See discussions, stats, and author profiles for this publication at: http://www.researchgate.net/publication/226113878

Characterization of two novel γ-gliadin genes encoded by K genome of Crithopsis delileana and evolution analysis with those from

ARTICLE in GENES & GENOMICS · JUNE 2010 Impact Factor: 0.6 · DOI: 10.1007/s13258-010-0005-x

CITATIONS READS 3 17

10 AUTHORS, INCLUDING:

Zhi-Fu Guo Li Zhang

Shenyang Agricultural University 241 PUBLICATIONS 2,955 CITATIONS 12 PUBLICATIONS 187 CITATIONS SEE PROFILE SEE PROFILE

Li-Jing Chen Shenyang Agricultural University

8 PUBLICATIONS 23 CITATIONS

SEE PROFILE

Li-Jun Zhang

13 PUBLICATIONS 129 CITATIONS

SEE PROFILE

Available from: Zhi-Fu Guo Retrieved on: 25 December 2015 Genes & Genomics (2010) 32: 259-265 DOI 10.1007/s13258-010-0005-x RESEARCH ARTICLE

Characterization of two novel γ-gliadin genes encoded by K genome of Crithopsis delileana and evolution analysis with those from Triticeae

Zhi-Fu Guo · Ming Zhong · Yu-Ming Wei · Li Zhang · Hui Ma · Hao-Ge Li · Li-Jing Chen · Jing-Wei Lin · Li-Jun Zhang · You-Liang Zheng 1)

Received: 25 January 2010 / Accepted: 28 March 2010 / Published online: 30 June 2010 © The Genetics Society of Korea and Springer 2010

Abstract precious information for better understanding the qualities as- By acid polyacrylamide gel electrophoresis (A-PAGE) analy- sociated with gliadins, the response in coeliac disease and sis, it was indicated that the electrophoresis mobility of glia- studying the evolutionary relationship of gliadins in Triticeae. dins from Crithopsis delileana (Schult) Roshev (2n=2x=14, KK) had obvious difference with those from common wheat Keywords Crithopsis delileana; Gene cloning; γ-gliadin; phylo- in α, γ and ω region. Using homologous primers, two γ-gliadin genetic analysis; Triticeae genes (gli-Kr1 and gli-Kr2) were isolated from C. delileana, which had been deposited in the GenBank under accession numbers EU283818 and EU283821, respectively. Two γ Introduction -gliadin genes of C. delileana had the similar primary struc- tures to the corresponding gene sequences from other wheat Wheat gliadins are monomeric prolamins that comprise approx- related species. The differences were mainly resulted from sub- imately 50% of total gluten proteins (MacRitchie, 1992 stitutions, insertions and deletions involving single amino acid Gianibelli et al., 2001). Although gliadins account for about residues or motifs of γ-gliadins. The repetitive domains of half of gluten, their contribution to end-use quality is not as gli-Kr1 and gli-Kr2 from C. delileana are shorter than most well understood as is that of high molecular weight (HMW) of other sequences. By the alignment of γ-gliadin genes from glutenin subunits. Gliadin genes are contained within multigene A, B, D, Am, Au, S, Sl, Ssh, Ss and Sb genomes of Triticum clusters, so the effect of individual gliadins is difficult to de- and Aegilops, R genome of Secale (γ-secalin), Ee genome of termine (Fido et al., 1997). Based on Acid polyacrylamide gel Lophopyrum and K genome of Crithopsis in Triticeae, phylo- electrophoresis (A-PAGE), gliadins are divided into four groups genetic analysis indicated that two γ-gliadin genes of C. deli- (α-, β-, γ- and ω-gliadins) from fastest to slowest mobility, with leana could be clustered together with a γ-gliadin genefrom molecular weights ranging from 30 to 75 kDa. Later inves- Ssh genome of Aegilops by an interior paralleled branch. It tigations of primary structures have shown that only three types was the first time that the γ-gliadin genes encoded by K ge- of gliadins α-, γ- and ω-type exist (Bietz et al., 1977; Kasarda nome of C. delileana were characterized. These could offer et al., 1983 Yildiz et al., 2003). In terms of amino acid composi- tion, γ-gliadins differ from α-gliadins in the amounts of aspartic Z.-F. Guo · M. Zhong · L. Zhang · H. Ma · H.-G. Li · L.-J. Chen · acid proline, methionine, tyrosine, phenylalanine and trypto- J.-W. Lin · L.-J. Zhang ( ) phan (Bietz et al., 1977). The γ-gliadins have been considered Key Laboratory of Agricultural Biotechnology of Liaoning to be the most ancient members of the wheat gluten family Province, College of Biosciences and Biotechnology，Shenyang Agricultural University, Shenyang, Liaoning110866, China (Shewry and Tatham,1990). Sequence information for γ-gliadin e-mail: [email protected] genes in GenBank includes 34 complete/nearly complete open reading frame (ORF) and 66 partial sequences. These sequences Y.-M. Wei · Y.-L. Zheng ( ) come from various wheat，Aegilops and Lophopyrum species. Triticeae Research Institute, Sichuan Agricultural University, Yaan, Sichuan 625014, China However, no systematic research has been conducted yet e-mail: [email protected] (Anderson et al., 2001; Pistón et al., 2006; Chen et al., 2009; 260 Genes & Genomics (2010) 32:259-265

