US00783873OB2

(12) United States Patent (10) Patent No.: US 7,838,730 B2 Gallie et al. (45) Date of Patent: *Nov. 23, 2010

(54) ENGINEERING 2004/0214272 A1 10, 2004 La Rosa et al. SINGLE-GENE-CONTROLLED STAYGREEN FOREIGN PATENT DOCUMENTS POTENTIAL INTO PLANTS WO WO92,04456 3, 1992 WO WO 96/35792 11, 1996 (75) Inventors: Daniel R. Gallie, Riverside, CA (US); WO WOO1/25455 4/2001 Robert Meeley, Des Moines, IA (US); WO WOO1,57063 8, 2001 Todd Young, Palm Springs, CA (US); WO WOO3,OOO906 A2 1, 2003 Timothy George Helentiaris, Tucson, AZ (US) OTHER PUBLICATIONS Mendipweb “Welcome to Plant-Hormones,” webpage at http://www. (73) Assignees: Pioneer Hi-Bred International Inc., plant-hormones.info?, 1 page, Jun. 26, 2008. Bhalla and Singh (1999) Molecular control of male fertility in Bras Des Moins, IA (US); The Regents of the sica Proc. 10" Annual Rapeseed Congress, Canberra, Australia. University of California, Oakland, CA Borrell AK. Douglas ACL (1996) Maintaining greenleafarea in grain (US) Sorghum increases yield in a water-limited environment. In: Foale MA, Henzell RG, Kneipp JF, eds. Proceedings of the third Australian (*) Notice: Subject to any disclaimer, the term of this Sorghum conference. Melbourne: Australian Institute of Agricultural patent is extended or adjusted under 35 Science, Occasional Publication No. 93. U.S.C. 154(b) by 0 days. Bruce et al. (2002), “Molecular and physiological approaches to maize improvement for drought tolerance' Journal of Experimental This patent is Subject to a terminal dis Botany, 53 (366): 13-25. claimer. Database EMBL Apr. 5, 1996, Subramaniam, L. “Triticum aestivum ACC synthase (TA-ACS2) gene, complete cods.” Retrieved from EBI (21) Appl. No.: 12/313,376 Database accession No. U42336. Davis KM and Grierson D (1989) Identification of cDNA clones for tomato (Lycopersicon esculentum Mill.) mRNAS that accumulate (22) Filed: Nov. 18, 2008 during fruit ripening and leaf Senescence in response to ethylene. Pinto 179: 73-80. (65) Prior Publication Data Desai et al. (2002) “Expression and Affinity Purification of Recom US 2009/O172844 A1 Jul. 2, 2009 binant Proteins from Plants.” Protein Expression and Purification, 25:195-202. Related U.S. Application Data Duncan RR. et al. (1981) “Descriptive comparison of senescent and non-senescent sorghum genotypes.” Agronomy.Journal 73: 849-853. (63) Continuation of application No. 1 1/698.310, filed on Gallie and Young (2004) The ethylene biosynthetic and perception Jan. 24, 2007, which is a continuation of application machinery is differentially expressed during endosperm and embryo No. 10/875,127, filed on Jun. 22, 2004, now Pat. No. development Mol Gen Genomics 271:267-281. 7,230,161. Gan et al. (1997) “Making Sense of Senescence.” Plant Physiology, 113:313-319. (60) Provisional application No. 60/480,861, filed on Jun. Gan S and Amasino RM (1995) Inhibition of leaf senescence by 23, 2003. autoregulated production of cytokinin. Science 270: 1986-1988. GenBankAccession No. AX659868, “Sequence 225 from Patent WO (51) Int. Cl. 03000906,” Mar. 22, 2003. AOIH IM00 (2006.01) GenBank Accession No. M96673, “Oryza sativa AOIH 5/00 (2006.01) 1-aminocyclopropane-1 carboxylate synthase (ACC1) gene, com plete cds,” Jun. 12, 1993. CI2N 5/82 (2006.01) Genbank accession No. AAAAO 1003833, date of publication Apr. 4. C7H 2L/04 (2006.01) 2002, date of retrieval Feb. 9, 2005. (52) U.S. Cl...... 800/278; 800/283; 800/285: 800/286:800/295: 800/298; 800/320.1; 800/320.2: (Continued) 435/410; 435/412: 435/419:435/.424; 536/24.5 Primary Examiner Eileen B O Hara (58) Field of Classification Search ...... None (74) Attorney, Agent, or Firm Monicia Elrod-Erickson; See application file for complete search history. Brian E. Davy; Quine Intellectual Property Law Group, P.C. (56) References Cited (57) ABSTRACT U.S. PATENT DOCUMENTS The enzymes of the ACC synthase family are used in produc 5.449,764 A 9, 1995 Bird et al. ing ethylene. Nucleotide and polypeptide sequences of ACC 5,484.906 A 1/1996 Bird et al. synthases are provided along with knockout plant cells hav 5,536,659 A 7, 1996 Fukuda et al. ing inhibition in expression and/or activity in an ACC Syn 5,702.933 A 12/1997 Klee et al. thase and knockout plants displaying a staygreen phenotype, 5,723,766 A 3/1998 Theologis et al. a male sterility phenotype, or an inhibition in ethylene pro 5,750,864 A 5, 1998 Bestwicket al. duction. Methods for modulating staygreen potential in 5,824,875 A 10, 1998 Ranu plants, methods for modulating sterility in plants, and meth 5,886,164 A 3, 1999 Bird et al. ods for inhibiting ethylene production in plants are also pro 5,908,971 A 6, 1999 Van Der Straeten vided. 6,156,956 A 12/2000 Theologis et al. 6,207,881 B1 3/2001 Theologis et al. 29 Claims, 59 Drawing Sheets 6,262,346 B1 7, 2001 Bird (2 of 59 Drawing Sheet(s) Filed in Color) US 7,838,730 B2 Page 2

