosiphum gei (Koch). Proc. R. Soc. London Ser. B 127: 543-

576.

Watson, M.A. and Roberts, F.M. 1940. Evidence against the hypothesis that certain plant viruses

are transmitted mechanically by aphides. Ann. Appl. Biol. 27: 227-233.

Whitfield, A.E., N.K.K. Kumar, D. Rotenberg, D.E. Ullman, E.A. Wyman, C. Zietlow, D.K.

Willis and T.L. German. (2008) A soluble form of Tomato spotted wilt virus (TSWV)

Glycoprotein GN (GN-S) Inhibits Transmission of TSWV by Frankliniella occidentalis.

Phytopathol. 98(1):45-50.

Zawirska, I. (1976) Untersuchungen uber zwei biologische Typen von Thrips tabaci Lind.

(Thysanoptera, Thripidae) in der VR Polen. Arch. Phytopath. Plant Prot. 12: 411-422.

Figure 1.1 Tomato spotted wilt symptoms. (a) TSWV chlorotic and necrotic ring symptoms on tomatoes (Elizabeth Bush, Virginia Polytechnic Institute and State University, Bugwood.org). (b) Necrotic TSWV lesions on pepper (Vegetable Pathology-Long Island Horticultural Research & Extension Center, Cornell University. (c) TSWV necrotic leaf spots on potato (Vegetable Pathology-Long Island Horticultural Research & Extension Center, Cornell University). (d) Tomato plant with leaf bronzing and wilting from TSWV (aces.nmsu/ces/plantclinic/tomato- spotted-wilt-viru.html).

Figure 1.2 (a) Depiction of the TSWV virion and genome. (b) TSWV genome organization, indicating the open reading frames of the viral genes on each genomic segment.

Figure 1.3 Feeding damage caused by onion thrips, T. tabaci. Photograph by Joseph Ogrodnick, Cornell University.

Figure 1.4 TSWV dissemination pathway in thrips vectors with the internal anatomy of the salivary glands relative to the gut of F. occidentalis highlighted.

Figure 1.5 Adult onion thrips, T. tabaci. Photograph by Diane Alston, Utah State University, Bugwood.org. Adult females are 1.0-1.3 mm in length and adult males are about 0.7 mm in length.

Figure 1.6 Representation of the generalized orthotospovirus replication cycle based off other Bunyavirales members. Elliot, R.M. 2014. Nature Reviews Microbiology 12:673-685.

Chapter 2

Transmission of a persistently-propagative plant virus by its insect vector is not solely

influenced by virus titer

To be submitted to Scientific Reports:

Jessica A. Brown1, Alana L. Jacobson2, Tim L. Sit1, and George G. Kennedy1

1Department of Entomology and Plant Pathology, Varsity Research Bldg. Module 6, 1575 Varsity Dr., Suite 1535, Campus Box 7616, North Carolina State University, Raleigh, NC 27695-7616 2Department of Entomology and Plant Pathology, 301 Funchess Hall, Auburn University,

Auburn, AL, 36849, USA

Abstract

Plant viruses rely on insect vectors for transmission to new plant hosts, but many of the specifics of virus-vector interactions are not fully understood. Thrips tabaci transmits Tomato spotted wilt virus (TSWV) in a persistent and propagative manner, and has been shown to vary greatly in its ability to transmit different isolates of TSWV. Similarly, TSWV isolates are transmitted at different efficiencies by different populations of T. tabaci. This study examined the relationships between virus titer in source leaves, titer in individual transmitting and non- transmitting thrips, and transmission efficiency by 12 TSWV isolate-T. tabaci isoline pairings previously shown to differ in transmission efficiency. Results of quantitative real-time PCR of the TSWV L RNA segment show that virus titers in individual thrips were unrelated to the virus titers in the source leaves from which they acquired virus and when averaged over thrips from all

TSWV isolates and T. tabaci isolines, were significantly higher in thrips that transmitted the virus than those that did not. However, mean virus titers in the vector were lower and virus transmission rates were higher for TSWV isolate-T. tabaci pairings collected from the same location (sympatric) than for pairings collected from different locations (allopatric). Results of these experiments provide evidence for the importance of specific vector-virus interactions and local adaptation on transmission efficiency of TSWV by T. tabaci.

Introduction

Modern agricultural practices and globalization of trade have contributed to a surge of emerging plant viruses that are responsible for billions of dollars in annual crop losses. The expansion of agricultural land alters stable relationships between viruses, insects, and their natural plant hosts providing opportunities for viruses and vectors to exploit widely available cultivated hosts (Gray & Banerjee, 1999). The majority of plant viruses are dependent on insect vectors for plant-to-plant transmission. Specific interactions with their insect vectors are required for the viruses to move to new hosts, but little is known about how these interactions impact the efficiency of transmission.

Vector competence reflects the success of the virus in overcoming intrinsic, physiological, microbiota, and immunity barriers that can be governed by genetic interactions between vector and viral genotypes and are subject to influence by extrinsic factors, including host plants and environmental conditions (Agarwal et al., 2017). Transmission of persistently transmitted viruses requires that the viruses traverse anatomical barriers in their vectors. After ingestion, they move from the gut lumen across other tissues or through hemolymph and into the salivary glands from which the viruses are introduced back into plants in saliva during insect feeding (Bosco et al.,

2007; Ammar & Hogenhout, 2008). Transmission and transmission efficiency of viruses are ultimately determined by the number of virions that accumulate in the appropriate salivary compartments after circulation and/or replication within the vector and are transferred in saliva to the host plant during feeding.

Several studies on vector taxa exhibiting different modes of transmission have shown a positive correlation between viral titer within the source plant or insect vector and the efficiency of transmission of plant viruses (Gill, 1969; Ammar, 1975; Pereira et al., 1989; Gray et al., 1991;

Ammar et al., 1995). Circulative, non-propagative viruses in the Luteoviridae, Geminiviridae, and Nanoviridae families are transmitted by aphids, whiteflies or leafhoppers. Because these viruses do not replicate in their vectors, higher virus titers in plants (Gill, 1969; Pereira et al.,

1989; Gray et al., 1991) and/or longer feeding periods (Let et al., 2002) have been shown to increase the amount of virus acquired by the vector and increase transmission (Whitfield et al.,

2015). In persistent-propagative viruses, less is known about how virus titers in source plants and in the insect vector relate to transmission efficiency. There is evidence in the genus Tenuivirus that virus titer in source plants positively correlates with transmission efficiency by planthopper vectors (Ammar, 1975; Ammar et al., 1995), but this was not consistent among isolates of Maize stripe virus (MStV) (Ammar et al., 1995). Virus titer is also believed to be a determinant for transmission of the Orthotospovirus Tomato spotted wilt virus (TSWV) (Bunyavirales:

Tospoviridae), because higher titers of TSWV in adult thrips have been shown to be related to significantly higher frequencies of transmission (Inoue et al., 2004; Nagata et al., 2004;

Rotenberg et al., 2009; Okazaki et al., 2011).

Although the aforementioned studies document a relationship between virus titer in individual vectors and transmission frequency for sowcific virus-vector combinations, they do not address the relationship between virus titer in the vector and inter-population variation in transmission within a single vector species. A previous study examining transmission of 89 distinct pairings between TSWV isolates and Thrips tabaci isolines initiated from thrips collected from different geographic locations in North Carolina, USA showed a significant effect of virus isolate, thrips isoline, and their interaction on transmission efficiency (Jacobson &

Kennedy, 2013). Although transmission rates ranged from 0-55% across all isolate by isoline pairings, the ability of a single isoline to transmit multiple virus isolates varied up to 18-fold, and

the transmissibility of each isolate by multiple T. tabaci varied up to 45-fold. In addition, significantly higher transmission rates were observed among sympatric (originate from the same location) TSWV isolate-T. tabaci isoline pairings than allopatric pairings (originate from different locations), suggesting local adaptation between virus and vector resulting from antagonistic coevolution in which local virus has greater infectivity than foreign virus on local vectors (Morgan et al., 2005). Whether or not the observed variation in transmission frequency was influenced by differences in virus titer within the vector was not examined. Both the thrips and the leaf tissue used in the studies of Jacobson and Kennedy (2013) were flash frozen in liquid nitrogen immediately following their acquisition and inoculation access periods, respectively, and stored at -80°C until used in this study. This study was undertaken to determine if TSWV titers in adult T. tabaci varied among a subset of the TSWV isolate and T. tabaci isoline pairings studied by Jacobson and Kennedy (2013), and whether variation in virus titers in the vector accounted for differences in transmission.

Materials and Methods

T. tabaci and TSWV: Collecting, culturing and transmission assays. T. tabaci individuals and TSWV isolates were subsamples of those tested by Jacobson and Kennedy

(2013) in their characterization of differences in transmission efficiency among different pairings of T. tabaci isolines and TSWV isolates obtained from multiple locations and host plants in

North Carolina in 2010. Their study used clonal isolines of T. tabaci that were established from thelytokous females (parthenogenetic reproduction - producing only female offspring) collected at each location to minimize genetic variation within each of the isolines. Transmission efficiency was then characterized by each of the isolate by isoline pairings. Details of collection, establishment of clonal thrips isolines, TSWV isolate establishment, transmission experiments,

and results from transmission assays to characterize each TSWV isolate-isoline pairing are described in Jacobson and Kennedy (2013). They classified individual thrips as transmitting or non-transmitting based on a DAS-ELISA test of the leaf discs on which viruliferous thrips were allowed to feed during the inoculation access period (these leaf discs were no longer available for the experiments reported here). Samples of transmitting thrips, non-transmitting thrips, and infected leaf tissue used for acquisition of TSWV from each isolate-isoline pairing were flash frozen in liquid nitrogen and stored at -80°C until used in the experiments reported here. A subset consisting of 12 of the 89 isolate-isoline pairings for which transmission efficiencies were reported by Jacobson and Kennedy (2013) were chosen for these experiments; they were representative of the range in transmission efficiencies observed among the 89 isolate-isoline pairings and included both sympatric and allopatric isolate-isoline pairings (Jacobson &

Kennedy, 2013) (Table 2.1). For each isolate-isoline pairing we quantified TSWV titers in individual transmitting and non-transmitting thrips and in the TSWV-infected Emilia sonchifolia leaf disc on which the thrips fed during the acquisition access period (AAP) using RT-qPCR. Up to five transmitting and non-transmitting thrips were selected per isolate-isoline pairing unless transmission rates were so low that five transmitting individuals were not observed in transmission experiments. The numbers of transmitting and non-transmitting thrips for each isolate-isoline pairing subjected to qPCR are shown in table S1.

Thrips and Leaf Disc RNA Extraction. Total RNA was extracted from 105 individual T. tabaci using TRIzol™ reagent (ThermoFisher Scientific, Waltham, Massachusetts) following the protocol used by Mason et al. (2003) with some modifications. For homogenization, each individual thrips was placed in a 1.5 ml microfuge tube, flash frozen in liquid N2, and then homogenized with a motorized micropestle (Kimble Chase, Vineland, NJ) followed by the

addition of TRIzol™. All incubation steps were at room temperature and all centrifugation steps were done at 16,000 x g. The pellets were air dried for 15 minutes instead of vacuum concentrated and resuspended in 8 µl (Diethyl pyrocarbonate (DEPC) treated water (Amresco,

Solon, OH).

The Emilia sonchifolia source leaf tissue (20 mg) was extracted with TRIzol™ using the manufacturers’ protocol. Homogenization was done using three Pyrex solid glass beads (3 mm;

Corning, Corning, NY) in a 1.5 ml tube containing leaf tissue, flash frozen in liquid N2, and shaken for 20 seconds in a Silamat S6 mixer (Ivoclar Vivadent, Amherst, NY). Total RNA was resuspended in 50 µl of dH2O.

cDNA Synthesis. cDNA synthesis was required to convert total RNA to the DNA template required for RT-qPCR. First strand cDNA was synthesized from total RNA using Protoscript® II reverse transcriptase (New England Biolabs, Ipswich, MA). Both thrips and leaf disc cDNA was synthesized using 2 µl of total RNA in a 20 µl reaction primed with 2 µl of random hexamers (60

µM; Invitrogen, Carlsbad, CA). The primers, 1 µl dNTP mix (10 mM), total RNA and dH2O to a final volume of 12 µl were combined and heated at 70°C for 5 minutes and chilled immediately on ice before the remaining reagents were added (Protoscript reaction buffer, DTT (10 mM final), Murine RNase inhibitor (2U/µl final) and Protoscript® II reverse transcriptase (20U/µl final). The prep was then incubated at 25°C for 5 minutes followed by incubation at 42°C for 1 hour. The enzyme was inactivated at 80°C for 5 minutes and stored at -20°C until used for RT- qPCR.

Quantitative Real-Time PCR (RT-qPCR) Primer design. There are no published RT- qPCR primers or a complete genome sequence for T. tabaci. Previously reported F. occidentalis actin primers as well as other internal control genes were assayed as possible internal control

genes for T. tabaci (Boonham et al., 2002; Yang et al., 2014; Zheng et al., 2014) (Table S2).

Primers were also designed and validated for the commonly used internal control Elongation factor one alpha (EF1A) from an alignment of 7 published partial T. tabaci EF1A sequences

(accession numbers: KM582809, AB894111, AB277263, AB277262, AB894109, AB894108,

AB277575) (Table S3).

E. sonchifolia does not have published RT-qPCR primers or a complete genome sequence.

Previously published RT-qPCR primers developed from the highly conserved common plant genes actin, tRNA, and profilin (Laube et al., 2010) were assayed on E. sonchifolia. An alignment of 3 partial E. sonchifolia sequences for the 5.8S rRNA gene and internal transcribed spacer (ITS) were also utilized to design additional primer pairs (accession numbers: JF733772,

KU696022, MF440623) (Table S4).

TSWV quantification was validated using a number of published RT-qPCR primers specific to the nucleocapsid (N) gene of the small (S) RNA segment (Roberts et al., 2000;

Boonham et al., 2002; Mortimer-Jones et al., 2009; Rotenberg et al., 2009). Primers were also designed spanning the L RNA segment using an alignment of 5 published sequences (accession numbers: NC_002052, JN664254, HM581940, HM581934, JF960237) as another possible measurement of TSWV transcript levels in both thrips and infected source leaf tissue (Table

S5).

RT-qPCR. Viral titer was quantified using the primer efficiency method, in which the target gene expression is quantified relative to the expression of an internal control while accounting for primer efficiency (Pfaffl, 2001; Schmittgen & Livak, 2008). Primer efficiency values (E) were calculated by 10(-1/slope) where the slope of the standard curve was obtained by plotting the concentration of five, ten-fold dilutions of a single cDNA reaction made from thrips

with a high TSWV titer against their Ct values. TSWV transcript levels were normalized to the internal controls to obtain the relative abundance ratio using the inverse equation of Pfaffl

Ct (internal control) Ct (L) (Pfaffl, 2001; Rotenberg et al., 2009; Ruark et al., 2017): Einternal control /EL , where Ct = the amplification cycle number at which fluorescence emitted during the reaction first exceeds background fluorescence and L = L RNA target gene Ct value. RT-qPCR was performed on a QuantStudio™ 6 Flex system with a 96-well fast block. This system automatically applied the Pfaffl inverse equation to calculate the relative abundance ratio using the primer efficiencies (provided by the user in the relative quantification settings) and the target gene and control Ct values.

SsoAdvanced™ SYBR® Green Supermix, iTaq™ Universal SYBR® Green Supermix, , and SsoFast™ EvaGreen® Supermix (all Bio-Rad, Hercules, CA) were compared for their ability to detect amplification of DNA. SsoAdvanced™ SYBR® Green Supermix was chosen because it had the most reproducible results in our hands. All samples were run in triplicate for each primer pair to control for pipetting errors, along with no-template controls, where the primers, SYBR Green mix, and water are included but no template to make sure there is no contamination that would result in a false positive. No primer controls were also included, where the template, SYBR Green mix, and water are included but no primers to make sure there is nothingelse that will amplify the template. Reactions (20 µl) were performed in 0.1 ml 96-well plates using the manufacturer’s recommended protocol: initial denaturation at 95°C for 30 seconds, 40 cycles of denaturation at 95°C for 15 seconds and annealing/extension at 60°C for

30 seconds, followed by a single melt curve stage of 95°C for 15 seconds, 60°C for 60 seconds, and 95°C for 15 seconds. The number of denaturation/annealing/extension cycles was reduced to

30 for the source leaf tissue due to the higher initial RNA concentrations obtained.

Statistical Analysis. Virus titers were expressed as the relative abundance ratios for the

TSWV transcript levels individual thrips and in the leaf tissue that was used as the virus source for AAPs. Titers in the leaf discs used as virus sources were log transformed (base 10) and subjected to one-way ANOVA to test for differences among isolate-isoline pairings.

Further analyses examining the relationships between virus titer in individual thrips and virus isolate and thrips isoline were conducted using the GLIMMIX procedure of the SAS system version 9.4 (SAS Institute, Cary, NC) in which the relative abundance ratio values for the

TSWV transcript levels were analyzed using a generalized linear model with an assumed lognormal response distribution. An initial analysis tested a model in which the independent variables were virus isolate, isoline and their interaction. This relationship was examined further in a second model in which the interaction term was replaced with the variable “collection location,” in which virus isolate and isoline pairings were grouped as sympatric or allopatric.

Similar analyses were conducted to test the association between virus titer in thrips and transmission. In these analyses transmission was treated as a binary variable with individual thrips in our subsamples classified as transmitting or non-transmitting. We could not directly test for associations between titers and transmission rates of the specific isolate-isoline pairings because the thrips from each pairing subjected to qPCR were not randomly selected. Because the transmission rates recorded by Jacobson and Kennedy (2013) were very low for sume pairings, thenumbers of transmitting thrips in those pairings were too low to ensure inclusion of a sufficient number of transmitting thrips in a random sample of thrips available to us for use in these experiments. Therefore, the samples of thrips from each isolate-isoline pairing subjected to qPCR were chosen to ensure adequate representation of transmitting and non-transmitting thrips.

To address the question of whether variation in virus titers in the vector accounted for

differences in transmission efficiency reported by Jacobson and Kennedy (2013) for the virus isolates and isolines included in our study (Table 2.1), we examined the isoline probability of transmission for each isolate and isoline by conducting an ANCOVA with isolate and isolines as main effects, and the average virus titer of the isoline (transmitting and non-transmitting individuals) as a covariate.

Results

Primer efficiency and validation. Most of the published F. occidentalis RT-qPCR primers for thrips internal controls did not show the specificity and consistency required for reproducible

RT-qPCR with T. tabaci samples. EF1A primers from F. occidentalis demonstrated the most promising results for a heterologous internal control. However, the homologous T. tabaci EF1A primers amplified more robustly and consistently (Fig. S1). Primer pair EF1A_346F and

EF1A_456R (Table 2.2) was chosen as the internal control with a primer efficiency of 86% (Fig.

S2).

The highly conserved plant gene primers resulted in no amplification from the source leaf tissue. The E. sonchifolia ITS primers had poor amplification but the 5.8S rRNA primers amplified the most efficiently and consistently (Fig. S3). Primer pair Emilia_5.8S_rRNAF and

Emilia 5.8S_rRNAR was chosen as the internal control for the source leaf tissue with a primer efficiency of 97% (Fig. S4).

The N gene primers for TSWV quantification produced results that were inconsistent. The

L RNA primers were more consistent and robust overall than any of the N primers. Primer pair

TSWVL4832F and TSWVL 4493R was used to measure TSWV transcript levels with a primer efficiency of 92% (Fig. S5). The L RNA is also a better representation of the viral titer present in infected tissue due to the fact it is mostly a measure of genome replication, while the N gene

primers measure both genome replication (S RNA) and N gene expression (amplified S mRNAs).

Viral titers in the source leaf tissues. There were no statistically significant differences in virus titers (as indicated by relative abundance ratios) in the source leaf tissue used for virus acquisition among any of the isoline-isolate treatment pairings [F= 0.25, df= (11, 12), P =

0.9853] (Fig. 2.1; Table 2.3). This result indicates that virus titers in the source leaves were not a significant source of variation accounting for differences in virus titers or transmission among thrips included in this study because all thrips had the potential to ingest similar amounts of

TSWV. The Ct values of the TSWV L RNA are very similar to the Ct values of the 5.8S rRNA of E. sonchifolia showing the virus replicates to the level of ribosomal RNA in the source leaf tissue.

Effects of virus isolate and T. tabaci isoline on virus titer in thrips. The main effect of

TSWV isolate [F = 8.6, df = (3, 93), P < 0.0001] (Fig. 2.2) was significant, explaining virus titers

(relative abundance ratios) in individual thrips but T. tabaci isoline was not [F = 2.3, df = (3, 93),

P = 0.0820] (Fig. 2.3),. The isolate by isoline interaction was also highly significant [F = 6.12, df

= (5, 93), P < 0.001 (Fig. 2.4)], indicating that the effect of TSWV isolate on virus titer in individuals from each isoline was not consistent across thrips isolines. This was not completely unexpected because Jacobson and Kennedy (2013) reported higher transmission efficiency among sympatric than allopatric isolate-isoline pairings. Therefore, another analysis was conducted in which collection location (allopatric/sympatric) replaced the interaction term.

Relative abundance ratios were measured in 39 individual thrips representing sympatric virus isolate–thrips isoline pairings and 66 individual thrips representing allopatric virus isolate-thrips isoline pairings. In this analysis, virus isolate [F = 12.21, df = (3, 94), P < 0.0001] and thrips

isoline [F = 5.53, df = (3, 94), P = 0.0015] main effects were both significant. In addition, the effect of location was significant; mean relative abundance ratios of adult thrips were significantly lower for sympatric than allopatric virus isolate-thrips isoline pairings [F = 14.05, df = (1, 94), P = 0.0002] (Fig. 2.5).

Relationship between TSWV transmission and virus titer in the vector. Of the 105 T. tabaci included in our study, 42 percent had transmitted TSWV to leaf discs and 58 percent had not transmitted. TSWV was detected in all 105 thrips regardless of whether or not they transmitted the virus, and the mean relative abundance ratio per thrips was significantly higher in transmitting than non-transmitting thrips [F = 11.23, df = (1, 100), P = 0.0011] (Fig. 2.6).

However, even within individual isolate-isoline pairings relative abundance ratios were not always higher in transmitting than non-transmitting thrips, demonstrating that non-transmitters were capable of supporting similar levels of viral replication (Table S6; Fig. S6).

Because the thrips from each isolate-isoline pairing in which we measured relative abundance ratios were selected to ensure representation of both transmitting and non- transmitting thrips and comprised only a small sub-sample (n=5-10) of the individual thrips used by Jacobson and Kennedy (2013) to characterize the transmission efficiency of each TSWV isolate and thrips isoline pairing (Table 2.1), our subsamples could not be used to directly test associations between virus titers and transmission efficiencies of the isolate and isoline pairings.

However, to address the question of whether the effects of isolate and isoline on TSWV transmission rates reported by Jacobson and Kennedy (2013) remained significant after accounting for the average effects of virus titer in the vector, we conducted an analysis of covariance. In this analysis, virus titer in the thrips was included as a covariate (random effect), virus isolate and T. tabaci isoline were included as fixed effects, and the probability of

transmission as measured by Jacobson and Kennedy (2013) (shown in Table 2.1) was included as the dependent variable. The effect of virus titer on probability of transmission was not significant [F = 0.42, df = (1, 97), P = 0.5177] in this analysis but effects of virus isolate [F =

101.61, df = (3, 97), P < 0.0001], and thrips isoline [F = 5.42, df = (3, 97), P = 0.0017] were both significant, indicating that variation in virus titers within the vector did not fully account for differences in transmission rates among the TSWV isolates and among isolines included in this study (Table 2.4).

Discussion

The overall aim of this study was to determine if variation in transmission efficiency previously reported among pairings of different TSWV isolates and T. tabaci populations can be explained by variation in titers within the thrips vector. The absence of such an association would indicate that specific virus-vector interactions other than those affecting virus uptake, replication and accumulation within the vector would be of primary importance in determining transmission efficiency of TSWV by different populations of T. tabaci. To address our objective, we measured TSWV LRNA using qPCR to characterize variation in titers of TSWV in transmitting and non-transmitting T. tabaci from multiple sympatric and allopatric TSWV isolate

– T. tabaci isoline pairings that differed in transmission efficiency and represented different virus isolates and vector populations.

During the course of these experiments we developed a reliable method for quantifying

LRNA, which is the only genome segment of TSWV that does not produce subgenomic RNA and therefore provides a measure of only genomic replication and not gene expression, and therefore may be more reliable for quantifying viral titers. In our study, relative abundance ratio of LRNA is used to estimate virus titers in thrips and the leaf tissue from which they acquired

virus. Virus titer in the leaf tissue did not account for differences in virus titers within thrips, suggesting vector-virus interactions are more important for determining transmission outcomes than viral load acquired during feeding. Virus titers in adult T. tabaci did not fully explain the variation in transmission efficiency observed among the TSWV isolate-isoline pairings either.

Although mean virus titer in transmitting individuals was significantly higher than in non- transmitting individuals, there was extensive overlap in virus titers among transmitting and non- transmitting individuals both within and among isolate-isoline pairings. The effects of isolate and the interaction of isolate and isoline on virus titer were consistently significant in all of our analyses, whereas the effect of T. tabaci isoline was significant only when collection location

(sympatry/allopatry) was included as a main effect. Jacobson and Kennedy (2013), in their prior study involving a larger number of TSWV isolate-isoline pairings, found that sympatric isolate and isoline pairs transmitted TSWV at a significantly higher rate than allopatric pairs; a result indicative of local adaptation, which occurs when the mean fitness of a population is higher in its own habitat than in a remote habitat (Gandon & Michalakis, 2002). Within the subset of the isolate-isoline pairings that were included in our study, the mean transmission rates for the sympatric and allopatric pairings were 25% and 12%, respectively, but the mean virus titers in thrips from the allopatric pairings were significantly higher than in the thrips from the sympatric pairings. This finding is supported by our analysis of covariance indicating that after accounting for effects of virus titer in the vector, the effects of both virus isolate and thrips isoline on transmission rates measured by Jacobson and Kennedy (2013) for the isolate-isoline pairings includediin our study remained significant. Together these results suggest that local adaptations between virus and vector leading to more efficient virus transmission involve more than simply higher virus uptake, replication or accumulation rates in the vector and. In the locations where

the T. tabaci and TSWV isolates used in our study were collected, the most abundant vectors are

F. fusca and F. occidentalis. The evidence for local adaptation between TSWV isolates and T. tabaci populations used in our study suggests that selection on the virus population for adaptation to specific vectors is sufficiently strong that even a relatively minor vector species can influence local vector-virus evolution (Jacobson & Kennedy, 2013; Jacobson et al., 2013) (Table

2.1).

A genetic basis for transmission of Orthotospoviruses has been reported in T. tabaci and two other thrips species (Cabrera-La Rosa & Kennedy, 2007; Halaweh & Poehling, 2009; Ogada et al., 2016), and there are numerous opportunities for virus replication and movement within the vector that may be compromised and result in reduced transmission efficiency (Rotenberg et al.,

2015; Oliver & Whitfield, 2016). Viral genes that encode nucleocapsid, glycoproteins, and NSs have been implicated in infection and movement in thrips vectors (Ullman et al., 1993; Ullman et al., 1995; Sin et al., 2005; Margaria et al., 2014). In order for TSWV to be transmitted by thrips, it must traverse the midgut following ingestion by 1st instars and infect the circular and longitudinal muscles surrounding the midgut where replication occurs. The virus must then move via the tubular salivary glands and the efferent duct that leads from the principal salivary glands to the salivary reservoir (Montero-Astúa et al., 2016). The viral receptor proteins putatively interact with the cell receptors of midgut cells in thrips, enabling movement of TSWV to the salivary glands for transmission through endocytosis (Bandla et al., 1998; Kikkert et al., 1998;

Sin et al., 2005; Whitfield et al., 2008; Montero-Astúa et al., 2016). Even if replication occurs, infection may be limited to the midgut if virus cannot cross the basal lamina (Thomas et al.,

1993), and midgut infections can persist in adult thrips that cannot transmit the virus, as well as

in non-vector species (Ullman et al., 1992; de Assis Filho et al., 2005). Details of viral interactions that influence transmission but occur after midgut escape are not known.

TSWV has been shown to elicit an immune response in F. occidentalis and F. fusca

(Medeiros et al., 2004; Ogada et al., 2016; Schneweis et al., 2017; Shrestha et al., 2017) that limits virus movement, suggesting variation in vector competence may be affected by differences in immune responses of the vector. Similarly, the silencing suppressor (NSs) might also have a role as it has also been shown to influence virus accumulation in F. occidentalis; although its exact role is unknown, it likely suppresses the immune response (Margaria et al., 2014).

Behavior and fitness-related effects on the vector were not examined in this study but have been documented to influence transmission of plant viruses by their vectors. Infection of TSWV in male thrips increased feeding and the number of non-ingestion probes (Stafford et al., 2011), which are believed to be largely responsible for transmission because they leave cells largely intact (Kindt et al., 2003). Both infection in thrips and host plants significantly change survival and development times of F. occidentalis and F. fusca, and the magnitude of these effects is influenced by host plant, virus isolate and temperature (Stumpf & Kennedy, 2005; Stumpf &

Kennedy, 2007). Effects of plant and vector infection on fitness of T. tabaci have not been reported but may be involved with the lower transmission rates and higher titers observed in allopatric T. tabaci. Although not formally studied, low or no survival of T. tabaci on TSWV- infected plants has been observed in some of the transmission experiments (Jacobson and

Kennedy personal observation). Plant-virus interactions leading to changes in plant attractiveness to vectors are documented for plant viruses and their vectors (Eigenbrode et al., 2018), but have not been studied in this pathosystem.

Previous work demonstrated that isoline transmission efficiency of TSWV by T. tabaci likely depends on genotypic interactions between virus isolates and T. tabaci clonal lines

(Jacobson & Kennedy, 2013; Jacobson et al., 2013). Our results extend their findings by demonstrating that variation in virus titers in adult thrips is not responsible for the observed variation in transmission efficiency and provide additional support for the importance of specific vector-virus interactions and co-evolutionary dynamics in transmission outcomes. A better understanding of virus replication, movement, and accumulation in the vector is needed to determine whether or not transmission outcomes are influenced by more efficient localization or replication in the salivary glands. Understanding epidemiologically important patterns of variation in vector competence also requires a better understanding of the mechanisms underlying transmission, similarities of these mechanisms across vector species, and the influence of vector-imposed selection pressure on viral populations.

Acknowledgements

This work was supported by USDA NIFA Coordinated Agricultural Project Grant 2012-

68004-20166. The authors would like to acknowledge Dorith Rotenberg for her help with RT- qPCR, and Thomas Chappell for his help with statistics.

Literature Cited

Agarwal, A., Parida, M., and Dash, P.K. 2017. Impact of transmission cycles and vector

competence on global expansion and emergence of arboviruses. Rev. med. Virol. 27(5):

e1941.

Ammar, E-D. and Hogenhout, S.A. 2008. A neurotropic route for Maize mosaic virus

(Rhabdoviridae) in its planthopper vector Peregrinus maidis. Virus Research 131: 77-85.

Ammar, E-D., Gingery, R.E., and Madden, L.V. 1995. Transmission efficiency of three isolates

of maize stripe tenuivirus in relation to virus titre in the planthopper vector. Plant Pathol.

44: 239-243.

Ammar, E-D. 1975. Effect of European wheat striate mosaic, acquired transovarially, on the

biology of its planthopper vector Javesella pellucida. Ann. Appl. Biol. 79: 203-213.

Bandla, M. D., Campbell, L. R., Ullman, D. E., and Sherwood, J. L. 1998. Interaction of tomato

spotted wilt tospovirus (TSWV) glycoproteins with a thrips midgut protein, a potential

cellular receptor for TSWV. Phytopathology. 88(2): 98–104.

Boonham, N., Smith, P., Walsh, K., Tame, J., Morris, J., Spence, N., Bennison, J., and Barker, I.

2002. The detection of Tomato spotted wilt virus (TSWV) in individual thrips using real

time fluorescent RT-PCR (Taqman). J. virol. Methods 101: 37-48.

Bosco, D., Galetto, L., Leoncini, P., Saracco, P., Raccah, B., and Marzachì, C. 2007.

Interrelationships between Candidatus Phytoplasma Asteris and its leafhopper vectors

(Homoptera: Cicadellidae). J. Econ. Entomol. 100(5): 1504-1511.

Cabrera-La Rosa, J.C. and Kennedy, G.G. 2007. Thrips tabaci and tomato spotted wilt virus:

inheritance of vector competence. Entomol. Exp. Appl. 124: 161-166.

de Assis Filho, F.M., Stavisky, J., Reitz, S.R., Deom, C.M., and Sherwood J.L. 2005. Midgut

infection by tomato spotted wilt virus and vector incompetence of Frankliniella tritici. J.

Appl. Entomol. 129 (9/10): 548-550.

Gandon, S. and Michalakis Y. 2002. Local adaptation, evolutionary potential and host-parasite

coevolution: interactions between migration, mutation, population size and generation time.

J. Evol. Biol. 15: 451-462.

Eigenbrode, S.D., Bosque-Pérez, B.A., and Davis T.S. 2018. Insect-borne pathogens and their

vectors: ecology, evolution, and complex interactions. Annu. Rev. Entomol. 63: 169-191.

Gill, C.C. 1969. Cyclical transmissibility of barley yellow dwarf virus from oats with increasing

age of infection. Phytopathol. 59: 23-28.

Gray, S. M. and Banerjee N. 1999. Mechanisms of arthropod transmission of plant and animal

viruses. Microbiol. Mol. Biol. Rev. 63(1): 128-148.

Gray, S.M., Power, A.G., Smith, D.M., Seaman, A.J., and Altman, N.S. Aphid transmission of

barley yellow dwarf virus: acquisition access periods and virus concentration requirements.

Phytopathol. 81(5): 539-545.

Halaweh, N. and Poehling, H.M. 2009. Inheritance of vector competence by the thrips

Ceratothripoides claratris (Shumsher) (Thysanoptera: Thripidae). J. Appl. Entomol. 133:

386-393.

Inoue, T., Sakurai, T., Murai, T., and Maeda, T. 2004. Specificity of accumulation and

transmission of tomato spotted wilt virus (TSWV) in two genera, Frankliniella and Thrips

(Thysanoptera: Thripidae). Bull. Entomol. Res. 94(6): 501–507.

Jacobson, A. L. and Kennedy, G. G. 2013. Specific insect-virus interactions are responsible for

variation in competency of different Thrips tabaci isolines to transmit different tomato

spotted wilt virus isolates. PLOS ONE 8(1): e54567.

Jacobson, A. L., Booth, W., Vargo, E. L., and Kennedy, G. G. 2013. Thrips tabaci population

genetic structure and polyploidy in relation to competency as a vector of tomato spotted wilt

virus. PLOS ONE 8(1): e54484.