Qi et al., 2009). The common wheat ‘Chinese spring’ was used as the reference Gliadins are also important because they are associated with of gliadins. the development of coeliac disease (CD), a food-sensitive enter- opathy caused by the ingestion of gluten proteins. There is also A-PAGE analysis clear evidence that γ-gliadins are active in CD (Arentz-Hansen et al., 2000; Shan et al., 2002). The selection of genotypes with Gliadins were extracted from single seed with a solution of specific profiles of γ-gliadins may, therefore, be of interest in- 75%(v/v) ethanol and 0.05%(w/v) methyl green and separated relation to determining the relative activities of individual γ by a standard A-PAGE at pH3.1(Draper, 1987). -gliadins in provoking a response in CD and developing culti- vars with lower levels of the more toxic components. Designation of specific primers for gliadin genes The storage protein genes in the tribe of Triticeae were thought to have a common evolutionary origin (Kreis et al., 1985 Based on the nucleotide differences in the conserved regions Shewry and Tatham, 1990), and the wild species belonging to of alignments of some γ-gliadin genes published in GenBank, this tribe have been widely used as a source for novel prolamin a set of primers were designed using Primer Premier 5 soft- investigations (Bustos et al., 2001; Wan et al., 2002; Yan et ware (Table. 1). These primers had four combinations with al., 2002; Liu et al., 2003; Ko et al., 2004; Guo et al., 2005, gli-γF1 and R1, gli-γF1 and R2, gli-γF2 and R1 and gli-γF2 2008; Qi et al., 2006; Wang et al., 2006). Genetic transformation and R2. allows some new allelic variants of prolamin genes from these species to be introduced into wheat for wheat breeding to widen DNA extraction and PCR amplification or improve the properties of wheat for different end-uses. Besides the critical role of on making products, the prolamin Genomic DNA was extracted from leaf tissue using CTAB genes of wild species in Triticeae are very useful in studies of method as reported by Rogers et al. (1988). PCR reactions were in Triticeae evolution (Yan et al.,2006). performed in a total reaction volume of 25 μl containing 50 Crithopsis delieana (Schult) Roshev (2n=2x=14, KK) is a ng of genomic DNA, 1× Taq DNA polymerase buffer, 1.5 mM wild diploid species belonging to the Triticeae, which is the only MgCl2, 0.5 μM each primer, 200 μM each dNTP and 1U Taq member of the Crithopsis Jaub.Et Spach. in the Triticeae DNA polymerase (Tiangen). The program for PCR amplifica- group (Sakamoto, 1973). The distribution of C. delileana extends tion was as the follow: initial denaturation at 94℃ for 4 min, from northern of Africa to the southwest of Asia (Löve, 1984 35 cycles of 94℃ for 30 sec, 54℃ for 1 min, 72℃ for 1 Frederiksen, 1993). The classification and evolution about this min 30 sec, and a final extension at 72℃ for 7 min. The PCR species has been obtained by using morphology, cytology and products were separated on 1.2% agarose gels, and then the molecular biology methods (Hsiao et al., 1995; Catalan et al., targeted DNA fragments were recovered and cloned into the 1997; Petersen and Seberg, 1997). However, the phylogenetic pGEMT-Easy vector (Promega). The ligated products were relationships between this species and the other species in transformed into Escherichia coli (DH5α) cells and the result- Triticeae have not been comprehensively established. In previous ing plasmids were obtained as a sequencing template. investigations we have characterized two HMW prolamin genes and four low molecular weight (LMW) prolamin genes from Bioinformatic analyses this species, and compared its primary structure with that of pre- viously published subunits (Guo et al., 2005, 2008). To data, The ORFs were translated into amino acids sequences using there is no literature report on the characterization of the γ the ORF finder program at the NCBI network service -gliadin genes from this species. In the present study, we charac- (http://www.ncbi.nlm.nih. gov/gorf/gorf.html). Primer Premier terized two γ-gliadin genes from C. delileana and described phy- 5 software (http:// www.Premierbiosoft. com) was used for all logenetic relationships with its related species in Triticeae. Table 1. The sequences and location of the γ-gliadin gene primers.