OTHER PUBLICATIONS Grbic V and Bleeker AB (1995) Ethylene regulates the timing of leaf senescence in Arabidopsis. The Plant Journal 8: 95-102. Genbank accession No. AAAAO 1005233, date of publication Apr. 4. Jeon et al. (1999) Isolation and characterization of an anther-specific 2002, date of retrieval Feb. 9, 2005. gene, RA8, from rice (Olyza sativa L). Plant Molecular Biology Genbank accession No. AAAAO 1009261, date of publication Apr. 4. 39:35-44. 2002, date of retrieval Feb. 9, 2005. John I, et al. (1995) Delayed leaf senescence in ethylene-deficient Genbank accession No. AAAAO 1016483, date of publication Apr. 4. ACC-oxidase antisense tomato plants: molecular and physiological 2002, date of retrieval Feb. 9, 2005. analysis. The Plant Journal 7: 483-490. Genbank accession No. AAAAO 1021286, date of publication Apr. 4. Kim et al. Tissue-Specific Expression of the Gus Gene Driven by the 2002, date of retrieval Feb. 9, 2005. GBAN2 15-6 Promoter in Cabbage and Tobacco Plants, International Genbank accession No. AAAAO 1027795, date of publication Apr. 4. Plant & Animal Genome Conference, San Diego, CA Jan. 9-12, 2002, date of retrieval Feb. 9, 2005. 2000, Abstract. Genbank accession No. AB085172, date of publication Feb. 26. Kolkman, JMetal. (2005) “Distribution of Activator (Ac) Through 2006, date of retrieval Aug. 3, 2006. out the Maize Genome for Use in Regional Mutagenesis' Genetics, Genbank accession No. AC090973, date of publication Mar. 21. 169: 981-995. 2001, date of retrieval Feb. 9, 2005. McBee GG, Waskom RM, Miller FR, Creelman RA (1983) Effect of Genbank accession No. AF008942, date of publication Oct. 16, 2003, Senescence and non-senescence on carbohydrates in Sorghum during date of retrieval Feb. 9, 2005. late kernel maturity states. CropScience 23: 372-377. Genbank accession No. AF 1295.08, date of publication Apr. 7, 2000, New England BioLabs 1988-1989 Catalog, p. 62, catalog #1230, date of retrieval Feb. 9, 2005. Random Primer. Genbank accession No. AF179248, date of publication Jul. 13, 2001, Oeller et al. (1991) “Reversible Inhibition of Tomato Fruit Senes date of retrieval Feb. 9, 2005. cence by Antisense RNA.” Science, 254:437-439. Genbank accession No. AF179249, date of publication Jul. 13, 2001, Pepescu and Turner (2004) “Silencing of ribosomal protein L3 genes date of retrieval Feb. 9, 2005. in N tabacum reveals coordinate expression and significant alter Genbank accession No. AF332390.1, date of publication May 7, ations in plant growth, develepment and ribosome biogenesis.” The 2003, date of retrieval Feb. 9, 2005. Plant Journal 39:29-44. Genbank accession No. AF332391.1, date of publication May 7, Picton S, et al. (1993) Altered fruit ripening and leaf senescence in 2003, date of retrieval Feb. 9, 2005. tomatoes expressing an antisense ethylene-forming enzyme Genbank accession No. AF334712.1, date of publication Dec. 11, transgene. The Plant Journal 3: 469-481. 2003, date of retrieval Feb. 9, 2005. Protein Information Resource accession No. F46376, date of publi Genbank accession No. AF334720, date of publication Dec. 11, cation Jul. 9, 2004, date of retrieval Feb. 8, 2005. 2003, date of retrieval Feb. 9, 2005. Protein Information Resource accession No. G46376, date of publi Genbank accession No. AL606624, date of publication Feb. 10, 2004, cation Jul. 9, 2004, date of retrieval Feb. 8, 2005. date of retrieval Feb. 9, 2005. Protein Information Resource accession No. S71 174, date of publi Genbank accession No. AP000559, date of publication Nov. 30. cation Jul. 9, 2004, date of retrieval Feb. 9, 2005. 2004, date of retrieval Feb. 9, 2005. Protein Information Resource accession No. T13019, date of publi Genbank accession No. AP002746, date of publication Nov. 16. cation Jul. 9, 2004, date of retrieval Feb. 9, 2005. 2004, date of retrieval Feb. 9, 2005. Protein Information Resource accession No. T47943, date of publi Genbank accession No. AY133715, date of publication Sep. 18. cation Jul. 9, 2004, date of retrieval Feb. 9, 2005. 2002, date of retrieval Feb. 9, 2005. Rosenow DT, Quisenberry JE, Wendt CW. Clark LE (1983) Drought Genbank accession No. AY702076, date of publication Sep. 6, 2004, tolerant Sorghum and cotton germplasm. Agricultural Water Man date of retrieval Feb. 9, 2005. agement 7: 207-222. Genbank accession No. M96672, date of publication Jun. 12, 1993, Rottmann et al. (1991) 1-Aminocyclopropane-1-carboxylate date of retrieval Aug. 3, 2006. Synthase intomato is encoded by a multigene family whose transcrip Genbank accession No. NM 100030, date of publication Feb. 19. tion is induced during fruit and floral sensescence Journal of Molecu 2004, date of retrieval Feb. 9, 2005. lar Biology 222:937-961. Genbank accession No. NM 127846, date of publication Jan. 25. Rougonetal. (1975) “Insertion of rabbit B-globin gene sequence into an E. coli plasmid.” Nucleic Acids Research. 2:2365-2378. 2005, date of retrieval Feb. 9, 2005. Russell WA (1991) Genetic improvement of maize yields. Advances Genbank accession No. T13019, date of publication Mar. 28, 1995, in Agronomy 46: 245-298. date of retrieval Feb. 9, 2005. Smith et al. (200) "Total silencing by intron-spliced hairpin RNAs.” Genbank accession No. U17972, date of publication Mar. 8, 1997. Nature, 407:319-320. date of retrieval Feb. 9, 2005. Sozzi et al. (2002) Gibberellic acid, synthetic auxins, and ethylene Genbank accession No. U26544, date of publication Apr. 3, 1996, differentially modulate O-L-arabinofuranosidase activites in date of retrieval Feb. 9, 2005. antisense 1-aminocyclopropane-1-carboxylic acid synthase tomato Genbank accession No. U42336, date of publication Nov. 7, 1996, pericarp discs Plant Physiology 129:1330-1340. date of retrieval Feb. 9, 2005. Spano et al. (2003) “Physiological characterization of 'stay-green Genbank accession No. U72389, date of publication Oct. 22, 1996, mutants in durum wheat.” Journal of Experimental Botany, 54.1415 date of retrieval Feb. 9, 2005. 1420. Genbank accession No. U72390, date of publication Oct. 22, 1996, Subramaniam et al. (1996) "Isolation of two differently expressed date of retrieval Feb. 9, 2005. wheat ACC synthase cDNAs and the characterization of one of their Genbank accession No. U79999, date of publication Jan. 5, 1999, genes with root-predominant expression.” Plant Molecular Biology date of retrieval Feb. 9, 2005. 31:1009-1020. Genbank accession No. X59139, date of publication Jan. 30, 1992, SwissProt accession No. AAG48754, date of publication May 7, date of retrieval Jan. 13, 2006. 2003, date of retrieval Mar. 8, 2005. Genbank accession No. X59145, date of publication Jan. 30, 1992, SwissProt accession No. AAG48755, date of publication May 7, date of retrieval Feb. 9, 2005. 2003, date of retrieval Mar. 8, 2005. Genbank accession No. X59145, date of publication Jan. 30, 1992, SwissProt accession No. AAG50090, date of publication Dec. 11, date of retrieval Jan. 13, 2006. 2003, date of retrieval Mar. 8, 2005. Genbank accession No. X59146, date of publication Apr. 18, 2005, SwissProt accession No. Q06402, date of publication Jan. 25, 2005, date of retrieval Jan. 13, 2006. date of retrieval Mar. 8, 2005. Genbank accession No. X59146, date of publication Jan. 30, 1992, Tada et al. (2003)“Effect of an Antisense Sequence on Rice Allergen date of retrieval Feb. 9, 2005. Genes Comprising a Multigene Family.” Breeding Science 53:61-67. US 7,838,730 B2 Page 3