Kikkert, M., Meurs, C., van de Wetering, F., Dorfmüller, S., Peters, D., Kormelink, R., and

Goldbach, R.1998. Binding of tomato Spotted wilt virus to a 94-kDa thrips protein.

Phytopathology, 88(1): 63–69.

Kindt, F., Joosten, N.N., Peters, D., and Tjallingii, W.F. 2003. Characterisation of the feeding

behavior of western flower thrips in terms of electrical penetration graph (EPG) waveforms.

Journal of Insect Physiology 49: 183-191.

Laube, I., Hird, H., Brodmann, P., Ullman, S., Schöne-Michling, M., Chrisholm, J., and Broll, H.

2010. Development of primer and probe sets for the detection of plant species in honey.

Food Chemistry 118: 979-986.

Lett, J-M., Granier, M., Hippolyte, I., Grondin, M., Royer, M., Blanc, S., Reynaud, B., and

Peterschmitt, M. 2002. Spatial and temporal distribution of geminiviruses in leafhoppers of

the genus Cicadulina monitored by conventional and quantitative polymerase chain reaction.

Phytopathol. 92(1): 65-74.

Margaria, P., Bosco, L. and Vallino, M. 2014. The NSs protein of Tomato spotted wilt virus is

required for persistent infection and transmission by Frankliniella occidentalis. J. Virol.

88(10): 5788–5802.

Mason, G., Roggero, P., and Tavella, L. 2003. Detection of tomato spotted wilt virus in its vector

Frankliniella occidentalis by reverse transcription-polymerase chain reaction. J. virol.

Methods 109(1): 69-73.

Medeiros, R.B., Resende, R.D.O. and Ávila C.D. 2004. The plant virus tomato spotted wilt

tospovirus activates the immune system of its main vector, Frankliniella occidentalis. J.

Virol. 78(10): 4976-4982.

Montero-astúa, M., Rotenberg, D., Leach-Kieffaber, A., Schneweis, B. A., Park, S., Park, J. K.,

German, T. L., and Whitfield, A. E. 2014. Disruption of vector transmission by a plant-

expressed viral glycoprotein. Mol. Plant Microbe Interact. 27(3): 296–304.

Montero-Astua, M., Ullman, D. E. and Whitfield, A. E. 2016. Salivary gland morphology, tissue

tropism and the progression of tospovirus infection in Frankliniella occidentalis. Virology

493: 39–51.

Morgan, A.D., Gandon, S., and Buckling, A. 2005. The effect of migration on local adaptation in

a coevolving host-parasite system. Nature 437: 253-256.

Mortimer-Jones, S.M., Jones, M.G.K., Jones, R.A.C., Thomson, G., and Dwyer, G.I. 2009. A

single tube, quantitative real-time RT-PCR assay that detects four potato viruses

simultaneously. J. virol. Methods 161: 289-296.

Nagata, T., Almeida, A. C. L., Resende, R. O., and DeÁvila, A. C. 2004. The competence of four

thrips species to transmit and replicate four tospoviruses. Plant Pathol. 53(2): 136–140.

Ogada, P.A., Debener, T., and Poehling, H.M. 2016. Inheritance genetics of the trait vector

competence in Frankliniella occidentalis (western flower thrips) in the transmission of

tomato spotted wilt virus. Ecology and Evolution 6: 7911-7920.

Okazaki, S., Okuda, M., Komi, K., Yamasaki, S., Okuda, S., Sakurai, T., and Iwanami, T. 2011.

The effect of virus titre on acquisition efficiency of Tomato spotted wilt virus by

Frankliniella occidentalis and the effect of temperature on detectable period of the virus in

dead bodies. Australasian Plant pathol. 40: 120-125.

Oliver, J.E. and Whitfield, A.E. 2016. The genus Tospovirus: Emerging Bunyaviruses that

threaten food security. Annu. Rev. Virol. 3: 101-24.

Pereira, A-M., Lister, R.M., Barbara, P.J., and Shaner, G.E. 1989. Relative transmissibility of

barley yellow dwarf virus from sources with differing virus contents. Phytopathology 79:

1353-1358.

Pfaffl, M.W. 2001. A new mathematical model for relative quantification in real-time RT-PCR.

Nucleic acids research, 29(9): e45.

Roberts, C.A., Dietzgen, R.G., Heelan, L.A., and Maclean, D.J. 2000. Real-time RT-PCR

fluorescent detection of tomato spotted wilt virus. J. virol. Methods 88: 1-8.

Rotenberg, D., Kumar, N. K. K., Ullman, D. E., Montero-Astúa, M., Willis, D. K., German, T.

L., and Whitfield, A. E. 2009. Variation in Tomato spotted wilt virus titer in Frankliniella

occidentalis and its association with frequency of transmission. Phytopathology 99(4): 404–

10.

Rotenberg, D., Jacobson, A. L., Schneweis, D. J., and Whitfield, A. E. 2015. Thrips transmission

of tospoviruses. Current Opinion in Virology 15: 80–89.

Ruark, C.L., Koenning, S.R., Davis, E.L., Opperman C.H., Lommel, S.A., Mitchum, M.G., and

Sit, T.L. 2017. Soybean cyst nematode culture collections and field populations from North

Carolina and Missouri reveal high incidences of infection by viruses. Plos One 12(1):

e0171514.

Schmittgen, T. D. and Livak, K. J. 2008. Analyzing real-time PCR data by the comparative CT

method. Nature Protocols 3(6): 1101–1108.

Schneweis, D. J., Whitfiled, A. E., and Rotenberg, D. 2017. Thrips developmental stage-specific

transcriptome response to tomato spotted wilt virus during the virus infection cycle in

Frankliniella occidentalis, the primary vector. Virology 500: 226–237.

Shrestha, A., Champagne, D.E., Culbreath, A.K., Rotenberg, D., Whitfield, A.E., and Srinivasan,

R. 2017. Transcriptome changes associated with Tomato spotted wilt virus infection in

various life stages of its thrips vector, Frankliniella fusca (Hinds). J. Gen. Virol. 98: 2156-

2170.

Sin, S. H., McNulty, B. C., Kennedy, G. G., and Moyer, J. W. 2005. Viral genetic determinants

for thrips transmission of Tomato spotted wilt virus. PNAS 102(14): 5168–5173.

Stafford, C.A., Walker, G.P., and Ullman, D.E. 2011. Infection with a plant virus modifies vector

feeding behavior. PNAS 108(23): 9350-9355.

Stumpf, C.F. and Kennedy G.G. 2005. Effects of tomato spotted wilt virus (TSWV) isolates, host

plants, and temperature on survival, size, and development time of Frankliniella fusca.

Entomol. Exp. Appl. 114: 215-225.

Stumpf, C.F. and Kennedy, G.G. 2007. Effects of tomato spotted wilt virus isolates, host plants,

and temperature on survival, size, and development time of Frankliniella occidentalis.

Entomol. Exp. Appl. 123: 139-147.

Thomas, R.E., Wu, W.K., Verleye, D., and Rai, K.S. 1993. Midgut basal lamina thickness and

dengue-1 virus dissemination rates in laboratory strains of Aedes albopictus (Diptera:

Culicidae). J. Med. Entomol. 30: 326-331.

Ullman, D.E., Cho, J.J., Mau, R.F.L., Westcot, D.M., and Custer D.M. 1992. A midgut barrier to

Tomato spotted wilt virus acquisition by adult western flower thrips. Phytopathology

82(11): 1333-1342.

Ullman, D.E., German, T.L., Sherwood, J.L., Westcot, D.M, and Cantone, F.A. 1993.

Immunocytochemical evidence that the nonstructural protein encoded by the S RNA of

tomato spotted wilt tospovirus is present in thrips vector cells. Phytopathology 83: 456-463.

Ullman, D.E., Westcot, D.M., Chenault, K.D., Sherwood, J.L., German, T.L., Bandla, M.D.,

Cantone, F.A., and Duer, H.L. 1995. Compartmentalization, intracellular transport, and

autophagy of tomato spotted wilt tospovirus proteins in infected thrips cells. Phytopathol.

85: 644-654.

Whitfield, A. E., Kumar, N. K. K., Rotenberg, D., Ullman, D. E., Wyman, E. A., Zietlow, C.

Willis, D. K., and German T. L. 2008. A soluble form of the tomato spotted wilt virus

(TSWV) glycoprotein GN ( GN -S ) inhibits transmission of TSWV by Frankliniella

occidentalis. Phyopathology 98(1): 45–50.

Whitfield, A.E., Falk, B.W., and Rotenberg, D. 2015. Insect vector-mediated transmission of

plant viruses. Virology 479-480: 278-289.

Yang, C.C., Li, H., Pan, H., Ma, Y., Zhang, D., Liu, Y., Zhang, Z., Zheng, C., Chu, D. 2014.

Validation of reference genes for gene expression studies in nonviruliferous and viruliferous

Frankliniella occidentalis (Thysanoptera: Thripidae). PeerJ PrePrints 2: e662v1.

Zheng. Y.T., Li, H.B., Lu, M.X., and Du, Y.Z. 2014. Evaluation and validation of reference

genes for qRT-PCR normalization in Frankliniella occidentalis (Thysanoptera: Thripidae).

PLOS ONE 9(10): e111369.

Table 2.1. TSWV isolate and T. tabaci isofemale line pairings included in this study: North Carolina locations and host plants from which TSWV isolates and adult thrips used to initiate each T. tabaci clonal isofemale line were collected and mean proportion of T. tabaci transmitting TSWV for each isolate-isofemale line pairing as reported by Jacobson and Kennedy (2013). Proportion T. TSWV Location Host plant thrips tabaci isolate isolate-isoline Isolate-isoline transmitting isoline (n) Cove City – Cove Nicotiana tabacum –Allium AM1 IPOC1* City 0.20 (n=65) spp.

Cove City – Kinston AM1 Kin1 N. tabacum – Allium cepa 0.21 (n=66)

Cove City – Jackson AM1 SH2 Springs N. tabacum - Secale cerealae 0.21 (n=28)

Cove City – Jackson Capsicum annuum – AM1 SH72 Springs 0.10 (n=63) Raphanus sativus var niger

Jackson Springs - SH3 IPOC1 Cove City N. tabacum – Allium spp. 0.03 (n=67)

Jackson Springs – SH3 Kin1 Kinston N. tabacum – A. cepa 0.16 (n=68)

Jackson Springs – SH3 SH2* Jackson Springs N. tabacum – S. cerealae 0.16 (n=131)

Cove City – Cove SR3-3 IPOC1* City N. tabacum – Allium spp. 0.07 (n=54)

Cove City – Kinston SR3-3 Kin1 N. tabacum – A. sepa 0.08 (n=42)

Cove City – Jackson SR3-3 SH2 Springs N. tabacum – S. cerealae 0.06 (n=141)

Cove City – Jackson N. tabacum - Raphanus SR3-3 SH72 Srpings 0.20 (n=20) sativus var niger

Jackson Springs – Capsicum annuum - S. SHP SH2* Jackson Springs 0.55 (n= 52) cerealae

Table 2.2. Primers designed in this study that were used in qRT-PCR reactions. The elongation factor 1 alpha (EF1A) primers were used as a reference sequence in T. tabaci. TSWVL primers were the target L RNA sequence for TSWV, and the Emilia_5.8S primers were the reference sequence for Emilia sonchifolia. Primer Name Sequence (5'-3') EF1A_346F CGTCAAGGAACTTCGTCGTG EF1A_456R CACAGGGGTGTATCCGTTG TSWVL_4382F GCATGAAYTGGTTRCAAGGC TSWVL_4493R CAGAGTGCACAATCCATCTAG Emilia_5.8S_rRNAF GTGTGAATTGCAGAATCCCGT Emilia_5.8S_rRNAR CATGTGACGCCCAGGCA

Table 2.3. Average Ct values for the E. sonchifolia leaf tissue and T. tabaci individuals. 1 E. sonchifolia Ct Values T. tabaci Ct Values TSWV Thrips TSWV-L Emilia 5.8S TSWV-L Thrips Isolate Isoline RNA rRNA RNA EF1A AM1 IPOC1* 14.7 ± 0.1 12.2 ± 0.1 30.5 ± 0.5 21.3 ± 0.1 AM1 Kin1 14.5 ± 0.0 12.3 ± 0.1 25.3 ± 0.2 20.8 ± 0.1 AM1 SH2 14.9 ± 0.1 12.5 ± 0.1 29.6 ± 0.2 19.6 ± 0.1 AM1 SH72 16.1 ± 0.3 12.6 ± 0.1 31.2 ± 0.3 18.9 ± 0.2 SH3 IPOC1 14.6 ± 0.2 11.7 ± 0.1 27.3 ± 0.3 20.6 ± 0.1 SH3 Kin1 12.6 ± 0.1 11.9 ± 0.2 34.2 ± 0.2 21.7 ± 0.3 SH3 SH2* 14.4 ± 0.2 12.0 ± 0.1 35.8 ± 0.7 18.1 ± 0.0 SR3-3 IPOC1* 15.2 ± 0.4 12.4 ± 0.1 30.0 ± 0.2 22.7 ± 0.1 SR3-3 Kin1 13.0 ± 0.4 11.8 ± 0.1 31.4 ± 0.2 21.2 ± 0.1 SR3-3 SH2 14.1 ± 0.2 10.9 ± 0.2 27.0 ± 0.2 22.5 ± 0.2 SR3-3 SH72 15.0 ± 0.0 12.5 ± 0.1 27.1 ± 0.3 24.2 ± 0.1 SHP SH2* 12.7 ± 0.1 12.4 ± 0.1 25.7 ± 0.3 20.9 ± 0.1 1Values within columns are not significantly different (P>0.05): Data for each observation in Table S5. *TSWV isolate and thrips isoline pairings that are designated as sympatric

Table 2.4. Effects of thrips isoline and TSWV Isolate on mean probability of transmission after accounting for effects of TSWV titer in the vector.

Probability of Transmission Main effect (SE)

Thrips Isoline

Kin1 0.2293 (0.0091) A

IPOC1 0.2169 (0.0113) AB

SH2 0.2089 (0.0058) BC

SH72 0.1818 (0.0153) C

TSWV Isolate

AM1 0.1908 (0.0046) A

Hwy55 0.0766 (0.0037) B

SH3 0.1698 (0.0177) B

SHP 0.5474 (0.0129) C

Mean separation within thrips isoline and within TSWV isolate by LS Means (log odds transmission) at α=0.05

Figure 2.1. Log10 mean relative abundance ratio of L RNA in E. sonchifolia source leaf tissue for all virus isolate-thrips isoline pairings. No significant differences in titer were found between any of the virus isolates-thrips isoline pairings (F=0.25; df=11,12; P=0.9853). Error bars = standard error of mean.

Figure 2.2. Average log10 relative abundance ratio of L RNA across each virus isolate in thrips. Virus titer is displayed as the log10 of the normalized abundance ratio. The main effect of virus isolate on titer is significant (F = 8.6; df = 3, 93; P < 0.0001).. Error bars = standard error of mean.

Figure 2.3. Mean log10 relative abundance ratio of L RNA in each thrips isofemale line. The main effect of thrips isoline is not significant (F = 2.3; df = 3, 93; P = 0.0820). Error bars = standard error of mean.

Figure 2.4. Mean log10 relative abundance ratio of LRNA for all TSWV isolate – thrips isoline combinationsTSWV isolate by thrips isoline interaction is highly significant (F = 6.12; df =5, 93; P < 0.001) indicating that the effect of TSWV isolate on virus titer in the thrips vector depends on the thrips isoline. Error bars = standard error of mean.

Figure 2.5. Mean log10 relative abundance ratio of L RNA in sympatric and allopatric TSWV isolate – thrips isoline pairings. The main effect of location on titer is significant (F = 14.05; df =1, 94; P = 0.0002), indicating allopatric pairings have higher virus titers on average than sympatric pairings. Error bars = standard error of mean.

Figure 2.6. Mean log10 relative abundance ratio of LRNA in transmitting thrips and nontransmitting thrips. The main effect of transmission on titer is significant (F = 11.23; df = 1,100; P = 0.0011), indicating that on average transmitting T. tabaci have higher titers than non- transmitting T. tabaci. Error bars = standard error of mean.

Chapter 3

Population genetic analysis of Tomato spotted wilt virus within its vector T. tabaci and plant

host E. sonchifolia

Jessica A. Brown1, Alana L. Jacobson2, Tim L. Sit1, Ignazio Carbone1, and George G. Kennedy1

Auburn, AL, 36849, USA

Abstract

Tomato spotted wilt virus (TSWV) is a widespread plant virus has a tripartite, ambisense, single- stranded RNA genome transmitted by numerous thrips species. T. tabaci is an important vector but can vary in its ability to transmit different TSWV isolates compared to other thrips species.

There have been no studies investigating TSWV population genetics within any thrips vectors or differences between plant hosts and thrips vectors. Here we report the first study to compare

TSWV population genetics between T. tabaci and plant hosts. We sequenced the entire TSWV genome from several North Carolina isolates using next-generation sequencing of virus from T. tabaci, and the leaf discs from which they fed, as well as, TSWV isolates that had been serially transmitted by different vector species Here we identified evolutionary forces (mutation, recombination and purfying selection), genome diversity, and mutations that may influence transmission of TSWV. The variant analysis found most mutations occur in the NSs and GnGc coding regions. We found that plant hosts are stronger bottlenecks that greatly purge genetic diversity that was increased during acquisition and dissemenation in T. tabaci. We also found a unique 12 nucleotide insertion in the NSs that is only present in sequences originating from plant hosts that may have implications for avoidance from RNAi defenses. These findings shed light on the interactions between TSWV, its thirps vectors, and plant hosts that have been difficult to elucidate.

Introduction

Many arboviruses are RNA viruses that are transmitted by insect species in many different taxonomic orders. RNA viruses exist as quasispecies, which are heterogeneous populations of highly similar genomes or mutant swarms. They have high genetic variability due to their high mutation rates, short generation times, high replication rates, error-prone replication, and large population size, which allowsfor greater adaptability and rapid evolution (Steinhauer and Holland, 1987). Under these conditions, genetic variants are produced constantly and in each infected host, the virus population displays a high degree of genetic diversity (Beerenwinkel et al., 2012). These viruses have complex transmission cycles, encounter many different environments, and evolutionary pressures as they move between hosts and vectors.

Plant RNA viruses obligately cycle between their plant hosts and insect vectors ,which imposes special selective constraints and shapes their evolution. In evolutionary biology, a bottleneck is a stochastic event that decreases the number of viable replicating organisms in a population to a much smaller number (Forrester et al., 2014). According to Muller’s Ratchet, asexual populations that periodically undergo population bottlenecks should tend to accumulate deleterious mutations unless sex or recombination occurs to restore the wild-type or master sequence (Muller, 1964). This would mean viral populations should regularly go extinct or recover to a larger effective population size; either way the genetic diversity should be reduced

(Li and Roossinck, 2004). Even though in theory the latter should occur, there is little to no evidence that bottlenecks affect fitness or even genetic stability in experimental settings or in nature (Elena et al., 1996; Yuste et al., 1999; Yuste et al., 2000; Weaver et al., 1999; Domingo et al., 2005).

Tomato spotted wilt virus (TSWV) (Bunyavirales: Tospoviridae) is a tripartite, single- stranded, negative-sense RNA virus that is transmitted by multiple thrips species worldwide.

TSWV infects over 1000 plant species including important crop and ornamental species and is responsible for millions of dollars in crop losses every year (Rotenberg et al., 2015). TSWV is transmitted by its thrips vectors in a persistent-propagative manner. Acquisition and transmission of TSWV is developmental-stage dependent; thrips larvae are the only life stage capable of acquiring TSWV that results in transmission at the adult stage. During this process TSWV crosses multiple anatomical barriers starting with the midgut, then the circular and longitudinal muscles surrounding the midgut, the tubular salivary glands and finally the efferent duct that leads from the principal salivary glands to the salivary reservoir (Montero-Astúa et al., 2016).

From there TSWV is secreted in the saliva during feeding into plant mesophyll cells.

The TSWV genome is comprised of the large (L), medium (M) and small (S) RNA. The

L RNA is 8897 nucleotides (nt) and of complete negative polarity. It contains one large open reading frame (ORF) in the viral complementary (vc) strand, coding for a 331.5 kDa protein (De

Haan et al., 1991), the RNA dependent RNA polymerase. The M RNA is 4821 nt and of ambisense polarity, containing two nonoverlapping ORFs, in the viral (v)-strand coding for a nonstructural protein (NSm) of 33.6 kDa, the movement protein, and in the vc-strand encoding the glycoproteins (Gn and Gc) precursor of 127.4 kDa (Kormelink et al., 1992, 1994; Storms et al., 1995). The S RNA is 2918 nt and is also of ambisense polarity, encoding a nonstructural protein (NSs) of 52.1 kDa in the v-strand that acts as a suppressor of silencing, and the nucleoprotein (N) of 28.9 kDa in the vc-strand (Bucher et al., 2003; De Haan, et al., 1990;

Takeda et al., 2002).

Previous studies have investigated the genetic structure and molecular variability of TSWV isolates in the United States, Europe, and other countries (Tsompana et al., 2004; Kaye et al.,

2011; Tentchev et al., 2011). These studies examined a partial genome and used isolates from plant tissue only. Tsompana et al. (2004) examined the NSs, N, NSm, and GnGc; Kaye et al.

(2011) examined the N, NSm, and RdRp; Tentchev et al. (2011) examined NSs, N, partial L and

M RNAs. They found geographic structuring of isolates, except in Kaye et al. (2011) which predominantly looked at isolates from North Carolina (NC) and Virginia. All of these studies found mutation and purifying selection as the dominant evolutionary forces, even though viruses exhibited high genetic diversity, high haplotype diversity, recombination, and reassortment. The present study uses NC TSWV isolates from two different transmission studies to understand the evolution and selection pressures both the thrips and plant hosts exert on the virus. The first study (Jacobson & Kennedy, 2013) examined transmission of 89 TSWV iosolate-T. tabaci isofemale line pairings originating from various locations in NC, showing a significant effect of virus isolate, thrips isofemale line, and their interaction underlying transmission efficiency. The second study involved serial transmission of NC TSWV isolates by F. occidentalis, F. fusca, and

T. tabaci to investigate whether the transmission phenotypes of thsese vector species to transmit field collected isolates change after serial passages of the isolate by a single vector species and whether the genotypes of these field collected isolates change in response to serial passages of the isolate by a single vector species.

The present study uses whole genome next-generation sequencing of TSWV from thrips of the virus isolate-T. tabaci isofemale line pairings and the E. sonchifolia source leaves from which the thrips acquired the virus, and the E. sonchifolia leaves from the serial transmission experiments post-transmission from thrips. We used population genetic analyses of the

sequencing data to investigate genetic differences in TSWV between 1) thrips and plants, 2) the virus isolate-thrips isoline pairings, 3) non-transmitting and transmitting thrips, 4) allopatric and sympatric pairings, 5) thrips with high titer and thrips with low titer, 6) transmission by different thrips species. Our goal is to understand what evolutionary changes these isolates are undergoing that could impact transmission from T. tabaci.

Materials and Methods

T. tabaci and TSWV from the virus isolate-T.tabaci isofemale line pairings:

Collecting, culturing and transmission assays. T. tabaci individuals and TSWV isolates were collected from three locations in North Carolina from different cultivated plant hosts in 2010

(Table 1). Details of collection, establishment of clonal isofemale thrips isolines, TSWV isolate establishment, transmission experiments, and results from transmission assays are described in

Jacobson and Kennedy (2013). Because transmission experiments were conducted using single thrips, thrips were classified as transmitting if the Emilia sonchifolia leaf disc they were allowed to feed on tested positive for TSWV or non-transmitting if the leaf disc did not test positive with

DAS-ELISA (these leaf discs were no longer available for the experiments reported here).

Samples of transmitting thrips, nontransmitting thrips, and young symptomatic leaf tissue from source plants used for acquisition of TSWV were flash frozen and stored at -80°C until used in the experiments reported here. A total of 12 isolate-isoline combinations were chosen for these experiments (Table 1) because they were a representative subset of the varying transmission efficiencies observed in the total 89 isolate-isoline combinations (Jacobson and Kennedy,

2013). These samples are labelled with the Virus isolate used first, followed by the thrips isoline, and whether they were nontransmitting (NT) or transmitting (T). Some samples have the addition of high or low meaning they had high or low virus titer from RT-qPCR results.

Serial transmission by different vector species information. Four TSWV isolates originally field collected from tobacco were mechanically inoculated into E. sonchifolia plants in the laboratory. Three lines of each isolate were then established: one that was transmitted exclusively with F. fusca, one that was transmitted exclusively with F. occidentalis, and one that was transmitted exclusively with thelytokous T. tabaci. Serial transmission of these lines was conducted by infesting approximately eight week old TSWV infected E. sonchifolia plants with 1st instar thrips, which allowed the offspring to acquire the virus and develop to adults on these plants. These adults, were collected by harvesting foliage and drying it down at room temperature in plastic containers that contained a thrips-proof screen at both ends to ensure proper ventilation and cabbage as a food source. Groups of five adult females of mixed age were confined on two-week old E. sonchifolia seedlings for 72 hours and then sprayed with spinosad (Tracer®, Dow AgroSciences, Indianapolis, IN), to kill the adults and their offspring. Plants were held under grow lights in the laboratory for two to three weeks until infected plants developed symptoms and could be visually identified as infected. Infected plants were then transplanted into three-gallon pots and held in cages with thrips-proof screen in the greenhouse until they were large enough to infest with thrips; the next round of transmission was then initiated. Each line was maintained until no longer transmissible (5-8 serial transmissions) by each respective vector species. TSWV infected plant material from each round was collected

4-6 weeks after inoculation (before thrips infestation for the next transmission round), and stored at -80°C.

Thrips and Leaf Disc RNA Extraction. Total RNA was extracted from 105 individual

T. tabaci using TRIzol™ reagent (ThermoFisher Scientific, Waltham, MA) following the protocol of by Mason et al. (2003) with some modifications. For homogenization, each

individual T. tabaci was placed in a 1.5 ml microfuge tube, flash frozen in liquid N2, and then homogenized with a motorized micropestle (Kimble Chase, Vineland, NJ) followed by the addition of TRIzol™. All incubation steps were at room temperature and all centrifugation steps were done at 16,000 x g. The pellets were air dried for 15 minutes instead of vacuum concentrated and resuspended in 8 µl DEPC treated water (Amresco, Solon, OH).

The E. sonchifolia source leaf tissue (20 mg) from the virus isolate-thrips isoline pairings experiment (table 3.1) and leaves (100 mg) from the serial transmission experiment were extracted with TRIzol™ using the manufacturer’s protocol. Homogenization was done using three Pyrex solid glass beads (3 mm; Corning, Corning, NY) in a 1.5 ml tube containing leaf tissue, flash frozen in liquid N2, and shaken for 20 seconds in a Silamat S6 mixer (Ivoclar

Vivadent, Amherst, NY). Total RNA was resuspended in 50 µl of dH2O.

T. tabaci Next-generation sequencing. The TSWV genome was sequenced using

Illumina® Nextseq® 500 platform with 75 bp paired-end reads. 21 pooled samples of total RNA originating from 66 individual adult T. tabaci (Table 3.3) were library prepped using the

Ovation® Fusion Panel Target Enrichment System V2 (NuGEN, San Carlos, CA) and the

Ovation® cDNA Module for Target Enrichment. Final library concentration was determined by the New England Biolabs NEBNext® Library Quant Kit for Illumina® (NEB, Ipswich, MA).

Not all of the virus isolate-thrips isoline pairings are represented in the pooled samples due to sequencing space constraints. The individual T. tabaci had to be pooled due to the low amounts of total RNA. Pooled samples contain only total RNA from individuals of the same virus isolate- thrips isoline pairing. There are pooled individuals for transmitting (T) and nontransmitting (NT) samples for each pairing. Based on real-time qPCR results (Brown et al., manuscript in

preparation), some samples were pooled by high or low titers to test for variances that may influence differences in those titers.

E. sonchifolia Next-generation sequencing. The TSWV genome was sequenced using

Illumina® Miseq® platform with 250 bp paired-end reads for source leaf tissue from all 12

TSWV isolate-thrips isoline pairings. cDNA synthesis was required to convert total RNA to the

DNA template required for RT-PCR. First strand cDNA was synthesized from total RNA using

Protoscript® II reverse transcriptase (NEB). cDNA was synthesized using 1 µg of total RNA in a

20 µl reaction primed with the reverse primer (10 µM) for each pair (Table 3.4. All primers

(Table 3.4) were purchased from Eurofins Genomics (Louisville, KY) and designed by analyzing

TSWV genomic alignments in Vector NTI (Life Technologies, Carlsbad, CA). The primers, 1 µl dNTP mix (10 mM), total RNA and dH2O to a final volume of 12 µl were combined and heated at 70°C for 5 minutes and chilled immediately on ice. The remaining reagents were added

[Protoscript reaction buffer, DTT (10 mM final), Murine RNase inhibitor (2U/µl final) and 1 µl

Protoscript® II reverse transcriptase (20U/µl)] and incubated at 42°C for 1 hour. The enzyme was inactivated at 80°C for 5 minutes and stored at -20°C. All genome segments were then PCR amplified from source leaf tissue total RNA using OneTaq® 2x master mix with standard buffer

(NEB). OneTaq PCR reactions had the following conditions: 1X OneTaq® 2x master mix with standard buffer (NEB), 10 µM forward primer, 10 µM reverse primer, and 1 µg or less of template DNA. Thermal cycling conditions were initial denaturation at 94°C for 5 minutes; 40 cycles of 94°C for 30 seconds, 50-60°C for 30 seconds, 68°C (S RNA: 3:15, M RNA: 5.15, L

RNA: 5:00); final extension for 68°C 5:00 minutes. All PCR reactions were performed on a Bio-

Rad C1000 Touch thermal cycler (Hercules, CA). The S and M RNAs were amplified as whole segments but the L RNA had to be amplified in two halves, primers can be found in table 3.4.

Samples were library prepped using the Illumina® Truseq® Nano DNA sample prep LS protocol. DNA was fragmented using a Covaris® S2 focused-ultrasonicator (Woburn, MA) with the Illumina® guidelines for a 550 bp insert size. Final library concentration was measured using

Agilent 2100 bioanalyzer (Santa Clara, CA). There were no technical replicates for this experiment, due to the constraints of sequencing space and the cost of library preparation and sequencing.

Population Statistics. The sequencing reads for all samples were aligned to a reference genome (S RNA: NC_002051.1; M RNA: NC_002050.1; L RNA: NC_002052.1) using CLC genomics workbench (Qiagen, Germantown, MD) RNA-Seq Analysis. Consensus nucleotide sequences for the NSs, N, NSm, Gn, Gc, GnGc, and RdRp were extracted, translated for amino acid analyses, and aligned in using CLC genomics workbench. Nucleotide alignments of all genes were analyzed using DnaSP Version 6.11.01 (Rozas et al., 2017) to estimate average pairwise nucleotide diversity (π) (Tajima, 1983), number of segregating sites (s) (Nei, 1987), average number of pairwise nucleotide differences (k) (Tajima, 1983), the number of haplotypes

(h), and haplotype diversity (hd). This program was also used to estimate the coefficient of gene differentiation, FST, for all encoded viral genes. To examine selection acting on proteins, neutrality tests were performed using with Tajima’s D (Tajima, 1989) and Fu and Li’s D* and F*

(1993) and Fu’s Fs (Fu, 1997) implemented in Neutrality Test Release 1.1

(http://www.picb.ac.cn/evolgen/softwares/). Statistical significance of the neutrality tests were determined using 1000 permutation tests. dN, dS, and dN/dS ratio were calculated using SNAP version 2.1.1 (Korber, 2000, www.hiv.lanl.gov).

Mutation, Reassortment and Recombination in TSWV populations. Phylogenetic congruence was used to examine the contributions of mutation, genetic reassortment and

recombination in the evolution of TSWV. The mutation and recombination history of each ancestral node in the reconstructed TSWV phylogeny was examined using the Hypha package module of Mesquite v3.51 (Maddison & Maddison 2011; Oliver et al. 2013). Hypha compared the internodal support values from each virus locus phylogeny (Gn, Gc, RdRp, N, NSm, and

NSs) on the total evidence tree inferred from a concatenated SNP matrix of the six loci. Nodal grid support values were based on a bootstrap threshold support value of 70% and were output as node annotations on the total evidence tree. Support values for each locus phylogeny were visualized in T-BAS v2.0 (Carbone et al. 2017) using grids on branches of the total evidence tree with colors showing node bipartitions that were supported at a bootstrap support value ≥70%

(black color) or <70% (white color); a node bipartition not found in the total evidence tree was reported as missing or inapplicable (grey color). Grids that were filled in with mostly black squares indicated mutation as a major driving force in the evolution of descendants of that node.

High conflict (red color) was used to indicate a node bipartition in the locus tree that conflicted with the total evidence tree at a bootstrap support value ≥70%, most likely due to recombination

(i.e. reassortment and crossovers) among isolates in descendant branches. Low conflict (cyan color) was used for nodes that were not recovered by the bootstrap analysis because there was either insufficient variation or too much confounding variation (i.e. homoplasy) due to extensive recombination.

Variant Analysis. The variant calling analysis was done using CLC Genomics

Workbench. Variants were called from mapped reads starting with the Basic Variant Detection tool followed by filtering low quality variant calls using the Marginal Variant Calls tool in CLC genomics with default settings of minimum frequency 2%, minimum forward/reverse balance

0.05, and minimum average base quality 20. The types of variants called included single

nucleotide variants (SNVs), multiple nucleotide variants (MNVs), replacements, insertions, and deletions. The variant files for all 48 samples were compared to observe unique and shared variants between the 3 sets of samples.

Results

Phylogenetic analysis reveals limited amount of structuring between isolates and extensive recombination. A phylogenetic tree was constructed for the coding regions of the Gn,

Gc, RdRp, N, NSm, and NSs using amino acid alignments of all 48 samples total from both experiments (Fig. 3.1). The TSWV sequences from thrips diverged rapidly away from the plant samples in both experiments, mostly through recombination occurring in the Gn and Gc regions.