Materials and Methods Name Sequences (5′→3′) Primer location Gli-γF 1 GAAGATTTGGTTTATGYCTAACAAC 5 ′ region of coding domain materials Gli-γF2 CAAACATTCCCCCATCAACC 5′ region of coding domain Gli-γR1 TCAAACATGATGGTCCACRC 3′ region of coding domain An accession of C. delileana, which was originally collected Gli-γR2 GGGGAATGATTGTTGTGGTTG 3′ region of coding domain from Demark, was used for the characterization of gliadins. Y = C or T; R = A or G Genes & Genomics (2010) 32:259-265 261

Figure 2 Amplifiation of complete ORFs for gliadins of C. delileana in genomic PCR experiments. LaneM: DNA size markers (bp); Lane 1, 2, 3 and 4: PCR products were amplified with primer pairs gli-γF1 and R1, gli-γF1 and R2, gli-γF2 and R1 and gli-γF2 and R2, respectively.

and sequenced, respectively. By the analysis and comparison Figure 1. The A-PAGE analysis of the gliadins in C. delileana. of sequences, two products had the similar but not identical Lane 1: common wheat ‘Chinese spring’ Lane 2: C. delileana. structures. The two resulting sequences, designated as gli-Kr1 and gli-Kr2, are 930 and 948 bp long with the GenBank ac- the primer designs. Sequences were aligned using softwares cession numbers EU283818 and EU283821, respectively (Fig DNAman 5.2.2 (http://www.lynnon.com) and CLUSTAL W 3). As all the other gliadin genes, no intron was found in the 1.81(Thompson et al., 1994). The phylogenetic tree was gen- coding regions of the gli-Kr1 and gli-Kr2, and the stop codon erated based on the NJ (neighour-joining) sequences distance TGA was observed at the 3' ends. Each sequence comprises method (Saitou and Nei, 1987) and depicted and edited by a single open reading frame (ORF), sharing a similarity of MEGA 3.1 program (Kumar et al., 2004). The used distance 95.36%. The gli-Kr1 could encode a putative mature peptide for the NJ grouping was 0.02 and the bootstrap value was with 315 amino acid residues, and the gli-Kr2 could encode estimated based on 500 replications. a putative mature peptide with 309 amino acid residues (Fig. 4). The sequence similarity between the two predicted proteins was 93.65%. Results The comparison of amino acid sequences of gliadins A-PAGE analysis The analysis and comparison of sequences indicated that the Protein bands in A-PAGE were classified as α-, γ- and ω-gliadins deduced amino acid sequences of gli-Kr1 and gli-Kr2 had the according to their electrophoretic mobility as described by similar but not identical primary structures to the representa- Draper (1987). Three, six and eight bands were detected in α-, tive γ-gliadins from other wheat related species (Fig. 4). The γ- and ω-gliadin region from C. delileana, respectively. It was deduced amino acid sequences of gli-Kr1 and gli-Kr2 both shown that the gliadin bands from C. delileana had obvious dif- consists of a conserved signal peptide with 19 residues, a ference with those from Chinese Spring in every region (Fig. shorter and conserved N-terminal domain with 12 residues, 1). This indicated that there were more likely varieties of gliadins a highly variable repetitive domain, a conserved nonrepetitive in C. delileana. domain with a series of repeats based on the consensus motif PQQPFPQ, a variable polyglutamine region and a C-terminal Isolation and sequencing of gliadin genes domain, respectively. There were 34 and 28 residues in poly- glutamine region of gli-Kr1 and gli-Kr2, respectively. The In genomic PCR reactions, the primer pairs gli-γF2 and gli-γ length difference was mainly caused by the number of gluta- R1 and gli-γF2 and gli-γR2 successfully amplified the products mine (Q)in polyglutamine regions of all gliadin sequences with about 900 bp (Fig. 2), then the PCR products were cloned were aligned. As all the other gliadin genes, their nonrepetitive 262 Genes & Genomics (2010) 32:259-265 domainscontain six conserved cysteine residues (C), and the dendrogram, it is clear that all sequences cluster into three C-terminal domains contain two conserved cysteine residues major groups and the genes from same genome approximately (C), respectively. The comparison of amino acid sequences were clustered into a small group. A gliadin gene from R ge- indicated that two gliadins of C .delileana were different from nome of Secale was clustered into a separate group. Two γ other γ-gliadin representatives by substitutions, insertions -gliadin genes of C. delileana were closely related to a γ and/or deletions involving single amino acid residues or motifs -gliadin gene from Ssh genome of Aegilops (Fig. 5). (Fig. 4). The main regions of variability are repetitive domains and polyglutamine regions. Discussion Evolutionary relationship analysis Only a small number of γ-gliadin gene sequences from some In order to understanding of the phylogenetic relationships wheat and related grass species have been reported to date among γ-gliadin genes in Triticeae, an analysis was carried (Anderson et al., 2001; Pistón et al., 2006; Chen et al., 2009; out to construct a dendrogram using some representative amino Qi et al., 2009). PCR-based cloning is a well-recognised strat- acid sequences without the repetitive domains and polyglut- egy for obtaining members of gene families, although it is amine regions. The alignment sequences were from A, B, D, inevitably restricted by the choice of primers used for m u l sh s A , A , S, S , S , S and Sb genomes of Triticum and Aegilops, amplification. It was found that the coding sequences of stor- Ee genome of Lophopyrum, R genome of Secale (γ-secalin) age protein are not interrupted by introns and are highly con- and K genome of Crithopsis, respectively. On the resulting served at 5′ and 3′terminal sequences (Shewry et al., 1989;

Figure 3. Comparison of nucleotide sequences of gli-Kr1 and gli-Kr2 from C. delileana. The degree of sequence conservation is indicated on the grey scale. Genes & Genomics (2010) 32:259-265 263

D′ovidio et al., 1995), which has facilitated the design of PCR work again illustrated the convenience and precision of PCR primers that could be used to amplify the coding regions of to investigate the gliadin multi-gene family from wild species unknown gliadin genes from wheat and its related species in the Triticeae. (Pistón et al., 2006; Qi et al., 2006, 2009; Chen et al., 2009). It is generally accepted that CD is an inflammatory T cell In addition, the evolutionary studies had revealed that the pro- response to gluten peptides bound to HLA-DQ2 or -DQ8. CD lamin genes in the Triticeae had the common origin (Kreis patients mount a T cell response to both major and minor α- et al., 1985). Thus, there had the possibility to isolate the novel and γ-gliadins (Spaenij-Dekking et al., 2004). So, the removal gliadin genes from the wheat related species. In this study, of these peptides is required to render wheat safe for con- we reported the isolation of gliadin genes gli-Kr1 and sumption by CD patients (Vader et al., 2003; Shan et al., gli-Kr2and the characterization of their coding sequences from 2005). Obviously, the classification depending on the length a wheat related diploid species C. delileana at first time. This of repetitive domain is reflected in the occurrence of toxic