Thomas et al. (2001) 'Size constraints for targeting post-transcrip Young TE, et al. (2004) “ACC Synthase Expression Regulates Leaf tional gene silencing and for RNA-directed methylation in Nicotana Performance and Drought Tolerance in Maize” The Plant Journal, benthamiana using a potato virus X vector.” The Plant Journal, 40:813-825. 25:417-425. Zarembinski et al. (1993) "Oryza sativa 1-aminocyclopropane-1 Thomas Hand Howarth CJ (2000) "Five ways to stay green” Journal carboxylate synthase (ACC1) mRNA” complete cols. GenBank of Experimental Botany. 51: 329-337. Accession M96672, pp. 1-2. Thomas H. Smart CM (1993) Crops that stay green. Annals of Chuang and Meyerowitz (2000)"Specific and heritable genetic inter Applied Biology 123: 193-219. ference by double-stranded RNA in Arabidopsis thaliana, ' PNAS, Thomas I. Zarembinski and Athanasios Theologis (1993) "Anaerobiosis and Plant Growth Hormones Induce Two Genes 97(9):4985-4990. Encoding 1-Aminocyclopropane-1- Carboxylate Synthase in Rice Colliver et al. (1997) “Differential modification of flavonoid and (Oryza sativa L.) Molecular Biology of the Cell vol. 4, 363-373. isoflavonoid biosynthesis with an antisense chalcone synthase con Tsuchisaka A. and Theologis A. (2004) “Unique and overlapping struct in transgenic Lotus corniculatus, ' Plant Molecular Biology, expression patterns among the Arabidopsis 1-amino-cyclopropane 35:509-522. 1-carboxylate synthase gene family members' Plant Physiology, Elomaa et al. (1996) "Transformation of antisense constructs of the 136: 2982-3000. chalcone sythase gene Superfamily into Gerbera bybrida: differential Twell et al. (1993) Activation and developmental regulation of an effect on the expression of family members.” Molecular Breeding, Arabidopsis anther-specific promoter in microspores and pollen of 2:41-50. Nicotiana tabacum. Sex. Plant Reprod. 6:217-224. GenBank Accession No. AB085172, date of publication Feb. 26. van Tunen et al. (1990) Pollen- and anther-specific chi promoters 2003, date of retrieval Dec. 29, 2007. from petunia: tandem promoter regulation of the chiA gene. Plant Horesh etal (2003) "A rapid method for detection of putative RNAi Cell 2:393-40. target genes in genomic data.” Bioinformatics, 19:ii73-ii80. U.S. Patent Nov. 23, 2010 Sheet 1 of 59 US 7,838,730 B2

Activation of Cell Death execution phase

EN2 AdoMet --> ACC -> Ethylene Induction of ACC ACC ethylene synthase oxidase response genes

Fig. 1 U.S. Patent US 7,838,730 B2

Z‘61–

U.S. Patent Nov. 23, 2010 Sheet 3 Of 59 US 7,838,730 B2

U.S. Patent Nov. 23, 2010 Sheet 4 of 59 US 7,838,730 B2

U.S. Patent Nov. 23, 2010 Sheet 5 of 59 US 7,838,730 B2

Fig. 5A 5 -- B73 (+/-) -8- 15 (070) 4.

3

Fig. 5B zoo 1 2 3 4 5 6 7 8 9 1 O

1 2 3 4 5 6 7 8 9 1 O Fig. 5C 30 -- B73 (+++) -- 15 (OO) .9 it as ES 2 > so O CD 1 2 3 4 5 6 789 10 Bottom -...--> Top Leaf Position U.S. Patent Nov. 23, 2010 Sheet 6 of 59 US 7,838,730 B2

Fig. 5D

Fi 9. 5 E 5 OO 450 400 - -e- 15 (ofo)

1 2 3 4 5 6 7 8 9 Bottom - Top Leaf Position

U.S. Patent Nov. 23, 2010 Sheet 8 Of 59 US 7,838,730 B2

A47pep A5Opep OsiaCS1 pep OsjaCS1 pep TaACS2pep - MaAS1 pep MaAS5pep A65 pep OsiaCS2pep AtACS5pep AtACS9 AtACS4 pep AtACS8 LeACS3pep LeACS7pep MaACS2pep MaACS3pep OsjACS2pep f OsjACS3 OsjACS3pep AtACS7 AtACS6pep AtACS1 pep AtACS2pep LeACS2pep LeACS4 pep LeACS 1 Apep - LeACS1Bpep LeACS6pep

o O.OO number of substitutions per 100 amino acids

U.S. Patent Nov. 23, 2010 Sheet 15 of 59 US 7,838,730 B2

AtACS2pep . YEDGLSSPG . IMSPHSPLL RA- ~ LeACS2pep mydesvilspl sspippsplv r- ~~ LeACS4 pep stimkmilla- - -- ~~~~~~~~~ ~~~~ MaACS1 pep FEDPTIMTP. HLMSPHSPLV QAAT MaACS5pep FEDPTIMTP. HLMSPHSPLV OAAT LeACS1Apep lchefnnspa hspn. Insplv rt -- ~ LeACS1Bpep lod. df.nspa hspIm.nsplv rt ~~ LeACS6pep L.D. DFMNSP. HSPM. SSPMV QARN AtACS6pep FDDGFF. SP. HSPVPPSPLV RAQT A65pep ER-~~~~~~~ ~~~~~~~~~~ ~~~~ osiacs2pep ER-~~~~~~~ ~~~~~~~~~~ ~~~~ AtACS5pep DER- ~~~~~~ ~~~~~~~~~~ ~~~~ AtACS9 DER- ~~~~~ - - - - ~~~~~~~ - - - - At ACS4 pep EER- ~~~~~~ -- ~~~~~~~~~ ~~~~ At ACS8 EER------MaACS2pep ~~~~~~~~~~ ~~~~~~~~~~ ~~~~ MaACS3 pep ~~~~~~~~~~ ~~~~~~~~~~ ~~~~ LeACS3 pep ER- ~~~~~~~ ~~~~~~~~~~ - ~~~ LeACS7 pep ER- ~~~~~~~ ~~~~~~~~~~ -- ~~~ OsjACS2pep - ~~~~~~~~~ ~~~~~~~~~~ --~~~ OsjACS3 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~ OsiaCS3 pep ~~~~~~~~~~ ~~~~~~~~~~ -- ~~~ AtACS7 ------ConSensus ------

Fig. 8G

U.S. Patent Nov. 23, 2010 Sheet 22 Of 59 US 7,838,730 B2

AtACS2pep . YEDGLSSPG IMSPHSPLL RA- a LeACS2pep mydesvils.pl sspippsplv a ruru LeACS4pep Stinkmla------MaACS1 pep FEDPTIMTP. HLMSPHSPLV MaACS5pep FEDPTIMTP. HLMSPHSPLV LeACS1Apep ldhefnn spa hspn.nsplv LeACS1Bpep ld df. n spa hispn. n splv LeACS6pep L.D. DFMNSP. HSPM SSPMV AtACS6 pep FDDGFF. SP. HSPVPPSPLV A65 pep ER------Osiacs2pep AtACS5pep At ACS9 AtACS4 pep At ACS8 MaACS2pep sw away w exe aw as ess aw as as as away are era was aw as aw way a MaACS3 pep ^s aw ex exa exa ex awaw aw axw We are as aw as aware eras aw aw was era era LeACS3 pep LeACS7 pep ER------OsjACS2pep ~~~~~~~~~~ ~~~~~~~~~~ ~~~~ OsjACS3 ~~~~~~~~~~ -- ~~~~~~~~~ -- ~~~ OsiACS3 pep - ~~~~~~~~~ ~~~~~~~~~~ ~~~~ At ACS7 aw are as as as asses as are are awar as are are aw as awar as aware as a Consensus