The isolates SH3 Ipoc1 NT low and SH3 SH2 T were the only samples with a most recent ancestor having recombination the NSs. The virus isolate-T.tabaci isoline source leaves and serial transmission TSWV isolates evolved together into several clades. Noteably, the Parker and

Kin-2009 TTAB R5 serial transmitted isolates that lost transmissibility and Kin-2009 TTAB R1 evolved together and had recombination in the Gn, Gc, and RdRp, and are the only isolates that evolved in such a manner. The clade containing all Kin-3 isolates, except for Kin-3 Ffus R4 which grouped with SR3 TTAB R4, and SHP SH2 Plant, evolved through recombination and mutation acting on the GnGc, and RdRp. AM1 Kin1 Plant, SH3 SH2 Plant, and SH3 Ipoc1 Plant evolved through mutation alone on the Gn, Gc, and RdRp. A clade consisting of SR3 isolates from both experiments and Kin-2009 Ffus R5 evolved from recombination in the Gc, and mutation in the RdRp. The last clade Containing SR3 Ffus R5, AM1 TTAB R4, Kin-3 Ffus R4, and AM1 Focc R8, AM1 SH72 Plant, AM1 SH2 Plant, SH3 Kin1 Plant, and AM1 Ipoc1 Plant all evolved from recombination occurring only in the RdRp.

Genetic diversity and selection acting on TSWV genes. The population summary statistics performed on all encoded proteins of the TSWV genome for virus samples from both experiments can be found in table 3.5. Estimates of nucleotide diversity can range from zero when no variation exists to 0.100 under cases of extreme divergence between alleles (Kaye et al.,

2011). The observed nucleotide diversity for virus samples from thrips ranged from 0.016-0.11, for samples from source plants 0.0070-0.011, and for transmission experiment 0.008-0.014. The genetic diversity analysis found TSWV sequences from thrips have increased diversity for all population statistics on all encoded genes compared to both sets of plant sequences. The virus isolate-thrips isoline pairing source leaves and serial transmitted isolates are very similar in genetic diversity; although overall, the serial transmitted isolates have slightly higher amounts of diversity than the virus isolate-thrips isoline source leaves.

Our haplotype analysis measured the number of haplotypes (h) and their diversity (Hd).

Hd can range from zero, meaning no diversity, to 1 meaning high levels of diversity. Hd ranged from 0.818- 1.000 indicating high diversity for each locus in virus sequences from both plants and thrips. Overall thrips sequences exhibited the maximum possible number of haplotypes with each of the 21 different isolates containing a different haplotype for each locus except for N, which had 19. Virus from the 12 virus isolate-thirps isoline source leaves on the other had collapsed into fewer haplotypes (range: 5-8) except for the RdRp where all isolates contain a different haplotype, which may be due to the larger number of nucleotides contributing the number of haplotypes compared to the other genes. The 15 serially transmitted isolates had 15 individual haplotypes for the GnGc and the RdRp and with a clustering of haplotypes ranging from 9-13 for the other genes.

Nonsynonymous/synonymous codon substitution (dN/dS) ratios quantify selection pressures by comparing the rate of substitutions at silent sites (dS) to the rate of substitutions at non-silent sites (dN) (Kryazhimskiy & Plotkin, 2008). A ratio greater than one indicates positive selection (adaptive or diversifying), a ratio equal to 1 indicates neutral evolution, and a ratio less than one indicates negative (purifying) selection. The dN/dS ratio for thrips ranged from 0.536-

1.095, for source plants it ranged from 0.038-1.011, and for serially transmitted isolates it ranged from 0.061-3.019. The only genes with evidence for positive selection were the NSs (1.095) for the thrips sequences, the N (1.011) for the source plant sequences, and Gn (3.019) and Gc

(2.069) for the serially transmitted isolates. For each gene there were more nonsynonymous mutations in TSWV sequences from thrips compared to TSWV sequences from plants in both experiments, and more synonymous mutations in thrips compared to plants in both experiments with the exception of the NSs, which was 0.03 for both sets of plant samples and 0.01 for thrips samples.

To examine the evolutionary forces acting on TSWV, four neutrality test statistics

(Tajima’s D, Fu and Li’s D* and F*, Fu’s Fs) were used in this study to examine the sequence data for departure from neutrality, all values can be found in table 3.6. Negative values for these tests indicate an excess of low frequency polymorphism caused by either background selection,

genetic hitchhiking, or population expansions. Positive values represent low frequency polymorphis, balancing selection, or population contraction. The only significant tests was Fu’s

Fs for the thrips TSWV sequences N gene (-12.207; P<0.05) and the Gn of the serial transmission TSWV sequences (-3.509; P<0.05) meaning deviation from neutral equilibrium is due to negative selection against deleterious mutations.

The fixation index (FST) is a measure of population differentiation due to genetic structure (Weir

& Cockerharm, 1984). It is frequently estimated from genetic polymorphism data, such as single- nucleotide polymorphisms (SNP). Wright's definition illustrates that FST measures the amount of genetic variance that can be explained by population structure (Wright, 1951). The values range from 0 to 1. A zero value implies complete panmixis; that is, that the two populations are interbreeding freely. A value of one implies that all genetic variation is explained by the population structure, and that the two populations do not share any genetic diversity. The serially transmitted isolates and virus isolate-thrips isoline pairing source leaves are both very close to zero when compared (-0.0026-0.055) meaning their population structure is very similar. The thrips TSWV sequences compared to plant sequences from both experiments results in much higher Fst values and are equivalent in both comparisons. The N had the lowest value of differention of 0.19 and Gn at the highest of 0.44, meaning the thrips TSWV sequences do not share much genetic diversity and are highly different from sequences origination from plants

(Table 3.7).

Widespread polymorphism found throughout the genome. Most of the virus isolate- thrips isoline combinations originating from thrips had variable amounts of unique SNPs in most or all of the genes (Table 3.8), while source plant TSWV sequences has much less (Table 3.9).

Plant samples from both experiments were found to have a 12-nucleotide insertion

(AAGCTTTTGTCA) in the NSs (Fig. 3.2) that occurs in between nucleotides 788-789.

AAGCTTTTGTCA is present in all plant samples except SHP SH2, which has one synonymous nucleotide change resulting in AAGCGTTTGTCA. This causes the amino acid change

Ala235_Ser236insPheValLysAla and is absent from the reference sequence (Isolate TSWV

CPNH9) and mostly absent from thrips sequences. Thrips sample AM1 Ipoc1 T Low has an

insertion that is not the exact same (AATGGATTAACA). The insertion was also found in other published TSWV sequences originating from plants (Genbank accession numbers: DQ915948.1,

DQ915946.1, DQ431237.1, AY870392.1, KT717693.1, MG602673.1, KT160282.1, MF805764,

AB643674.1, MG025804.1, AB643673.1, HE600702.1, FR693044.1), as well as the tospoviruses Groundnut ringspot virus and Melon severe mosaic virus (Genbank accession numbers: KT972593.1, NC_033832.1). The NSs insertion could have important implications for responses to plant RNA silencing.

For both thrips and plant TSWV sequences, the majority of the S RNA variants were found in the NSs, the majority of M RNA variants were in the GnGc, Gn and Gc coding regions, and numerous variants throughout the RdRp. Interestingly when analyzing the virus isolate- thrips isoline pairing source leaves TSWV sequences alone, we observed the SHP SH2 plant sequence reads had the most unique SNVs in the genome compared to all other plant sequences and it had the highest transmission efficiency (55%) in Jacobson and Kennedy (2013). In contrast, the low transmission efficiency (6%) SR3 SH2, had the second most unique variants except in the L RNA where it had more than SHP SH2. There were also SNVs and other types of variants that all plant samples except for SHP SH2 carried in all RNAs, while SR3 SH2 lacked common variants only in the L RNA (Supplemental table 3.3). Perhaps the SHP SH2 combination of unique and absent variants allows for the increased transmissibility and SR3 SH2 mutations in the L RNA may decrease transmissibility.

There were no variants consistently in common for nontransmitting or transmitting thrips samples and no variants that consistently associated withsympatric or allopatric pairings. There also did not appear to be a distinct genetic link between samples with high titers or samples with low titers. The virus isolate-thrips isoline pairings in plants had fewer polymorphisms than the

sequences in thrips. Plant pairings also associated by virus isolate for a number of variants in all

RNA segments (Supplemental table 3.2), which is not surprising because these isolates have not yet been influenced by the thrips isofemale line, meaning these are basically different samples of the same initial virus isolate at this point. In general, virus isolate-thrips isoline pairings from thrips associated by virus isolate for numerous variants, but some pairs or groups of samples would share variants consistently across virus isolates or thrips isolines (Supplemental tables 3.4-

3.6).

The variant patterns of serially transmitted isolates coincide with their clades in the phylogenetic analysis. Kin-2009 Ffus R5 has no variants in common with the other Kin-2009 isolates for all genes but shares variants with SR3 field col and SR3 Focc R5. All Kin-3 isolates share unique variants across the genome except for Kin-3 Ffus R4. Kin-3 Ffus R4, AM1 Ffus

R8, AM1 TTAB R4, AM1 Focc R8, and SR3 Ffus R5 all have numerous variants in common throughout the M and L RNAs (Supplemental tables 3.10 & 3.12). Parker and Kin-2009 TTAB

R5 were the two samples that lost transmission and they have a lot of similarities in variants. The

Parker and Kin-2009 TTAB R5 samples lacked variants that were found in all other samples for the nucleocapsid, NSm, GnGc, and RdRp. Kin-2009 TTAB R1, Kin-2009 TTAB R5, and Parker are missing 3 variants in the S RNA at 607 (G to A), 2464 (G to A), 2563 (A to G)

(Supplemental table 3.7). Parker, Kin-2009 TTAB R5 and Kin-2009 TTAB R1 in the S RNA share 4 SNVs at 235, 1195, 1919, and 2647. For the M RNA, Kin-2009 TTAB R1, Kin-2009

TTAB R5 and SR3 TTAB R4 shared 13 SNVs, 1 MNV, and 1 insertion (Supplemental table

3.10) while missing 3 SNVs in the GnGc (Supplemental table 3.9). Kin-2009 TTAB R5 and Kin-

2009 TTAB R1 share 25 unique variants in the M RNA but neither of these samples shares variants with Parker. In the L RNA, Parker and Kin-2009 TTAB R5 had 34 SNVs in common

ranging from nucleotides 117-8752. Both previous isolates lacked an SNV at 1281 (T to C) in the L RNA (Supplemental table 3.11).

Discussion

To our knowledge, this is the first study to use next-generation sequencing to examine

TSWV sequence diversity from both thrips and the plant tissues from which they acquired the virus, and to use all five TSWV genes in a population genetics study.The objective of this study was to identify genetic differences among 4 TSWV isolates that varied in transmission rate by 4 different T. tabaci isolines. By sequencing virus samples taken from the plants from which the thrips acquired the virus and from the thrips used to test transmission, we were able to compare sequence diversity of virus populations of the same isolates in their plant host and in their thrips vectors following acquisition for the infected plant host. We were also able to examine whether there are consistent patterns of diversity across different T. tabaci isolines, whether there were specific patterns of sequence diversity associated with differences in virus titers (high vs low) within thrips and whether patterns of diversity were associated with successful virus transmission by thrips, as well as between thrips isolines and virus isolates collected from the same or different locatons (aympatric vs allopatric). We also sequenced TSWV from a serial passaging experiment using F. occientalis, F. fusca, and T. tabaci to reapeatedly transmit various TSWV isolates to E. sonchifolia leaves, which provides us the ability to investigate phylogenetic relationships of the isolates and assess whether TSWV isolates respond similarly to selection with a single vector species and to look for genetic changes associated with transmission by the different vector species. The serially transmitted isolates were also collected post-feeding, allowing us to compare those TSWV sequences to the pre-feeding sequences from the pairing experiment. It was expected the TSWV sequences from thrips would show less diversity due to

the anatomical bottlenecks encountered during movement through various thrips tissues, but this was not the case. Instead, we found TSWV sequences of virus from plants converge towards one genotype whereas viral sequences from thrips that acquired virus from these plants diverge away from this genotype for the whole genome, indicating strong purifying selection pressure by plant hosts on the virus.

Nucleotide diversity, the number of segregating sites, and haplotype diversity together show the variability that occurs within and between plant hosts and vectors. All TSWV sequences originating from E. sonchifolia had lower nucleotide diversity in all genes, fewer segregating sites and pairwise differences than TSWV sequences from thrips. Haplotype diversity was high in all samples, but thrips TSWV sequences had higher haplotype diversity in most cases except in the RdRp, where they both equal 1. The overall range of π of virus sampled from virus isolate-T. tabaci isoline source leaves (0.0070-0.011) is lower than that observed in

TSWV from plants by Tsompana et al. (2004) but similar to the results of Kaye et al. (2011).

These findings are not surprising since Kaye et al. (2011) compared isolates found in North

Carolina and Virginia while Tsomapana et al. (2004) compared isolates from multiple states in the U.S. and Europe, which may contribute to the higher diversity. The high haplotype diversity is consistent with previous studies of TSWV and should be expected given its quasispecies nature. During the transmission cycle TSWV goes through several anatomical bottlenecks, mainly the midgut, circular and longitudinal midgut muscles, tubular salivary glands and principal salivary glands (Monetero-Astúa et al., 2016) but genetic diversity is highest in the thrips vectors and constrained in the plant, suggesting plants serve as a stronger bottleneck.

Granted, we do not know the size and selectivity between these different bottlenecks especially in thrips where bottlenecks can differ between species and subspecies of the same vector.

The neutrality test statistics (Tajima’s D, Fu and Li’s D* and F*, Fu’s Fs) were used to examine the sequence data for departure from neutrality. The NSs, NSm, Gc, GnGc, and RdRp did not significantly vary from neutrality for all four tests. N from the thrips TSWV sequences and Gn from the serially transmitted isolates were significantly negative, deviating from neutrality for only Fu’s Fs; meaning there is purifying selection action on those genes. The nucleocapsid is a structural protein required for encapsidating the RNA segments; selection would have to act against any deleterious mutations that would possibly be detrimental to the virus. The Gn is a structural protein likely necessary for receptor-mediated endocytosis into thrips cells.

The dN/dS ratio provides more evidence for purifying selection on all viral genes except the N protein for the plant sequences, the NSs for the thrips sequences, and Gn, and Gc for serially transmitted isolates. Across all genes there were more nonsynonymous mutations in thrips compared to plants, and more synonymous mutations in thrips compared to plants with the exception of the NSs where dS for source leaves = 0.037, serially transmitted isolates = 0.036, and thrips = 0.014. Other studies have found evidence for strong purifying selection in TSWV sampled from plants (Tsompana et al., 2005; Kaye et al., 2011) and our results add to this evidence that plant hosts put intense selection pressure on TSWV. In other insect vectors, it is hypothesized, based on comparison of genetic diversity of West Nile Virus in whole bodies the vector Culex pipens to diversity of virus in the vector’s salivary secretion, that significant purging of diversity occurs during salivary gland infection (Ciota and Kramer, 2010; Jerzak et al., 2007; Ciota et al., 2009). It is thought that switching by viruses between two different hosts is accompanied by an evolutionary stasis that is caused by differential selective pressures between the hosts (Woolhouse et al., 2001; Scott et al., 1994; Ciota & Kramer, 2010). This means

mutations have opposing fitness effects in either host resulting in a situation in which sequence changes are more likely to be purged by purifying selection than in single host systems (Wright,

1931; Levens, 1968; Domingo & Holland, 1997). For the T.tabaci-TSWV pathosystem, this could mean the numerous TSWV polymorphisms observed in sequences originating from thrips would be purged upon transmission into plants and why there is less genetic diversity in plant sequences. Phylogenetic studies of arboviruses analyzing the proportion of nonsynonymous change over time demonstrate that purifying selection is generally the dominant selective force in arbovirus evolution (Woelk & Holmes, 2002; Holmes, 2003). One study with DENV-2 evaluated full genome sequences after sequential or alternate passage in mammalian and mosquito cell lines and found that it was not host cycling that lessened genetic change but replication in invertebrate cells (Vasilakis et al., 2009; Ciota & Kramer, 2010).

We expected stronger phylogenetic structuring based on sympatry since Jacobson &

Kennedy (2013) found evidence for local adaptation but our analyses did not reveal such structuring. There was, however, evidence for isolates emerging from mutation, recombination, and resassortment. The thrips TSWV sequences diverged exponentially from the plant TSWV sequences and is supported by the large amount of genetic diversity comparatively. TSWV sequences from source leaves for the virus isolate-T. tabaci isoline pairings and serially transmitted isolates associated into more specific clades. Noteably, the serially transmited isolates that lost transmission, Parker and Kin-2009 TTAB R5 clustered together along with Kin-

2009 TTAB R1 providing evidence for a genetic link to loss in transmissibility. Most of the mutation and recombination events occur in the Gn, Gc, and RdRp. The Gn and Gc have been considered putative determinants of transmission but research on the RdRp has been lacking

(Bandla et al., 1998; Sin et al., 2005; Whitfield et al., 2008; Montero-Astúa et al., 2014).

The NSs and GnGc proteins have been identified as determinants for transmission and resistance breaking (Bandla et al., 1998; Sin et al., 2005; Margaria et al., 2007; Whitfield et al.,

2008; Margaria, et al., 2014; Monetro-Astúa et al., 2014). In the variant analysis virus from plant samples have a 12-nucleotide insertion in the NSs that is absent from sequences of virus thrips.

This insertion is present in other published sequences including two other tospoviruses and may play a role in avoidance of plant RNAi (Ciota & Kramer, 2010). For both thrips and plant sequences, the majority of the S RNA variants were in the NSs and for the M RNA they were in the GnGc. Other studies have found evidence for positive selection on specific amino acids in the

NSs and GnGc proteins in vius samples from plants (Tsompana et al., 2004).

Experimental evolution studies have confirmed the hypothesis that RNAi targeting by the arthropod vector leads to diversification of arbovirus genomes (Attarzadeh-Yazdi et al., 2009;

Brackney et al., 2009; Brackney et al., 2015; Grubaugh et al., 2016). RNA silencing is the main antiviral defense in insects and plants, which can have direct consequences for virus intrahost evolution. Virus-derived small RNAs inhibit virus replication and translation by directly binding to complementary viral RNA. With the NSs, GnGc, and RdRp being the most diverse portions of the genome, they are also most likely to be targets of RNAi. It is known that the NSs suppresses silencing in plant hosts and is suspected in thrips but while there is no definite proof, TSWV infection does upregulate genes involved in this process (Medieros et al., 2004; Schneweis et al.,

2017; Shrestha et al., 2017). In a study using artificially diverse WNV strains, it was confirmed that high levels of intrahost genetic diversity was associated with increased fitness in their mosquito vector (Fitzpatrick et al., 2010). The generation and perpetuation of novel sequences of viral RNA may thus be beneficial for the virus within the vector because small RNAs will not match with perfect complementarity and this would also be beneficial in plant hosts.

It is important to note there were several limitations in sequencing from the thrips such as low total RNA input, no poly-A tails to select for, and inability to deplete rRNA due to the already low input amounts. The library prep kit used had probes specifically designed for TSWV to hybridize to the viral sequences and avoid sequencing the T. tabaci mRNA. While NGS sequencing has made it easier to sample viral populations, it has pitfalls especially with smaller samples. Due to the high heterogeneity of viruses, it might be disadvantageous to use virus- specific primers for amplification due to potential primer bias or even complete failure of amplification (Beerenwinkel et al., 2012). There were sequencing failures in some parts of the thrips sequences, especially in AT rich regions. These regions were filled in with the reference sequence.

Previous TSWV population genetics studies were limited to sequences from plant hosts and did not sequence all five viral genes, but they found large amounts of genetic diversity and evidence for purifying selection. Our study compared sequences from the thrips vector, T. tabaci, and from the plant host, E. sonchifolia, for all five TSWV genes, as well as serially transmitted

TSWV isolates passaged by F. occidentalis, F. fusca, and T. tabaci. The goal was to find a genetic link for TSWV transmission based on the TSWV isolate-thrips isolines. We found that plant hosts are stronger bottlenecks that greatly purge genetic diversity that was increased during acquisition and dissemenition in T. tabaci. We also found a unique 12 nucleotide insertion in the

NSs that is present only in sequences originating from plant hosts. This insertion may have implications for avoidance from RNAi defenses. A reverse genetics system would improve our ability to link variants with transmission phenotypes.

We found major differences in sequences between virus from plants and virus from thrips. If TSWV populations in thrips are indeed experiencing bottlenecks, in theory genetic

diversity should be reduced in the thrips. Instead, the TSWV genome in thrips greatly diversifies through mutation and recombination, and upon transmission into plants that diversity is lost most likely through selection for a specific genotype favored in plants and purifying selection against non-favored genotypes. It would have been useful to have pre-acquisition, post-aquistion, and post-transmission virus samples for the same isolates and compare across different vector species. Future research should include investigation of how thrips anatomical barriers to virus movement affects TSWV diversity. While we know a lot about the TSWV genome, we still do not know how it functions and interacts within its thrips vectors. We also know very little about thrips genomes and their responses to TSWV infection. Thrips and TSWV are important pests of crops all over the world, understanding how the genetic interactions that underlie TSWV diversity and vector competency could lead to improved and sustainable management strategies.

Acknowledgements

This work was supported by USDA NIFA Coordinated Agricultural Project Grant 2012-68004-

20166. Next-generation sequencing was done at the NCSU genomics sciences laboratory.

Literature Cited

Attarzadeh-Yazdi, G., Fragkoudis, R., Chi, Y., Siu, R.W.C., Ülper, L., Barry, G., Rodriguez-

Andres, J., Nash, A.A., Bouloy, M., Merits, A., Fazakerley, J.K., and Kohl, A. 2009. Cell-

to-cell spread of the RNA interference response suppresses Semliki Forest virus (SFV)

infection of mosquito cell cultures and cannot be antagonized by SFV. J. Virol. 83(11):

5735-5748.

Bandla, M. D., Campbell, L. R., Ullman, D. E., and Sherwood, J. L. 1998. Interaction of tomato

spotted wilt tospovirus (TSWV) glycoproteins with a thrips midgut protein, a potential

cellular receptor for TSWV. Phytopathol. 88(2): 98–104.

Beerenwinkel, N., Günthard, H.F., Roth, V., and Metzner, K.J. 2012 Challenges and

opportunities in estimating viral genetic diversity from next-generation sequencing data.

Front. Microbiol. 3: 329.

Boni, M.F., Posada, D., and Feldman, M.W. 2007. An exact nonparametric method for inferring

mosaic structure in sequence triplets. Genetics 176: 1035-1047.

Brackney, D.E., Beane, J.E., and Ebel, G.D. 2009. RNAi targeting of West Nile virus in

mosquito midguts promotes virus diversification. PLOS Pathogens 5(7): e1000502.

Brackney, D.E., Schirtzinger, E.E., Harrison, T.D., Ebel, G.D., and Hanley, K.A. 2015.

Modulation of flavivirus population diversity by RNA interference. J. Virol.

DOI: 10.1128/JVI.02612-14.

Bucher, E., Sijen, T., de Haan, P., Goldbach, R., and Prins, M. 2003. Negative-strand

tospoviruses and tenuiviruses carry a gene for a suppressor of gene silencing at analogous

genomic positions. J. Virol. 77: 1329-1336.

Carbone, I., White, J.B., Miadlikowska, J., Arnold, A.E., Miller, M.A., Kauff, F., U’Ren, J.M.,

May, G., and Lutzoni, F. 2017. T-BAS: tree-based alignment selector toolkit for

phylogenetic-based placement, alignment downloads, and metadata visualization: an

example with the Pezizomycotina tree of life. Bioinformatics 33(8): 1160-1168.

Ciota, A.T., Jia, Y., Payne A.F., Jerzak, G., Davis, L.J., Young, D.S., Ehrbar, D., and Kramer,

L.D. 2009. Experimental passage of St. Louis encephalitis virus in vivo in mosquitoes and

chickens reveals evolutionary significant virus characteristics. PLOS One 4(11): e7876.

Ciota, A.T. and Kramer, L.D. 2010. Insights into arbovirus evolution and adaptation from

experimental studies. Viruses 2: 2594-2617.

De Haan, P., Wagemakers, L., Peters, D., and Goldbach R. 1990. The S RNA segment of

Tomato spotted wilt virus has an ambisense character. J. Gen. Virol. 71: 1001-1008.

De Haan, P., Kormelink, R., Resende, D., van Poelwijk, F., Peters, D., and Goldback R. 1991.

Tomato spotted wilt virus L RNA encodes a putative RNA polymerase. J. Gen. Virol. 72:

2207-2216.

Domingo, E. and Holland J.J. 1997. RNA virus mutations and fitness for survival. Ann. Rev.

Microbiol. 51: 151-178.

Domingo, E., Escarmis, C., Lazaro, E., and Manrubia, S.C. 2005. Quasispecies dynamics and

RNA virus extinction. Virus Res. 107: 129-139.

Elena, S.F., Gonzalez-Candelas, F., Novella, I.S., Duate, E.A., Clarke, D.K., Domingo, E.,

Holland, J.J., and Moya, A. 1996. Evolution of fitness in experimental populations of

vesicular stomatitis virus. Genetics 142: 673-679.

Forrester, N.L., Coffey, L.L., and Weaver, S.C. 2014 Arboviral bottlenecks and challenges to

maintaining diversity and fitness during mosquito transmission. Viruses 6: 3991-4004.

Fu, Y.X. and Li, W.H. 1993. Statistical tests of neutrality of mutations. Genetics 133: 693-709.

Fu, Y.X. 1997. Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics 147: 915-925.

Gibbs, M.J., Armstrong, J.S., and Gibbs, A.J. 2000. Sister-scanning: a Monte Carlo procedure

for assessing signals in recombinant sequences. Bioinformatics 16: 573-582.

Grugaugh, N.D., Rückert, C., Armstrong, P.M., Bransfield, A., Anderson, J.F., Ebel, G.D., and

Brackney, D.E. 2016. Transmission bottleneckes and RNAi collectively influence tick-borne

flavivirus evolution. Virus Evolution 2(2): vew033.

Holmes, E.C. 2003. Patterns of intra- and interhost nonsynonymous variation reveal strong

purifying selection in dengue viruses. J. Virol. 77: 11296-11298.

Jacobson, A.L. and Kennedy, G.G. 2013. Specific Insect-Virus Interactions Are Responsible for

Variation in Competency of Different Thrips tabaci Isolines to Transmit Different Tomato

Spotted Wilt Virus Isolates. PLOS ONE 8(1): e54567

Jerzak, G., Bernard, K., Kramer, L., Shi, P-Y., and Ebel, G. 2007. The West Nile virus mutant

spectrum is host-dependent and a determinant of mortality in mice. Virology 360: 469-476.

Kaye, A.C., Moyer, J.W., Parks, E.J., Carbone, I., and Cubeta, M.A. 2011. Population genetic

analysis of Tomato spotted wilt virus on peanut in North Carolina and Virginia. Phytopahol.

101(1): 147-153.

Kolakofsky, D. and Hacker D. 1991. Bunyavirus RNA synthesis: genome transcription and

replication. Current Topics in Microbiololgy and Immunology 169: 143-159.

Korber B. 2000. HIV Signature and Sequence Variation Analysis. Computational Analysis of

HIV Molecular Sequences, Chapter 4, pages 55-72. Allen G. Rodrigo and Gerald H. Learn,

eds. Dordrecht, Netherlands: Kluwer Academic Publishers.

Kormelink, R., De Haan, P., Meurs, C., Peters, D., and Goldbach, R. 1992. The nucleotide

sequence of the M RNA segment of Tomato spotted wilt virus, a bunyavirus with two

ambisense RNA segments. J. Gen. Virol. 73: 2795-2804.

Kryazhimskiy, S., and Plotkin, J.B. 2008. The population genetics of dN/dS. Plos Genetics

4(12): e1000304.

Lemmety, A. and Lindquist, I. 1993. Thrips tabaci (Lind.) (Thysanoptera, Thripidae) another

vector for Tomato spotted wilt virus in Finland. Agric. Sci. Finl. 2:189-194.

Levens, R. 1968. Evolution in Changing Environments; Princeton University Press: Princeton,

NJ, USA.

Li, H.Y., and Roossinck, M.J. 2004. Genetic bottlenecks reduce population variation in an

experimental RNA virus population. J. Virol. 78: 10582-10587.

Lian, S., Lee, J-S., Cho, W.K., Yu, J., Kim, M-K., Choi, H-S., and Kim, K-H. 2013.

Phylogenetic and recombination analysis of Tomato spotted wilt virus. PLOS One 8(5):

e63380.

Maddison, W. P. and Maddison D.R. 2018. Mesquite: a modular system for evolutionary

analysis. Version 3.51 http://www.mesquiteproject.org

Margaria, P., Ciuffo, M., and Turina, M. 2007. Evidence that the nonstructural protein of Tomato

spotted wilt virus is the avirulence determinant in the interaction with resistant pepper

carrying the TSW gene. Mol. Plant Microbe Interact. 20: 547-558.

Margaria, P., Bosco, L., and Vallino, M. 2014. The NSs protein of Tomato spotted wilt virus is

required for persistent infection and transmission by Frankliniella occidentalis. J. Virol.

88(10): 5788–5802.

Martin, D.P., Williamson, C., and Posada, D. 2005. RDP2: Recombination detection and analysis

from sequence alignments. Bioinformatics 21: 260-262.

Martin, D.P., Lemey, P., Lott, M., Moulton, V., and Posada, D., et al. 2010. RDP3: a flexible and

fast computer program for analyzing recombination. Bioinformatics 26: 2462-2463.

Mason, G., Roggero, P., and Tavella, L. 2003. Detection of tomato spotted wilt virus in its vector

Frankliniella occidentalis by reverse transcription-polymerase chain reaction. J. virol.

Methods 109(1): 69-73.

Medeiros, R.B., Resende, R.D.O. & Ávila C.D. 2004. The plant virus tomato spotted wilt

tospovirus activates the immune system of its main vector, Frankliniella occidentalis. J.

Virol. 78(10): 4976-4982.

Morgan, A.D., Gandon, S., and Buckling, A. 2005. The effect of migration on local adaptation in

a coevolving host-parasite system. Nature 437: 253-256.

Montero-Astúa, M., Rotenberg, D., Leach-Kieffaber, A., Schneweis, B.A., Park, S., Park, J.K.,

German, T.L., and Whitfield, A.E. 2014. Disruption of vector transmission by a plant-

expressed viral glycoprotein. Mol. Plant Microbe Interact. 27(3): 296–304.

Montero-Astúa, M., Ullman, D. E. and Whitfield, A. E. 2016. Salivary gland morphology, tissue

tropism and the progression of tospovirus infection in Frankliniella occidentalis. Virology

493: 39–51.

Muller, H.J. 1964. The relation of recombination to mutational advance. Mutat. Res. 1: 2-9.

Nagata, T., Almeida, A.C.L., Rosende, R.O., and de Ávila A.C. 2004. The Competence of four

thrips species to transmit and replicate four tospoviruses. Plant Pathology 53: 136-140.

Nei, M. 1987. Molecular Evolutionary Genetics. Columbia University Press, New York.

Oliver, J.C., Miadlikowska, J., Arnold, A.E., Maddion, D.R., and Lutzoni, F. 2013. Hypha: a

Mesquite package for support value integration. Version 1.0.

http://mesquiteproject.org/packages/hypha.

Padidam, M., Sawyer, S., and Fauquet, C.M. 1999. Possible emergence of new geminviruses by

frequent recombination. Virology 265: 218-225.

Paliwal, Y.C. 1976. Some characteristics of the thrips vector relationship of tomato spotted wilt

virus in Canada. Can. J. Bot. 54: 402-405.

Posada, D. and Crandall, K.A. 2001. Evaluation of methods for detecting recombination from

DNA sequences: Computer simulations. Proc. Natl. Acad. Sci. USA 98: 13757-13762.

Qiu, W.P., Geske, S.M., Hickey, C.M., and Moyer, J.W. 1998. Tomato spotted wilt Tospovirus

genome reassortment and genome segment-specific adaptation. Virology 224(1): 186-194.

Richmond, K.E., Chenault, K., Sherwood, J.L., and German, T.L. 1998. Characterization of the

nucleic acid binding properties of tomato spotted wilt virus nucleocapsid protein. Virology

248: 6-11.

Robinson, D.J., Hamilton, W.D.O, Harrison, B.D., and Baulcombe, D.C. 1987. Two anomalous

tobravirus isolates: evidence for RNA recombination in nature. J. Gen. Virol. 68: 2551-

2561.

Rotenberg, S., Jacobson, A.L., Schneweis, D.J., and Whitfield, A.E. 2015. Thrips transmission of

tospoviruses. Current Opinion in Virology 15: 80-89.

Rozas, J., Ferrer-Mata, A., Sánchez-DelBarrio, J.C., Guirao-Rico, S., Librado, P., Ramos-

Onsins, S.E., and Sánchez-Gracia, A. 2017. DnaSP 6: DNA Sequence Polymorphism

Analysis of Large Datasets. Mol. Biol. Evol. 34: 3299-3302.

Salminen, M.O., Carr, J.K., Burke, D.S., and McCutchan, F.E. 1995. Identification of

breakpoints in intergenotypic recombinants of HIV-1 by bootscanning. AIDS Res. Hum.

Retrov. 11: 1423-1425.

Schneweis, D. J., Whitfiled, A. E. and Rotenberg, D. 2017. Thrips developmental stage-specific

transcriptome response to tomato spotted wilt virus during the virus infection cycle in

Frankliniella occidentalis, the primary vector. Virology 500: 226–237.

Scott, T.W., Weaver, S.C., and Mallampalli, V.L. 1994. Evolution of mosquito-borne viruses. In

The Evolutionary Biology of Viruses; Morse, S.S., Ed; Raven Pres, Ltd: New York, NY,

USA; pp293-324.

Shrestha, A., Champagne, D.E., Culbreath, A.K., Rotenberg, D., Whitfield, A.E., and Srinivasan,

R. 2017. Transcriptome changes associated with Tomato spotted wilt virus infection in

various life stages of its thrips vector, Frankliniella fusca (Hinds). J. Gen. Virol. 98: 2156-

2170.

Sin, S. H., McNulty, B. C., Kennedy, G. G., and Moyer, J. W. 2005. Viral genetic determinants

for thrips transmission of Tomato spotted wilt virus. PNAS 102(14): 5168–5173.

Steinhauer, D.A. and Holland, J.J. 1987. Rapid evolution of RNA viruses. Ann. Rev. Microbiol.

41: 409-433.

Storms, M.M.H., Kormelink, R., Peters, D., van Lent, J.W.M. and Goldbach, R.W. 1995. The

nonstructural NSm protein of Tomato spotted wilt virus induces tubular structures in plant

and insect cells. Virology 214: 485-493.

Tajima, F. 1983. Evolutionary relationship of DNA sequences in finite populations. Genetics

105: 437-460.

Tajima, F. 1989. Statistical method for testing the neutral mutation hypothesis by DNA

polymorphism. Genetics 123: 585-595.

Takeda, A., Sugiyama, K., Nagano, H., Mori, M., Kaido, M., Mise, K., Tsuda, S., and Okuno, T.

2002. Identification of a novel RNA silencing suppressor, NSs protein of Tomato spotted

wilt virus. FEBS lett. 532: 75-79.

Tedeschi, R., Ciuffo, M., Mason, G., Roggero, P., and Tavella, L. 2001. Transmissibility of four

tospoviruses by a thelytokous population of Thrips tabaci from Liguria, Northwestern Italy.

