Characterization of Two Novel Γ-Gliadin Genes Encoded by K Genome of Crithopsis Delileana and Evolution Analysis with Those from Triticeae
Total Page：16
File Type：pdf, Size：1020Kb
See discussions, stats, and author profiles for this publication at: http://www.researchgate.net/publication/226113878 Characterization of two novel γ-gliadin genes encoded by K genome of Crithopsis delileana and evolution analysis with those from Triticeae ARTICLE in GENES & GENOMICS · JUNE 2010 Impact Factor: 0.6 · DOI: 10.1007/s13258-010-0005-x CITATIONS READS 3 17 10 AUTHORS, INCLUDING: Zhi-Fu Guo Li Zhang Shenyang Agricultural University 241 PUBLICATIONS 2,955 CITATIONS 12 PUBLICATIONS 187 CITATIONS SEE PROFILE SEE PROFILE Li-Jing Chen Shenyang Agricultural University 8 PUBLICATIONS 23 CITATIONS SEE PROFILE Li-Jun Zhang 13 PUBLICATIONS 129 CITATIONS SEE PROFILE Available from: Zhi-Fu Guo Retrieved on: 25 December 2015 Genes & Genomics (2010) 32: 259-265 DOI 10.1007/s13258-010-0005-x RESEARCH ARTICLE Characterization of two novel γ-gliadin genes encoded by K genome of Crithopsis delileana and evolution analysis with those from Triticeae Zhi-Fu Guo · Ming Zhong · Yu-Ming Wei · Li Zhang · Hui Ma · Hao-Ge Li · Li-Jing Chen · Jing-Wei Lin · Li-Jun Zhang · You-Liang Zheng 1) Received: 25 January 2010 / Accepted: 28 March 2010 / Published online: 30 June 2010 © The Genetics Society of Korea and Springer 2010 Abstract precious information for better understanding the qualities as- By acid polyacrylamide gel electrophoresis (A-PAGE) analy- sociated with gliadins, the response in coeliac disease and sis, it was indicated that the electrophoresis mobility of glia- studying the evolutionary relationship of gliadins in Triticeae. dins from Crithopsis delileana (Schult) Roshev (2n=2x=14, KK) had obvious difference with those from common wheat Keywords Crithopsis delileana; Gene cloning; γ-gliadin; phylo- in α, γ and ω region. Using homologous primers, two γ-gliadin genetic analysis; Triticeae genes (gli-Kr1 and gli-Kr2) were isolated from C. delileana, which had been deposited in the GenBank under accession numbers EU283818 and EU283821, respectively. Two γ Introduction -gliadin genes of C. delileana had the similar primary struc- tures to the corresponding gene sequences from other wheat Wheat gliadins are monomeric prolamins that comprise approx- related species. The differences were mainly resulted from sub- imately 50% of total gluten proteins (MacRitchie, 1992 stitutions, insertions and deletions involving single amino acid Gianibelli et al., 2001). Although gliadins account for about residues or motifs of γ-gliadins. The repetitive domains of half of gluten, their contribution to end-use quality is not as gli-Kr1 and gli-Kr2 from C. delileana are shorter than most well understood as is that of high molecular weight (HMW) of other sequences. By the alignment of γ-gliadin genes from glutenin subunits. Gliadin genes are contained within multigene A, B, D, Am, Au, S, Sl, Ssh, Ss and Sb genomes of Triticum clusters, so the effect of individual gliadins is difficult to de- and Aegilops, R genome of Secale (γ-secalin), Ee genome of termine (Fido et al., 1997). Based on Acid polyacrylamide gel Lophopyrum and K genome of Crithopsis in Triticeae, phylo- electrophoresis (A-PAGE), gliadins are divided into four groups genetic analysis indicated that two γ-gliadin genes of C. deli- (α-, β-, γ- and ω-gliadins) from fastest to slowest mobility, with leana could be clustered together with a γ-gliadin genefrom molecular weights ranging from 30 to 75 kDa. Later inves- Ssh genome of Aegilops by an interior paralleled branch. It tigations of primary structures have shown that only three types was the first time that the γ-gliadin genes encoded by K ge- of gliadins α-, γ- and ω-type exist (Bietz et al., 1977; Kasarda nome of C. delileana were characterized. These could offer et al., 1983 Yildiz et al., 2003). In terms of amino acid composi- tion, γ-gliadins differ from α-gliadins in the amounts of aspartic Z.-F. Guo · M. Zhong · L. Zhang · H. Ma · H.-G. Li · L.-J. Chen · acid proline, methionine, tyrosine, phenylalanine and trypto- J.-W. Lin · L.-J. Zhang ( ) phan (Bietz et al., 1977). The γ-gliadins have been considered Key Laboratory of Agricultural Biotechnology of Liaoning to be the most ancient members of the wheat gluten family Province, College of Biosciences and Biotechnology，Shenyang Agricultural University, Shenyang, Liaoning110866, China (Shewry and Tatham,1990). Sequence information for γ-gliadin e-mail: [email protected] genes in GenBank includes 34 complete/nearly complete open reading frame (ORF) and 66 partial sequences. These sequences Y.-M. Wei · Y.