Fig. 9G

U.S. Patent Nov. 23, 2010 Sheet 29 Of 59 US 7,838,730 B2

AtACS2pep ... YEDGLSSPG . IMSPHSPLL RA- - LeACS2pep mydesvilspl sspippsplv ra- - - LeACS4 pep Stinkmilla------MaACS1 pep FEDPTIMTP. HLMSPHSPLV QAAT MaACS5 pep FEDPTIMTP. HLMSPHSPLV QAAT LeACS1Apep ldhefmnspa hspm.nsplV rt - - LeACS1Bpep ld. df. nspa hspm.nsplv rt - - LeACS6pep L.D. DFMNSP. HSPM. SSPMV QARN AtACS6pep FDDGFF. SP. HSPVPPSPLV RAQT A65pep ER------Osiacs2pep AtACS5 pep AtACS9 AtACS4pep AtACS8 MaACS2pep en me mo M M an any as as aw en m me a My as an are as aw w m M. M. MaACS3 pep mo an en m an an an eno an an an an an an M as an any an are m me m w LeACS3 pep LeACS7pep ER------OsjACS2pep - ~~~~~~~~~ ~~~~~~~~~~ ~~~~ OsjACS3 m w w w mo m w aw aw aw w Mu awm Mw ww as at aw ex ma Mm ww OsiaCS3pep ~~~~~~~~~~ ~~~~~~~~~~ ~~~~ AtACS7 m an an an on an ap rae are a m an an on me are an era at W an M - aw COn Sen SuS an an an a- a-- a-- a- an en m an an an a rate a rao an an M. M. M.

Fig. 10G

U.S. Patent Nov. 23, 2010 Sheet 33 Of 59 US 7,838,730 B2

451 5 OO A47 pep AERWAATRPM RLSLPRRGGA TASHPISSP M. ALLSPOSP MVHAS- - - - - A5 Opep AERWAATRPL RLSLPRRGAT TASHLASSP L. ALLSPQSP MVHASr. a- - - - Osiac Slpep AERWAANRQL RLSLPHHHHL SPAH. LSSP L. ALLSPOSP MVRATS. a- - - OsjacSlpep AERWAANROL RLSIPHHHHL SPAH. LSSP LALLSPOSP MVRATS - - - - TaACS2pep AQRWAARSHL HLSLORHGPM ASOYHALSSP MAALLSPOSP LVHAAS -- ~~~ AtACS1 pep NCNCICNNKR . . ENKKRKSF . . . QKNLKLS LSSMR. . YEE HVRSPK. LMS AtACS2pep IVEKASENDO VIONKSAKKL KWTOTNLRLS FRRL . . . YED GLSSPG. MS LeACS2pep ... Sgdikss ...... Smekko qwkkinnlirls fs . . krmyde SVlsplis spi LeACS4 pep . . nVinking ...... VInknkh ngrgttydlit pc. . mgstmk Imlila--~~~~~ MaACS1 pep . . DAA...... VQAKNKR RWDEA LRLS LPR. RRFEDP TIMTP. HLMS MaACS5pep . . DAA...... VOAKNKR KWDET. LRLS LP . . RRFEDP TIMTP. HLMS LeACS1Apep . . . .ldp.kg lnniaaikko c. Srirklois ls. firrld he fInnspahspn LeACS1Bpep . . . . lot.kg lnniaaikko c. srsklois ls. firrld. d. f. InspahspIm LeACS6 pep . . . YLOPNKG V. EVATKKOY CRTRSKLEIS LS. FRRLD. D FMNSP. HSPM AtACS6 pep . . EETKPMAA TTMMAKKKKK CW. OSNLRLS FSDTRRFDDG FF. SP, HSPV COn Sen SulS

A47 pep awar as eswers away awes are A5 Opep Osiac Slpep aw was aw awes as a as a OsjacS1 pep TaACS2pep experswers as aw exa MY awasaw as AtACS1 pep PHSPLTRA- - AtACS2pep PHSPLLRA- - LeACS2pep ppsplvr- ~~ LeACS4 pep MaACS1 pep PHSPLVOAAT MaACS5pep PHSPLVOAAT LeACS1Apep .nsplvrt ~~ LeACS1Bpep .nsplvrt~~ LeACS6pep . SSPMVQARN AtACS6pep PPSPLVRAOT Consensus

Fig. 1 1D

U.S. Patent Nov. 23, 2010 Sheet 38 of 59 US 7,838,730 B2

Consensus Secuence (identical amino acid residues)

1. 50 A65 pep ~~~~~~ MIAD EKPOPOLLSK KAACNSHGQD SSYFLGWEEY EKNPYDPVAN osiacs2pep ~~MVSQVVAE EK. . POLLSK KAGCNSHGOD SSYFLGWQEY EKNPFDPVSN AtACS5pep ~~~~~~~~~~ - ~~~ MKQLST KVTSNGHGQD SSYFLGWEEY EKNPYDEIKN AtACS9 ~~~~MKQLSR KVTSNAHGQD SSYFLGWEEY EKNPYDEIKN AtACS4 pep -- ~~~~~~~~ - ~~~ MVOLSR KATCNSHGQV SSYFLGWEEY EKNPYDWTKN At ACS8 - - - -MGLLSK KASCNTHGQD SSYFWGWEEY EKNPYDEIKN MaACS2pep ~~~~~~~~~~ ~~~~~~~~~~ -- ~~~~~~~~~ --~~~~~~~~ MaACS3 pep -- ~~~~~~~~ - ~~~~~~~~~ -- ~~~~~~~~~ ~~~~~~~~~~ - ~~~~~~~~~ LeACS3 pep -- ~~~~~~~~~ ~~~~ MKLLSE KATCNSHGQD SSYFLGWOEY EKNPYDEION LeACS7 pep -- ~~~~~~~~~ ~~~~MKILLSK KAMCNSHGQD SSYFLGWEEY QKNPYDEIRN OsjACS2pep MGGKLLPAAA FAGSAPPLSO WATSAAHGED SPYFAGWKAY DEOPYHAVON OsjACS3 MGGKLLPAAA FAGSAPPLSQ VATSAAHGED SPYFAGWKAY DEDPYHAVDN OsiaCS3 pep MGGKLLPAAA FAGSAPPLSQ VATSAAHGED SPYFAGWKAY DEDPYHAVIDN AtACS7 MGLPLMMERS SNNNNVELSR VAVSDTHGED SPYFAGWKAY DENPYDESHN COn SenSuS ------LS ------HG-- S-YF-GW--Y ---P- - - - - N