Phytoparasitica 29(1): 37-45.

Tentchev, D., Verdin, E., Marchal, C., Jacquet, M., Aguilar, J.M., and Moury, B. 2011.

Evolution and structure of Tomato spotted wilt virus populations: evidence of extensive

reassortment and insights into emergence process. J. Gen. Virol. 92: 961-973.

Tsompana, M., Abad, J., Purugganan, M., and Moyer, J.W. 2004. The molecular population

genetics of the Tomato spotted wilt virus (TSWV) genome. Molecular Ecology 14(1): 53-

66.

Vasilakis, N., Deardorff, E.R., Kenney, J.L, Rossi, S.L., Hanley, K.A., and Weaver, S.C. 2009.

Mosquitos put the brake on arbovirus evolution: Experimental evolution reveals slower

mutation accumulation in mosquito than vertebrate cells. PLoS pathog. 5: e1000467.

Weaver, S.C., Brault, A.C., Kang, W., and Holland, J.J. 1999. Genetic and fitness changes

accompanying adaptation of an arbovirus to vertebrate and invertebrate cells. J. Virol. 73:

4316-4326.

Weir, B. S., Cockerham, C.C. (1984). Estimating F-Statistics for the Analysis of Population

Structure. Evolution 38 (6): 1358–1370.

100

Whitfield, A. E., Kumar, N.K.K., Rotenberg, D., Ullman, D.E., Wyman, E.A., Zietlow, C.,

Willis, D.K., and German, T.L. 2008. A soluble form of the tomato spotted wilt virus

(TSWV) glycoprotein GN ( GN -S ) inhibits transmission of TSWV by Frankliniella

occidentalis. Phyopathology 98(1): 45–50.

Woelk, C.H. and Holmes, E.C. 2002. Reduced positive selection in vector-borne RNA viruses.

Mol. Biol. Evol. 19: 2333-2336.

Woolhouse, M.E., Taylor, L.H., and Haydon, D.T. 2001. Population biology of multihost

pathogens. Science 292: 1109-1112.

Wright, S. 1931. Evolution in Mendelian populations. Genetics 16: 97-159.

Wright, S. 1951. The genetical structure of populations. Ann. Eugenics 15: 323-354.

Yuste, E., Sanchez-Palomino, S., Casado, C., Domingo, E., and Lopez-Galindez, C. 1999.

Drastic fitness loss in human immunodeficiency virus type 1 upon serial bottleneck events.

J. Virol. 73: 2745-2751.

Yuste, E., Lopez-Galindez, C., and Domino, E. 2000. Unusual distribution of mutations

associated with serial bottleneck passages of human immunodeficiency virus type 1. J.

Virol. 74: 9546-9552.

101

Table 3.1. TSWV isolate and T. tabaci isofemale line combinations included in this study: North Carolina locations and host plants from which TSWV isolates and adult thrips used to initiate each T. tabaci clonal isofemale line were collected and mean proportion of T. tabaci transmitting TSWV for each isolate-isofemale line combination as reported by Jacobson and Kennedy (2013).

Proportion TSWV T. tabaci Location Host plant thrips isolate isoline isolate-isoline Isolate-isoline transmitting (n) Cove City – Cove City Nicotiana tabacum –Allium AM1 IPOC1* 0.20 (n=65) spp. Cove City – Kinston AM1 Kin1 N. tabacum – Allium cepa 0.21 (n=66)

Cove City – Jackson AM1 SH2 Springs N. tabacum - Secale cerealae 0.21 (n=28)

Cove City – Jackson Capsicum annuum – AM1 SH72 Springs 0.10 (n=63) Raphanus sativus var niger

Jackson Springs - SH3 IPOC1 Cove City N. tabacum – Allium spp. 0.03 (n=67)

Jackson Springs – SH3 Kin1 Kinston N. tabacum – A. cepa 0.16 (n=68)

Jackson Springs – SH3 SH2* Jackson Springs N. tabacum – S. cerealae 0.16 (n=131)

Cove City – Cove City SR3-3 IPOC1* N. tabacum – Allium spp. 0.07 (n=54)

Cove City – Kinston SR3-3 Kin1 N. tabacum – A. sepa 0.08 (n=42)

Cove City – Jackson SR3-3 SH2 Springs N. tabacum – S. cerealae 0.06 (n=141)

Cove City – Jackson N. tabacum - Raphanus SR3-3 SH72 Srpings 0.20 (n=20) sativus var niger

Jackson Springs – Capsicum annuum - S. SHP SH2* Jackson Springs 0.55 (n= 52) cerealae

102

Table 3.2. The TSWV Virus isolates and thrips species they were transmitted by, and the round of serial transmission to plants the virus were collected from, or if they were field collected isolates. Isolate Thrips Speciesa Roundb AM1 F. fusca 8 AM1 F. occidentalis 8 AM1 T. tabaci 4 Kin-2009 F. fusca 5 Kin-2009 T. tabaci 1 Kin-2009 T. tabaci 5 Kin-3 F. fusca 4 Kin-3 Field Collected 0 Kin-3 F. fusca 4 Kin-3 T. tabaci 4 SR3 F. fusca 5 SR3 Field Collected 0 SR3 F. occidentalis 5 SR3 T. tabaci 4 aThe thrips species used to transmit the virus isolates b The round of transmission the final isolate was collected

103

Table 3.3. The 66 Thrips virus isolate-thrips pairings pooled into 23 samples for next- generation sequence. Pooled sample Individual T. tabaci AM1 Ipoc1 1

AM1 Ipoc1 T High AM1 Ipoc1 2

AM1 Ipoc1 3 AM1 Ipoc1 4 AM1 Ipoc1 T Low AM1 Ipoc1 5 AM1 Ipoc1 NT AM1 Ipoc1 6 AM1 Ipoc1 7

AM1 Ipoc1 9

AM1 Ipoc1 10

AM1 Kin1 T AM1 Kin1 1 AM1 Kin1 2 AM1 Kin1 3 AM1 Kin1 4 AM1 Kin1 5 AM1 Kin1 NT AM1 Kin1 6

AM1 Kin1 7

AM1 Kin1 8

AM1 Kin1 9

AM1 SH72 T AM1 SH72 1 AM1 SH72 2 AM1 SH72 NT AM1 SH72 5 AM1 SH72 6 AM1 SH72 7

AM1 SH72 8

SH3 Ipoc1 T SH3 Ipoc1 1

SH3 Ipoc1 2 SH3 Ipoc1 NT SH3 Ipoc1 4 High SH3 Ipoc1 6 SH3 Ipoc1 NT Low SH3 Ipoc1 7 SH3 Ipoc1 8 SH3 SH2 T SH3 SH2 1

SH3 SH2 2

SH3 SH2 3

SH3 SH2 4

SH3 SH2 5 SH3 SH2 NT SH3 SH2 6 SH3 SH2 7

104

Table 3.3 (Continued). SH3 SH2 8 SH3 SH2 9 SH3 SH2 10 SR3 Ipoc1 T SR3 Ipoc1 1 SR3 Ipoc1 2 SR3 Ipoc1 3 SR3 IPoc1 NT low SR3 Ipoc1 4 SR3 Ipoc1 5 SR3 Ipoc1 6 SR3 Ipoc1 NT SR3 Ipoc1 7 High SR3 Ipoc1 8 SR3 Kin1 T SR3 Kin1 1 SR3 Kin1 2 SR3 Kin1 NT SR3 Kin1 3 SR3 Kin1 4 SR3 Kin1 5 SR3 SH2 T SR3 SH2 1 SR3 SH2 3 SR3 SH2 4 SR3 SH2 NT SR3 SH2 5 SR3 SH2 6 SR3 SH2 8 SR3 SH2 9 SR3 SH72 T SR3 SH72 1 SR3 SH72 2 SR3 SH72 3 SR3 SH72 NT SR3 SH72 4 SR3 SH72 5 SR3 SH72 8

105

Table 3.4. Primers designed for PCR amplification of the TSWV genome from E. sonchifolia leaves. BamT7TSWVS AATTGGATCCTAATACGACTCACTATAGAGAGCAATTGTGTCAKAATTTTG TSWV S (-)† AGAGCAATTGTGTCAATTTTATTC BamT7TSWVM AATTGGATCCTAATACGACTCACTATAGAGAGCAATCAGTGCRTCAG TSWV M (-)† AGAGCAATCAGTGCAAACAAAAAC TSWV L(+) AGAGCAATCAGGTAACAACGATTTTAAGC TSWV L 4474 (-) GAGTGCACAATCCATCTAGTTTGGAAATC TSWV L 4120XHO AATTCTCGAGATCAGTCGAAATGGTCGGC TSWV L (-)† AGAGCAATCAGGTACAACTAAAAC † These primers were used for both PCR and cDNA synthesis

106

Table 3.5. The population statistics for all encoded TSWV genes compared between the TSWV nucleotide sequences from thrips the source plants from which they acquired virus, and the TSWV isolates serially transmitted by different thrips species. Gene Source π a Sb kc hd Hde dNf dSg dN/dSh NSs Thrips 0.016 104 21.662 21 1 0.016 0.0148 1.095 Source Plants 0.007 32 9.758 7 0.894 0.001 0.037 0.038 Serial Transmitted Isolates 0.008 43 11.162 13 0.981 0.0022 0.0363 0.061 N Thrips 0.017 50 13.057 19 0.986 0.018 0.024 0.734 Source Plants 0.008 20 5.879 5 0.818 0.009 0.0091 1.011 Serial Transmitted Isolates 0.009 27 7.333 9 0.914 0.037 0.0438 0.084 NSm Thrips 0.066 157 42.281 21 1 0.068 0.124 0.547 Source Plants 0.012 31 10.652 6 0.848 0.003 0.06 0.052 Serial Transmitted Isolates 0.01 31 9.067 11 0.952 0.0032 0.0437 0.073 Gn Thrips 0.10691 303 100.919 21 1 0.1315 0.1128 0.86 Source Plants 0.00889 25 9.182 5 0.818 0.0051 0.0122 2.39 Serial Transmitted Isolates 0.01369 48 14.1429 14 0.99 0.0053 0.016 3.019 Gc Thrips 0.10359 207 72.095 21 1 0.1335 0.1058 0.79 Source Plants 0.00886 17 6.606 5 0.818 n/a† n/a n/a Serial Transmitted Isolates 0.01273 31 9.495 11 0.962 0.0072 0.0149 2.069 GnGc Thrips 0.035 435 107.414 21 1 0.039 0.06 0.645 Source Plants 0.01 96 32.636 8 0.924 0.004 0.042 0.094 Serial Transmitted Isolates 0.014 163 46.171 15 1 0.0062 0.0425 0.146 RdRp Thrips 0.039 1428 294.533 21 1 0.038 0.072 0.536 Source Plants 0.011 332 88.864 12 1 0.008 0.023 0.338 Serial Transmitted Isolates 0.012 434 103.686 15 1 0.009 0.0256 0.352 a Average number of nucleotide differences per site b Total number of segregating sites c Average number of nucleotide differences between sequences

107

Table 3.5. (Continued). d Total number of haplotypes e Measurement of haplotype diversity f Average number of pairwise differences of nonsynonymous sites g Average number of pairwise differences of synonymous sites h The rate of substitutions at non-silent sites to the rate of substitutions at silent sites † no synonymous mutations or enough nonsynonymous mutations to calculate the statistics

108

Table 3.6. Summary of the neutrality test statistic values for all TSWV coding regions for virus extracted from thrips, source plants used in virus isolate-thrips isoline experiment, and from plants used in serial transmission by thrips experiment. Gene Source Tajima's Da Fu and Li's Db Fu and Li's Fc Fu's Fsd NSs Thrips -0.124 (0.495) 0.114 (0.551) 0.194 (0.623) 1.080 (0.474) Source Leaves 0.973 (0.901) 1.866 (1.000) 1.661 (0.996) 1.770 (0.618) Serial Transmission Isolates 0.463 (0.752) 2.012 (1.000) 1.868 (0.999) 2.122 (0.654) N Thrips 1.161 (0.918) -0.533 (0.303) -0.567 (0.284) -12.207 (0.000)* Source Leaves 0.022 (0.581) -0.238 (0.435) -0.160 (0.457) 3.393 (0.929) Serial Transmission Isolates -0.192 (0.444) -0.277 (0.382) -0.267 (0.401) -1.234 (0.256) NSm Thrips -0.464 (0.329) 1.413 (0.989) 1.166 (0.948) 0.424 (0.420) Source Leaves 0.022 (0.581) -0.238 (0.435) -0.160 (0.457) 3.393 (0.929) Serial Transmission Isolates -0.192 (0.444) -0.277 (0.382) -0.267 (0.401) -1.234 (0.256) GnGc Thrips -0.299 (0.422) -1.268 (0.124) -1.182 (0.131) -1.739 (0.089) Source Leaves 0.114 (0.598) -0.437 (0.377) -0.280 (0.407) 4.288 (0.958) Serial Transmission Isolates -0.416 (0.348) -0.494 (0.341) -0.492 (0.325) -1.920 (0.102) Gn Thrips -0.709 (0.237) -0.958 (0.205) -0.897 (0.207) -1.928 (0.093) Source Leaves 0.446 (0.729) 0.059 (0.537) 0.184 (0.576) 4.379 (0.970) Serial Transmission Isolates -0.246 (0.423) -0.117 (0.452) -0.155 (0.437) -3.509 (0.050)* Gc Thrips -0.712 (0.224) -1.058 (0.162) -0.974 (0.171) -2.859 (0.063) Source Leaves 0.689 (0.814) 0.478 (0.700) 0.568 (0.736) 3.110 (0.923) Serial Transmission Isolates -0.138 (0.493) -0.029 (0.517) -0.048 (0.504) -1.050 (0.314) RdRp Thrips -0.514 (0.311) 1.563 (0.996) 1.259 (0.962) 3.046 (0.677) Source Leaves 0.878 (0.876) 1.788 (1.000) 1.587 (0.993) 3.614 (0.731) Serial Transmission Isolates 0.470 (0.753) 1.922 (1.000) 1.796 (0.998) 3.964 (0.766) P-values are in parenthesis

a Tajima's D compares the nucleotide diversity with the proportion of polymorphic sites, which are expected to equal under selective neutrality.

b Fu and Li's D-test statistic is based on the differences between the number of singletons and the total number of mutations.

c Fu and Li’s F-test statistic is based on the differences between the number of singletons and the average number of nucleotide differences between pairs of sequences. d Probability of having a number of haplotypes greater or equal to the observed number of samples drawn from a constant-sized population

109

Table 3.7. Population Differention due to genetic structure for all encoded genes between the serial transmitted isolates, thrips virus isolate-thrips isoline pairings, and source plant virus isolate-thrips isoline pairings. Gene Population 1a Population 2b Fstc NSs Serial transmitted isolatesd source leavese 0.025 Serial transmitted isolates thripsf 0.4 sources leaves thrips 0.4 N Serial transmitted isolates source leaves 0.023 Serial transmitted isolates thrips 0.21 sources leaves thrips 0.19 NSm Serial transmitted isolates source leaves 0.0077 Serial transmitted isolates thrips 0.33 sources leaves thrips 0.31 Gn Serial transmitted isolates source leaves 0.055 Serial transmitted isolates thrips 0.43 sources leaves thrips 0.44 Gc Serial transmitted isolates source leaves 0.048 Serial transmitted isolates thrips 0.41 sources leaves thrips 0.42 GnGc Serial transmitted isolates source leaves 0.034 Serial transmitted isolates thrips 0.33 sources leaves thrips 0.34 RdRp Serial transmitted isolates source leaves -0.0026 Serial transmitted isolates thrips 0.37 sources leaves thrips 0.37 a Population 1 is the group of TSWV isolates compared to population 2. b Population 2 is the group of TSWV isolates compared to population 1. cThe values range from 0 to 1. A zero value implies complete panmixis; that is, that the two populations are interbreeding freely. A value of one implies that all genetic variation is explained by the population structure, and that the two populations do not share any genetic diversity. d TSWV isolates that were serially transmitted by three different thrips vectors. e Source leaves from the TSWV isolate-T.tabaci isofemale line pairings. f TSWV isolates from the T. tabaci of the TSWV isolate-T.tabaci isofemale line pairings.

110

Table 3.8. Total number of unique polymorphisms found in the nucleotide sequences for all pairings of nontransmitting and transmitting thrips. Nontransmitting Isolate-Isoline NSs N NSm Gn Gc GnGc RdRp AM1 Ipoc1 6 5 13 1 11 18 72 AM1 Kin1 1 0 0 1 1 3 5 AM1 SH72 1 0 0 0 0 0 74 SH3 Ipoc1 High 1 0 5 0 5 5 6 SH3 Ipoc1 Low 33 13 0 6 0 15 84 SH3 SH2 13 2 0 7 0 22 78 SR3 Ipoc1 High 2 1 2 5 0 6 24 SR3 Ipoc1 Low 11 3 8 11 0 27 41 SR3 Kin1 0 0 1 0 1 3 11 SR3 SH2 0 0 2 0 1 2 11 SR3 SH72 0 0 0 2 1 10 36 Transmitting Isolate-Isoline NSs N NSm Gn Gc GnGc RdRp AM1 Ipoc1 High 1 0 2 0 0 2 9 AM1 Ipoc1 Low 6 5 3 0 0 3 13 AM1 Kin1 0 0 0 4 0 4 23 AM1 SH72 3 2 2 0 0 3 8 SH3 Ipoc1 0 0 1 0 0 0 0 SH3 SH2 27 22 6 5 5 24 143 SR3 Ipoc1 0 0 0 0 0 0 13 SR3 Kin1 14 1 1 3 0 15 42 SR3 SH2 0 0 2 0 0 3 25 SR3 SH72 1 0 0 0 0 6 5

111

Table 3.9. Total number of unique polymorphisms found in the nucleotide sequences for all pairings of plant sequences. Sample NSs N NSm Gn Gc GnGc RdRp AM1 Ipoc1 1 0 0 0 1 1 0 AM1 Kin1 0 0 0 0 0 0 6 AM1 SH72 0 0 0 0 0 0 0 AM1 SH2 0 0 0 0 0 0 0 SH3 Ipoc1 0 0 0 0 0 0 1 SH3 Kin1 0 0 0 0 0 0 0 SH3 SH2 0 0 0 0 0 0 0 SHP SH2 6 1 1 2 3 6 10 SR3 Ipoc1 1 0 0 0 0 1 19 SR3 Kin1 2 0 0 0 0 0 1 SR3 SH2 2 2 1 1 1 3 17 SR3 SH72 0 0 0 0 0 0 0

112

Table 3.10. Total number of unique polymorphisms found in the nucleotide sequences for all serially transmitted TSWV isolate sequences. Sample NSs N NSm Gn Gc GnGc RdRp AM1 Ffus R8 1 0 3 1 1 4 4 AM1 Focc R8 1 0 3 1 0 1 5 AM1 TTAB R4 0 1 0 1 0 1 4 Kin-2009 Ffus R5 0 0 1 0 1 2 2 Kin-2009 TTAb R1 0 0 0 0 0 0 35 Kin-2009 TTAB R5 2 0 1 1 1 3 34 Kin-3 Ffus R4 0 2 0 1 2 4 4 Kin-3 Field col 7 0 0 0 0 2 7 Kin-3 Focc R4 5 1 0 1 0 2 6 Kin-3 TTAB R4 1 0 0 1 1 4 10 SR3 Ffus R5 0 0 1 2 1 6 5 SR3 Field col 0 0 0 0 0 0 1 SR3 Focc R5 0 1 0 0 0 3 0 SR3 TTAB R4 1 3 2 3 4 12 32 Parker 8 5 4 2 5 17 45

113

Figure 3.1. Phylogenetic congruence of mutation, genetic reassortment and recombination in the evolution of TSWV. The mutation and recombination history of each ancestral node in the reconstructed TSWV phylogeny was examined comparing the internodal support values from each virus locus phylogeny (Gn, Gc, RdRp, N, NSm, and NSs) on the total evidence tree inferred from a concatenated SNP matrix of the six loci. Nodal grid support values were based on a bootstrap threshold support value of 70% and were output as node annotations on the total evidence tree. Support values for each locus phylogeny are shown using grids on branches of the total evidence tree with colors showing node bipartitions that were supported at a bootstrap support value ≥70% (black color) or <70% (white color); a node bipartition not found in the total evidence tree was reported as missing or inapplicable (grey color). Grids that were filled in with mostly black squares indicated mutation as a major driving force in the evolution of descendants of that node. High conflict (red color) was used to indicate a node bipartition in the locus tree that conflicted with the total evidence tree at a bootstrap support value ≥70% most likely due to recombination (i.e. reassortment and crossovers) among isolates in descendant branches. Low conflict (cyan color) was used for nodes that were not recovered by the bootstrap analysis because there was either insufficient variation or too much confounding variation (i.e. homoplasy) due to extensive recombination.

114

Figure 3.2. Alignment of NSs showing the 12 nucleotide insertion between nucleotides 788 and 789 present in plant sequences. The insertion was also present in published sequences of other TSWV isolates and tospoviruses, but is mostly absent form thrips sequences. Asterisk is the reference sequence used for mapping the reads to the S RNA.

115

Chapter 4

Developing a Partial Reverse Genetics System for Tomato spotted wilt virus

Jessica A. Brown and Tim L. Sit

Department of Entomology and Plant Pathology, Varsity Research Bldg. Module 6, 1575 Varsity Dr., Suite 1535, Campus Box 7616, North Carolina State University, Raleigh, NC 27695-7616

116

Abstract

Here we report the attempt to develop a T7 RNA polymerase-based partial reverse genetics system for TSWV to identify genetic determinants of transmission from thrips. A successful system would be used to test sequence polymorphisms, found in next-generation sequencing analysis, and their effect on transmission from T. tabaci. This system involves co-infiltration of

Nicotiana benthamiana leaves with Agrobacterium tumefaciens strains containing plasmids encoding the S RNA, and S RNA encoding the green fluorescent protein in place of the nucleocapsid as a reporter gene, under the control of the T7 promoter and addition of hepatitis δ ribozyme for exact 3’ terminal ends. TSWV nucleocapsid was cloned into pPZP212 under the control of the 35S promoter for constitutive expression to encapsidate nascent RNA produced by the T7 RNA polymerase. This would allow us to produce reassortants between a given virus isolate and a cloned cDNA. Even though all known steps were taken to produce constructs that should be able to mimic the TSWV life cycle, there was no success in planta for many possible reasons.

117

Introduction

Reverse genetic systems are experimental tools allowing for the production and subsequent replication and transcription of viral RNA genomes, or genome analogues, from complementary DNA (cDNA) (Hoenen et al. 2011). These systems are invaluable because they allow for manipulation of RNA genomes to study the effects of these changes on the biology of the virus at the phenotypic level. Negative-strand RNA (NSR) viruses have major impacts on public health, agriculture, and ecology, and are collectively responsible for some of our most serious human, veterinary, wild life and plant diseases (King et al. 2012; Wang et al. 2015).

These viruses comprise members of the Bunyavirales and Mononegavirales, and account for many economically important crop diseases. Currently the only methods of associating mutations with specific phenotypes are directed mutation analysis, reassortment experiments, and comparisons of genomic sequences. Furthermore, unlike positive-sense RNA viruses, whose genomic RNAs are infectious upon introduction into permissive host cells, neither naked genomic RNAs (gRNAs), or antigenomic RNAs (agRNAs) of NSR viruses are able to initiate an infection when present alone. Several positive-sense RNA genomes and segmented NSR genomes that cause human-related diseases have had successful reverse genetic systems developed (Bridgen & Elliot, 1996; Överby et al., 2006; de Wit et al., 2007; Boyce et al., 2008;

Albariño et al., 2009; Elliot et al., 2013; Acrani et al., 2014; Brennan et al., 2015) while only one successful system for a monopartite plant-infecting NSR virus has been developed (Wang et al.,

2015).

The minimum replication unit for NSR viruses is the encapsidated genome associated with the viral polymerase. It took almost a decade after the first positive-sense virus reverse genetics system was successful for in vivo reconstitution of infectious encapsidated NSRs to be

118

developed (Lawson et al. 1995; Schnell et al., 1994; Whelan et al. 1995). T7 RNA polymerase is widely used for the initial transcription of cDNA clones but must be supplied in trans from either an expression plasmid or through superinfection with a recombinant vaccinia virus encoding T7

RNA polymerase (Fuerst et al., 1986; Schnell et al., 1994; Radecke et al., 1995; Whelan et al.,

1995). Endogenous host-cell RNA polymerases (I and II) are the other widely used method for transcription (Zobel et al., 1993; Neumann et al., 1999; Hoffmann et al., 2000; Wagner et al.,

2001). The main difference between them is that the T7 polymerase transcribes in the cytoplasm while Pol I and II transcribe in the nucleus.

Transfection of a cDNA plasmid into cells results in transcription of a un-encapsidated genomic RNA by the co-expressed DNA dependent RNA polymerase. Since only the encapsidated genome in the form of a ribonucleoprotein (RNP) complex is a suitable template for the viral polymerase complex, this naked RNA must be artificially encapsidated by the nucleoprotein (N) provided in trans, a process called artificial or illegitimate encapsidation. This process is generally believed to be highly inefficient and mechanistically different from the encapsidation of nascent viral RNA (vRNA) or viral complementary RNA (vcRNA) molecules that occurs simultaneously with replication. Once encapsidated, this genomic RNA is then recognized by the other RNP components, to be provided in trans either by helper virus infection or from expression plasmids, before being replicated and transcribed into mRNAs. This leads to the production of all virus proteins and starts the virus replication cycle, and ultimately results in the production of a clonal population of infectious viruses. When the T7 RNA polymerase is used it leads to additional nucleotides at the 3’ ends of transcripts when compared to authentic vRNA As such, a Hepatitis δ virus ribozyme (HDR) is commonly used to provide an authentic 3’ end to the RNA (Hoenen et al., 2011).

119

There have been several successful T7-based reverse genetics systems for Bunyaviruses

(Bridgen & Elliot, 1996; Lowen et al., 2004; Ikegami et al., 2006; Habjan et al., 2008; Brennan et al., 2015) as well as other segmented genome viruses (de Wit et al., 2007; Perez et al., 2003).

The advantage of these systems is they have cell lines readily available for stable and transient expression of recombinant proteins, most commonly BHK21 cells (baby hamster kidney strain

21) and a derivative of BHK21 expressing the T7 RNA polymerase (BSR-T7/5). Plant NSR viruses require different approaches than animal NSR viruses. Most of these viruses replicate in insect vectors but cell lines of these vectors are not available, and those that have been developed are quite fastidious in their growth and maintenance requirements (Black, 1979; Ma et al. 2013).

In addition, infected insect cells fail to form plaques or display other easily distinguishable infection phenotypes (Ganesan et al., 2013). There is also the lack of T7 RNA polymerase expression systems and poorly defined RNA polymerase I promoters in plants as well as the rigid plant cell wall barrier for the delivery of multiple plasmids. Transgenic plants expressing

T7 RNA polymerase do exist but are not widely available (Zeitoune et al., 1999; Nguyen et al.,

2004; Peretz et al., 2008). Even still, the T7 RNA polymerase has been used successfully in plants to transcribe foreign genes (Petty et al., 1989; Lim et al., 2010).

The order Bunyavirales is one of the largest taxonomic groupings of RNA viruses, containing approximately 160 species. These viruses are characterized by a tripartite, negative- sense or ambisense, single-stranded RNA genome. The family Tospoviridae is one of three plant-infecting families of the Bunyavirales containing Tomato spotted wilt orthotosposvirus

(TSWV) which is responsible for causing crop losses worldwide every year (Pappu et al., 2009;

Riley et al., 2011). The segmented genome of TSWV is composed of three single-stranded

RNAs, small (S, 2.9 kb), medium (M, 4.8 kb), and large (L, 8.9 kb) (Fig 4.1). The S RNA is

120

ambisense and encodes the nucleocapsid protein (N) and non-structural protein (NSs) (De Haan et al. 1990; Takeda et al. 2002), the M RNA is also ambisense and encodes the non-structural movement protein (NSm) and the glycoprotein precursors (Gn / Gc) (De Haan et al. 1990;

Kormelink et al. 1992, 1994; Takeda et al. 2002), while the L RNA encodes the RNA-dependent

RNA polymerase (RdRp) (de Haan et al. 1991).

The TSWV virion is a spherical lipid-bound particle, 80-120 nm in diameter, covered with spike-like projections consisting of two glycoproteins Gn and Gc (Snippe et al., 2005). The core virion consists of pseudo-circular RNPs, each consisting of a viral RNA segment tightly enclosed by the N protein and minor amounts of L protein. Replication occurs in the cytoplasm and involves the Gn and Gc proteins attaching to unknown host cell receptors in thrips vectors, that are not required for plant infection, followed by virus internalization putatively via receptor- mediated endocytosis. Acidification of endocytic vesicles leads to virion uncoating and fusion of the viral membrane with the endosomal membrane. The viral RdRp catalyzes primary transcription of viral mRNAs which are primed by host cell-derived primers. Following translation of the viral mRNAs, the Gn and Gc proteins dimerize in the ER and localize to the

Golgi complex. The genomic segments are converted into positive-sense anti-genomic RNAs

(agRNAs) for genome replication. The RNPs are then transported to membranes of the Golgi complex that have been modified by insertion of Gn and Gc, and virus particles bud into Golgi membrane-derived vesicles. Golgi vesicles that contain virus particles are trafficked to the cell surface and fusion of the vesicular membranes with the plasma membrane leads to the release of infectious virions.

Population genetic studies of TSWV isolates have indicated high levels of genetic variability, geographical structuring of isolates, and evidence of widespread recombination and

121

reassortment (Lian et al., 2013; Qiu et al., 1998; Kaye et al., 2011; Tentchev et al., 2011;

Tsompana et al., 2004). T. tabaci has been found to vary greatly in its ability to transmit different isolates of TSWV but no definitive explanation has been discovered. Jacobson and Kennedy

(2013) examined transmission of 89 distinct pairings between TSWV isolates and T. tabaci isolines showing a significant effect of virus isolate, thrips isoline, and their interaction on transmission efficiency. Quantitative real-time PCR of the TSWV isolates and T. tabaci pairings from Jacobson and Kennedy (2013) has shown that virus titer in individual thrips was unrelated to the virus titers in the source leaves from which they acquired virus, and was not a significant variable underlying differences in transmission efficiency among TSWV isolates (Brown et al., manuscript in preparation). A new population genetics study on these same TSWV isolate and T. tabaci pairings have found most genetic variants occur in the NSs and GnGc proteins with isolates originating from plants having a 12 nucleotide insertion in the NSs that is absent in thrips

(Brown et al., manuscript in preparation). These experiments provide evidence for the importance of specific vector-virus interactions but further research needs to be done to understand if any of the variants found affect transmission of TSWV.

A reverse genetics system for TSWV would allow us to study the determinants of transmission from thrips vectors, by introducing polymorphisms found in next-generation sequence analysis. Here we report the attempt to develop a T7 RNA polymerase-based partial reverse genetics system for TSWV. We use only one of the three genome segments of TSWV instead of all three for simplicity. Our main interests are in the genes encoded by the S and M

RNAs that have been shown to be involved in transmission and resistance breaking (Bandla et al., 1998; Sin et al., 2005; Margaria et al., 2007; Whitfield et al., 2008; Margaria, et al., 2014;

Monetro-Astúa et al., 2014; Peiró et al., 2014). This system involves co-infiltration of Nicotiana

122

benthamiana leaves with Agrobacterium tumefaciens strains containing plasmids encoding the

TSWV S RNA, as well as the S RNA encoding the green fluorescent protein (GFP) as a reporter gene, under control of the T7 promotor and terminator, and HDR to provide authentic 3’ terminal ends (Fig. 4.2). In addition, TSWV N protein, viral suppressors of RNA silencing, and the T7

RNA polymerase are expressed from plasmids under the control of the Cauliflower mosaic virus

35S promoter to constitutively produce proteins (Fig. 4.3). Site-directed mutagenesis would introduce mutations to the cDNA construct to serve as a marker for the recombinant RNA progeny. The next step would be mechanically inoculating N. benthamiana with the wild type

TSWV isolate to be tested 1-2 days post-infiltration to produce reassortants between a given virus isolate and a cloned cDNA. Reassortants would be selected for by sap transmission of the infection to a local lesion host, followed by transfer of individual lesions to systemic hosts for amplification. Reassortants can then be assayed through a restriction site introduced as a genetic marker.

Materials and Methods

General. TSWV Amerson (AM1) isolate was collected from Cove City, North Carolina

(Jacobson & Kennedy, 2013). Total RNA was extracted from 100 mg of TSWV infected Emilia sonchifolia leaf material with TRIzol™ reagent (ThermoFisher Scientific, Waltham, MA) using the manufacturer’s protocol. Homogenization was carried out using three Pyrex solid glass beads

(3 mm; Corning, Corning, NY) in a 1.5 ml tube containing leaf tissue, flash frozen in liquid N2, and shaken for 20 seconds in a Silamat S6 mixer (Ivoclar Vivadent, Amherst, NY). Total RNA was resuspended in 50 µl of dH2O. All primers (Table 4.1) were purchased from Eurofins

Genomics (Louisville, KY). All restriction enzymes were purchased from New England Biolabs

(NEB; Ipswich, MA). Ligations were performed with T4 DNA ligase (NEB) at 16°C overnight.

123

Following ligation, plasmid DNAs were grown in E. coli DH5α on agar plates containing spectinomycin (100mg/ml) overnight at 37°C. Liquid cultures containing 3 ml of Luria broth and spectinomycin (100 mg/ml) for pPZP212 plasmids, or kanamycin (100 mg/ml) for pCAM plasmids, were inoculated with single colonies, grown overnight at 37°C and extracted using the

QIAprep Spin Miniprep kit (Qiagen, Germantown, MD).

All PCR and enzymatic reactions were purified using a phenol/chloroform extraction and ethanol precipitation. These extractions added 1 volume of TE buffer (10 mM Tris-HCl, pH 8.0,

1 mM EDTA) to the sample, then 1 volume of phenol:chloroform:octanol (25:24:1, pH 6.6), mixed thoroughly and centrifuged in an Eppendorf microcentrifuge (5424) at 15,000 rpm for 2 minutes. The aqueous layer was transferred to a new tube with the addition of 1 volume of chloroform (24:1 chloroform:octanol). The sample was mixed and centrifuged again for 2 minutes at 15,000 rpm. The final aqueous phase was removed to new tube followed by ethanol precipitation with 1/10th the volume of sodium acetate (3 M) and 2 ½ volumes of 95% ethanol.