Figure 4 Comparison of the deduced amino acid sequences of the γ-gliadin of C. delileana with other known γ-gliadins. The nontailed arrowheads indicated the positions of the eight cysteine residues. Ⅰ, Ⅱ, Ⅲ, Ⅳ, Ⅴand Ⅵö indicated signal peptide, N-terminal domain, repetitive domain, nonrepetitive domain, polyglutamine domain and C-terminal domain, respectively.The degree of sequence conservation is indicated on the grey scale. 264 Genes & Genomics (2010) 32:259-265

amine regions from the evolutionary study. The analysis of evolutionary relationship indicated that the gliadin genes from C. delileana were most closely related to a γ-gliadin gene from Ssh genome of Aegilops. It should help understanding the evo- lution of the gliadin gene family.

Acknowledgements We express our gratitude to the anonymous reviewers for helpful comments to improve the manuscript. This work was supported by the National Natural Science Foundation of China (Grant No. 30900894)，the National High Technology Research and the Development Program of China (863 program 2006AA10Z1F8 and 2006AA10Z179), the Key Technologies R&D Program of China (2006BAD01A02-23 and 2006BAD12B02), and the FANEDD project (200357 and 200458) from the Ministry of Education, China. Y.-M. Wei was supported by the Program for New Century Excellent Talents in the University of China(NECT-05-0814).

References Figure 5. The evolutionary relationships based on the alignments of the amino acid sequences of γ-gliadins from C. delileana （indicated Anderson OD, Hisa CC and Torres V (2001) The wheat γ-gliadin by ‘◆’) and other species in Triticeae. genes: characterization of ten new sequences and further under- standing of γ-gliadin gene family structure. Theor. Appl. Genet. epitopes. CD-toxic peptides of γ-gliadins are only found in 103: 323-330. the repetitive domain, especially the internal part, which is Anderson OD and Greene FC (1989) The characterization and com- parative analysis of High-Molecular-Weight glutenin genes from highly variable in length. Those γ-gliadins with a short repeti- genomes A and B of a hexaploid bread wheat. Theor. Appl. tive domain contain a brief internal part, which means that Genet. 77: 689-700. they are not/nearly not toxic to the population with celiac Arentz-Hansen H, McAdam SN, Molberg Ø, Kristiansen C and Sollid disease. Therefore, it is suggested that the genes with a short L (2000) Production of a panel of recombinant gliadins for the repetitive domain are more nutritional and valuable (Shan et characterisation of T cell reactivity in coeliac disease. Gut 46: 46-51. al., 2005; Qi et al., 2009). In the present study, the repetitive Bietz JA, Huebner FR, Sanderson JE and Wall JS (1977) Wheat glia- domain of gliadin gene from T. turgidumis shortest in all se- din homology revealed through N-terminal amino acid sequence quences were aligned (Fig. 4). The repetitive domains of analysis. Cereal Chem. 54: 1070–1083. gli-Kr1 and gli-Kr2 from C. delileana are shorter than most Bustos AD, Rubio Pand Jouve N (2001) Characterization of two gene subunits on the 1R chromosome of rye as orthologs of each of of other sequences. the Glu-1 genes of hexaploid wheat. Theor. Appl. As highly hererogeneous storage proteins, studies at the Genet.76: 513-529. DNA level can provide more information to define the origin Catalan P, Kellogg EA and Olmstead RG (1997) Phylogeny of of gliadin gene families in Triticeae. The high degree of se- subfamily based on chloroplast ndhF gene seq- quence similarity among all genes of storage protein from ce- uences. Mol. Phylogenet. Evol. 8 (2): 150-166. Chen FG, Zhao F, Liu SW and Xia GM (2009) The γ-gliadin gene reals related to wheat implied that they arose from the duplica- content of a derivative from a somatic hybrid between bread tion of a single ancestral sequence. Therefore, the sequences wheat and tall wheatgrass. Mol. Breeding 24(2): 117-126. of these genes were subjected to comparisons to determine D’ovidio R, Masci S and Porcedu E (1995) Development of a set their phylogenetic relationships (Shewry and Tatham, 1990). of oligonucletide primers specific for genes at the Glu-1 complex The alignment of homoelogous genes of storage protein had loci of wheat. Theor. Appl. Genet. 91: 189-194. Draper SR (1987) ISTA vatiety committee report of the working been widely used to reveal the evolutionary relationships of group for biochemical tests for cultivar identification 1983-1986. Triticeae species (Guo et al., 2005, 2008 Long et al.,2006; Seed Sci. Technol. 15: 431-434. Wang et al., 2006; Yan et al., 2006). Anderson and Greene Fido RJ, Bekes F, Gras PW and Tatham AS (1997) Effects of α-, (1989) suggested that differences/similarities in the repetitive β-, γ- and ω-gliadins on the dough mixing properties of wheat domain and the polyglutamine region should not be used as flour. J. Cereal Sci. 26: 271-277. Frederiksen S (1993) Taxonomuc studies in some annual genera of a basis for determining relatedness, since these domains are the Triticeae (poaceae). Nord. J. Bot. 13: 481-493. evolving rapidly within each gliadin family. In the present Gianibelli MC, Larroque OR, MacRitchie F and Wrigley CW (2001) study, we also excluded the repetitive domains and polyglut- Biochemical, genetic and molecular characterization of wheat glu- Genes & Genomics (2010) 32:259-265 265