51 1OO A65 pep PGGIIQMGLA ENOLSFDLLE AWLEA. NPDA LGLRR. . GGA SVFRELALFQ Osiacs2pep PSGIIQMGLA ENQLSFDLLE EWLEK. NPHA LGLRREGGGA SVFRELALFQ AtACS5 pep PNGMIOMGLA ENOLCFDLIE SWLTK. NPDA ASLKRN . . GQ SIFRELALFQ AtACS9 PNGIIQMGLA ENOLCFDLIE TWLAK. NPDA AGLKKD . . GO SIFKELALFQ AtACS4 pep PQGIIQMGLA ENQLCFDLLE SWLAQ. NTDA ACFKRD. . GQ SVFRELALFO AtACS8 PDGIIQMGLA ENOLSFDLIE SWLAK. NPDA ANFORE. . GQ SIFRELALFQ MaACS2pep ------MGFT ENOLCFDLIE SWLEN. HPDP AAFKKD . . GA LLFRELALFQ MaACS3 pep ------a- MGFA ENHVSFDLE SWLED. HPDL TGFKKD. . GG LVFRELALFQ LeACS3 pep PKGIIQMGLA ENQLSFDLLE SWLAQ. NPDA AGFKRN GE SIFRELALFQ LeACS7 pep PKGIIQMGLA ENOLSFDLLE SWLTL. NPDA SAFKIRN. . GH SIFRELSLFQ OsjACS2pep PDGVIQMGLA ENOVSFDLLE AYL, RDHPEA AGWSTGGAGA GSFRDNALFQ OsjACS3 PDGVIQMGLA ENOVSFDLLE AYL. RDHPEA AGWSTGGAGA GSFRDNALFO OsiaCS3pep PDGVIQMGLA ENQVSFDLLE AYL, RDHPEA AGWSTGGAGA GSFRDNALFQ AtACS7 PSGVIQMGLA ENOVSFDLLE TYLEKKNPEG SMW. . GSKGA PGFRENALFQ Consensus PSGIIQMG-- EN- - -FDL-E ------G --F----LFQ 101 150 A65pep DYHGMPAFKN ALARFMSEQR GYRVTFDPSN VTTAGATSA NEALMFCLAD Osiacs2pep DYHGLPAFKQ ALARFMSEQR GYKVVFDPSN VLTAGATSA NEALMFCLAD AtACS5pep DYHGMPEFKK AMAEFMEEIR GNRWTFDPKK IVLAAGSTSA NETLMFCLAE AtACS9 DYHGLPEFKK ALAEFMEEIR GNRVTFDPSK VLAAGSTSA NETLMFCLAE AtACS4pep DYHGLSSFKN AFADFMSENR GNRVSFDSNN LVLTAGATSA NETLMFCLAD AtACS8 DYHGLPSFKN AMADFMSENR GNRVSFNPNK LVLTAGATPA NETLMFCLAD MaACS2pep DYHGLPAFKR ALTKYMGEVR GNKVAFDPNR LVLTAGATSA NETLMFCLAE MaACS3 pep DYHGLPAFKN ALARYMGEVR GNKVSFEPSK LVLTAGATSA NETLMFCLAD LeACS3 pep DYHGLPAFKN AMTKFMSEIR GNRVSFDSNN LVLTAGATSA NETLMFCLAN LeACS7pep DYHGIPAFKD ALVQFMSEIR GNKVSFDSNK LVLTAGATSA NETLMFCLAD Os ACS2pep DYHGLKSFRK AMASFMGKIR GGKARFDPDH TVLTAGATAA NELLTFILAN OsjACS3 DYHGLKSFRK AMASFMGKIR GGKARFDPDH VLTAGATAA NELLTFILAN OsiaCS3 pep DYHGLKSFRK AMASFMGKIR GGKARFDPDH TVLTAGATAA NELLTFLAN AtACS7 DYHGLKTFRO AMASFMEOIR GGKARFDPDR IVLTAGATAA NELLTFILAD Consensus DYHG - - -F.-- A- - - -M---R G----F- - - - -VL-AG-T-A NE-L-F-LA

151 200 Fig 13A

U.S. Patent Nov. 23, 2010 Sheet 41 of 59 US 7,838,730 B2

MaACS3 pep ~~~~~~~~~~ ~~~~~~~~~~ -- ~~~~~~~~~ -- ~~~~~~~~~ - - - - ~~~~~~ LeACS3 pep KDFWESTAP NATNHQNQQQ SNANSKKKSF . . . SKWVFRL . . . SFNDRQR LeACS7 pep LKAFVDSRVN NKDDIQNQQQ . . CSNKKKSF . . . SKWVFRL . . . SFNERQR OsjACS2pep SRFMDTWING TKOQASCQQQ EQQ- ~~~~~~ ~~~~~~~~~~ - ~~~~~~~~~ OsjACS3 SRFMDTWING TKOQASCQQQ EQQ- ~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ OsiaCS3 pep ISRFMDTWNG TKQQASCQQQ EQQ- ~~~~~~ ~~~~~~~~~~ -- ~~~~~~~~~ AtACS7 IHEFMDRRRR F------Consensus

A65 pep Osiacs2pep AtACS5 pep DER AtACS9 DER AtACS4 pep EER AtACS8 EER MaACS2pep MaACS3 pep LeACS3 pep LeACS7 pep OsjACS2pep OsjACS3 OsiaCS3 pep At ACS 7 Consensus

Fig. 13D U.S. Patent Nov. 23, 2010 Sheet 42 of 59 US 7,838,730 B2

Consensus Sequence (similar amino acid residues)

1 50 A65 pep ~~~~~~ MIAD EKPQPQLLSK KAACNSHGOD SSYFLGWEEY EKNPYDPVAN osiacs2pep - ~MVSQVVAE EK. . POLLSK KAGCNSHGQD SSYFLGWQEY EKNPFDPVSN AtACS5pep ~~~~~~~~~~ ~~~~ MKQLST KVTSNGHGQD SSYFLGWEEY EKNPYDEIKN AtACS9 ~~~~MKQLSR KVTSNAHGQD SSYFILGWEEY EKNPYDEIKN AtACS4 pep - ~~~~~~~~~ -- ~~~ MVQLSR KATCNSHGOV SSYFLGWEEY EKNPYDVTKN AtACS8 - - - --MGLLSK KASCNTHGQD SSYFWGWEEY EKNPYDEIKN MaACS2pep - ~~~~~~~~~ -- ~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ -- ~~~~~~~~~ MaACS3 pep - ~~~~~~~~~ - ~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ -- ~~~~~~~~~ LeACS3 pep ~~~~~~~~~~ -- ~~~ MKLLSE KATCNSHGOD SSYFLGWOEY EKNPYDEIQN LeACS7pep ~~~~~~~~~~ -- ~~~ MKLLSK KAMCNSHGOD SSYFLGWEEY QKNPYDEIRN OsjACS2pep MGGKLLPAAA FAGSAPPLSQ VATSAAHGED SPYFAGWKAY DEDPYHAVIDN OsjACS3 MGGKLLPAAA FAGSAPPLSQ VATSAAHGED SPYFAGWKAY DEDPYHAVIDN OsiACS3 pep MGGKLLPAAA FAGSAPPLSQ VATSAAHGED SPYFAGWKAY DEDPYHAVIDN At ACS7 MGIPLMMERS SNNNNVELSR WAVSDTHGED SPYFAGWKAY DENPYDESHN Consensus - - - LS - - - - HGQ S-YF-GW--Y E--PY- - - -N