The mixture was incubated at -20°C for 20 minutes or overnight. After incubation, samples were centrifuged for 5 minutes at 15,000 rpm and the supernatant was poured off. 70% ethanol was added to gently wash remaining salts then removed. Remaining ethanol was vacuum dried

(Savant Speedvac concentrator, ThermoFisher Scientific) for 5 minutes, and the DNA was resuspended in water.

Plasmids already maintained by the lab were pCAM-T7RNAP containing the T7 RNA polymerase (Kindly provided by John Hammond, USDA, Beltsville, MD) (Zeitoune et al., 1999;

Nguyen et al., 2004; Peretz et al., 2008; Lim et al., 2010), and the RNA silencing suppressor constructs HC-Pro, p19, and TCV CP in plasmid pPZP212 (Powers et al., 2008b). cDNA synthesis was required to convert total RNA to the DNA template required for RT-PCR. First

124

strand cDNA was synthesized from total RNA using Protoscript® II reverse transcriptase (NEB). cDNA was synthesized using 1 µg of total RNA in a 20 µl reaction primed with the reverse primer (10 µM) for each pair in the following sections. The primers, 1 µl dNTP mix (10 mM), total RNA and dH2O to a final volume of 12 µl were combined and heated at 70°C for 5 minutes and chilled immediately on ice. The remaining reagents were added [Protoscript reaction buffer,

DTT (10 mM final), Murine RNase inhibitor (2U/µl final) and 1 µl Protoscript® II reverse transcriptase (20U/µl)] and incubated at 42°C for 1 hour. The enzyme was inactivated at 80°C for 5 minutes and stored at -20°C. All PCR reactions were performed on a Bio-Rad C1000

Touch thermal cycler (Hercules, CA). Pfu Turbo PCR reactions had the following conditions: 0.2

µM forward primer, 0.2 µM reverse primers, 10 µM dNTPs solution mix (NEB), 1X Pfu Turbo reaction buffer, 100-200 ng of template DNA, and 2.5 U Pfu Turbo. OneTaq PCR reactions had the following conditions: 1X OneTaq® 2x master mix with standard buffer (NEB), 10 µM forward primer, 10 µM reverse primer, and 1 µg or less of template DNA. All PCR reactions and restriction enzyme digests were confirmed via electrophoresis through a 1% 1X TAE agarose gel.

Development of PZPRiboTerm Base Plasmid. This plasmid served as the starting plasmid for S RNA constructs. It consists of plasmid pPZP212 with the T7 terminator sequence

(to stop transcription in vivo) along with the HDR to ensure authentic viral 3’ termini. The T7 terminator sequence was generated by annealing 2 oligonucleotides (T7 Term F and T7 Term R,

Table 4.1) in 1X annealing buffer (0.1 M Tris, pH 8, 0.5 M NaCl, 50 mM EDTA) by incubating the mixture at 95°C for 5 minutes followed by 70 1-minute cycles while dropping 1 degree every cycle in the C1000 Touch thermal cycler. The HDR sequence was amplified from plasmid FHV

(1,0; plasmid containing the Flock house virus RNA1 construct; Ball, 1994; kindly supplied by

125

Ranjit Dasgupta) using Pfu Turbo polymerase with primers 5’ HepD and 3’ HepD (Table 4.1).

Cycling conditions were as follows: initial denaturation 95°C for 3 minutes; 40 cycles of 95°C for 30 seconds, 56°C for 10 seconds, 72°C for 10 seconds; final extension at 72°C for 10 minutes. The T7 Terminator annealed oligonucleotides were ligated into plasmid pPZP212 which had been doubly-digested with KpnI and HindIII. The resulting pPZP212-T7Term plasmid was subsequently doubly-digested with EcoRI and KpnI followed by ligation with similarly cleaved HDR PCR product to produce PZPRiboTerm. The resultant plasmids were initially screened by linearizing with EcoRI followed by sequencing to confirm the integrity of the various inserts.

Development of PZPRiboTerm-sGFP. sGFP was cloned into PZPRiboTerm to act as a reporter gene, in order to easily observe function of the plasmid. sGFP was PCR amplified from a pRTL2 plasmid using Pfu Turbo polymerase in a 50 µl reaction with primers BAM-

T7TEVLeader and 35SpolyA(-) (Table 4.1). The addition of the Tobacco etch virus (TEV) 5’ translational enhancing leader in the forward primer allows for cap-independent translation of poly-adenylated mRNAs (Powers et al., 2008b). The cycling conditions were as follows: initial denaturation at 95°C for 3 minutes; 40 cycles of 95°C for 30 seconds, 58°C for 30 seconds, 72°C for 1 minute; final extension of 72°C for 5 minutes. The resulting PCR product was digested with BamHI and ligated into a PZPRiboTerm plasmid doubly-digested with SmaI and BamHI to make PZPRiboTerm-sGFP (Fig. 4.4). HindIII digested PZPRiboTerm-sGFP functionality was tested by in vitro transcription (Fig. 4.5) using Applied Biosystems MEGAscript™ T7 transcription kit (Invitrogen, Carlsbad, CA). This in vitro transcription kit allows for synthesis of

RNA molecules from templates containing the T7 promoter.

126

Development of PZPRiboTerm-S. The S RNA was cloned into a pGEM®-T Easy plasmid following the supplied protocol (Promega, Madison, WI). TSWV AM1 isolate S RNA was amplified from cDNA (primed with the TSWV S (-) primer) in a 50 µl reaction with

OneTaq® 2X master mix with standard buffer (NEB) and primers BamT7TSWVS and TSWV S

(-) (Table 4.1). The cycling conditions were as follows: initial denaturation at 94°C for 5 minutes; 40 cycles of 94°C for 30 seconds, 56°C for 30 seconds, 68°C for 3 minutes 15 seconds; final extension at 68°C for 5 minutes. The resulting PCR products were cloned into pGEM®-T

Easy. Site-directed mutagenesis was performed on a pGEM-SRNA construct to create a differentiating feature of the recombinant. We changed the 2nd amino acid of the N protein from

S to T to insert a BspHI site, using the Agilent QuickChange II Site-Directed Mutagenesis Kit

(Santa Clara, CA). We were unable to ligate the S RNA cDNA into the PZPRiboTerm plasmid as a single fragment resulting in the need to amplify the S RNA in two halves and ligate them sequentially. The 3’ half of the mutated pGEM-SRNA was amplified using OneTaq® 2X master mix with standard buffer and primers TSWV S (-) and TSWVBamXbaNCSTOP (Table 4.1) in a

25 µl reaction. Cycling conditions were as follows: 94°C for 3 minutes; 40 cycles of 94°C for 30 seconds, 56°C for 30 seconds, 68°C for 1 minute 45 seconds; final extension at 68°C for 5 minutes. The PCR fragment was cleaved with BamHI and ligated into PZPRiboTerm doubly- digested with BamHI and SmaI to produce PZPRiboTerm-3’NC. The 5’ S RNA half was amplified with primers BamT7TSWVS and TSWVNCXBAXHO 1507(-) (Table 4.1) from the mutated pGEM-SRNA. Cycling conditions were the same as the 3’ S RNA fragment. 5’ S RNA was doubly digested with BamHI and XbaI, then ligated into similarly cleaved PZPRiboTerm-

3’NC to produce PZPRiboTerm-SRNA (Fig. 4.6). The ligation of the 5’ half into PZPRiboTerm-

127

3’NC introduced an XbaI site at the N stop codon as another differentiating feature of the recombinant.

Development of PZPRiboTerm-GFP-S. PZPRiboTerm-3’NC plasmid was doubly- digested with BspHI and XbaI. sGFP was amplified from the pRTL2 plasmid with the same conditions as previously mentioned, and doubly-digested with NcoI and XbaI, then ligated into

PZPRiboTerm-3’NC to produce PZPRiboTerm-3’NC/sGFP. The same TSWV5’S PCR fragment used to construct PZPRiboTerm-S was ligated into PZPRiboTerm-3’NC/sGFP, by cleaving both with BamHI and XbaI to make PZPRiboTerm-GFP-S (Fig. 4.7). The functionality of the plasmid was checked with in vitro transcription from two PZPRiboTerm-GFP-S plasmids linearized by

XbaI (Fig. 4.8).

Development of PZP-NC. Since cDNA plasmids produce naked RNA it must be artificially encapsidated by the nucleoprotein provided in trans. Nucleocapsid was amplified from the TSWV S RNA cDNA (originating from the AM1 isolate) in a 50 µl reaction with

OneTaq® 2x master mix with standard buffer using the primers TSWVNC5’PCI and

TSWVNC3’XBA (Table 4.1). Cycling conditions were as follows: 94°C for 3 minutes; 40 cycles of 94°C for 30 seconds, 58°C for 1 minute, 68°C for 3 minutes 45 seconds; final extension at

68°C for 5 minutes. The resulting NC PCR product was doubly-digested with PciI and XbaI, then ligated into pRTL2 that was doubly digested with NcoI and XbaI, producing the pRTL2-NC plasmid. pRTL2 is used because it has the Cauliflower mosaic virus 35S promoter, which will constitutively express the N protein along with the TEV leader (Powers et al., 2008). pRTL2-NC was digested with HindIII to generate the expression cassette. pPZP212 plasmid was digested with HindIII and dephosphorylated with Antarctic phosphatase (NEB). The pRTL2-NC expression cassette was ligated into pPZP212 making PZP-NC (Fig. 4.9). SDS-PAGE would

128

allow us to test if nucleoprotein was being produced if we had TSWV polyclonal antisera or more ideally monoclonal nucleocapsid antisera. Unfortunately TSWV antisera is not commercially available.

Agroinfiltration. A. tumefaciens is used to deliver the plasmids because it naturally transfers and integrates DNA (T-DNA) into the plant genome through a tumor-inducing (Ti) plasmid. Strains used for genetic engineering have removed the Ti properties by deleting the T-

DNA and now genes are transferred into the plant by separate vectors (Gelvin, 2003; Hellens et al., 2000). In addition, Agrobacterium does not significantly activate host responses. N. benthamiana is used as the host in these experiments because it is a natural host of TSWV that has been heavily studied due in large part to its susceptibility to a multitude of viral pathogens

(Yang et al., 2004). N.benthamiana leaves are easily infiltrated with Agrobacterium cell suspensions that are directly injected into the airspaces within the leaf or through a tiny incision made to the underside of the leaf (Marillonnet et al. 2005)

The plasmids PZPRiboTerm-NC, PZPRiboTerm-sGFP, and pCAM-T7RNAP were electroporated into electrocompetent A. tumefacians strain C58C1 using a Gene Pulser Xcell™

(Bio-rad) set at 130-200Ω and a voltage of 1.44 kv in a 1 mm cuvette. pPZP212 plasmids were grown on LB plates containing spectinomycin (100 mg/ml), gentamycin (50 mg/ml), and rifampcin (50 mg/ml) while pCAM plasmids were grown with kanamycin (100 mg/ml), gentamycin (50 mg/ml), and rifampicin (50 mg/ml) for 2 days at 28°C.

Liquid cultures were inoculated with one colony from each construct in 2 ml of LB + respective antibiotics at the same concentrations as above and incubated overnight with shaking at 300 rpm. The final liquid culture was initiated with 250 µl of overnight culture added to 5 ml

129

of LB broth, appropriate antibiotics at the same concentrations as above, 10 mM MES pH 5.6

(50 µl), and 40 mM acetosyringone (2 µl) and incubated at 28°C overnight.

5 ml overnight cultures were spun down at 4800 rpm for 10 minutes, supernatant poured off, and cells resuspended in 5 ml of Agro infiltration buffer (10 mM MES pH 5.6, 10 mM

MgCl2, and 0.2 mM acetosyringone) and incubated at room temperature for 3 hours. When combining constructs to infiltrate together, one volume of each was added to one 10 ml tube

(Becton Dickinson, Franklin Lakes, NJ) before infiltrating into wild type (WT) and MP+

(RCNMV movement protein) N. benthamiana leaves using a 1 ml syringe. The leaves were checked 5 days post inoculation under UV light.

Same process was repeated for infiltrating N. benthamiana with PZPRiboTerm-GFP-S, pCAM-T7RNAP, PZP-NC, PZP-HCPro, PZP-p19, and PZP-TCVCP. The three silencing suppressors were included to help reduce any silencing responses by N. benthamiana.

Results and Discussion

The purpose of the work described above was to construct DNA expression vectors that would produce TSWV-like RNA and protein for a single genome segment to study the genetic determinants of transmission from thrips. We successfully cloned a full-length cDNA construct of TSWV genomic S RNA segment into the Agrobacterium plasmid pPZP212 containing a T7

RNA polymerase promoter, T7 RNA polymerase terminator, and 3’ HDR to generate authentic

3’ viral termini. We also cloned the TSWV N into pPZP212 under control of the 35S promoter for constitutive expression so the RNA produced by T7 RNA polymerase could be artificially encapsidated.

This system is inherently difficult to build due to the genomic RNA itself not being infectious, replication initiation is mediated by the viral RdRp, and the genomic RNA needs to

130

be encapsidated with viral nucleoprotein to serve as a template for transcription and replication.

In addition we have to infiltrate six individual plasmids into a single cell and have them all successfully transcribing before co-infection with a TSWV isolate. We chose to only do the S

RNA because a whole genome reverse genetics system would need all three genome segments representing separate transcription and replication units along with T7 RNA polymerase, 3 silencing suppressors, and the nucleocapsid. Not to mention the M and L RNAs are much larger than the S RNA, 4.8, 8.9 and 2.9 kb respectively. The S RNA was too big to ligate as a whole segment and had to be cloned as two halves to reconstitute a whole S RNA.

All known steps were taken to produce constructs that should be able to mimic the

TSWV life cycle but there was no success in planta. PZPRiboTerm-sGFP, used as a proof of concept, was infiltrated along with PZP-HCPro into WT N. benthamiana, and transgenic N. benthamiana expressing RCNMV MP. The RCNMV MP is a cell-to-cell movement protein that increases the size exclusion limit of the plasmodesmata and binds ssRNA to move them to other cells (Vaewhongs & Lommel, 1995). The RCNMV MP was also shown to have RNA silencing suppressor activity (Powers et al., 2008a) so that MP+ plants would provide transgenically expressed suppressor above and beyond the ones introduced by Agroinfiltration. A second infiltration included the same constructs with the addition of the pCAM T7 RNAP. A control infiltration of a PZP-GFP plasmid was also done by itself and with PZP-HCPro. The controls fluoresced visibly under a hand-held UV light in both WT and MP+ N. benthamiana but not the

PZPRiboTerm-sGFP. Under a fluorescent microscope minor fluorescence was observed. After confirming the PZPRiboTerm-sGFP construct was transcribing from in vitro transcription, we then made the PZPRiboTerm-S RNA and PZPRiboTerm-GFP-S constructs. In vitro transcription of linearized PZPRiboTerm-GFP-S showed successful high levels of transcription.

131

PZPRiboTerm-GFP-S was then co-infiltrated with three silencing suppressors HCPro, p19, and

TCV CP, and pCAM-T7RNAP in conjunction with the same controls mentioned previously. The controls showed no fluorescence in either WT or MP+ N. benthamiana but the PZPRiboTerm-

GFP-S will not fluoresce unless infected with a TSWV isolate providing an active viral polymerase.

The PZPRiboTerm-sGFP control was not helped by the addition of three silencing suppressors HCPro, p19, and TCV CP in agro infiltration, but when used in Ganesan et al.

(2013) they greatly increased fluorescent GFP foci as well as in Chiba et al. (2006). It is also possible that the reporter gene would have fluoresced if given a longer period of time. In the

SYNV system GFP expression was given 2-3 weeks and expression increased after 1 week. In testing for GFP expression in our system we waited 3-5 dpi, which is typically enough time for expression of Agrobacterium plasmids. The failure of the PZPRiboTerm-sGFP control may also be due to the infiltration buffer, which contains acetosyringone, MgCl2 and 2-(N- morpholino)ethanesulfonic acid (MES). The infiltration buffer could have contained expired reagents used to make it since even plasmids that fluoresced previously no longer did.

Acetosyringone is a chemical secreted by plants at wound sites to elicit virulence by pathogens or A. tumefacians in this case. The MgCl2 is to maintain cell homeostasis during infiltration and

MES regulates the pH of reaction mixtures. If any of the reagents or if the buffer varies from a pH of 5.6 it may no longer be viable for infiltration.

If constructs had worked the next step would have been mechanically inoculating N. benthamiana with the TSWV isolate to be tested 1-2 days post-infiltration because it takes 1 day for expression of the agro plasmids. Reassortants would be selected for by sap transmission of the infection to a local lesion host either N. tabacum c.v. “Burley 21” or N. glutinosa (Sin et al.,

132

2005; Whitfield et al., 2008). Individual lesions would be inoculated back onto N. benthamiana to increase viral quantities of a single reassortment. We would then PCR amplify the reassortant virus and check for presence of the BspHI and XbaI restriction sites engineered into the N sequence as genetic markers that would differentiate it from the WT sequence.

In our approach the PZPRiboTerm-S construct was in the genomic (g) sense instead of antigenomic (ag) sense. agRNA transcripts yield more efficient recovery of recombinant virus than gRNA transcripts (Neumann et al., 2002; Walpita & Flick, 2005; Ganesan et al., 2013). This is because agRNA orientation would circumvent hybridization of naked gRNAs and core protein mRNA transcripts, such as the nucleocapsid, to form double-stranded RNAs that could interfere with the template activities of the RNAs and trigger potential antiviral responses (Wang et al.,

2015). Although, several studies have shown it is possible to rescue recombinant viruses from constructs in the genomic sense but with lower efficiency (Durbin et al., 1997; Kato et al., 1996;

Neumann et al., 2002). This would not be an issue with the PZPRiboTerm-GFP-S construct since the nucleocapsid was replaced with GFP.

In most viruses there is a protein that regulates genome replication and transcription. For

TSWV the amount of N protein dictates the switch between replication and transcription (Snippe et al., 2005), although the details of how it does this are not understood. The overexpression of N may lead to a negative regulatory effects that have been seen in other systems (Carroll &

Wagner, 1979; Clinton et al., 1978; Finke & Conaelmann, 2003; Hoenen et al., 2010; Iwasaki et al., 2009; Lopez et al., 2001). The SYNV system found that differing amounts of certain proteins could greatly increase or decrease expression of reporter genes. When only the polymerase protein was included with a vector containing all viral core proteins they saw a 14% increase, while addition of the other core proteins reduced expression (Wang et al., 2015).

133

While there are numerous reports of T7 working for segmented NSR viruses, it was found not to work for Rice stripe tenuivirus (K.-H. Kim, personal communication), which is a plant virus consisting of four ssRNA genome segments encoding seven proteins. Outside the use of readily available T7 expressing cell lines and not having to infiltrate expression plasmids into plants, the technical difficulties of producing animal NSR T7-driven reverse genetics systems are the same as plant NSRs. Possibly it is too difficult to get all the necessary components present and working in individual plant cells. One thing we did not do was check the 5’ and 3’ terminal ends to make sure the correct sequence was present. If there are mismatched bases, insertions, deletions, or even additional bases added to either end, the panhandle configuration necessary for replication and transcription may not form properly and in turn inhibit viral polymerase binding, initiation or elongation. There is also the possibility that the capped S RNA transcripts derived in planta from PZPRiboTerm-S are not efficiently recognized by the L protein even if expression had been successful as TSWV gRNAs are uncapped. The PZPRiboTerm-sGFP transcripts are also not capped when produced by T7 RNA polymerase but the TEV leader should provide high levels of transcription independent of a cap structure.

To date the TSWV reverse genetics system has eluded researchers because of the difficult nature of the segmented genome, the process of infiltrating numerous plasmids into plant cells and lack of available cell lines expressing the T7 RNA polymerase. We had hoped with a successful system to introduce mutations found in a next-generation sequencing analysis (Brown, unpublished), into the S RNA and see if T. tabaci were still able to transmit the virus. This would hopefully allow us to define a genetic determinant(s) of transmission. Even though there was no success in planta, the plasmids developed here are large steps for future research to continue attempting a partial reverse genetics system for TSWV.

134

Acknowledgements

This work was supported by USDA NIFA Coordinated Agricultural Project Grant 2012-68004-

20166.

135

Literature Cited

Acrani, G.O., Tilston-Lunel, N., Spiegel, M., Weidmann, M., Dilcher, M., Andrade da Silva,

D.E., Nunes, M.R.T., and Elliot, R.M. 2014. Establishment of a minigenome system for

Oropouche Orthobunyavirus reveals the S genome segment to be significantly longer than

previously reported. J. Gen. Virol. 96(3): 513-523.

Albariño, C.G., Bergeron, É., Erickson, R., Khristovea, M.L., Rollin, P.E., and Nichol, S.T.

2009. Efficient reverse genetics generation of infections junin viruses differing in

glycoprotein processing. J. Virol. 83(11): 5606-5614.

Ball, L.A. 1994. Replication of the genomic RNA of a positive-strand RNA animal virus from

negative-sense transcripts. PNAS 91(26): 12443-12447.

Black, L.M. 1979. Vector cell monolayers and plant viruses. Adv. Virus. Res. 25: 191-271.

Bandla, M. D., Campbell, L. R., Ullman, D. E., and Sherwood, J. L. 1998. Interaction of tomato

spotted wilt tospovirus (TSWV) glycoproteins with a thrips midgut protein, a potential

cellular receptor for TSWV. Phytopathol. 88(2): 98–104.

Boyce, M., Celma, C.C.P., and Roy, P. 2008. Development of reverse genetics systems for

bluetongue virus: recovery of infectious virus from synthetic RNA transcripts. J. Virol.

82(17): 8339-8348.

Brennan, B., Li, P., Zhang, S., Li, A., Liang, M., Li, D., and Elliot, R.M. 2015. Reverse genetics

system for severe fever with thrombocytopenia syndrome virus. J. Virol. 89(6): 3026-3037.

Bridgen, A., and Elliot, R.M. 1996. Rescue of a segmented negative-strand RNA virus entierely

from cloned complementary DNAs. Proc. Natl. Acad. Sci. USA 93: 15400-15404.

Carroll, A.R. and Wagner, R.R. 1979. Role of the membrane (M) protein in endogenous

inhibition of in vitro transcription by vesicular stomatitis virus. J. Virol. 29: 134-142.

136

Chiba, M., Reed, J.C., Prokhnevsky, A.I., Chapman, E.J., Mawassi, M., Koonin, E.V.,

Carrington, J.C., and Dolja, V.V. 2006. Diverse suppressors of RNA silencing enhance

agroinfection by a viral replicon. Virology 346: 7-14.

Clinton, G.M., Little, S.P., Hagen, F.S., and Huang, A.S. 1978. The matrix (M) protein of

vesicular stomatitis virus regulates transcription. Cell 15: 1455-1462. de Haan, P., Wagemakers, L., Peters, D., and Goldbach, R. 1990. The S RNA Segment of

Tomato Spotted Wilt Virus Has an Ambisense Character. J. Gen. Virol. 71(5): 1001–1007. de Haan, P., Kormelink, R., de Oliveira Resende, R., van Poelwijk, F., Peters, D., and Goldbach,

R. 1991. Tomato Spotted Wilt Virus L RNA Encodes a Putative RNA Polymerase. The J.

gen. virol. 72 (9): 2207–2216. de Wit, E., Spronken, M.I.J., Vervaet, G., Rimmelzwaan, G.F., Osterhaus, A.D.M.E., and

Fouchier, R.A.M. 2007. A reverse genetics system for Influenza A virus using T7 RNA

polymerase. J. Gen. Virol. 88: 1281-1287.

Durbin, A.P., Hall, S.L., Siew, J.S., Whitehead, S.S., Collins, P.L., and Murphy, B.R. 1997.

Recovery of infectious human parainfluenza virus type 3 from cDNA. Virology 235: 323-

332.

Elliot, R.M., Blakqori, G., van Knippenberg, I.C., Koudrikova, E., McLees, P.L.A., Shi, X., and

Szemiel, A.M. 2013. Establishment of a reverse genetics system for Schmallenberg virus, a

newly emerged orthobunyavirus in Europe. J. Gen. Virol. 94: 851-859.

Fink, S. and Conzelmann, K.K. 2003. Dissociation of rabies virus matrix protein functions in

regulation of viral RNA synthesis and virus assembly. J. Virol. 77: 12074-12082.

Fuerst, T.R., Niles, E.G., Studier, F.W., and Moss, G. 1986. Eukaryotic transient expression

system bassed on recombinatnt vaccinia virus that synthesizes bacteriophage T7 RNA

137

polymerase. Proc. Natl. Acad. Sci. USA. 100:2002-2007.

Ganesan, U., Bragg, J.N., Deng, M., Marr, S., Lee, M.Y., Qian, S., et al. 2013. Construction of a

Sonchus Yellow Net Virus Minireplicon: A Step toward Reverse Genetic Analysis of Plant

Negative-Strand RNA Viruses. J. Virol. 87(19): 10598–10611.

Gelvin, S.B 2003. Agrobacterium-mediated plant transformation: The biology behind the "gene-

jockeying" tool. Microbiol. Mol. Biol. Rev. 67: 16-37.

Habjan, M., Penski, N., Spiegal, M., and Weber, F. 2008. T7 RNA polymerase-dependent and -

independent systems for cDNA-based rescue of rift valley fever virus. J. Gen. Virol. 89:

2157-2166.

Hellens, R. Mullineaux, P., and Klee, H. 2000. Technical focus: A guide to Agrobacterium

binary Ti vectors. Trends in Plant Sci. 5: 446-451.

Hoenen, T., Jung, S., Herwig, A., Groseth, A., and Becker, S. 2010. Both matrix proteins of

Ebola virus contribute to the regulation of viral genome replication and transcription.

Virology 403: 56-66.

Hoenen, T., Groseth, A., de Kok-Mercado, F., Kuhn, J.H., and Wahl-Jensen, V. 2011.

Minigenomes, Transcription and Replication Competent Virus-like Particles and beyond:

Reverse Genetics Systems for Filoviruses and Other Negative Stranded Hemorrhagic Fever

Viruses. Antiviral Research 91(2): 195–208.

Hoffmann, E., Neumann, G., Kawaoka, Y., Hobom, G., and Webster, R.G. 2000. A DNA

transfection system for generation of influenza A virus from eight plasmids. Proc. Natl.

Acad. Sci. USA 97: 6108-6113.

Ikegami, T., Won, S., Peters, C.J., and Makino, S. 2006. Rescue of infectious reift valley fever

virus entirely from cDNA, analysis of virus lacking the NSs gene, and expression of a

138

foreign gene. J. Virol. 80: 2933-2940.

Iwasaki, M., Takeda, M., Shirogane, Y., Nakatsu, Y., Nakamura, T., and Yanagi, Y. 2009. The

matrix protein of measles virus regulates viral RNA synthesis and assembly by interacting

with the nucleocapsid protein. J. Virol. 83: 10374-10383.

Jacobson, A. L. & Kennedy, G. G. 2013. Specific insect-virus interactions are responsible for

variation in competency of different Thrips tabaci isolines to transmit different tomato

spotted wilt virus isolates. PLOS ONE, 8(1): e54567.

Kato, A., Sakai, Y., Shiodoa, T., Kondo, T., Nakanishi, M., and Nagai, Y. 1996. Initiation of

Sendai virus multiplication from transfected cDNA or RNA with negative or positive sense.

Genes Cells 1: 569-579.

Kaye, A.C., Moyer, J.W., Parks, E.J., Carbone, I., and Cubeta, M.A. 2011. Population genetic

analysis of Tomato spotted wilt virus on peanut in North Carolina and Virginia. Phytopahol.

101(1): 147-153.

King, A., Adams, M.J., Carstens, E.B., and Lefkowitz, E.J. 2012. Virus Taxonomy:

Classification and Nomenclature of Viruses: Ninth Report of the International Committee

on Taxonomy of Viruses. (January).

Kormelink, R., de Haan, P., Meurs, C., Peters, D., and Goldback, R. 1992. The Nucleotide

Sequence of the M RNA Segment of Tomato Spotted Wilt Virus, a Bunyavirus with Two

Ambisense RNA Segments. J. Gen. Virol. 73(11): 2795–2804.

Kormelink, R., Storms, M., Van Lent, J., Peters, D., and Goldbach R. 1994. Expression and

Subcellular Location of the NSM Protein of Tomato Spotted Wilt Virus (TSWV), a Putative

Viral Movement Protein. Virology 200(1): 56–65.

Lawson, N. D., Stillman, E. A., Whitt, M.A., and Rose, J.K. 1995. Recombinant Vesicular

139

Stomatitis Viruses from DNA. Proc. Natl. Acad. Sci. 92(10): 4477–81.

Lian, S., Lee, J-S., Cho, W.K., Yu, J., Kim, M-K., Choi, H-S., and Kim, K-H. 2013.

Phylogenetic and recombination analysis of Tomato spotted wilt virus. PLOS One 8(5):

e63380.

Lim, H-S., Vaira, A.M., Domier, L.L., Lee, S.C., Kim, H.G., and Hammond, J. 2010. Efficiency

of VIGS and gene expression in a novel bipartite potexvirus vector delivery system as a

function of strength of TGB1 silencing suppression. Virology 402: 149-163.

Lowen, A.C., Noonan, C., McLees, A., and Elliot R.M. 2004. Efficient bunyavirus rescue from

cloned cDNA. Virology 330: 493-500.

Lopez, N., Jacamo, R., and Franze-Fernandez, M.T. 2001. Transcription and RNA regulation of

tacaribe virus genome and antigenome analogs require N and L proteins: Z protein is an

inhibitor of these processes. J. Virol. 75: 12241-12251.

Ma, Y., Wu, W., Chen, H., Liu, Q., Jia, D., Mao, Q., Chen, Q., Wu, Z., and Wei, T. 2013. An

Insect Cell Line Derived from the Small Brown Planthopper Supports Replication of Rice

Stripe Virus, a Tenuivirus. J. Gen Virol. 94(6): 1421–25.

Margaria, P., Ciuffo, M., and Turina, M. 2007. Evidence that the nonstructural protein of Tomato

spotted wilt virus is the avirulence determinant in the interaction with resistant pepper

carrying the TSW gene. Mol. Plant Microbe Interact. 20: 547-558.

Margaria, P., Bosco, L., and Vallino, M. 2014. The NSs protein of Tomato spotted wilt virus is

required for persistent infection and transmission by Frankliniella occidentalis. J. Virol.

88(10): 5788–5802.

140

Marillonnet, S., C. Thoeringer, R. Kandzia, V. Klimyuk and Y. Gleba. 2005. Systemic

Agrobacterium tumefaciens-mediated transfection of viral replicons for efficient transient

expression in plants. Nature Biotechnology 23(6): 718-723.

Montero-Astúa, M., Rotenberg, D., Leach-Kieffaber, A., Schneweis, B.A., Park, S., Park, J.K.,

German, T.L., and Whitfield, A.E. 2014. Disruption of vector transmission by a plant-

expressed viral glycoprotein. Mol. Plant Microbe Interact. 27(3): 296–304.

Neumann, G., Watanabe, T., Ito, H., Watanabe, S., Goto, H., Gao, P., Hughes, M., Perez, D.R.,

Donis, R., Hoffmann, E., Hobom, G., and Kawaoka, Y. 1999. Generation of influenza A

viruses entirely from cloned cDNAs. Proc. Natl. Acad. Sci. USA. 96: 9345-9350.

Neuman, G., Whitt, M.A., and Kawaoka, Y. 2002. A decade after the generation of a negative-

sense RNA virus from cloned cDNA-what have we learned? J. Gen. Virol. 83: 2635-2662.

Nguyen, H.T., Leelavathi, S., and Reddy, V.S. 2004. Bacteriophage T7 RNA polymerase-

directed, inducible and tissue specific over-expression of foreign genes in transgenic plants.

Plant Biotechnology Journal 2: 301-310.

Överby, A.K., Popov, V., Neve, E.P.A., and Pettersson, R.F. 2006. Generation and analysis of

infectious virus-like particles of UuKuniemi virus (Bunyaviridae): a useful system for

studying bunyaviral packageing and budding. Journal of Virology 80(21): 10428-10435.

Pappu, H.R., Jones, R.A., and Jain, R.K. 2009. Global status of tospovirus epidemics in diverse

cropping systems: successes achieved and challenges ahead. Virus Res. 141(2): 219-236.

Peiró, A., Cañizares, M.C., Rubio, L., López, C., Moriones, E., Aramburu, J., and Sánchez-

Navarro, J. 2014. The movement protein (NSm) of Tomato spotted wilt virus is the

avirulence determinant in the tomato Sw-5 gene-based resistance. Mol. Plant Pathol. 15(8):

802-813.

141

Peretz, Y., Levy, M., Avisar, E., Edelbaum, O., Rabinowitch, H., and Sela, I. 2008. A T7-driven

silencing systems in transgenic plants expressing T7 RNA polymerase is a nuclear process.

Transgenic Res. 17: 665-677.

Perez, M., Sanchez, A., Cubitt, G., Rosario, D., and de la Torre, J.C. 2003. A reverse genetics

system for Borna disease virus. J. Gen. Virol. 84: 3099-3104.

Petty, I.T.D., Hunter, B.G., Wei, N., and Jackson, A.O. 1989. Infectious Barley stripe mosaic

virus RNA transcribed in vitro from full-length genomic cDNA clones. Virology 171: 342-

349.

Powers, J.G., Sit, T.L., Heinsohn, C., George, C.G., Kim, K-H., and Lommel, S.A. 2008. The

Red clover necrotic mosaic virus RNA-2 encoded movement protein is a second suppressor

of RNA silencing. Virology 381(2): 277-286.

Powers, J.G., Sit, T.L., Qu, F., Morris, T.J., Kim, K-H., and Lommel, S.A. 2008. A versatile

assay for the identification of RNA silencing suppressors based on complementation of viral

movment. MPMI 221(7): 879-890.

Qiu, W.P., Geske, S.M., Hickey, C.M., and Moyer, J.W. 1998. Tomato spotted wilt Tospovirus

genome reassortment and genome segment-specific adaptation. Virology 224(1): 186-194.

Radecke, F., Spielhofer, P., Schneider, H., Kaelin, K., Huber, M., Dotsch, C., Christiansen, G.,

and Billeter, M.A. 1995. Rescue of measles viruses from cloned DNA. EMBO J. 14: 5773-

5784.

Riley, D.G., Joseph, S.V., Srinivasan, R., and Diffie, S. 2011. Thrips vectors of tospoviruses. J.

Integrat Pest Manage 1:1-10.

Schnell, M. J., Mebatsion, T., and Conzelmann, K.K. 1994. Infectious Rabies Viruses from

Cloned CDNA. EMBO J. 13(18): 4195–4203.

142

Sin, S., B.C. McNulty, G.G. Kennedy, J.W. Moyer. 2005. Viral genetic determinants for thrips

transmission of Tomato spotted wilt virus. PNAS 102(14): 5168-5173.