ten proteins. Cereal Chem. 78: 635-646. wheat (Triticum dicoccoides). DNA Sequence 17 (6): 415-421. Guo ZF, Yan ZH, Wang JR, Wei YM and Zheng YL (2005) Rogers SO and Bendich AJ (1988)Extraction of DNA from plant Characterization of HMW prolamines and their coding sequences tissues. Plant Molecular Biology Manual A6: 1-10. from Crithopsis delileana. Hereditas 142: 56-64. Saitou N and Nei M (1987) The neighbor-joining method: A new Guo ZF, Dong P, Long XY, Wei YM, Zhang LJ and Zheng YL (2008) method of reconstructing phylogenetic trees. Mol. Biol. Evol. Molecular characterization of LMW prolamines from Crithopsis 4: 406-425. delileana and the comparative analysis with those from Triticeae. Sakamoto S (1973) Patterns phylogenetic differentiation in the tribe Hereditas 145: 204-211. Triticeae. Rep. Kihara Inst. Biol. Res.24: 11-31. Hsiao C, Chatterton NJ and Asay KH (1995) Phylogenetic relation- Shan L, Molberg Ø, Parrot I, Hausch F, Filiz F, Gray GM, Sollid ships of the monogenomic species of the wheat tribe, Triticeae LM and Khosla C (2002) Structural basis for gluten intolerance (Poaceae), inferred from nuclear rDNA (internal transcribed in celiac sprue. Science 297: 2275–2279. spacer) sequences. Genome 38(2): 211-231. Shan L, Qiao S, Arentz-Hansen H, Molberg Ø, Gray GM, Sollid LM Kasarda DD, Autran JC, Lew EJL, Nimmo CC and Shewry RP (1983) and Khosla C (2005) Identification and analysis of multivalent N-terminal amino acid sequences of ω-gliadins and ω-secalins: proteolytically resistant peptides from gluten: implications for cel- Implications for the evolution of prolamin genes. Biochim. iac sprue. J. Proteome Res. 4(5): 1732–1741. Biophys. Acta. 747: 138–150. Shewry PR, Halford NG and Tatham AS (1989)The high molecular Ko JM, Park DS, Park HM, Yi GH, Cho JH, Nam MH, Suh DY weight subunits of wheat,barley and rye: genetics, molecular biol- and Seo BB (2004) Alteration of HMW glutenin subunits in wheat ogy, chemistry and role in wheat gluten structure and lines possessing new 1BL.1RS translocation. Kor. J. Genet. 26( functionality. Oxford Surv. Plant Mol. Cell Bio. l6: 163–219. 3)： 261-267 Shewry PR and Tatham AS (1990) The prolamin storage proteins Kreis M, Shewry PR and Forde BG (1985) Structure and evolution of cereal seeds: structure and evolution. Biochem. J. 267: 1–12. of seed storage proteins and their genes, with particular reference Spaenij-Dekking EHA, Kooy-Winkelaar EMC, Nieuwenhuizen WF, to those of wheat, barley and rye. Oxford Surv. Plant Cell Mol. Drijfhout JW and Koning F (2004) A novel and sensitive method Biol. 2: 253-317. for the detection of T cell stimulatory epitopes of α/β-, and γ Kumar S, Tamura K and Nei M (2004) MEGA3: integrated software -gliadin. Gut 53: 1267–1273. for molecular evolutionary genetics analysis and sequence Thompson JD, Higgins DG and Gibson TJ (1994) Clustal-W improv- alignment. Brief Bioinform. 