51 100 A65 pep PGGIIOMGLA ENOLSFDLLE AWLEA. NPDA LGLRR. . GGA SVFRELALFQ OsiaCS2pep PSGIIQMGLA ENQLSFDLLE EWLEK. NPHA LGLRREGGGA SVFRELALFQ AtACS5 pep PNGMIQMGLA ENQLCFDLIE SWLTK. NPDA ASLKRN . . GQ SIFRELALFO AtACS9 PNGIIQMGLA ENOLCFDLIE TWLAK. NPDA AGLKKD. . GQ SIFKELALFQ AtACS4pep PQGIIQMGLA ENQLCFDLLE SWLAQ. NTDA ACFKRD. . GQ SVFRELALFQ AtACS8 PDGIIQMGLA ENQLSFDLIE SWLAK. NPDA ANFORE. . GO SIFRELALFO MaACS2pep aw m - M M aw MGFT ENOLCFDLIE SWLEN. HPDP AAFKKD . . GA LLFRELALFO MaACS3 pep an an an M. m. aw MGFA ENHVSFDLTE SWLED. HPDL TGFKKD. . GG LVFRELALFQ LeACS3 pep PKGIIOMGLA ENOLSFDLLE SWLAQ. NPDA AGFKRN . . GE SIFRELALFQ LeACS7 pep PKGIIQMGLA ENQLSFDLLE SWLTL. NPDA SAFKRN . . GH SIFRELSLFQ OsjACS2pep PDGVIQMGLA ENQVSFDLLE AYL, RDHPEA AGWSTGGAGA GSFRDNALFQ OsjACS3 PDGVIQMGLA ENQVSFDLLE AYL. RDHPEA AGWSTGGAGA GSFRDNALFQ OsiaCS3 pep PDGVIQMGLA ENOVSFDLLE AY. RDHPEA AGWSTGGAGA GSFRDNALFQ At ACS7 PSGVIQMGLA ENOVSFDLLE TYLEKKNPEG SMW. GSKGA PGFRENALFO Consensus P-G-IQMGLA EN- - - FOLLE -WL ------G --FRE--LFO 101 150 A65 pep DYHGMPAFKN ALARFMSEQR GYRVTFDPSN IVLTAGATSA NEALMFCLAD Osiacs2pep DYHGLPAFKO ALARFMSEQR GYKVVFDPSN VLTAGATSA NEALMFCLAD AtACS5pep DYHGMPEFKK AMAEFMEER GNRVTFDPKK IVLAAGSTSA NETLMFCLAE AtACS9 DYHGLPEFKK ALAEFMEER GNRVTFDPSK IVLAAGSTSA NETLMFCLAE AtACS4 pep DYHGLSSFKN AFADFMSENR GNRVSFDSNN LVLTAGATSA NETLMFCLAD At ACS8 DYHGLPSFKN AMADFMSENR GNRVSFNPNK LVLTAGATPA NETLMFCLAD MaACS2pep DYHGPAFKR ALTKYMGEVR GNKVAFDPNR LVLTAGATSA NETLMFCLAE MaACS3 pep DYHGLPAFKN ALARYMGEVR GNKVSFEPSK LVLTAGATSA NETLMFCLAD LeACS3 pep DYHGLPAFKN AMTKFMSEIR GNRVSFDSNN LVLTAGATSA NETLMFCLAN LeACS7 pep DYHGLPAFKD ALVOFMSEIR GNKVSFDSNK LVLTAGATSA NETLMFCLAD OsjACS2pep DYHGLKSFRK AMASFMGKR GGKARFDPDH IVLTAGATAA NELTFILAN OsjACS3 DYHGLKSFRK AMASFMGKR GGKARFDPDH VLTAGATAA NELLTFIAN OsiaCS3 pep DYHGLKSFRK AMASFMGKIR GGKARFDPDH TVLTAGATAA NELLTFILAN AtACST DYHGLKTFRO AMASFMEQIR GGKARFDPDR IVLTAGATAA NELLTFILAD COn Sen SuS DYHGL --FK A---FM---R G-K--F- - - - IVL-AG-T-A NE-L-F-LA Fig ... 14A

U.S. Patent Nov. 23, 2010 Sheet 45 of 59 US 7,838,730 B2

MaACS2pep - ~~~~~~~~~ - ~~~~~~~~~ --~~~~~~~~~ -- ~~~~~~~~~ - ~~~~~~~~~ MaACS3 pep - ~~~~~~~~~ - ~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ -- ~~~~~~~~~ LeACS3 pep IKDFVESTAP NATNHQNQQQ SNANSKKKSF . . . SKWVFRL . . . SFNDRQR LeACS7pep LKAFVDSRVN NKDDIQNQQQ . . CSNKKKSF . . . SKWVFRL . . . SFNERQR OsjACS2pep ISRFMDTWNG TKQQASCQQQ EQQ- ~~~~~~ ~~~~~~~~~~ - ~~~~~~~~~ OsjACS3 ISRFMDTWNG TKQQASCQQQ EQQ- ~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ OsiACS3 pep ISRFMDTWNG TKOOASCOOO EOQ- ~~~~~~ - ~~~~~~~~~ ~~~~~~~~~~ AtACS7 IHEFMDRRRR F------~~~~ Consensus L- - - -D------

5 O1. A65 pep ER osiacs2pep ER AtACS5pep DER At ACS9 DER AtACS4pep EER AtACS8 EER MaACS2pep ~~~ MaACS3 pep -- ~~ LeACS3 pep ER LeACS7 pep ER OsjACS2pep ~~~ OsjACS3 ~~~ OsiaCS3 pep - ~~ AtACS7 ~~~ Consen SuS ---

Fig. 14D

U.S. Patent Nov. 23, 2010 Sheet 47 of 59 US 7,838,730 B2

Consensus W-LN-SPG-S -HC-EPGWFR VC-ANM---T --VAL-R- - - F ------

451 498 A47 pep AKAERWAATR PMRLSLPRR. . GGATASHLP ISSPMALLSP QSPMVHAS A5 Opep AKAERWAATR PLRLSLPRR. . GATTASHLA ISSPLALLSP QSPMVHAS A65pep VLAPARSISL PVRFSWANRL TPGSAADRKA ER- ~~~~~~~ ~~~~~~~~ COn Sensus --A------P-R-S- - -R------A------

Fig. 15B

U.S. Patent Nov. 23, 2010 Sheet 49 of 59 US 7,838,730 B2

Consensus V-LNVSPG- S -HC-EPGWFR VC-ANM---T MEVAL-RI- - F ------K

451 498 A47 pep AKAERWAATR PMRLSLPRR. . GGATASHLP ISSPMALLSP QSPMVHAS A5 Opep AKAERWAATR PLRLSLPRR. . GATTASHLA ISSPLALLSP QSPMVHAS A65 pep VLAPARSISL PVRFSWANRL TPGSAADRKA ER- ~~~~~~~ - ~~~~~~~ ConSensus --A------P-R-S---R------A------

Fig. 16B U.S. Patent Nov. 23, 2010 Sheet 50 of 59 US 7,838,730 B2

Fig. 17A 1000 8 O O

6 O O

4. O O -- B73 (+1+) 2 O O -e-ACS2 (OO) -- ACS6 (OIO) O & 1 2 3 4 5 6 7 8 9 O 11

8 O O

6 O O I 4 O O

2 O O

O Fig. 17Cooo 1 2 3 4 5 6 7 8 9 1 O 11

- - B73 (+ft, control) -A ACS6 (070, Control) - - - B73 (++, drought) - A - ACS6 (O?O, drought)

1 2 3 4 5 6 7 8 9 1 O 11 Bottom - Top Leaf Position U.S. Patent Nov. 23, 2010 Sheet 51 of 59 US 7,838,730 B2

Fig. 17D 1200 1 OOO 8OO 6OO 4OO |-e-B73(30dap) 2OO -- B73(40dap) O 1 2 3 4 5 6 7 8 9 1 O 11 Bottom --> Top Leaf Position

Fig. 18A

. 9 c. 6 g 2 g - 3 -- B73 (+14) OO -e-ACs2 (OO) -A-ACS6 (OO)

1 2 3 4 5 6 7 8 9 1 O 11

Bottom --> Top Leaf Position U.S. Patent Nov. 23, 2010 Sheet 52 of 59 US 7,838,730 B2