Snippe, M., Goldbach, R., and Kormelink, R. 2005. Tomato Spotted Wilt Virus Particle

Assembly and the Prospects of Fluorescence Microscopy to Study Protein-Protein

Interactions Involved. Adv. Virus Res. 65(5): 63–120.

Takeda, A., Sugiyama, K., Nagano, H., Mori, M., Kaido, M., Mise, K., Tsuda, S., and Okuno, T.

2002. Identification of a novel RNA silencing suppressor, NSs protein of Tomato Spotted

Wilt Virus. FEBS Letters 532: 75–79.

Tentchev, D., Verdin, E., Marchal, C., Jacquet, M., Aguilar, J.M., and Moury, B. 2011.

Evolution and structure of Tomato spotted wilt virus populations: evidence of extensive

reassortment and insights into emergence process. J. Gen. Virol. 92: 961-973.

Tsompana, M., Abad, J., Purugganan, M., and Moyer, J.W. 2004. The molecular population

genetics of the Tomato spotted wilt virus (TSWV) genome. Molecular Ecology 14(1): 53-

66.

Vaewhongs, A.A. and Lommel, S.A. 1995. Virion formation is required for the long-distance

movement of Red clover necrotic mosaic virus in movement protein transgenic plants.

Virology 212(2): 607-613.

Wagner, E., Engelhardt, O.G., Gruber, S., Haller, O., and kochs, G. 2001. Rescue of recombinant

Thogoto virus from cloned cDNA. J. Virol. 75: 9282-9286.

Walpita, P. and Flick, R. 2005. Reverse genetics of negative-stranded RNA viruses: a global

perspective. FEMS Microbiol. Lett. 244: 9-18.

Wang, Q., Ma, X., Qian, S., Zhou, X., Sun, K., Chen, X., Zhou, X., Jackson, A.O., and Li, Z..

2015. Rescue of a plant negative-strand RNA virus from cloned cDNA: Insights into

143

enveloped plant virus movement and morphogenesis. PLoS Pathogens 11(10): 1–19.

Whelan, S. P., Ball, L.A., Barr, J.N., and Wertz, G.T. 1995. Efficient recovery of infectious

vesicular stomatitis virus entirely from cDNA clones. Proc. Natl. Acad. Sci. USA 92(18):

8388–8392.

Whitfield, A. E., Kumar, N.K.K., Rotenberg, D., Ullman, D.E., Wyman, E.A., Zietlow, C.,

Willis, D.K., and German, T.L. 2008. A soluble form of the tomato spotted wilt virus

(TSWV) glycoprotein GN ( GN -S ) inhibits transmission of TSWV by Frankliniella

occidentalis. Phyopathology 98(1): 45–50.

Yang, S., Carter, S.A., Cole, A.B., Cheng, N., and Nelson, R.S. 2004. A natural variant of a host

RNA-dependent RNA polymerase is associated with increased susceptibility to viruses

by Nicotiana benthamiana. PNAS 101(16): 6297-6302.

Zeitoune, S., Livneh, O., Kuzuetzova, L., Stram, Y., and Sela, I. 1999. T7 polymerase drives

transcription of a reporter gene from T7 promoter, but engenders post-transcriptional

silencing of expression. Plant Science 141: 59-65.

Zobel, A., Neumann, G., and Hobom, G. 1993. RNA polymerase I catalyzed transcription of

insert viral cDNA. Nucl. Acids Res. 21: 3607-3614.

144

Table 4.1. Primers designed for all devleoped plasmids.

Primer Name Primer Sequence (5'-3')a 5' HepD AATTGAATTCGGATCCTCGAGCCCGGGTCGGCATGGCATCTCC 3' HepD TTAAAGCTTGGTACCCAGCTCTCCCTTAGCC T7 Term Fb CTAGCTAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGA T7 Term R AGCTTCAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGGTAC TSWVNC5’PCI AATTACATGTCTAAGGTTAAGCTCACTAAGG TSWVNC3’XBA AATTTCTAGATTAAGCAAGTTCTGYGAGTTTTGCC TSWVBamXbaNCSTOP AATTGGATCCTCTAGACAAGTTCTGTGAGTTTTGCC TSWV S (-)c AGAGCAATTGTGTCAATTTTATTC BamT7TSWVS AATTGGATCCTAATACGACTCACTATAGAGAGCAATTGTGTCAKAATTTTG TSWVNCXBAXHO 1507(- AATTCTCGAGTCTAGAAGCAGCTGTAAGTTAAATTATAAAAAGCC ) BAM-T7TEVLeader AATTGGATCCTAATACGACTCACTATAGCTCAACACAACATATACAAAAC 35SpolyA(-) GATTTTGGTTTTAGGAATTAG a Underlined, T7 promoter sequence; italics, restriction enzyme sites.

b T7 Term primers were used only for annealing to make the T7 terminator c TSWV S (-) was used for both as a cDNA and a PCR primer

145

Figure 4.1 Organization and expression strategy for the TSWV genome (Snippe et al., 2005). The negative-sense RNA genome is transcribed into virus-complementary RNA (vcRNA), which acts as a template for transcription of additional copies of genomic RNAs. Transcription from the negative-sense RNA also yields positive-sense subgenomic RNAs which translation of the viral RdRp, N, and GnGc occurs. In the case of the nonstructureal proteins NSs and NSm, which are encoded in the opposite orientation relative to the other three viral proteins, transcription from the vcRNA yields subgenomic RNAs for translation to proteins.

146

Figure 4.2. Depiction of the PZPRiboTerm plasmids. A) PZPRiboTerm-S encoding the S RNA with the T7 promoter, T7 Terminator and Hepatitis δ ribozyme. B) The S RNA with GFP replacing the nucleocapsid, with the T7 promoter, T7 Terminator and Hepatitis δ ribozyme.

147

TEV HCpro T7 RNA Polymerase

TBSV p19 Nucleocapsid

35S Promoter

TCV CP 35S Terminator

Figure 4.3. Depiction of pPZP212 plasmids with a 35S promotor and terminator. TEV HCpro, TBSV p19 and TCV CP are all suppressors of RNA silencing. T7 RNA polymerase recognizes the plasmids with T7 promoters in Fig. 4.2. Nucleocapsid is vital to the virus life cycle and has to be provided artificially to encapsidate the RNAs produced by the T7 polymerase.

148

Figure 4.4. Confirmation of sGFP ligation into PZPRiboTerm by digestion with BamHI and BglII. I) Non-digested control plasmid, II) Digested control plasmid, III) Non-digested PZPRiboTerm-sGFP, IV) Digested PZPRiboTerm-sGFP plasmid cleaving out the sGFP fragment shown in the white box.

149

Figure 4.5. In vitro transcription of PZPRiboTerm-sGFP. I) Non-linearized transcribed plasmid, II) Plasmid linearized with HindIII showing the template can be transcribed and the ribozyme is active, shown in the white box.

150

Figure 4.6. Confirmation of the ligations of the 3’S RNA and the full length S RNA into PZPRiboTerm. A. I) Non-digested PZPRiboTerm-3’NC plasmid II) XbaI and HindIII digest of the PZPRiboterm-3’NC cleaving out the 3’NC insert. B. I) Non-digested plasmid control, II) Digested control plasmid, III) Non-digested PZPRiboTerm-S plasmid, IV) PZPRiboTerm-S plasmid BamHI and NcoI digested to cleave out the S RNA.

151

Figure 4.7. NcoI and BamHI digests of PZPRiboTerm-GFP-S confirming ligation of the sGFP into PZPRiboTerm-S. I) Non-digested control plasmid, II) Digested control plasmid, III) Non-digested plasmid IV) Digested plasmid not containing the S RNA-sGFP insert, V) Non- digested plasmid, VI) Digested plasmid containing S RNA and sGFP, shown in the white box.

152

Figure 4.8. In vitro transcription of the PZPRiboTerm-GFP-S plasmid. The plasmid was linearized with XbaI and was successfully transcribed and showing the ribozyme is functional, shown in the white box.

153

Figure 4.9. Confirmation of the nucleocapsid in the pRTL2 and pPZP212 plasmids. A. I) Control pRTL2 plasmid digested with HindIII, II) pRTL2 plasmid containing the nucleocapsid digested with HindIII, shown in the white box. B. I) pPZP212 control plasmid non-digested, II) pPZP212 control digested with HindIII, III) Non-digested pPZP212 plasmid containing the nucleocapsid and 35S promoter (PZP-NC), IV) HindIII digested PZP-NC confirming the presence of the nucleocapsid, shown in the white box.

154

APPENDICES

155

Appendix A

Chapter 2 Supporting Information

Table S1. The Thrips tabaci isoline-Tomato spotted wilt virus (TSWV) isolate pairings included in this study, and the number of adult T. tabaci in each isoline that transmitted or did not transmit each TSWV isolate. Thrips and leaf tissue used in study are the same reported in Jacobson and Kennedy (2013) and were stored at -80°C until used in this study.

Number of thrips TSWV Thrips Transmitting Nontransmitting Total Isolate Isoline AM1 IPOC1* 5 5 10 AM1 Kin1 5 5 10 AM1 SH2 4 5 9 AM1 SH72 4 5 9 SH3 IPOC1 2 6 8 SH3 Kin1 1 4 5 SH3 SH2* 5 5 10 SR3-3 IPOC1* 3 5 8 SR3-3 Kin1 2 5 7 SR3-3 SH2 4 5 9 SR3-3 SH72 3 6 9 SHP SH2* 6 5 11

44 61 105

156

Table S2. F. occidentalis primers tested as possible internal control genes for Thrips tabaci qPCR experiments. Gene Primer Name Primer Sequence (5'-3') Reference β-actin WFT-RNA-25F F: GGTATCGTCCTGGACTCTGGTG Boonham et al. (2002) WFT-RNA-26F F: GTATCGTCCTGGACTCTGGTGA Boonham et al. (2002) WFT-RNA-93R-C R: GGGGAAGGGCGTAACTTCA Boonham et al. (2002) WFT-RNA-94R-B R: GGGGAAGGGCGTAACCTTC Boonham et al. (2002) WFT-RNA-93R-D R: GGGGAAGGGCGTAACCTTCAT Boonham et al. (2002) WFT-RNA-92R R: GGGGAAGGGCGTAACCTTCATAG Boonham et al. (2002) Actin F CCTCATCCCTAGTTGTCTTGTG Yang et al. (2014) Actin R TTCTCGCTCAGCTGTAATTGT NADH- ubiquinoneoxidoreductase NADH F: AGCTACTAAACCGCCTCATAAA Yang et al. (2014) R: GGTGGTTATGGTATTTATCGTTTGT α-tubulin Tubulin F: GTGGACAACGAAGCCATCTA Yang et al. (2014) R: CGGTTCAGGTTGGTGTAGG heat shock protein 90 HSP90 F: CTCGCAACCAGGACGATATTAG Yang et al. (2014) R: CTGACCCTCCACAGAGAAATG heat shock protein 70 HSP70 F: GTCACCGTACCCGCATATTT Yang et al. (2014) R: GCAGTGGGCTCGTTGATAATA heat shock protein 60 HSP60 F: CTGGACTGTAAGCGTGCTATAA Yang et al. (2014) R: GGCACGATGAACACCTATGA vacuolar type H+ -ATPase ATPase F: TACCAAATGGGACTCCAATACC Yang et al. (2014) R: GTAAGTAAGAGGTGGCCAGATAC ribosomal protein l32 RPL32 F: CTGGCGTAAACCTAAGGGTATT Yang et al. (2014) R: GTCTTGGCATTGCTTCCATAAC F: CAACATCGGTTATGGAAGCA Zheng et al. (2014) R: ACAGCGTGGGCAATTTCAGC 28S ribosomal RNA 28S F: GGGTGGTAAACTCCATCTAAGG Yang et al. (2014) R: CACGTACTCTTGAACTCTCTCTTC 18S ribosomal RNA 18S F: CTGCGGAAATACTGGAGCTAATA Yang et al. (2014)

157

Table S2. (Continued). R: AAGTAGACGATGGCCGAAAC F: AACACGGGAAACCTCACCA Zheng et al. (2014) R: CAGACAAATCGCTCCACCAA elongation factor 1 α EF1A F: AAGGAACTGCGTCGTGGATA Yang et al. (2014) R: AGGGTGGTTCAGGACAATGA EF-1 F TCAAGGAACTGCGTCGTGGAT Zheng et al. (2014) EF-1 R ACAGGGGTGTAGCCGTTAGAG

158

Table S3. T. tabaci EF1A primers designed from existing Genbank sequences and tested as possible internal control genes for qPCR.

Primer Name Sequence EF1A_315F CGACAACGTTGGTTTCAACATC EF1A_448R GTAGCCGTTGGAGATCTGGCCAGG EF1A_372F CGTCGCTGGTGACTCCAAG EF1A_478R GGCGGTGTGGCAATCCAGCAC EF1A_346F CGTCAAGGAACTTCGTCGTG EF1A_322F GTCGGCTTCAACATCAAGAACG EF1A_414F CGACTTCACCGCACAGGT

EF1A_481R AGCGGTGTGGCAATCCAG

EF1A_431R ACCTGTGCGGTGAAGTCG EF1A_456R CACAGGGGTGTATCCGTTG

159

Table S4. E. sonchifolia internal control primers designed from existing Genbank sequences and tested as possible internal control genes for qPCR.

Gene Primer Name Primer Sequence Reference Sunflower profilin Heli-all-nes_f2 CGTCAATACTTGTTAATATTATTAAGAATTA Laube et al. (2010) Heli-all-r1 ATAGCTTGGCCCGTTTTCTT Laube et al. (2010) Plant tRNA Plant_nes-2-f ATTGAGCCTTGGTATGGAAACCT Laube et al. (2010) Plant_nes-2-r GGATTTGGCTCAGGATTGCC Laube et al. (2010) Plant actin Act-f CAAGCAGCATGAAGATCAAGGT Laube et al. (2010) Act-r CACATCTGTTGGAAAGTGCTGAG Laube et al. (2010) E. sonchifiolia 5.8S rRNA Emilia_5.8S_rRNAF GTGTGAATTGCAGAATCCCGT Emilia_5.8S_rRNAR CATGTGACGCCCAGGCA E. sonchifolia ITS Emilia_ITS2_F GTCACCTCCCAACACACCT Emilia_ITS2_R GCTTTTCGACCACCACTAATC

160

Table S5. TSWV target gene primers from existing literature, and newly designed primers tested as targets for qPCR reactions. Gene Primer Name Primer Sequence Reference Nucleocapsid TSWV-CP-17F F: CTCTTGATGATGCAAAGTCTGTGA Boonham et al. (2002) R: TSWV-CP-100R TCTCAAAGCTATCAACTGAAGCAATAA TSWV N F F: GCTTCCCACCCTTTGATTC Rotenberg et al (2009). TSWV N R R: ATAGCCAAGACAACACTGATC TSW.1 F: TCTGGTAGCATTCAACTTCAA Roberts et al. (2000) TSW.2 R: GTTTCACTGTAATGTTCCATA Mortimer-Jones et al. TSWV-1 For F: AGACAGGATTGGAGCCACTGACAT (2009) TSWV-1 Rev R: TCCCAGTTTCCTCAACAAGCCTGA

L RNA TSWVL_746F F: GGATGCCAATCACTGTTACTAG TSWVL_884R R: CACCACTGTGGGTGTGG TSWVL_2696F F: CTGTCATGATAGGAACTGTGAC TSWVL_2877R R: GAGATCTTCCATTCTGAAC TSWVL_4382F F: GCATGAAYTGGTTRCAAGGC TSWVL_4493R R: CAGAGTGCACAATCCATCTAG TSWVL_4656R R: CRGATGAAGAAGCATAACTC TSWVL_4890F F: CTATTCAATGCTTCCTGGTG TSWVL_4966R R: CTCTAAGGGTGTTTGTACC TSWVL_6394F F: CTGGACACTGCTGTATACATATC TSWVL_6585R R: GTGTTCAATTCACTGTTATGTG TSWVL_6766F F: GGGATCATGACAAGAAGCTG TSWVL_6970R R: GCAYGCATCRCCTGGTTC TSWV_7712F F: CATGCCACAACAATGACTC TSWVL_7919R R: GRTTCTCTCCAGATATAACAAACC TSWVL_7993F F: GTGTTGAGGCTAGATGAGG TSWVL_8192R R: CTRCCCARTCTGTCAGTTG

161

Table S6. Individual T. tabaci Ct values, Standard deviations, normalized abundance ratios, and log10 transformed normalized abundance ratios. Internal Viral L RNA Control Log10 of Virus Thrips EF1A TSWV TSWV L Delta Ct Delta Normalized Sympatry EF1A Ct normalized Isolate Isoline SD L Ct SD SD Ct SE abundance ratio abundance ratio AM1 IPOC1-1 Sympatric 19.514 0.144 21 0.163 1.149 1.083 0.204 -0.69 AM1 IPOC1-2 Sympatric 21.326 0.043 23.42 0.169 1.12 1.068 0.13 -0.887 AM1 IPOC1-3 Sympatric 21.548 0.088 23.514 0.15 1.119 1.067 0.14 -0.854 AM1 IPOC1-4 Sympatric 22.911 0.035 35.675 0.579 1.46 1.244 0 -3.932 AM1 IPOC1-5 Sympatric 29.619 0.334 38.096 0 0 0 0.002 -2.81 AM1 IPOC1-6 Sympatric 20.791 0.018 36.156 2.134 4.024 2.676 0 -4.64 AM1 IPOC1-7 Sympatric 20.718 0.008 36.444 1.007 1.929 1.461 0 -4.741 AM1 IPOC1-8 Sympatric 18.416 0.185 21.763 0.152 1.112 1.063 0.055 -1.26 AM1 IPOC1-9 Sympatric 16.76 0.206 32.358 0.555 1.468 1.248 0 -4.65 AM1 IPOC1-10 Sympatric 20.896 0.076 36.934 0.039 1.055 1.033 0 -4.832 AM1 Kin1-1 Allopatric 21.496 0.016 24.79 0.48 1.367 1.198 0.059 -1.23 AM1 Kin1-2 Allopatric 17.577 0.236 21.513 0.163 1.199 1.11 0.044 -1.357 AM1 Kin1-3 Allopatric 17.759 0.072 21.619 0.068 1.065 1.037 0.046 -1.338 AM1 Kin1-4 Allopatric 18.852 0.055 22.502 0.248 1.18 1.1 0.051 -1.294 AM1 Kin1-5 Allopatric 25.354 0.082 27.043 0.052 1.063 1.036 0.149 -0.828 AM1 Kin1-6 Allopatric 19.891 0.023 22.455 0.229 1.162 1.091 0.1 -1.001 AM1 Kin1-7 Allopatric 19.185 0.086 22.337 0.092 1.084 1.048 0.07 -1.158 AM1 Kin1-8 Allopatric 19.591 0.376 24.167 0.178 1.297 1.162 0.027 -1.566 AM1 Kin1-9 Allopatric 27.389 0.097 31.6 0.087 1.086 1.049 0.027 -1.571 AM1 Kin1-10 Allopatric 20.958 0.01 34.622 0.517 1.401 1.215 0 -4.16 AM1 SH2-1 Allopatric 20.621 0.239 24.111 0.173 1.205 1.113 0.053 -1.273 AM1 SH2-2 Allopatric 21.581 0.091 21.043 0.258 1.194 1.108 0.716 -0.145 AM1 SH2-3 Allopatric 19.993 0.061 37.157 0 0 0 0 -5.138 AM1 SH2-4 Allopatric 20.3 0.058 23.036 0.088 1.07 1.04 0.088 -1.055

162

Table S6 (Continued). AM1 SH2-5 Allopatric 19.383 0.078 22.026 0.065 1.066 1.038 0.096 -1.016 AM1 SH2-6 Allopatric 20.695 0.011 36.177 0 0 0 0 -4.671 AM1 SH2-7 Allopatric 17.214 0.022 33.781 0.605 1.484 1.322 0 -4.931 AM1 SH2-8 Allopatric 18.25 0.074 35.38 0.053 1.059 1.037 0 -5.105 AM1 SH2-9 Allopatric 18.14 0.042 34.042 0.642 1.521 1.345 0 -4.755 AM1 SH72-1 Allopatric 19.842 0.193 28.218 0.076 1.139 1.078 0.002 -2.646 AM1 SH72-2 Allopatric 20.025 0.072 32.05 0.201 1.148 1.083 0 -3.683 AM1 SH72-3 Allopatric 17.976 0.093 36.208 0.766 1.653 1.337 0 -5.413 AM1 SH72-4 Allopatric 17.881 0.359 35.354 0 0 0 0 -5.197 AM1 SH72-5 Allopatric 19.281 0.188 27.362 0.399 1.33 1.179 0.003 -2.555 AM1 SH72-6 Allopatric 19.169 0.403 31.074 0.596 1.588 1.306 0 -3.637 AM1 SH72-7 Allopatric 17.761 0.082 26.299 0.046 1.061 1.035 0.002 -2.664 AM1 SH72-8 Allopatric 17.924 0.028 26.41 0.056 1.042 1.024 0.002 -2.651 AM1 SH72-9 Allopatric 19.609 0.021 37.413 0.838 1.727 1.371 0 -5.314 SH3 IPOC1-1 Allopatric 19.025 0.035 20.516 0.022 1.026 1.015 0.207 -0.685 SH3 IPOC1-2 Allopatric 23.874 0.075 24.273 0.129 1.101 1.057 0.361 -0.442 SH3 IPOC1-3 Allopatric 18.187 0.085 23.437 0.184 1.14 1.079 0.018 -1.738 SH3 IPOC1-4 Allopatric 25.445 0.024 26.355 0.046 1.034 1.02 0.246 -0.609 SH3 IPOC1-5 Allopatric 23.22 0.137 35.325 2.007 3.713 2.527 0 -3.749 SH3 IPOC1-6 Allopatric 19.814 0.004 22.984 0.011 1.007 1.004 0.067 -1.171 SH3 IPOC1-7 Allopatric 17.43 0.14 32.023 0.18 1.157 1.088 0 -4.375 SH3 IPOC1-8 Allopatric 17.843 0.025 33.151 0.196 1.138 1.077 0 -4.583 SH3 Kin1-1 Allopatric 25.468 0.328 35.393 0 0 0 0.001 -3.163 SH3 Kin1-2 Allopatric 19.288 0.278 33.775 0.457 1.412 1.22 0 -4.37 SH3 Kin1-3 Allopatric 19.801 0.163 33.902 0.345 1.28 1.153 0 -4.268 SH3 Kin1-4 Allopatric 26.38 0.293 36.954 0 0 0 0 -3.359 SH3 Kin1-5 Allopatric 17.613 0.266 30.873 0.19 1.229 1.126 0 -4 SH3 SH2-1 Sympatric 20.39 0.017 36.044 0.685 1.564 1.372 0 -4.716 SH3 SH2-2 Sympatric 17.822 0.047 36.781 0.136 1.098 1.067 0 -5.617

163

Table S6 (Continued). SH3 SH2-3 Sympatric 16.814 0.01 35.264 0.904 1.803 1.405 0 -5.459 SH3 SH2-4 Sympatric 17.736 0.033 35.362 0.679 1.558 1.292 0 -5.238 SH3 SH2-5 Sympatric 18.826 0.014 35.478 1.369 2.443 1.675 0 -4.977 SH3 SH2-6 Sympatric 18.207 0.08 36.599 0 0 0 0 -5.462 SH3 SH2-7 Sympatric 20.203 0.014 35.935 0.752 1.634 1.328 0 -4.736 SH3 SH2-8 Sympatric 16.318 0.04 36.075 1.116 2.071 1.673 0 -5.822 SH3 SH2-9 Sympatric 17.263 0.06 34.887 0 0 0 0 -5.231 SH3 SH2-10 Sympatric 17.353 0.03 35.854 0.983 1.899 1.448 0 -5.481 SR3-3 IPOC1-1 Sympatric 23.539 0.01 25.903 0.023 1.017 1.01 0.101 -0.994 SR3-3 IPOC1-2 Sympatric 36.016 0 36.207 0 0 0 0.281 -0.551 SR3-3 IPOC1-3 Sympatric 19.802 0.006 22.218 0.073 1.049 1.028 0.11 -0.957 SR3-3 IPOC1-4 Sympatric 20.321 0.068 34.678 1.007 1.932 1.593 0 -4.348 SR3-3 IPOC1-5 Sympatric 19.597 0.314 37.249 0 0 0 0 -5.271 SR3-3 IPOC1-6 Sympatric 21.626 0.058 36.914 0.231 1.167 1.114 0 -4.629 SR3-3 IPOC1-7 Sympatric 21.351 0.067 24.651 0.035 1.049 1.028 0.059 -1.229 SR3-3 IPOC1-8 Sympatric 19.673 0.026 21.937 0.01 1.018 1.01 0.122 -0.913 SR3-3 Kin1-1 Allopatric 23.856 0.063 25.507 0.041 1.049 1.028 0.16 -0.797 SR3-3 Kin1-2 Allopatric 18.779 0.052 22.546 0.02 1.036 1.02 0.047 -1.326 SR3-3 Kin1-3 Allopatric 22.878 0.134 35.831 0.266 1.212 1.141 0 -3.985 SR3-3 Kin1-4 Allopatric 21.337 0.102 35.025 0.483 1.379 1.204 0 -4.172 SR3-3 Kin1-5 Allopatric 19.501 0.124 34.377 0.608 1.497 1.263 0 -4.483 SR3-3 Kin1-6 Allopatric 18.88 0.024 31.279 0.035 1.028 1.016 0 -3.773 SR3-3 Kin1-7 Allopatric 23.009 0.056 35.132 0 0 0 0 -3.752 SR3-3 SH2-1 Allopatric 20.869 0.116 23.071 0.096 1.1 1.057 0.123 -0.912 SR3-3 SH2-2 Allopatric 23.639 0.114 36.64 0 0 0 0 -4.009 SR3-3 SH2-3 Allopatric 20.394 0.074 22.957 0.028 1.05 1.029 0.098 -1.007 SR3-3 SH2-4 Allopatric 21.708 0.092 24.851 0.055 1.07 1.04 0.065 -1.19 SR3-3 SH2-5 Allopatric 20.952 0.318 21.864 0.093 1.23 1.127 0.284 -0.547 SR3-3 SH2-6 Allopatric 19.744 0.031 22.414 0.007 1.02 1.011 0.094 -1.029

164

Table S6 (Continued). SR3-3 SH2-7 Allopatric 20.203 0.113 36.206 0 0 0 0 -4.812 SR3-3 SH2-8 Allopatric 34.867 0.928 32.584 1.04 2.435 1.672 1.466 0.166 SR3-3 SH2-9 Allopatric 20.103 0.015 22.796 0.033 1.024 1.014 0.091 -1.04 SR3-3 SH72-1 Allopatric 38.784 0.07 35.699 1.326 2.378 1.649 2.184 0.339 SR3-3 SH72-2 Allopatric 20.577 0.034 23.067 0.032 1.03 1.017 0.103 -0.989 SR3-3 SH72-3 Allopatric 19.537 0.014 26.011 0.027 1.15 1.084 0.008 -2.073 SR3-3 SH72-4 Allopatric 20.278 0.215 26.609 0.063 1.294 1.161 0.013 -1.892 SR3-3 SH72-5 Allopatric 19.981 0.047 25.004 0.18 1.129 1.072 0.02 -1.698 SR3-3 SH72-6 Allopatric 25.792 0.067 0 0 0 0 0 0 SR3-3 SH72-7 Allopatric 22.153 0.11 35.986 0 0 0 0 -4.225 SR3-3 SH72-8 Allopatric 20.765 0.089 35.481 0.025 1.059 1.034 0 -4.456 SR3-3 SH72-9 Allopatric 29.948 0.166 35.95 0.652 1.549 1.358 0.008 -2.113 SHP SH2-1 Sympatric 18.822 0.108 21.629 0.107 1.102 1.057 0.088 -1.055 SHP SH2-2 Sympatric 18.391 0.046 22.988 1.456 2.587 1.731 0.028 -1.556 SHP SH2-3 Sympatric 20.036 0.164 22.595 0.166 1.16 1.09 0.1 -1.001 SHP SH2-4 Sympatric 19.764 0.046 22.956 0.082 1.063 1.036 0.067 -1.177 SHP SH2-5 Sympatric 23.045 0.074 24.37 0.077 1.071 1.04 0.203 -0.693 SHP SH2-6 Sympatric 26.503 0.065 28.727 0.089 1.073 1.042 0.101 -0.996 SHP SH2-7 Sympatric 18.23 0.381 24.342 0.04 1.269 1.147 0.01 -1.983 SHP SH2-8 Sympatric 27.938 0.198 36.227 0 0 0 0.002 -2.734 SHP SH2-9 Sympatric 18.354 0.078 33.948 0.915 1.82 1.413 0 -4.671 SHP SH2-10 Sympatric 19.939 0.078 21.807 0.087 1.077 1.044 0.157 -0.804 SHP SH2-11 Sympatric 18.55 0.042 23.214 0.062 1.049 1.028 0.026 -1.577

= Transmitting

= Non-transmitting

165

Figure S1. T. tabaci internal control and L RNA melt curves. The thrips internal control (EF1A) primers and TSWV target (L RNA) are shown for multiple samples with sharp single peaks indicating high specificity, amplification, and one product for each primer pair. Negative controls with no template controls are also shown to indicate no contamination or primer dimers.

166

Figure S2. Slope of the line for EF1A 346F and 456R primer pair. The slope is required for the primer efficiency calculation E=10-1/slope and is obtained by using a dilution series of cDNA and plotting the log of the concentrations against the Ct values from RT-qPCR.

167

Figure S3. E. sonchifolia internal control and L RNA melt curves. The leaf tissue internal control (5.8S rRNA) primers and TSWV target (L RNA) are shown for multiple samples with sharp single peaks indicating high specificity, amplification, and one product for each primer pair. Negative controls with no template are also shown to indicate no contamination or primer dimers.

168

Figure S4. Slope of the line for Emilia 5.8S rRNA F and R primer pair. The slope is required for the primer efficiency calculation E=10-1/slope and is obtained by using a dilution series of cDNA and plotting the log of the concentrations against the Ct values from RT-qPCR.

169

Figure S5. Slope of the line for TSWV L 4382F and 4493R primer pair. The slope is required for the primer efficiency calculation E=10-1/slope and is obtained by using a dilution series of cDNA and plotting the log of the concentrations against the Ct values from RT-qPCR.

170

Transmitting

Nontransmitting

Figure S6. Normalized virus titer for each individual T. tabaci for all thrips tested. Means are presented for each single T. tabaci tested for TSWV titer and shown for all virus isolates and thrips isofemale lines separately. Transmitting individuals are in white solid bars and nontransmitting individuals are in black solid bars.