5: 150–163. ing the sensitivity of progressive multiple sequence alignment Liu Z, Yan Z, Wan Y. Liu K, Zheng Y and Wang D (2003)Analysis through sequence weighting, position-specific gap penalties and of HMW glutenin subunits and their coding sequences in two weight matrix choice. Nuclo. Acids. Res. 22: 4673-4680. dipliod Aegilops species. Theor. Appl. Genet. 106: 1368-1378. Vader LW, Stepniak DT, Bunnik EM, Kooy YM, De-Haan W, Löve A (1984) Conspectus of the Triticeae. Feddes. Rep. Bd.95 Drijfhout JW, Van-Veelen PA and Koning F (2003) (7/8): 425-521. Characterization of cereal toxicity for celiac disease patients based Long H, Wei YM, Yan ZH, Baum B, Nevo E and Zheng YL (2006) on protein homology in grains. Gastroenterology 125: 1105– Classification of wheat low-molecular-weight glutenin subunit 1113. genes and its chromosome assignment by developing LMW-GS Wan Y, Wang D, Shewry PR and Halford NG (2002) Isolation and group-specific primers. Theor. Appl. Genet. 111: 1251-1259. characterization of fie novel high molecular weight subunit of MacRitchie F (1992)Physicochemical properties of wheat proteins in glutenin genes from Triticum timopheevi and Aegilops cylindrical. relation to functionality. Adv. Food Nutr. Res. 36: 1-87. Theor. Appl. Genet. 104: 828-839. Petersen G and Seberg O (1997) Phylogenetic analysis of the Triticeae Wang JR, Yan ZH, Wei YM and Zheng YL (2006) Characterization (Poaceae) based on rpoA sequence data. Mol. Phylogenet. Evol. of high-molecular-weight glutenin subunit genes from Elytrigia 7 (2): 217-230. elongata. Plant Breeding 125: 89-95. Pistón F, Dorado G, Martín A and Barro F (2006) Cloning of nine Yan ZH, Wan YF, Liu KF, Zheng YL and Wang DW (2002) γ-gliadin mRNAs (cDNAs) from wheat and the molecular charac- Identification of a novel HMW gultenin subunit and comparison terization of comparative transcript levels of γ-gliadin subclasses. of its amino acid sequence with those of homologous subunits. J. Cereal Sci. 43: 120-128. Chinese Sci. Bull.47(3): 220-225. Qi PF, Wei YM, Ouellet T, Chen Q, Tan X and Zheng YL (2009) Yan ZH, Wei YM, Wang JR, Liu DC, Dai SF and Zheng YL (2006) The gamma-gliadin multigene family in common wheat (Triticum Characterization of two HMW glutenin subunit genes from aestivum) and its closely related species. BMC genomics Taenitherum Nevski. Genetica. 127: 267-276. http://www.biomedcentral.com/1471-2164/10/168. Yildiz M, Yildiz AV and Ozgen M (2003) Cytoplasmic Effects on Qi PF, Yue YW, Long H, Wei YM, Yan ZH and Zheng YL (2006) Gliadin Composition in Winter Durum Wheat (Triticum durum Molecular characterization of α-gliadin genes from wild emmer Desf.). Kor. J. Genet. 25(3): 209-214