Fig. 18B

C. 8 a - th5, - 6 g) S. O. On 4

O w (O 2

O Fig. 18C 12

9 CD w

?h5

O OD 6 -- B73 (+1+, control) 5 - 3 |-A-ACS6 (0/0, control) - as - B73 (+1+, drought) - A - ACS6 (070, drought) O

Fig. 18D 14 12

. CD - 1 O 5 Lile 8 9 O CO. 8 O WW CO -e- B73(30dap) -- B73(40dap)

1 2 3 4 5 6 7 8 9 1 O 11 Bottom - Top Leaf Position

U.S. Patent Nov. 23, 2010 Sheet 54 Of 59 US 7,838,730 B2

...... 30 DAP

1 2 3 4 5 6 7 8 9 1 O 11 Fig. 19C

Leaf 3 Leaf 6 Leaf 9 35OO

28OO

(NA-16/6ni)||Kudouo|?O 14OO :acs6;-:;: 7OO B73 acS2 ::::::::::::::|aos6, acs2 acs6+ACC acs6+ACC acs6+ACClight acs6+ACClight

Fig. 20A

U.S. Patent Nov. 23, 2010 Sheet 57 Of 59 US 7,838,730 B2

GATCCGCCGCTTCGTGCGCCAGCACCAGCACAGCAAGGCCAAGGCCGAGCGCTGGGCGGCCACGC GGCCCCTCCGCCTCAGCTTGCCGCGCCGGGGAGCA ACCACCGCTTCGCACCTCGCCATCCCCAGCC CCTTGGCGTTGCTGTCGCCGCAGTCCCCGATGGTCCACGCCAGCTAGCTAGTCACCGAGCGTTCGG TAAG ACTGGCTGTAGGGTGTGCCCTCACATAACTGCAAACAAGTGGACAAAAAATATTAGACAAG ACTAATAAAGGGCATTAGTAGCTAGCTTGACATTACACAGAGACGTTGCACAGGCGTCAGCAGGC GTCGGCGGTAAGCAGCTAGTCAAGCAGGACGCATTTGTCCTCGATTTTTTCGTGTATATATGTTCTT TTTTCTGTTTTGCCAAATCGCATGTATGGTTTGGTTTAACGTTAGTACACGGTAGAATAACGACGG GTATGGTAATTAGACCTCCCGATCAATTGTTGTTGAAAACCTGTCACGTAACTTCAGGACACAGA AGGCGTAGCTCAAGGGTGAATAAAAGACCAGTTTACATATCAAAAAAAAAAAAAAAAAAAAAAA AAAAAGGGC Fig. 21C