171

Appendix B

Chapter 3 Supporting Information

Table S1. The T. tabaci Virus isolate-thrips isoline pairings that were extracted from individual thrips. Virus Thrips Sympatry Transmission Isolate Isoline AM1 IPOC1-1 Sympatric Transmitting AM1 IPOC1-2 Sympatric Transmitting AM1 IPOC1-3 Sympatric Transmitting AM1 IPOC1-4 Sympatric Transmitting AM1 IPOC1-5 Sympatric Transmitting AM1 IPOC1-6 Sympatric Non-transmitting AM1 IPOC1-7 Sympatric Non-transmitting AM1 IPOC1-8 Sympatric Non-transmitting AM1 IPOC1-9 Sympatric Non-transmitting AM1 IPOC1-10 Sympatric Non-transmitting AM1 Kin1-1 Allopatric Transmitting AM1 Kin1-2 Allopatric Transmitting AM1 Kin1-3 Allopatric Transmitting AM1 Kin1-4 Allopatric Transmitting AM1 Kin1-5 Allopatric Transmitting AM1 Kin1-6 Allopatric Non-transmitting AM1 Kin1-7 Allopatric Non-transmitting AM1 Kin1-8 Allopatric Non-transmitting AM1 Kin1-9 Allopatric Non-transmitting AM1 Kin1-10 Allopatric Non-transmitting AM1 SH2-1 Allopatric Transmitting AM1 SH2-2 Allopatric Transmitting AM1 SH2-3 Allopatric Transmitting AM1 SH2-4 Allopatric Transmitting

172

Table S1 (Continued). AM1 SH2-5 Allopatric Non-transmitting AM1 SH2-6 Allopatric Non-transmitting AM1 SH2-7 Allopatric Non-transmitting AM1 SH2-8 Allopatric Non-transmitting AM1 SH2-9 Allopatric Non-transmitting AM1 SH72-1 Allopatric Transmitting AM1 SH72-2 Allopatric Transmitting AM1 SH72-3 Allopatric Transmitting AM1 SH72-4 Allopatric Transmitting AM1 SH72-5 Allopatric Non-transmitting AM1 SH72-6 Allopatric Non-transmitting AM1 SH72-7 Allopatric Non-transmitting AM1 SH72-8 Allopatric Non-transmitting AM1 SH72-9 Allopatric Non-transmitting SH3 IPOC1-1 Allopatric Transmitting SH3 IPOC1-2 Allopatric Transmitting SH3 IPOC1-3 Allopatric Non-transmitting SH3 IPOC1-4 Allopatric Non-transmitting SH3 IPOC1-5 Allopatric Non-transmitting SH3 IPOC1-6 Allopatric Non-transmitting SH3 IPOC1-7 Allopatric Non-transmitting SH3 IPOC1-8 Allopatric Non-transmitting SH3 Kin1-1 Allopatric Transmitting SH3 Kin1-2 Allopatric Non-transmitting SH3 Kin1-3 Allopatric Non-transmitting SH3 Kin1-4 Allopatric Non-transmitting SH3 Kin1-5 Allopatric Non-transmitting SH3 SH2-1 Sympatric Transmitting SH3 SH2-2 Sympatric Transmitting

173

Table S1 (Continued). SH3 SH2-3 Sympatric Transmitting SH3 SH2-4 Sympatric Transmitting SH3 SH2-5 Sympatric Transmitting SH3 SH2-6 Sympatric Non-transmitting SH3 SH2-7 Sympatric Non-transmitting SH3 SH2-8 Sympatric Non-transmitting SH3 SH2-9 Sympatric Non-transmitting SH3 SH2-10 Sympatric Non-transmitting SR3-3 IPOC1-1 Sympatric Transmitting SR3-3 IPOC1-2 Sympatric Transmitting SR3-3 IPOC1-3 Sympatric Transmitting SR3-3 IPOC1-4 Sympatric Non-transmitting SR3-3 IPOC1-5 Sympatric Non-transmitting SR3-3 IPOC1-6 Sympatric Non-transmitting SR3-3 IPOC1-7 Sympatric Non-transmitting SR3-3 IPOC1-8 Sympatric Non-transmitting SR3-3 Kin1-1 Allopatric Transmitting SR3-3 Kin1-2 Allopatric Transmitting SR3-3 Kin1-3 Allopatric Non-transmitting SR3-3 Kin1-4 Allopatric Non-transmitting SR3-3 Kin1-5 Allopatric Non-transmitting SR3-3 Kin1-6 Allopatric Non-transmitting SR3-3 Kin1-7 Allopatric Non-transmitting SR3-3 SH2-1 Allopatric Transmitting SR3-3 SH2-2 Allopatric Transmitting SR3-3 SH2-3 Allopatric Transmitting SR3-3 SH2-4 Allopatric Transmitting SR3-3 SH2-5 Allopatric Non-transmitting SR3-3 SH2-6 Allopatric Non-transmitting

174

Table S1 (Continued). SR3-3 SH2-7 Allopatric Non-transmitting SR3-3 SH2-8 Allopatric Non-transmitting SR3-3 SH2-9 Allopatric Non-transmitting SR3-3 SH72-1 Allopatric Transmitting SR3-3 SH72-2 Allopatric Transmitting SR3-3 SH72-3 Allopatric Transmitting SR3-3 SH72-4 Allopatric Non-transmitting SR3-3 SH72-5 Allopatric Non-transmitting SR3-3 SH72-6 Allopatric Non-transmitting SR3-3 SH72-7 Allopatric Non-transmitting SR3-3 SH72-8 Allopatric Non-transmitting SR3-3 SH72-9 Allopatric Non-transmitting SHP SH2-1 Sympatric Transmitting SHP SH2-2 Sympatric Transmitting SHP SH2-3 Sympatric Transmitting SHP SH2-4 Sympatric Transmitting SHP SH2-5 Sympatric Transmitting SHP SH2-6 Sympatric Transmitting SHP SH2-7 Sympatric Non-transmitting SHP SH2-8 Sympatric Non-transmitting SHP SH2-9 Sympatric Non-transmitting SHP SH2-10 Sympatric Non-transmitting SHP SH2-11 Sympatric Non-transmitting

175

Table S2. TSWV variants found in plant nucleotide sequences. Total Genome Referen New Sample number Region Type† Length Origin sequences segment ce Allele count of samples S RNA 276^277 Insertion - A 1 SR3_Ipoc1 , SR3_Kin1 , SR3_SH72 3 12 S RNA 2244 SNV A G 1 SR3_Ipoc1 , SR3_Kin1 , SR3_SH72 3 12 M RNA 2088 SNV T C 1 SR3 Ipoc1 , SR3 Kin1 , SR3 SH72 3 12 M RNA 2433 SNV C T 1 SR3 Ipoc1 , SR3 Kin1 , SR3 SH72 3 12 M RNA 3384..3385 MNV AA TG 2 SR3 Ipoc1 , SR3 Kin1 , SR3 SH72 3 12 M RNA 3561 SNV T C 1 SR3 Ipoc1 , SR3 Kin1 , SR3 SH72 3 12 M RNA 4064 SNV T C 1 SR3 Ipoc1 , SR3 Kin1 , SR3 SH72 3 12 M RNA 4152 SNV T C 1 SR3 Ipoc1 , SR3 Kin1 , SR3 SH72 3 12 M RNA 4725 SNV T G 1 SR3 Ipoc1 , SR3 Kin1 , SR3 SH2 3 12 M RNA 2966..2967 Replacement CC T 2 SR3 Ipoc1 , SR3 Kin1 , SR3 SH2 , SR3 SH72 4 12 M RNA 681 SNV A G 1 AM1 Ipoc1 , AM1 SH2 , AM1 SH72 , SH3 Kin1 4 12 M RNA 3548 SNV C T 1 AM1 Ipoc1 , AM1 SH2 , AM1 SH72 , SH3 Kin1 4 12 M RNA 3681..3682 MNV TA AG 2 AM1 Ipoc1 , AM1 SH2 , AM1 SH72 , SH3 Kin1 4 12 M RNA 4646 SNV C T 1 AM1 Ipoc1 , AM1 SH2 , AM1 SH72 , SH3 Kin1 4 12 M RNA 1697..1698 MNV AT GC 2 AM1 Kin1 , SH3 Ipoc1 , SH3 SH2 , SHP SH2 4 12 AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SH72 M RNA 2965..2967 Replacement GCC AT 3 7 12 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SH72 M RNA 1404..1405 MNV TC CT 2 7 12 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SH72 M RNA 1860 SNV T C 1 8 12 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 , SHP SH2 AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SH72 M RNA 2154 SNV C T 1 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 , SHP SH2 , 9 12 SR3 SH2 L RNA 5609 SNV A G 1 SR3 Kin1 , SR3 SH72 2 12

176

Table S2 (Continued). L RNA 1378 SNV G T 1 SR3 Ipoc1 , SR3 Kin1 , SR3 SH72 3 12 L RNA 3657..3658 MNV AA GG 2 SR3 Ipoc1 , SR3 Kin1 , SR3 SH72 3 12 L RNA 8639 SNV A G 1 SR3 Ipoc1 , SR3 Kin1 , SR3 SH72 3 12 L RNA 8237 SNV C T 1 AM1 Ipoc1 , AM1 SH2 2 12 L RNA 1064 SNV A G 1 AM1 Kin1 , SH3 Ipoc1 , SH3 SH2 3 12 L RNA 1452^1453 Insertion - T 1 AM1 Kin1 , SH3 Ipoc1 , SH3 SH2 3 12 L RNA 2085 SNV T G 1 AM1 Kin1 , SH3 Ipoc1 , SH3 SH2 3 12 L RNA 8303 SNV A T 1 AM1 Kin1 , SH3 Ipoc1 , SH3 SH2 3 12 L RNA 2075 SNV T C 1 AM1 Ipoc1 , AM1 SH2 , AM1 SH72 , SH3 Kin1 4 12 L RNA 2804..2805 MNV CT TC 2 AM1 Ipoc1 , AM1 SH2 , AM1 SH72 , SH3 Kin1 4 12 L RNA 3584 SNV T C 1 AM1 Ipoc1 , AM1 SH2 , AM1 SH72 , SH3 Kin1 4 12 L RNA 5400..5401 MNV CA TG 2 AM1 Ipoc1 , AM1 SH2 , AM1 SH72 , SH3 Kin1 4 12 L RNA 8332 SNV G A 1 AM1 Ipoc1 , AM1 SH2 , AM1 SH72 , SH3 Kin1 4 12 AM1 Ipoc1 , AM1 SH2 , AM1 SH72 , SH3 Kin1 , L RNA 6348..6349 MNV GG AA 2 5 12 SR3 Ipoc1 AM1 Ipoc1 , AM1 SH2 , AM1 SH72 , SH3 Kin1 , L RNA 7303 SNV A G 1 5 12 SR3 Ipoc1 AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SH72 , L RNA 715 SNV G A 1 7 12 SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 AM1 Ipoc1 , AM1 SH2 , AM1 SH72 , SH3 Kin1 , L RNA 1465^1466 Insertion - AG 2 8 12 SHP SH2 , SR3 Ipoc1 , SR3 Kin1 , SR3 SH72 AM1 Kin1 , SH3 Ipoc1 , SH3 SH2 , SHP SH2 , SR3 L RNA 7817 SNV A G 1 8 12 Ipoc1 , SR3 Kin1 , SR3 SH2 , SR3 SH72 AM1 Ipoc1 , AM1 SH2 , AM1 SH72 , SH3 Kin1 , L RNA 1455^1456 Insertion - A 1 SHP SH2 , SR3 Ipoc1 , SR3 Kin1 , SR3 SH2 , SR3 9 12 SH72 AM1 Ipoc1 , AM1 SH2 , AM1 SH72 , SH3 Kin1 , L RNA 2085 SNV T A 1 SHP SH2 , SR3 Ipoc1 , SR3 Kin1 , SR3 SH2 , SR3 9 12 SH72 AM1 Ipoc1 , AM1 SH2 , AM1 SH72 , SH3 Kin1 , L RNA 4756 SNV G A 1 SHP SH2 , SR3 Ipoc1 , SR3 Kin1 , SR3 SH2 , SR3 9 12 SH72 †SNV-single nucleotide variant; MNV-multiple nucleotide variant

177

Table S3. Variants present in all plant samples with the exceptions of either SHP SH2, SR3 SH2 or SR3 Ipoc1. Total Genome New Sample Absent Region Type† Reference Length Origin sequences number of segment Allele count samples samples AM1_Ipoc1 , AM1_Kin1 , AM1_SH2 , AAGCT AM1_SH72 , SH3 Ipoc1 ,SH3_kin1 ,SH3_SH2 SHP S RNA 788^789 Insertion - TTTGT 12 11 12 , SR3_Ipoc1 , SR3_Kin1 , SR3_SH2 , SH2 CA SR3_SH72 AM1_Ipoc1 , AM1_Kin1 , AM1_SH2 , AM1_SH72 , SH3 Ipoc1 ,SH3_kin1 ,SH3_SH2 SHP S RNA 1104 Deletion G - 1 11 12 , SR3_Ipoc1 , SR3_Kin1 , SR3_SH2 , SH2 SR3_SH72 AM1_Ipoc1 , AM1_Kin1 , AM1_SH2 , AM1_SH72 , SH3 Ipoc1 ,SH3_kin1 ,SH3_SH2 SHP S RNA 2645 SNV T C 1 11 12 , SR3_Ipoc1 , SR3_Kin1 , SR3_SH2 , SH2 SR3_SH72 AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SHP M RNA 556..557 MNV AA GG 2 SH72 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 , SR3 11 12 SH2 Ipoc1 , SR3 Kin1 , SR3 SH2 , SR3 SH72 AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SHP M RNA 2970^2971 Insertion - T 1 SH72 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 , SR3 11 12 SH2 Ipoc1 , SR3 Kin1 , SR3 SH2 , SR3 SH72 AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SHP M RNA 4201 SNV C G 1 SH72 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 , SR3 11 12 SH2 Ipoc1 , SR3 Kin1 , SR3 SH2 , SR3 SH72 AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SHP L RNA 1219 SNV G A 1 SH72 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 , 11 12 SH2 SR3 Ipoc1 , SR3 Kin1 , SR3 SH2 , SR3 SH72 AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SR3 L RNA 2040 SNV T A 1 SH72 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 , 11 12 SH2 SHP SH2 , SR3 Ipoc1 , SR3 Kin1 , SR3 SH72 AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SR3 L RNA 4300..4301 MNV CA GG 2 SH72 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 , 11 12 SH2 SHP SH2 , SR3 Ipoc1 , SR3 Kin1 , SR3 SH72 AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SR3 L RNA 5684 SNV C A 1 SH72 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 , 11 12 SH2 SHP SH2 , SR3 Ipoc1 , SR3 Kin1 , SR3 SH72 AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SR3 L RNA 5944 SNV G A 1 SH72 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 , 11 12 SH2 SHP SH2 , SR3 Ipoc1 , SR3 Kin1 , SR3 SH72 AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SR3 L RNA 6856 SNV T C 1 SH72 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 , 11 12 SH2 SHP SH2 , SR3 Ipoc1 , SR3 Kin1 , SR3 SH72

178

AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SR3 L RNA 5431 SNV G A 1 SH72 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 , 11 12 Ipoc1 SHP SH2 , SR3 Kin1 , SR3 SH2 , SR3 SH72 Table S3 (Continued). AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SR3 L RNA 6970^6971 Insertion - G 1 SH72 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 , 11 12 Ipoc1 SHP SH2 , SR3 Kin1 , SR3 SH2 , SR3 SH72 AM1 Ipoc1 , AM1 Kin1 , AM1 SH2 , AM1 SR3 L RNA 7024 SNV T C 1 SH72 , SH3 Ipoc1 , SH3 Kin1 , SH3 SH2 , 11 12 Ipoc1 SHP SH2 , SR3 Kin1 , SR3 SH2 , SR3 SH72 †SNV-single nucleotide variant; MNV-multiple nucleotide variant

179

Table S4. S RNA variants present in TSWV sequences originating from thrips. Total Sampl numbe Genome New Region Type† Reference Length Origin sequences e r of segment Allele count sample s S RNA 122 Deletion A - 1 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 129..130 Replacement CT A 2 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 133 Deletion A - 1 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 135 Deletion T - 1 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 399 SNV C G 1 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 399..400 MNV CA GC 2 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 402 Deletion T - 1 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 404 SNV A C 1 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 404..405 MNV AA CC 2 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 409^410 Insertion - C 1 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 453^454 Insertion - G 1 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 2245..2246 Replacement TT AGGA 4 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 2251 Deletion A - 1 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 2461..2463 MNV CCT AAG 3 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 2468..2469 Deletion AA - 2 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 2473 SNV A C 1 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 2476 Deletion A - 1 SH3-Ipoc1-Nlow , SH3-SH2T 2 21 S RNA 779..780 MNV CC AA 2 SH3-SH2NT , SH3-SH2T 2 21 S RNA 782 Replacement A GG 2 SH3-SH2NT , SH3-SH2T 2 21 S RNA 787..788 Replacement TC A 2 SH3-SH2NT , SH3-SH2T 2 21 S RNA 1326^1327 Insertion - C 1 SR3-Kin1T , SR3-lpoc1ntlow 2 21 S RNA 1138 SNV T A 1 SR3-SH2NT , SR3-SH2T , SR3-SH72NT 3 21 S RNA 1144 Deletion T - 1 SR3-SH2NT , SR3-SH2T , SR3-SH72NT 3 21

180

Table S4 (Continued). S RNA 2001 SNV C T 1 SR3-Ipoc1NThigh , SR3-SH2T , SR3-SH72NT 3 21 SR3-lpoc1ntlow , SR3-SH2NT , SR3-SH2T , SR3- S RNA 1122^1123 Insertion - T 1 4 21 SH72NT S RNA 795 SNV C T 1 AM1-Ipoc1Tlow , SH3-Ipoc1-Nlow 2 21 CAAAAA TCGC S RNA 2651..2658 MNV 8 AM1-Ipoc1Tlow , SH3-Ipoc1-Nlow 2 21 GT TCTC S RNA 1061 SNV G A 1 AM1-Ipoc1NT , SR3-lpoc1ntlow 2 21 S RNA 2057..2058 Replacement CT A 2 AM1-Ipoc1NT , SR3-lpoc1ntlow 2 21 S RNA 2058 Replacement T AA 2 AM1-Ipoc1NT , SR3-lpoc1ntlow 2 21 S RNA 405 SNV A T 1 AM1-Ipoc1NT , SH3-Ipoc1-Nlow 2 21 S RNA 850 SNV G T 1 AM1-Ipoc1NT , SH3-Ipoc1-Nlow 2 21 S RNA 2501 SNV C T 1 AM1-Ipoc1NT , SH3-Ipoc1-Nlow 2 21 S RNA 2064^2065 Insertion - C 1 SH3-SH2T , SR3-lpoc1ntlow 2 21 S RNA 2076 SNV C T 1 SH3-SH2T , SR3-lpoc1ntlow 2 21 S RNA 2107 Replacement A GG 2 SH3-SH2T , SR3-lpoc1ntlow 2 21 S RNA 2109^2110 Insertion - C 1 SH3-SH2T , SR3-lpoc1ntlow 2 21 S RNA 2111 SNV A G 1 SH3-SH2T , SR3-lpoc1ntlow 2 21 S RNA 2111..2112 Replacement AT C 2 SH3-SH2T , SR3-lpoc1ntlow 2 21 S RNA 2116 Deletion A - 1 SH3-SH2T , SR3-lpoc1ntlow 2 21 S RNA 2119 Deletion A - 1 SH3-SH2T , SR3-lpoc1ntlow 2 21 S RNA 742..744 MNV GAA CTC 3 AM1-Ipoc1Tlow , SH3-Ipoc1-Nlow , SH3-SH2T 3 21 S RNA 768 SNV A G 1 AM1-Ipoc1NT , AM1-Ipoc1Tlow , SH3-SH2T 3 21 S RNA 779 SNV C A 1 AM1-Ipoc1NT , SH3-SH2NT , SH3-SH2T 3 21 S RNA 786 SNV C G 1 AM1-Ipoc1Tlow , SH3-Ipoc1-Nlow , SH3-SH2NT 3 21 AM1-Ipoc1Thigh , SH3-Ipoc1-Nlow , SH3- S RNA 833..836 MNV GTTC AGAG 4 3 21 SH2NT S RNA 2655..2656 MNV AA TC 2 AM1-Ipoc1Tlow , SH3-Ipoc1-Nlow , SH3-SH2NT 3 21 †SNV-single nucleotide variant; MNV-multiple nucleotide variant

181

Table S5. M RNA variants present in TSWV sequences originating from thrips. Total Genome Referenc New Sample number Region Type† Length Origin sequences segment e Allele count of samples M RNA 746 SNV A G 1 AM1-Ipoc1 NT, AM1-Ipoc1Thigh 2 21 M RNA 3681..3682 MNV TA AG 2 AM1-Kin1 NT, AM1-Kin1 T 2 21 M RNA 4325..4326 MNV TT CA 2 AM1-Ipoc1 NT, AM1-Ipoc1Thigh 2 21 M RNA 4328 SNV T G 1 AM1-Ipoc1 NT, AM1-Ipoc1Thigh 2 21 M RNA 633 Deletion T - 1 SH3-Ipoc1 NT High, SH3-SH2 T 2 21 M RNA 636..638 MNV TTT GAG 3 SH3-Ipoc1 NT High, SH3-SH2 T 2 21 M RNA 640 SNV T G 1 SH3-Ipoc1 NT High, SH3-SH2 T 2 21 M RNA 642 Deletion T - 1 SH3-Ipoc1 NT High, SH3-SH2 T 2 21 M RNA 1663..1664 MNV AT TC 2 SH3-Ipoc1 NT Low, SH3-SH2 T 2 21 M RNA 1705 SNV A C 1 SH3-Ipoc1 NT Low, SH3-SH2 T 2 21 M RNA 2579 SNV C G 1 SH3-Ipoc1 NT Low, SH3-SH2 T 2 21 M RNA 3544..3545 MNV TT GA 2 SH3-SH2 NT, SH3-SH2 T 2 21 M RNA 3547 SNV G C 1 SH3-SH2 NT, SH3-SH2 T 2 21 Replacemen M RNA 512 T AA 2 SR3-Kin1 T, SR3-lpoc1 NT Low 2 21 t M RNA 1480^1481 Insertion - CTC 3 SR3-Ipoc1 NT High, SR3-Kin1 T 2 21 M RNA 1563 SNV A G 1 SR3-lpoc1 NT Low, SR3-SH72 NT 2 21 M RNA 1983^1984 Insertion - G 1 SR3-Kin1 T, SR3-SH2 NT 2 21 M RNA 1985 SNV A T 1 SR3-Kin1 T, SR3-SH2 NT 2 21 M RNA 3340..3341 MNV GG CA 2 SR3-Kin1 NT, SR3-lpoc1 NT Low, SR3-SH2 T 3 21 M RNA 3340..3343 MNV GGTT CAAA 4 SR3-Kin1 NT, SR3-lpoc1 NT Low 2 21 M RNA 3417^3418 Insertion - GG 2 SR3-Kin1 T, SR3-lpoc1 NT Low 2 21 M RNA 3418^3419 Insertion - TCG 3 SR3-Kin1 T, SR3-lpoc1 NT Low 2 21 M RNA 3422..3423 MNV AA TC 2 SR3-Kin1 T, SR3-lpoc1 NT Low, SR3-SH2 NT 3 21 †SNV-single nucleotide variant; MNV-multiple nucleotide variant

182

Table S6. L RNA variants present in TSWV sequences originating from thrips. Total Genome Referenc New Sample number Region Type† Length Origin sequences segment e Allele count of samples L RNA 263 SNV C T 1 AM1-Ipoc1Thigh , AM1-Kin1NT 2 21 L RNA 265 SNV A G 1 AM1-Ipoc1Thigh , AM1-Kin1NT 2 21 L RNA 5431 SNV G A 1 AM1-Ipoc1Thigh , AM1-Kin1T 2 21 L RNA 5455 SNV A G 1 AM1-Ipoc1Thigh , AM1-Kin1T 2 21 L RNA 2118 Deletion T - 1 AM1-Ipoc1NT, AM1-Ipoc1Tlow 2 21 L RNA 2962 SNV A C 1 AM1-Kin1T, AM1-SH72NT 2 21 L RNA 3300..3302 Replacement CCC GA 3 AM1-Ipoc1NT, AM1-Ipoc1Thigh 2 21 L RNA 8280^8281 Insertion - C 1 AM1-SH72NT, AM1-SH72T 2 21 L RNA 8282 SNV T C 1 AM1-SH72NT, SH3-SH2T 2 21 L RNA 176 SNV T G 1 SH3-Ipoc1-Nlow, SH3-SH2T 2 21 L RNA 180 SNV T G 1 SH3-Ipoc1-Nlow, SH3-SH2T 2 21 L RNA 184 SNV A C 1 SH3-Ipoc1-Nlow, SH3-SH2T 2 21 L RNA 5793^5794 Insertion - A 1 SH3-Ipoc1-Nlow, SH3-SH2T 2 21 L RNA 4885 SNV T G 1 SH3-SH2NT, SH3-SH2T 2 21 L RNA 6049 SNV G C 1 SH3-SH2NT, SH3-SH2T 2 21 L RNA 5335 Deletion T - 1 SH3-Ipoc1-Nlow, SH3-Ipoc1T 2 21 L RNA 5793^5794 Insertion - A 1 SH3-Ipoc1-Nlow, SH3-SH2T 2 21 L RNA 5933 SNV T C 1 SH3-Ipoc1T , SH3-SH2NT 2 21 L RNA 3426^3427 Insertion - G 1 SR3-Kin1T, SR3-lpoc1ntlow 2 21 L RNA 3428..3429 Replacement AT GCG 3 SR3-Kin1T, SR3-lpoc1ntlow 2 21 L RNA 3431 SNV A T 1 SR3-Kin1T, SR3-lpoc1ntlow 2 21 L RNA 6521 SNV A C 1 SR3-Kin1T, SR3-lpoc1ntlow 2 21

183

Table S6 (Continued). L RNA 7916 SNV T G 1 SR3-Kin1T, SR3-lpoc1ntlow 2 21 L RNA 7922 SNV G A 1 SR3-Kin1T, SR3-lpoc1ntlow 2 21 L RNA 7952 Deletion A - 1 SR3-Kin1T, SR3-lpoc1ntlow 2 21 L RNA 3757 SNV A C 1 SR3-Ipoc1T, SR3-lpoc1ntlow 2 21 L RNA 3769 Deletion A - 1 SR3-Ipoc1T, SR3-lpoc1ntlow 2 21 L RNA 8488 Deletion T - 1 SR3-Ipoc1T, SR3-lpoc1ntlow 2 21 L RNA 1133 SNV A G 1 SR3-lpoc1ntlow, SR3-SH2T 2 21 L RNA 1135..1136 MNV AT TC 2 SR3-lpoc1ntlow, SR3-SH2T 2 21 L RNA 6595 SNV A T 1 SR3-Kin1NT, SR3-Kin1T 2 21 L RNA 2040 SNV T A 1 AM1-Ipoc1NT, AM1-Ipoc1Thigh , AM1-Kin1T 3 21 L RNA 3529 SNV A G 1 AM1-Ipoc1Thigh , AM1-Kin1T, SR3-SH2T 3 21 L RNA 1513..1514 MNV TT GA 2 SH3-Ipoc1T , SR3-Kin1T, SR3-lpoc1ntlow 3 21 L RNA 2085 SNV T G 1 SH3-Ipoc1T , SR3-Kin1T, SR3-lpoc1ntlow 3 21 L RNA 2900 Deletion C - 1 SH3-Ipoc1T , SH3-SH2NT, SR3-Kin1T 3 21

L RNA 3096^3097 Insertion - C 1 SH3-Ipoc1T , SR3-Kin1T, SR3-SH2T 3 21 L RNA 4545 SNV T G 1 AM1-Ipoc1NT, SH3-Ipoc1-Nlow, SH3-SH2NT 3 21 L RNA 5867 SNV A G 1 SH3-Ipoc1-NThigh, SH3-Ipoc1T , SR3-lpoc1ntlow 3 21 L RNA 5938 SNV C G 1 SH3-Ipoc1-Nlow, SH3-Ipoc1T , SH3-SH2T 3 21 L RNA 6120 Replacement T AG 2 AM1-Ipoc1NT, SH3-SH2NT, SH3-SH2T 3 21 L RNA 6592..6593 MNV AA CT 2 AM1-Kin1NT, SH3-Ipoc1T , SH3-SH2T 3 21 L RNA 113 SNV A G 1 SH3-Ipoc1T , SH3-SH2NT, SH3-SH2T, SR3-Kin1T 4 21 SH3-Ipoc1T , SH3-SH2NT, SR3-Kin1T, SR3- L RNA 2905..2906 MNV CC GA 2 4 21 lpoc1ntlow SH3-Ipoc1-Nlow, SH3-Ipoc1T , SH3-SH2NT, SH3- L RNA 115 SNV C A 1 5 21 SH2T, SR3-Kin1T SH3-Ipoc1-Nlow, SH3-Ipoc1T , SH3-SH2NT, SR3- L RNA 2905 SNV C G 1 5 21 Kin1T, SR3-lpoc1ntlow

184

Table S6 (Continued). AM1-SH72NT, SH3-Ipoc1-Nlow, SH3-SH2NT, SH3- L RNA 4889 SNV T G 1 5 21 SH2T, SR3-SH72NT AM1-SH72NT, SH3-Ipoc1-Nlow, SH3-SH2NT, SH3- L RNA 4891 SNV C A 1 5 21 SH2T, SR3-SH72NT AM1-SH72NT, SH3-Ipoc1-Nlow, SH3-SH2NT, SH3- L RNA 4893..4894 MNV TC CG 2 5 21 SH2T, SR3-SH72NT AM1-SH72NT, SH3-Ipoc1-Nlow, SH3-SH2NT, SH3- L RNA 4897..4899 MNV GGT CTC 3 5 21 SH2T, SR3-SH72NT AM1-Ipoc1NT, SH3-Ipoc1-NThigh, SH3-SH2NT, SH3- L RNA 8168^8169 Insertion - G 1 5 21 SH2T, SR3-SH72NT AM1-Ipoc1NT, SH3-Ipoc1-NThigh, SH3-SH2NT, SH3- L RNA 8171^8172 Insertion - G 1 5 21 SH2T, SR3-SH72NT AM1-Ipoc1NT, SH3-Ipoc1-NThigh, SH3-SH2NT, SH3- L RNA 8172^8173 Insertion - G 1 5 21 SH2T, SR3-SH72NT AM1-Ipoc1NT, SH3-Ipoc1-NThigh, SH3-SH2NT, SH3- L RNA 8175..8176 MNV AT CC 2 5 21 SH2T, SR3-SH72NT AM1-Ipoc1NT, SH3-Ipoc1-NThigh, SH3-SH2NT, SH3- L RNA 8179 SNV T G 1 5 21 SH2T, SR3-SH72NT †SNV-single nucleotide variant; MNV-multiple nucleotide variant

185

Table S7. S RNA variants present in TSWV sequences originating from serially transmitted isolates that lacked certain samples. Total number Genome New Sample of Absent segment Region Type† Reference Allele Length Origin sequences count samples samples S RNA Kin 2009 FFus R5 , Kin 2009 TTAB R1 , Kin-3 Field col , AM1 TTAB R4 , Kin 2009 TTAB R5 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 FFus R4 , Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker , SR3 FFus R5 , SR3 field col , SR3 1626 SNV T C 1 Focc R5 14 15 Parker S RNA Kin 2009 FFus R5 , Kin 2009 TTAB R1 , Kin-3 Field col , AM1 TTAB R4 , Kin 2009 TTAB R5 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 FFus R4 , Kin-3 Focc R4 , Kin-3 TTAB R4 , SR3 FFus R5 , SR3 field col , SR3 Focc R5 , 1679 SNV G A 1 SR3 TTAB R4 14 15 Parker S RNA Kin 2009 FFus R5 , Kin 2009 TTAB R1 , Kin-3 Field col , AM1 TTAB R4 , Kin 2009 TTAB R5 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 FFus R4 , Kin-3 Focc R4 , Kin-3 TTAB R4 , SR3 FFus R5 , SR3 field col , SR3 Focc R5 , 2593 SNV T C 1 SR3 TTAB R4 14 15 Parker S RNA Kin 2009 FFus R5 , Kin-3 Field col , AM1 TTAB R4 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 FFus R4 , Kin-3 Kin-2009 Focc R4 , Kin-3 TTAB R4 , Parker , SR3 FFus R5 , SR3 TTAB R1 2638 SNV G A 1 field col , SR3 Focc R5 , SR3 TTAB R4 13 15 and R5 S RNA Kin 2009 FFus R5 , Kin-3 Field col , AM1 TTAB R4 , kin-2009 AM1 Focc R8 , AM1 FFus R8 , Kin-3 FFus R4 , Kin-3 TTAB R1, Focc R4 , Kin-3 TTAB R4 , SR3 FFus R5 , SR3 field col , Kin-2009 607 SNV G A 1 SR3 Focc R5 , SR3 TTAB R4 12 15 R5, Parker S RNA Kin 2009 FFus R5, Kin-3 Field col, AM1 TTAB R4 , AM1 kin-2009 Focc R8 , AM1 FFus R8 , Kin-3 FFus R4 , Kin-3 Focc R4 TTAB R1, , Kin-3 TTAB R4 , SR3 FFus R5 , SR3 field col , SR3 Focc Kin-2009 2464 SNV G A 1 R5 , SR3 TTAB R4 12 15 R5, Parker S RNA Kin 2009 FFus R5, Kin-3 Field col, AM1 TTAB R4 , AM1 kin-2009 Focc R8 , AM1 FFus R8 , Kin-3 FFus R4 , Kin-3 Focc R4 TTAB R1, , Kin-3 TTAB R4 , SR3 FFus R5 , SR3 field col , SR3 Focc Kin-2009 2563 SNV A G 1 R5 , SR3 TTAB R4 12 15 R5, Parker †SNV-single nucleotide variant; MNV-multiple nucleotide variant

186

Table S8. S RNA variants present in TSWV sequences originating from serially transmitted isolates. Total number of Genome New Sample sample segment Region Type† Reference Allele Length Origin sequences count s S RNA 1801 Replacement A GT 2 SR3 field col , SR3 TTAB R4 2 15 S RNA 1791 Deletion T - 1 SR3 field col , SR3 Focc R5 2 15 S RNA 418 SNV G A 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 S RNA 547 SNV C T 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 S RNA 878 SNV G A 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 S RNA 1621 Deletion A - 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 S RNA 1677..1679 MNV ACG CAA 3 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 S RNA 1732^1733 Insertion - TG 2 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 S RNA 1801 SNV A G 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 S RNA 1966 SNV T C 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 S RNA 2047 SNV A G 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 S RNA 2659 SNV C T 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 S RNA 1756..1757 MNV AT TG 2 Kin-3 Field col , Kin-3 Focc R4 2 15 S RNA 1799^1800 Insertion - A 1 Kin-3 Field col , Kin-3 Focc R4 2 15 S RNA 1804^1805 Insertion - G 1 Kin-3 Field col , Kin-3 Focc R4 2 15 S RNA 1806 SNV A T 1 Kin-3 Field col , Kin-3 Focc R4 2 15 S RNA 1812 SNV T C 1 Kin-3 Field col , Kin-3 Focc R4 2 15 S RNA 1815 SNV T A 1 Kin-3 Field col , Kin-3 Focc R4 2 15 S RNA 1737^1738 Insertion - G 1 Kin-3 Field col , Kin-3 TTAB R4 2 15 S RNA 1743^1744 Insertion - G 1 Kin-3 Field col , Kin-3 TTAB R4 2 15 S RNA 4 SNV G T 1 Kin-3 Field col , Kin-3 FFus R4 2 15 S RNA 13 Replacement T AGAG 4 Kin-3 Field col , Kin-3 FFus R4 2 15 S RNA 823 SNV C T 1 Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 3 15 S RNA 1579 SNV T C 1 Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 3 15 S RNA 1596 SNV A G 1 Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 3 15

187

Table S8 (Continued). S RNA 1742 SNV G T 1 Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 3 15 S RNA 2203..2204 MNV CT TC 2 Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 3 15 S RNA 2614 SNV A G 1 Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 3 15 S RNA 2758 SNV A G 1 Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 3 15 S RNA 235 SNV T C 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , Parker 3 15 S RNA 1195 SNV T C 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , Parker 3 15 S RNA 1919 SNV C T 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , Parker 3 15 S RNA 2647 SNV C T 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , Parker 3 15 S RNA 276^277 Insertion - A 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 S RNA 862 SNV T C 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 S RNA 1580 SNV G A 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 S RNA 1654^1655 Insertion - - 0 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 S RNA 1664^1665 Insertion - AAT 3 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 S RNA 1664^1665 Insertion - - 0 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 S RNA AAAA 1672^1673 Insertion - AT 6 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 S RNA 1672^1673 Insertion - - 0 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 S RNA 1946 SNV T C 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 S RNA 2170 SNV T C 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 S RNA 2244 SNV A G 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 S RNA AM1 TTAB R4 , AM1 Focc R8 , Kin-3 FFus R4 , SR3 1666^1667 Insertion - T 1 FFus R5 4 15 S RNA AM1 TTAB R4 , AM1 Focc R8 , Kin-3 FFus R4 , SR3 1670..1671 MNV TT AA 2 FFus R5 4 15 S RNA Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , SR3 187 SNV T C 1 TTAB R4 4 15 S RNA Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , SR3 577 SNV T C 1 TTAB R4 4 15 S RNA AAGC GTTT Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , SR3 788^789 Insertion - GTCA 12 TTAB R4 4 15

188

Table S8 (Continued). S RNA Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , SR3 1102 Deletion C - 1 TTAB R4 4 15 S RNA Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , SR3 1104 SNV G T 1 TTAB R4 4 15 S RNA Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , SR3 1671..1672 Deletion TA - 2 TTAB R4 4 15 S RNA Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , SR3 1951 SNV T C 1 TTAB R4 4 15 S RNA Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , SR3 2100 SNV T A 1 TTAB R4 4 15 S RNA Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , SR3 2107 SNV A G 1 TTAB R4 4 15 S RNA AM1 TTAB R4 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 448 SNV T C 1 FFus R4 , SR3 FFus R5 5 15 S RNA AM1 TTAB R4 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 532 SNV T C 1 FFus R4 , SR3 FFus R5 5 15 S RNA AM1 TTAB R4 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 664 SNV C T 1 FFus R4 , SR3 FFus R5 5 15 S RNA AM1 TTAB R4 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 991 SNV A G 1 FFus R4 , SR3 FFus R5 5 15 S RNA AM1 TTAB R4 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 1453 SNV T C 1 FFus R4 , SR3 FFus R5 5 15 S RNA AM1 TTAB R4 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 1651 SNV A G 1 FFus R4 , SR3 FFus R5 5 15 S RNA AM1 TTAB R4 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 1672^1673 Insertion - T 1 FFus R4 , SR3 FFus R5 5 15 S RNA AM1 TTAB R4 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 2383 SNV A G 1 FFus R4 , SR3 FFus R5 5 15 S RNA Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker 249 SNV T C 1 , SR3 TTAB R4 5 15 S RNA Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker 1659..1660 Deletion AC - 2 , SR3 TTAB R4 5 15 S RNA Kin 2009 FFus R5 , Kin 2009 TTAB R1 , Kin 2009 TTAB 1807^1808 Insertion - C 1 R5 , SR3 field col , SR3 Focc R5 , SR3 TTAB R4 6 15 S RNA Kin 2009 FFus R5 , Kin 2009 TTAB R1 , Kin 2009 TTAB 1812 SNV T G 1 R5 , SR3 field col , SR3 Focc R5 , SR3 TTAB R4 6 15