-L. Zheng ( ) come from various wheat，Aegilops and Lophopyrum species. Triticeae Research Institute, Sichuan Agricultural University, Yaan, Sichuan 625014, China However, no systematic research has been conducted yet e-mail: [email protected] (Anderson et al., 2001; Pistón et al., 2006; Chen et al., 2009; 260 Genes & Genomics (2010) 32:259-265 Qi et al., 2009). The common wheat ‘Chinese spring’ was used as the reference Gliadins are also important because they are associated with of gliadins. the development of coeliac disease (CD), a food-sensitive enter- opathy caused by the ingestion of gluten proteins. There is also A-PAGE analysis clear evidence that γ-gliadins are active in CD (Arentz-Hansen et al., 2000; Shan et al., 2002). The selection of genotypes with Gliadins were extracted from single seed with a solution of specific profiles of γ-gliadins may, therefore, be of interest in- 75%(v/v) ethanol and 0.05%(w/v) methyl green and separated relation to determining the relative activities of individual γ by a standard A-PAGE at pH3.1(Draper, 1987). -gliadins in provoking a response in CD and developing culti- vars with lower levels of the more toxic components. Designation of specific primers for gliadin genes The storage protein genes in the tribe of Triticeae were thought to have a common evolutionary origin (Kreis et al., 1985 Based on the nucleotide differences in the conserved regions Shewry and Tatham, 1990), and the wild species belonging to of alignments of some γ-gliadin genes published in GenBank, this tribe have been widely used as a source for novel prolamin a set of primers were designed using Primer Premier 5 soft- investigations (Bustos et al., 2001; Wan et al., 2002; Yan et ware (Table. 1). These primers had four combinations with al., 2002; Liu et al., 2003; Ko et al., 2004; Guo et al., 2005, gli-γF1 and R1, gli-γF1 and R2, gli-γF2 and R1 and gli-γF2 2008; Qi et al., 2006; Wang et al., 2006). Genetic transformation and R2. allows some new allelic variants of prolamin genes from these species to be introduced into wheat for wheat breeding to widen DNA extraction and PCR amplification or improve the properties of wheat for different end-uses. Besides the critical role of on making products, the prolamin Genomic DNA was extracted from leaf tissue using CTAB genes of wild species in Triticeae are very useful in studies of method as reported by Rogers et al. (1988). PCR reactions were in Triticeae evolution (Yan et al.,2006). performed in a total reaction volume of 25 μl containing 50 Crithopsis delieana (Schult) Roshev (2n=2x=14, KK) is a ng of genomic DNA, 1× Taq DNA polymerase buffer, 1.5 mM wild diploid species belonging to the Triticeae, which is the only MgCl2, 0.5 μM each primer, 200 μM each dNTP and 1U Taq member of the genus Crithopsis Jaub.Et Spach. in the Triticeae DNA polymerase (Tiangen). The program for PCR amplifica- group (Sakamoto, 1973). The distribution of C. delileana extends tion was as the follow: initial denaturation at 94℃ for 4 min, from northern of Africa to the southwest of Asia (Löve, 1984 35 cycles of 94℃ for 30 sec, 54℃ for 1 min, 72℃ for 1 Frederiksen, 1993). The classification and evolution about this min 30 sec, and a final extension at 72℃ for 7 min. The PCR species has been obtained by using morphology, cytology and products were separated on 1.2% agarose gels, and then the molecular biology methods (Hsiao et al., 1995; Catalan et al., targeted DNA fragments were recovered and cloned into the 1997; Petersen and Seberg, 1997). However, the phylogenetic pGEMT-Easy vector (Promega). The ligated products were relationships between this species and the other species in transformed into Escherichia coli (DH5α) cells and the result- Triticeae have not been comprehensively established. In previous ing plasmids were obtained as a sequencing template. investigations we have characterized two HMW prolamin genes and four low molecular weight (LMW) prolamin genes from Bioinformatic analyses this species, and compared its primary structure with that of pre- viously published subunits (Guo et al., 2005, 2008). To data, The ORFs were translated into amino acids sequences using there is no literature report on the characterization of the γ the ORF finder program at the NCBI network service -gliadin genes from this species. In the present study, we charac- (http://www.ncbi.nlm.nih. gov/gorf/gorf.html). Primer Premier terized two γ-gliadin genes from C. delileana and described phy- 5 software (http:// www.Premierbiosoft. com) was used for all logenetic relationships with its related species in Triticeae. Table 1. The sequences and location of the γ-gliadin gene primers. Materials and Methods Name Sequences (5′→3′) Primer location Gli-γF 1 GAAGATTTGGTTTATGYCTAACAAC 5 ′ region of coding domain Plant materials Gli-γF2 CAAACATTCCCCCATCAACC 5′ region of coding domain Gli-γR1 TCAAACATGATGGTCCACRC 3′ region of coding domain An accession of C. delileana, which was originally collected Gli-γR2 GGGGAATGATTGTTGTGGTTG 3′ region of coding domain from Demark, was used for the characterization of gliadins. Y = C or T; R = A or G Genes & Genomics (2010) 32:259-265 261 Figure 2 Amplifiation of complete ORFs for gliadins of C.