189

Table S8 (Continued). S RNA Kin 2009 FFus R5 , AM1 TTAB R4 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 FFus R4 , SR3 FFus R5 , SR3 field col , 1456 SNV G A 1 SR3 Focc R5 8 15 S RNA Kin 2009 FFus R5 , AM1 TTAB R4 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 FFus R4 , SR3 FFus R5 , SR3 field col , 2052 SNV T C 1 SR3 Focc R5 8 15 S RNA Kin 2009 FFus R5 , AM1 TTAB R4 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 FFus R4 , SR3 FFus R5 , SR3 field col , 2128 SNV C T 1 SR3 Focc R5 8 15 S RNA Kin 2009 FFus R5 , AM1 TTAB R4 , AM1 Focc R8 , AM1 FFus R8 , Kin-3 FFus R4 , SR3 FFus R5 , SR3 field col , 2777 SNV G A 1 SR3 Focc R5 8 15 †SNV-single nucleotide variant; MNV-multiple nucleotide varian

190

Table S9. M RNA variants present in TSWV sequences originating from serially transmitted isolates that lacked certain samples. Total number of Genome Type New Sample sample Absent segment Region † Reference Allele Length Origin sequences count s samples AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin-3 Focc R4 , Kin 2009 TTAB R1 , Kin-3 TTAB R4 , Kin-3 Field col , AM1 Focc R8 , Kin 2009 TTAB R5 , Kin 2009 FFus R5 , SR3 FFus R5 , SR3 field col , SR3 Focc R5 , M RNA 337 SNV A G 1 SR3 TTAB R4 14 15 parker AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin-3 Focc R4 , Kin 2009 TTAB R1 , Kin-3 TTAB R4 , Kin-3 Field col , AM1 Focc R8 , Kin 2009 TTAB R5 , Kin 2009 FFus R5 , SR3 FFus R5 , SR3 field col , SR3 Focc R5 , M RNA 3559 SNV A G 1 SR3 TTAB R4 14 15 parker AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin-3 Focc R4 , Kin 2009 TTAB R1 , Kin-3 TTAB R4 , Kin-3 Field col , AM1 Focc R8 , Kin 2009 TTAB R5 , Kin 2009 FFus R5 , SR3 FFus R5 , SR3 field col , SR3 Focc R5 , M RNA 3955 SNV A G 1 SR3 TTAB R4 14 15 parker AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin-3 Focc R4 , Kin 2009 TTAB R1 , Kin-3 TTAB R4 , Kin-3 Field col , AM1 Focc R8 , Kin 2009 TTAB R5 , Kin 2009 FFus R5 , SR3 FFus R5 , SR3 field col , SR3 Focc R5 , M RNA 4195 SNV T C 1 SR3 TTAB R4 14 15 parker AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field col , Kin-2009 AM1 Focc R8 , Kin 2009 FFus R5 , SR3 FFus R5 , SR3 TTAB R1 M RNA 343 SNV T C 1 field col , SR3 Focc R5 , SR3 TTAB R4 13 15 and R5 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field col , Kin-2009 AM1 Focc R8 , Kin 2009 FFus R5 , SR3 FFus R5 , SR3 TTAB R1 M RNA 2170 SNV T C 1 field col , SR3 Focc R5 , SR3 TTAB R4 13 15 and R5

191

Table S9 (Continued). AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field col , Kin-2009 AM1 Focc R8 , Kin 2009 FFus R5 , SR3 FFus R5 , SR3 TTAB R1 M RNA 3619 SNV T A 1 field col , SR3 Focc R5 , SR3 TTAB R4 13 15 and R5 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field col , Kin-2009 AM1 Focc R8 , Kin 2009 FFus R5 , SR3 FFus R5 , SR3 TTAB R1 M RNA 4417 SNV A G 1 field col , SR3 Focc R5 , SR3 TTAB R4 13 15 and R5 Kin-2009 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin-3 TTAB R1 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field col , and R5 AM1 Focc R8 , Kin 2009 FFus R5 , SR3 FFus R5 , SR3 and SR3 M RNA 3888 SNV A G 1 field col , SR3 Focc R5 12 15 TTAB R4 Kin-2009 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin-3 TTAB R1 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field col , and R5 AM1 Focc R8 , Kin 2009 FFus R5 , SR3 FFus R5 , SR3 and SR3 M RNA 4027 SNV T A 1 field col , SR3 Focc R5 12 15 TTAB R4 Kin-2009 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin-3 TTAB R1 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field col , and R5 AM1 Focc R8 , Kin 2009 FFus R5 , SR3 FFus R5 , SR3 and SR3 M RNA 4451 SNV G A 1 field col , SR3 Focc R5 12 15 TTAB R4 †SNV-single nucleotide variant; MNV-multiple nucleotide variant

192

Table S10. M RNA variants present in TSWV sequences originating from serially transmitted isolates. Total number Genome New Sample of segment Region Type† Reference Allele Length Origin sequences count samples M RNA 38 SNV T C 1 SR3 field col , SR3 Focc R5 2 15 M RNA 58 SNV C T 1 SR3 field col , SR3 Focc R5 2 15 M RNA 98 SNV G A 1 SR3 field col , SR3 Focc R5 2 15 M RNA 121 SNV C T 1 SR3 field col , SR3 Focc R5 2 15 M RNA 125 SNV A G 1 SR3 field col , SR3 Focc R5 2 15 M RNA 128 SNV C T 1 SR3 field col , SR3 Focc R5 2 15 M RNA 141..142 MNV TA CC 2 SR3 field col , SR3 Focc R5 2 15 M RNA 144 Deletion T - 1 SR3 field col , SR3 Focc R5 2 15 M RNA 146..147 MNV GC AA 2 SR3 field col , SR3 Focc R5 2 15 M RNA 274 SNV G A 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 1135 Deletion A - 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 1199..1202 Replacement TTTT CA 4 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 1210 SNV G C 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 1221 SNV A A 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 1250 SNV A A 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 1313..1315 MNV ATC GCT 3 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 1321 SNV C T 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 1407 SNV C G 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 1415 SNV T C 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 1495 SNV G C 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 1519 SNV T A 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 1732 SNV C T 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 1876 SNV A G 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 1915 SNV A G 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 2361 SNV A G 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 2457 SNV C T 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15

193

Table S10 (Continued). M RNA 2836 SNV T C 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 2928 SNV T C 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 3403..3404 MNV CA TG 2 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 3619 SNV T G 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 4417 SNV A T 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 4422 SNV A G 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 4490 SNV G A 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 4501..4502 MNV CC TT 2 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 2 15 M RNA 1196^1197 Insertion - A 1 Kin 2009 FFus R5 , SR3 Focc R5 2 15 M RNA 1793 SNV G A 1 Kin 2009 FFus R5 , SR3 Focc R5 2 15 M RNA 2856 SNV T C 1 Kin 2009 FFus R5 , SR3 Focc R5 2 15 M RNA 3796 SNV T C 1 Kin 2009 FFus R5 , SR3 Focc R5 2 15 M RNA 4148 SNV T C 1 Kin 2009 FFus R5 , SR3 Focc R5 2 15 M RNA 1239 SNV A A 1 SR3 Focc R5 , SR3 TTAB R4 2 15 M RNA 1242 SNV A T 1 SR3 Focc R5 , SR3 TTAB R4 2 15 M RNA 1242..1244 MNV AGT GCA 3 AM1 TTAB R4 , AM1 Focc R8 2 15 M RNA 1195^1196 Insertion - - 0 Kin-3 Field col , SR3 field col , SR3 Focc R5 3 15 M RNA 1208 SNV T T 1 AM1 FFus R8 , Kin 2009 TTAB R1 , Kin 2009 TTAB R5 3 15 M RNA 1254 SNV A A 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 FFus R5 3 15 M RNA 2923 SNV G A 1 Kin 2009 TTAB R1 , Parker , Kin 2009 TTAB R5 3 15 M RNA 346 SNV T C 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 TTAB R4 3 15 M RNA 1181^1182 Insertion - T 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 TTAB R4 3 15 M RNA 1204 SNV T T 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 TTAB R4 3 15 M RNA 1206 SNV G G 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 TTAB R4 3 15 M RNA 1434 SNV A G 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 TTAB R4 3 15 M RNA 1451 SNV T C 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 TTAB R4 3 15 M RNA 1582 SNV G A 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 TTAB R4 3 15 M RNA 1831 SNV C T 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 TTAB R4 3 15 M RNA 1966 SNV G A 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 TTAB R4 3 15

194

Table S10 (Continued). M RNA 2293 SNV T A 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 TTAB R4 3 15 M RNA 2652..2653 MNV CG TA 2 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 TTAB R4 3 15 M RNA 3289 SNV T A 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 TTAB R4 3 15 M RNA 4009 SNV C T 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 TTAB R4 3 15 M RNA 4349 SNV T A 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 TTAB R4 3 15 M RNA 4415 SNV A G 1 Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 TTAB R4 3 15 M RNA 517 SNV C T 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 538 SNV A G 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 697 SNV T C 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 769..770 MNV TG CT 2 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 988 SNV G A 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 1098 SNV G C 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 1134 SNV C T 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 1708 SNV A T 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 2088 SNV T C 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 2433 SNV C T 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 2737 SNV A G 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 3070 SNV A G 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 3292 SNV A G 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 3384..3385 MNV AA TG 2 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 3561 SNV T C 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 4064 SNV T C 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 4152 SNV T C 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 4252 SNV C T 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 4719 SNV G A 1 Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 3 15 M RNA 932 SNV A C 1 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 1089 SNV A G 1 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 1091 Deletion C - 1 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 1095..1098 Deletion AAAG - 4 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15

195

Table S10 (Continued). M RNA 1100 SNV G C 1 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 1410..1411 MNV GT AG 2 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 1420 SNV A C 1 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 1660 SNV A G 1 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 1681 SNV C T 1 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 1771 SNV C T 1 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 1948 SNV T A 1 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 1981 SNV A G 1 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 2034 SNV G A 1 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 2662 SNV T C 1 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 2808 SNV T C 1 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 2971 Replacement A TG 2 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 3375 SNV A G 1 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 4279 SNV T C 1 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 4533..4534 MNV CT GC 2 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 4749..4751 MNV ACC GAT 3 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col 3 15 M RNA 1240 Replacement T CA 2 AM1 TTAB R4 , AM1 Focc R8 , SR3 FFus R5 3 15 M RNA 1240 SNV T T 1 AM1 TTAB R4 , AM1 Focc R8 , SR3 FFus R5 3 15 AM1 FFus R8 , AM1 TTAB R4 , SR3 FFus R5 , SR3 M RNA 234^235 Insertion - T 1 TTAB R4 4 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , AM1 M RNA 1086 Deletion G - 1 Focc R8 4 15 Kin-3 FFus R4 , AM1 TTAB R4 , AM1 Focc R8 , SR3 M RNA 1182 Deletion T - 1 FFus R5 4 15 M RNA 1086 SNV G A 1 Parker , Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 4 15 M RNA 1088 SNV A G 1 Parker , Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 4 15 M RNA 1091 SNV C G 1 Parker , Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 4 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , SR3 M RNA 1196^1197 Insertion - ATATA 5 field col 4 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , SR3 M RNA 1242 Deletion A - 1 field col 4 15

196

Table S10 (Continued). Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field M RNA 299 SNV T C 1 col 4 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field M RNA 2723 SNV G A 1 col 4 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 418 SNV C T 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 681 SNV A G 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 856 SNV T C 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 1242..1243 Deletion AG - 2 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 1246..1247 MNV AA TT 2 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 1294 SNV G A 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 1404..1405 MNV TC CT 2 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 1465 SNV T C 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 1768 SNV G A 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 1948 SNV T C 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 2275 SNV A G 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 2350 SNV A G 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 2416 SNV A G 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 2479 SNV A C 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 2500 SNV T C 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 2668 SNV A C 1 Focc R8 , SR3 FFus R5 5 15

197

Table S10 (Continued). AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 3232 SNV A G 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 3517 SNV A G 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 3548 SNV C T 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 3681..3682 MNV TA AG 2 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 3796 SNV T A 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 3946 SNV A G 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 3964 SNV T C 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 4036 SNV G A 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 4222 SNV A T 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 4477 SNV T C 1 Focc R8 , SR3 FFus R5 5 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 M RNA 4646 SNV C T 1 Focc R8 , SR3 FFus R5 5 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field M RNA 4652 SNV A G 1 col , SR3 TTAB R4 5 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , Kin M RNA 1229 Replacement T CA 2 2009 FFus R5 , SR3 field col 5 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , Kin M RNA 1231 SNV T G 1 2009 FFus R5 , SR3 field col 5 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , Kin M RNA 1233 SNV G A 1 2009 FFus R5 , SR3 field col 5 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , SR3 M RNA 1196^1197 Insertion - - 0 field col , SR3 Focc R5 5 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , SR3 M RNA 1217 SNV G G 1 field col , SR3 Focc R5 5 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , SR3 M RNA 1239 Deletion A - 1 field col , SR3 Focc R5 5 15

198

Table S10 (Continued). Kin-3 FFus R4 , AM1 Focc R8 , Kin 2009 FFus R5 , SR3 M RNA 1100 Deletion G - 1 field col , SR3 Focc R5 5 15 AM1 FFus R8 , Kin 2009 TTAB R1 , Kin-3 TTAB R4 , M RNA 167..168 MNV CA TT 2 Parker , Kin-3 Field col , SR3 FFus R5 6 15 AM1 FFus R8 , AM1 TTAB R4 , Kin 2009 TTAB R1 , Kin M RNA 1099..1101 Deletion AGA - 3 2009 TTAB R5 , SR3 FFus R5 , SR3 TTAB R4 6 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin M RNA 1230 SNV T T 1 2009 TTAB R1 , SR3 FFus R5 , SR3 TTAB R4 6 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , Kin M RNA 1107 SNV A T 1 2009 FFus R5 , SR3 field col , SR3 Focc R5 6 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , Kin M RNA 1114..1120 Deletion ATCAAAC - 7 2009 FFus R5 , SR3 field col , SR3 Focc R5 6 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , Kin M RNA 1195^1196 Insertion - G 1 2009 FFus R5 , SR3 field col , SR3 Focc R5 6 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , Kin M RNA 1217 SNV G A 1 2009 FFus R5 , SR3 field col , SR3 Focc R5 6 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Parker M RNA 1009 SNV G A 1 , AM1 Focc R8 , SR3 FFus R5 6 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Parker M RNA 1210 Deletion G - 1 , AM1 Focc R8 , SR3 FFus R5 6 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Parker M RNA 1232..1233 MNV CG AT 2 , AM1 Focc R8 , SR3 FFus R5 6 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , SR3 M RNA 1224^1225 Insertion - G 1 field col , SR3 Focc R5 , SR3 TTAB R4 6 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , SR3 M RNA 1224^1225 Insertion - - 0 field col , SR3 Focc R5 , SR3 TTAB R4 6 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , SR3 M RNA 1250 Deletion A - 1 field col , SR3 Focc R5 , SR3 TTAB R4 6 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin-3 Field col , SR3 M RNA 1253..1254 Deletion GA - 2 field col , SR3 Focc R5 , SR3 TTAB R4 6 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Parker M RNA 1200 SNV T A 1 , AM1 Focc R8 , SR3 FFus R5 , SR3 TTAB R4 7 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Parker M RNA 1202 SNV T A 1 , AM1 Focc R8 , SR3 FFus R5 , SR3 TTAB R4 7 15 AM1 FFus R8 , AM1 TTAB R4 , Kin-3 Focc R4 , Kin-3 M RNA 1246..1247 MNV AA AA 2 Field col , AM1 Focc R8 , SR3 FFus R5 , SR3 Focc R5 7 15

199

Table S10 (Continued). Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field M RNA 1016 SNV A T 1 col , Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 7 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field M RNA 1060..1061 Deletion TG - 2 col , Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 7 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field M RNA 1065 SNV C T 1 col , Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 7 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field M RNA 3256 SNV T C 1 col , Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 7 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field M RNA 4570 SNV T C 1 col , Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 7 15 Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field M RNA 4725 SNV T G 1 col , Kin 2009 FFus R5 , SR3 field col , SR3 Focc R5 7 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , AM1 Focc R8 , Kin 2009 TTAB R5 , M RNA 170 SNV G A 1 SR3 FFus R5 7 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , AM1 Focc R8 , Kin 2009 TTAB R5 , M RNA 1226 Deletion A - 1 SR3 FFus R5 7 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , AM1 Focc R8 , Kin 2009 TTAB R5 , M RNA 1250 SNV A T 1 SR3 FFus R5 7 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , AM1 Focc R8 , Kin 2009 TTAB R5 , M RNA 1254 SNV A T 1 SR3 FFus R5 7 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 FFus R5 , SR3 M RNA 1086..1092 Deletion GAAAACA - 7 TTAB R4 7 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , SR3 FFus R5 , SR3 M RNA 1095 SNV A G 1 TTAB R4 7 15 AM1 FFus R8 , AM1 TTAB R4 , Kin 2009 TTAB R1 , Parker , AM1 Focc R8 , Kin 2009 TTAB R5 , SR3 FFus M RNA 1116^1117 Insertion - A 1 R5 , SR3 TTAB R4 8 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , Parker , AM1 Focc R8 , Kin 2009 M RNA 1208 SNV T A 1 TTAB R5 , SR3 FFus R5 8 15

200

Table S10 (Continued). AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , Parker , AM1 Focc R8 , Kin 2009 M RNA 1221 SNV A G 1 TTAB R5 , SR3 FFus R5 8 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , Parker , AM1 Focc R8 , Kin 2009 M RNA 1237 SNV T A 1 TTAB R5 , SR3 FFus R5 8 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , AM1 Focc R8 , Kin 2009 FFus R5 , SR3 FFus R5 , SR3 field M RNA 3664 SNV G A 1 col , SR3 Focc R5 8 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , AM1 Focc R8 , Kin 2009 TTAB R5 , M RNA 862 SNV C T 1 SR3 FFus R5 , SR3 TTAB R4 8 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , AM1 Focc R8 , Kin 2009 TTAB R5 , M RNA 1057 Deletion T - 1 SR3 FFus R5 , SR3 TTAB R4 8 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , AM1 Focc R8 , Kin 2009 TTAB R5 , M RNA 1061 SNV G A 1 SR3 FFus R5 , SR3 TTAB R4 8 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , AM1 Focc R8 , Kin 2009 TTAB R5 , M RNA 1065 Deletion C - 1 SR3 FFus R5 , SR3 TTAB R4 8 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , AM1 Focc R8 , Kin 2009 TTAB R5 , M RNA 1235 SNV T A 1 SR3 FFus R5 , SR3 TTAB R4 8 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , AM1 Focc R8 , Kin 2009 TTAB R5 , M RNA 1235 SNV T T 1 SR3 FFus R5 , SR3 TTAB R4 8 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , AM1 Focc R8 , Kin 2009 TTAB R5 , M RNA 1860 SNV T C 1 SR3 FFus R5 , SR3 TTAB R4 8 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin-3 Focc R4 , Kin-3 TTAB R4 , Parker , Kin-3 Field col , M RNA 1067 SNV A G 1 AM1 Focc R8 , SR3 FFus R5 9 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Parker , AM1 Focc R8 , Kin 2009 FFus R5 , SR3 FFus R5 , SR3 M RNA 2083 SNV A G 1 field col , SR3 Focc R5 9 15

201

Table S10 (Continued). AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Parker , AM1 Focc R8 , Kin 2009 FFus R5 , SR3 FFus R5 , SR3 M RNA 3703 SNV A G 1 field col , SR3 Focc R5 9 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , AM1 Focc R8 , Kin 2009 TTAB R5 , M RNA 4769 SNV G A 1 SR3 FFus R5 , SR3 field col , SR3 Focc R5 9 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , Parker , AM1 Focc R8 , Kin 2009 M RNA 1120 SNV C A 1 TTAB R5 , SR3 FFus R5 , SR3 TTAB R4 9 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , Parker , AM1 Focc R8 , Kin 2009 M RNA 1204 SNV T A 1 TTAB R5 , SR3 FFus R5 , SR3 TTAB R4 9 15 AM1 FFus R8 , Kin-3 FFus R4 , AM1 TTAB R4 , Kin 2009 TTAB R1 , Parker , AM1 Focc R8 , Kin 2009 M RNA 1196 SNV T G 1 TTAB R5 , SR3 FFus R5 , SR3 Focc R5 , SR3 TTAB R4 10 15 Kin-3 Focc R4 , Kin 2009 TTAB R1 , Kin-3 TTAB R4 , Parker , Kin-3 Field col , Kin 2009 TTAB R5 , Kin 2009 M RNA 1246..1247 Deletion AA - 2 FFus R5 , SR3 field col , SR3 Focc R5 , SR3 TTAB R4 10 15 Kin-3 Focc R4 , Kin 2009 TTAB R1 , Kin-3 TTAB R4 , Parker , Kin-3 Field col , Kin 2009 TTAB R5 , Kin 2009 M RNA 1713 SNV A G 1 FFus R5 , SR3 field col , SR3 Focc R5 , SR3 TTAB R4 10 15 Kin-3 Focc R4 , Kin 2009 TTAB R1 , Kin-3 TTAB R4 , Parker , Kin-3 Field col , Kin 2009 TTAB R5 , Kin 2009 M RNA 2479 SNV A T 1 FFus R5 , SR3 field col , SR3 Focc R5 , SR3 TTAB R4 10 15 Kin-3 Focc R4 , Kin 2009 TTAB R1 , Kin-3 TTAB R4 , Parker , Kin-3 Field col , Kin 2009 TTAB R5 , Kin 2009 M RNA 2701 SNV G A 1 FFus R5 , SR3 field col , SR3 Focc R5 , SR3 TTAB R4 10 15 Kin-3 Focc R4 , Kin 2009 TTAB R1 , Kin-3 TTAB R4 , Parker , Kin-3 Field col , Kin 2009 TTAB R5 , Kin 2009 M RNA 2966..2967 Replacement CC T 2 FFus R5 , SR3 field col , SR3 Focc R5 , SR3 TTAB R4 10 15 †SNV-single nucleotide variant; MNV-multiple nucleotide variant

202

Table S11. L RNA variants present in TSWV sequences originating from serially transmitted isolates that lacked certain samples. Total Sampl number Genome New e of Absent segment Region Type† Reference Allele Length Origin sequences count samples samples SR3 field col , SR3 Focc R5 , SR3 FFus R5 , SR3 TTAB R4 , Kin-3 Field col , Kin- 3 Focc R4 , Kin-3 FFus R4 , Kin-3 TTAB R4 , Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , Kin 2009 FFus R5 , AM1 FFus R8 , L RNA 1419 SNV C T 1 AM1 Focc R8 , AM1 TTAB R4 14 15 Parker SR3 field col , SR3 Focc R5 , SR3 FFus R5 , SR3 TTAB R4 , Kin-3 Field col , Kin- 3 Focc R4 , Kin-3 FFus R4 , Kin-3 TTAB R4 , Kin 2009 TTAB R5 , Kin 2009 FFus Kin- R5 , AM1 FFus R8 , AM1 Focc R8 , AM1 2009 L RNA 2502 SNV A C 1 TTAB R4 , Parker 14 15 TTAB R1 SR3 field col , SR3 Focc R5 , SR3 FFus R5 , SR3 TTAB R4 , Kin-3 Field col , Kin- 3 Focc R4 , Kin-3 FFus R4 , Kin-3 TTAB R4 , Kin 2009 TTAB R1 , Kin 2009 FFus Kin- R5 , AM1 FFus R8 , AM1 Focc R8 , AM1 2009 L RNA 5214 SNV T C 1 TTAB R4 , Parker 14 15 TTAB R5 SR3 field col , SR3 Focc R5 , SR3 FFus R5 , SR3 TTAB R4 , Kin-3 Field col , Kin- Kin- 3 Focc R4 , Kin-3 FFus R4 , Kin-3 TTAB 2009 R4 , Kin 2009 FFus R5 , AM1 FFus R8 , TTAB R1 L RNA 3768 SNV G A 1 AM1 Focc R8 , AM1 TTAB R4 , Parker 13 15 and R5

203

Table S11 (Continued). SR3 field col , SR3 Focc R5 , SR3 FFus R5 , SR3 TTAB R4 , Kin-3 Field col , Kin- 3 Focc R4 , Kin-3 FFus R4 , Kin-3 TTAB Parker R4 , Kin 2009 TTAB R1 , Kin 2009 FFus and Kin- R5 , AM1 FFus R8 , AM1 Focc R8 , AM1 2009 L RNA 1281 SNV T C 1 TTAB R4 13 15 TTAB R5 SR3 field col , SR3 Focc R5 , SR3 FFus R5 , Kin-3 Field col , Kin-3 Focc R4 , Kin- Parker 3 FFus R4 , Kin-3 TTAB R4 , Kin 2009 and Kin- TTAB R1 , Kin 2009 FFus R5 , AM1 FFus 2009 L RNA 4089 SNV A G 1 R8 , AM1 Focc R8 , AM1 TTAB R4 12 15 TTAB R5 †SNV-single nucleotide variant; MNV-multiple nucleotide variant

204

Table S12. L RNA variants present in TSWV sequences originating from serially transmitted isolates. Total number Genome New Sample of segment Region Type† Reference Allele Length Origin sequences count samples L RNA 117 SNV C T 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 297 SNV C T 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 603 SNV C T 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 808 SNV T C 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 951 SNV C A 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 1546 SNV A G 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 1658 SNV A C 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 1812 SNV T C 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 1824 SNV A G 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 2161 SNV A G 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 2223 SNV C T 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 2679 SNV T C 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 3134 SNV A G 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 3456 SNV A G 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 3885 SNV G A 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 3933 SNV A G 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 4428 SNV T C 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 4576 SNV C T 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 4705 SNV G T 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 4965 SNV C T 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 5244 SNV C T 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 5322 SNV T C 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 5355 SNV A C 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 5457 SNV G A 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 6027 SNV G A 1 Kin 2009 TTAB R5 , Parker 2 15

205

Table S12 (Continued). L RNA 6357 SNV T G 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 6645 SNV C T 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 7164 SNV T A 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 7953 SNV A G 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 8091 SNV G A 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 8409 SNV G A 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 8445 SNV C T 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 8737 SNV A G 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 8752 SNV A G 1 Kin 2009 TTAB R5 , Parker 2 15 L RNA 7054 SNV T C 1 Kin 2009 TTAB R1 , Parker 2 15 L RNA Kin 2009 TTAB R5 , Kin 2009 FFus 4098 SNV A G 1 R5 2 15 L RNA 6882 SNV T C 1 SR3 FFus R5 , AM1 FFus R8 2 15 L RNA 7944 SNV G A 1 SR3 FFus R5 , AM1 FFus R8 2 15 L RNA 8237 SNV C T 1 SR3 FFus R5 , AM1 FFus R8 2 15 L RNA 8579..85 80 MNV AC GT 2 SR3 Focc R5 , Kin 2009 FFus R5 2 15 L RNA 8615 SNV A G 1 SR3 Focc R5 , Kin 2009 FFus R5 2 15 L RNA 303 SNV G A 1 Kin-3 FFus R4 , AM1 Focc R8 2 15 L RNA 2691 SNV G T 1 Kin-3 FFus R4 , AM1 Focc R8 2 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 635 SNV A G 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 717 SNV T C 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 999 SNV C T 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 1758 SNV A G 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 1890 SNV A G 1 Kin-3 TTAB R4 3 15

206

Table S12 (Continued). L RNA Kin-3 Field col , Kin-3 Focc R4 , 2421 SNV T C 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 2727 SNV T C 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 2827 SNV G A 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 3225 SNV T C 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 3237 SNV A C 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 3402 SNV T A 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 3522 SNV A G 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 3579 SNV A G 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 4353 SNV G A 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 4359 SNV C T 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 5004 SNV G A 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 5566 SNV C T 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 5583 SNV C T 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 6210 SNV C T 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 6321 SNV T C 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 6978 SNV C T 1 Kin-3 TTAB R4 3 15

207

Table S12 (Continued). L RNA Kin-3 Field col , Kin-3 Focc R4 , 7851 SNV G A 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 7899 SNV A G 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 8395 SNV A G 1 Kin-3 TTAB R4 3 15 L RNA Kin-3 Field col , Kin-3 Focc R4 , 8455 SNV T C 1 Kin-3 TTAB R4 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 213..214 MNV GT AC 2 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 222 SNV C T 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 372..373 MNV CC TT 2 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 615 SNV T C 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 771 SNV C T 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 939 SNV A G 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 1035 SNV C T 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 1296 SNV G A 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 1378 SNV G T 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 1470 SNV A G 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 1575 SNV T C 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 1584 SNV A G 1 2009 FFus R5 3 15

208

Table S12 (Continued). L RNA SR3 field col , SR3 Focc R5 , Kin 1716 SNV A G 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 2766 SNV C T 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 2922 SNV C T 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 3042 SNV T C 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 3147 SNV C T 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 3165 SNV A T 1 2009 FFus R5 3 15 L RNA 3657..36 SR3 field col , SR3 Focc R5 , Kin 58 MNV AA GG 2 2009 FFus R5 3 15 L RNA 3858..38 SR3 field col , SR3 Focc R5 , Kin 59 MNV TC CT 2 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 4185 SNV T C 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 4200 SNV T C 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 4209 SNV T C 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 4365 SNV C T 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 4470 SNV C T 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 5100 SNV T C 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 5296 SNV T C 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 5609 SNV A G 1 2009 FFus R5 3 15

209

Table S12 (Continued). L RNA SR3 field col , SR3 Focc R5 , Kin 5634 SNV A G 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 5787 SNV T A 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 5922 SNV G A 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 5994 SNV A G 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 6510 SNV A G 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 6555 SNV A T 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 7056 SNV A G 1 2009 FFus R5 3 15 L RNA 7929..79 SR3 field col , SR3 Focc R5 , Kin 30 MNV TC CT 2 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 7983 SNV G A 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 8115 SNV A G 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 8331 SNV G A 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 8520 SNV A G 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 8580 SNV C T 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 8601 SNV A G 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 8639 SNV A G 1 2009 FFus R5 3 15 L RNA SR3 field col , SR3 Focc R5 , Kin 8708 SNV C T 1 2009 FFus R5 3 15

210

Table S12 (Continued). L RNA Kin-3 FFus R4 , AM1 Focc R8 , 3412 SNV G A 1 AM1 TTAB R4 3 15 L RNA Kin-3 FFus R4 , AM1 Focc R8 , 8614 SNV G A 1 AM1 TTAB R4 3 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 699 SNV A G 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 715 SNV G A 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 1827 SNV C T 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 2075 SNV T C 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 3006 SNV G A 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 3584 SNV T C 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 3903 SNV A G 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 4002 SNV T C 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 4095 SNV G A 1 TTAB R4 5 15

211

Table S12 (Continued). L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 4180 SNV T C 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 4464 SNV C T 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 4626 SNV C T 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 5400..54 FFus R8 , AM1 Focc R8 , AM1 01 MNV CA TG 2 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 5421 SNV C T 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 5568 SNV G A 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 5808 SNV C T 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 5847 SNV A G 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 5907 SNV T C 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 6348..63 FFus R8 , AM1 Focc R8 , AM1 49 MNV GG AA 2 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 7176 SNV T C 1 TTAB R4 5 15

212

Table S12 (Continued). L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 7303 SNV A G 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 7564 SNV C T 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 7722 SNV A C 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 7866 SNV A C 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 8124 SNV A T 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 8332 SNV G A 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 8700 SNV A G 1 TTAB R4 5 15 L RNA SR3 FFus R5 , Kin-3 FFus R4 , AM1 FFus R8 , AM1 Focc R8 , AM1 8739 SNV T C 1 TTAB R4 5 15 L RNA SR3 field col , SR3 Focc R5 , SR3 TTAB R4 , Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin 2009 TTAB R5 , Kin 2009 FFus R5 , 1773 SNV T C 1 Parker 9 15

213

Table S12 (Continued). L RNA SR3 field col , SR3 Focc R5 , SR3 TTAB R4 , Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin 2009 TTAB R1 , Kin 2009 FFus R5 , 7817 SNV A G 1 Parker 9 15 L RNA SR3 field col , SR3 Focc R5 , SR3 TTAB R4 , Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , Kin 4347 SNV C T 1 2009 FFus R5 , Parker 10 15 L RNA SR3 field col , SR3 Focc R5 , SR3 TTAB R4 , Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , Kin 5076 SNV A G 1 2009 FFus R5 , Parker 10 15 L RNA SR3 field col , SR3 Focc R5 , SR3 TTAB R4 , Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , Kin 6006 SNV T C 1 2009 FFus R5 , Parker 10 15 L RNA SR3 field col , SR3 Focc R5 , SR3 TTAB R4 , Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin 2009 6894..68 TTAB R1 , Kin 2009 TTAB R5 , Kin 95 MNV AT GC 2 2009 FFus R5 , Parker 10 15 L RNA SR3 field col , SR3 Focc R5 , SR3 TTAB R4 , Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , Kin 7233 SNV A G 1 2009 FFus R5 , Parker 10 15

214

Table S12 (Continued). L RNA SR3 field col , SR3 Focc R5 , SR3 TTAB R4 , Kin-3 Field col , Kin-3 Focc R4 , Kin-3 TTAB R4 , Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , Kin 7866 SNV A T 1 2009 FFus R5 , Parker 10 15 L RNA SR3 field col , SR3 Focc R5 , SR3 FFus R5 , Kin-3 Field col , Kin-3 Focc R4 , Kin-3 FFus R4 , Kin-3 TTAB R4 , Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , Kin 2009 FFus R5 , 8777 SNV C A 1 AM1 FFus R8 11 15 L RNA SR3 field col , SR3 Focc R5 , SR3 FFus R5 , Kin-3 Field col , Kin-3 Focc R4 , Kin-3 FFus R4 , Kin-3 TTAB R4 , Kin 2009 TTAB R1 , Kin 2009 TTAB R5 , Kin 2009 FFus R5 , 8779 SNV A G 1 AM1 FFus R8 11 15 †SNV-single nucleotide variant; MNV-multiple nucleotide variant

215