UB17M INTRON1 (PHI) UB1zM5UTR (PHI) UB12M PRO\ \\ ZM-ACS6| (TR1) ZM-ACS6 (TR2) | RB

US 7,838,730 B2 1. 2 ENGINEERING Sorghum during late kernel maturity states. CropScience 23: SINGLE-GENE-CONTROLLED STAYGREEN 372-377; Rosenow DT, Quisenberry J. E. Wendt CW. Clark POTENTIAL INTO PLANTS L E (1983) Drought-tolerant sorghum and cotton germplasm. Agricultural Water Management 7: 207-222; and, Borrell A CROSS-REFERENCE TO RELATED K. Douglas ACL (1996) Maintaining green leafarea in grain APPLICATIONS Sorghum increases yield in a water-limited environment. In: Foale MA, Henzell RG, Kneipp JF, eds. Proceedings of the This application is a continuation of U.S. patent applica third Australian sorghum conference. Melbourne. Australian tion Ser. No. 1 1/698,310, filed Jan. 24, 2007, entitled “Engi Institute of Agricultural Science, Occasional Publication No. neering single-gene-controlled Staygreen potential into 10 93). The stay-green phenotype has also been used as a selec plants' by Gallie et al., which issued on Jul. 27, 2010 as U.S. tion criterion for the development of improved varieties of Pat. No. 7,763,773, which is a continuation of U.S. patent corn, particularly with regard to the development of drought application Ser. No. 10/875,127, filed Jun. 22, 2004, entitled tolerance. See, e.g., Russell WA (1991) Genetic improvement “Engineering single-gene-controlled Staygreen potential into of maize yields. Advances in Agronomy 46: 245-298; and, plants' by Gallie et al., which issued on Jun. 12, 2007 as U.S. 15 Bruce et al. (2002), “Molecular and physiological Pat. No. 7,230,161, entitled “Engineering single-gene-con approaches to maize improvement for drought tolerance' trolled Staygreen potential into plants utilizing ACC synthase Journal of Experimental Botany, 53 (366): 13-25. from maize, and which claims priority to and benefit of the Five fundamentally distinct types of stay-green have been following prior provisional patent application: U.S. Ser. No. described, which are Types A, B, C, D and E (see e.g., Thomas 60/480,861, filed Jun. 23, 2003, entitled “Engineering single H. Smart CM (1993) Crops that stay green. Annals of Applied gene-controlled Staygreen potential into plants' by Gallie et Biology 123: 193-219; and, Thomas and Howarth, supra). In al. Each of these applications is incorporated herein by refer Type A stay-green, initiation of the senescence program is ence in its entirety for all purposes. delayed, but then proceeds at a normal rate. In Type B stay green, while initiation of the senescence program is STATEMENT AS TO RIGHTS TO INVENTIONS 25 unchanged, the progression is comparatively slower. In Type MADE UNDER FEDERALLY SPONSORED C stay-green, chlorophyll is retained even though senescence RESEARCH AND DEVELOPMENT (as determined through measurements of physiological func tion Such as photosynthetic capacity) proceeds at a normal This invention was made with government Support under rate. Type D stay-green is more artificial in that killing of the Grant No. 95-35304-4657 awarded by USDA/CREES and 30 leaf (i.e. by freezing, boiling or drying) prevents initiation of support under Grant MCB-0076434-002 awarded by the the senescence program, thereby stopping the degradation of National Science Foundation. The government has certain chlorophyll. InType Estay-green, initial levels of chlorophyll rights in the invention. are higher, while initiation and progression of leaf senescence are unchanged, thereby giving the illusion of a relatively FIELD OF THE INVENTION 35 slower progression rate. Type A and B are functional stay greens, as photosynthetic capacity is maintained along with This invention relates to modulating staygreen potential in chlorophyll content, and these are the types associated with plants, inhibiting ethylene production in plants, and modulat increased yield and drought tolerance in Sorghum. Despite the ing sterility in plants. The invention also provides knockout potential importance of this trait, in particular the benefits plant cells, e.g., where the knockout plant cells are disrupted 40 associated with increasing yield and drought tolerance, very in ACC synthase expression and/or activity, or knockout little progress has been made in understanding the biochemi plants, e.g., which display a staygreen phenotype or a male cal, physiological or molecular basis for genetically deter sterility phenotype. Nucleic acid sequences and amino acid mined stay-green (Thomas and Howarth, Supra). sequences encoding various ACC synthases are also This invention solves these and other problems. The inven included. 45 tion relates to the identification of ACC synthase genes asso ciated with Staygreen potential phenotype in plants and BACKGROUND OF THE INVENTION modulation of staygreen potential and/or ethylene produc tion. Polypeptides encoded by these genes, methods for Stay-green is a term used to describe a plant phenotype, modulating staygreen potential in plants, methods for inhib e.g., whereby leaf senescence (most easily distinguished by 50 iting ethylene production in plants, methods for modulating yellowing of the leaf associated with chlorophyll degrada sterility in plants, and knockout plant cells and plants, as well tion) is delayed compared to a standard reference. See, Tho as other features, will become apparent upon review of the mas H and Howarth C J (2000) “Five ways to stay green' following materials. Journal of Experimental Botany 51: 329-337. In sorghum, several stay-green genotypes have been identified which 55 SUMMARY OF THE INVENTION exhibit a delay in leaf Senescence during grain filling and maturation. See, Duncan RR, et al. (1981) “Descriptive com This invention provides methods and compositions for parison of senescent and non-senescent sorghum genotypes.' modulating staygreen potential and sterility in plants and Agronomy Journal 73: 849-853. Moreover, under conditions modulating (e.g., inhibiting) ethylene synthesis and/or pro of limited water availability, which normally hastens leaf 60 duction in plants. This invention also relates to ACC synthase senescence (see, e.g., Rosenow DT, and Clark L E (1981) nucleic acid sequences in plants, exemplified by, e.g., SEQID Drought tolerance in sorghum. In: Loden HD, Wilkinson D, NO:1 through SEQID NO:6 and SEQID NO:10, and a set of eds. Proceedings of the 36th annual corn and sorghum indus polypeptide sequences, e.g., SEQID NO:7 through SEQID try research conference, 18-31), these genotypes retain more NO:9 and SEQID NO:11, which can modulate these activi green leafarea and continue to fill grain normally (see, e.g., 65 ties. McBee GG, Waskom RM, Miller F R. Creelman RA (1983) In a first aspect, the invention provides for an isolated or Effect of senescence and non-senescence on carbohydrates in recombinant knockout plant cell comprising at least one dis US 7,838,730 B2 3 4 ruption in at least one endogenous ACC synthase gene (e.g., of at least one ACC synthase protein compared to a corre a nucleic acid sequence, or complement thereof, comprising, sponding control plant. In certain embodiments, the at least e.g., at least about 70%, at least about 75%, at least about one endogenous ACC synthase gene comprises a nucleic acid 80%, at least about 85%, at least about 90%, at least about sequence comprising, e.g., at least about 70%, at least about 95%, at least about 99%, about 99.5% or more sequence 75%, at least about 80%, at least about 85%, at least about identity to SEQID NO:1 (gACS2), SEQID NO:2 (gACS6), 90%, at least about 95%, at least about 99%, about 99.5% or or SEQ ID NO:3 (gACS7)). The disruption inhibits expres more, sequence identity to SEQID NO:1 (gACS2), SEQID sion oractivity of at least one ACC synthase protein compared NO:2 (gACS6), or SEQID NO:3 (gACS7), or a complement to a corresponding control plant cell lacking the disruption. In thereof. In certain embodiments, the knockout plant is a one embodiment, the at least one endogenous ACC synthase 10 hybrid plant. Essentially all of the features noted above apply gene comprises two or more endogenous ACC synthase genes to this embodiment as well, as relevant. (e.g., any two or more of ACS2. ACS6, and ACS7, e.g., ACS2 In another embodiment, a knockout plant includes a trans and ACS6). Similarly, in another embodiment, the at least one genic plant that comprises a staygreen potential phenotype. endogenous ACC synthase gene comprises three or more For example, a transgenic plant of the invention includes a endogenous ACC synthase genes. In certain embodiments, 15 staygreen potential phenotype resulting from at least one the disruption results in reduced ethylene production by the introduced transgene that inhibits ethylene synthesis. The knockout plant cell as compared to the control plant cell. introduced transgene includes a nucleic acid sequence encod In one embodiment, the at least one disruption in the ing at least one ACC synthase or Subsequence thereof, which knockout plant cell is produced by introducing at least one nucleic acid sequence comprises, e.g., at least about 70%, at polynucleotide sequence comprising an ACC synthase least about 75%, at least about 80%, at least about 85%, at nucleic acid sequence, or Subsequence thereof, into a plant least about 90%, at least about 95%, at least about 99%, about cell. Such that the at least one polynucleotide sequence is 99.5% or more sequence identity to SEQID NO:1 (gACS2), linked to a promoter in a sense or antisense orientation, and SEQ ID NO:2 (gACS6), SEQ ID NO:3 (gACS7), SEQ ID where the at least one polynucleotide sequence comprises, NO:4 (cACS2), SEQ ID NO:5 (cACS6), SEQ ID NO:6 e.g., at least about 70%, at least about 75%, at least about 25 (cACS7) or SEQID NO:10 (CCRA178R), or a subsequence 80%, at least about 85%, at least about 90%, at least about thereof, or a complement thereof, and is in a configuration 95%, at least about 99%, about 99.5% or more sequence that modifies a level of expression or activity of the at least identity to SEQID NO:1 (gACS2), SEQID NO:2 (gACS6), one ACC synthase (e.g., a sense, antisense, RNA silencing or SEQ ID NO:3 (gACS7), SEQ ID NO.4 (cACS2), SEQ ID interference configuration). Essentially all of the features NO:5 (cACS6), SEQID NO:6 (cACS7), or SEQ ID NO:10 30 noted above apply to this embodiment as well, as relevant. (CCRA178R) or a subsequence thereof, or a complement A transgenic plant of the invention can also include a thereof. In another embodiment, the disruption is introduced staygreen potential phenotype resulting from at least one into the plant cell by introducing at least one polynucleotide introduced transgene which inhibits ethylene synthesis, sequence comprising one or more Subsequences of an ACC where said at least one introduced transgene comprises a synthase nucleic acid sequence configured for RNA silencing 35 nucleic acid sequence encoding a Subsequence(s) of at least or interference. one ACC synthase, which at least one ACC synthase com In another embodiment, the disruption comprises insertion prises, e.g., at least about 70%, at least about 75%, at least of one or more transposons, where the one or more trans about 80%, at least about 85%, at least about 90%, at least posons are in the at least one endogenous ACC synthase gene. about 95%, at least about 99%, about 99.5% or more In yet another embodiment, the disruption comprises one or 40 sequence identity to SEQID NO:7 (pACS2), SEQID NO:8 more point mutations in the at least one endogenous ACC (pACS6), SEQ ID NO.:9 (pACS7), or SEQ ID NO.11 synthase gene. The disruption can be a homozygous disrup (pCCRA178R), or a conservative variation thereof. The tion in the at least one ACC synthase gene. Alternatively, the nucleic acid sequence is typically in an RNA silencing or disruption is a heterozygous disruption in the at least one interference configuration (or, e.g., a sense or antisense con ACC synthase gene. In certain embodiments, when more than 45 figuration), and modifies a level of expression or activity of one ACC synthase gene is involved, there is more than one the at least one ACC synthase. Essentially all of the features disruption, which can include homozygous disruptions, het noted above apply to this embodiment as well, as relevant. erozygous disruptions or a combination of homozygous dis The staygreen potential of a plant of the invention includes, ruptions and heterozygous disruptions. but is not limited to, e.g., (a) a reduction in the production of In certain embodiments, a plant cell of the invention is from 50 at least one ACC synthase specific mRNA; (b) a reduction in a dicot or monocot. In one aspect, the plant cell is in a hybrid the production of an ACC synthase; (c) a reduction in the plant comprising a staygreen potential phenotype. In another production of ethylene; (d) a delay in leaf senescence; (e) an aspect, the plant cell is in a plant comprising a sterility phe increase of drought resistance; (f) an increased time in main notype, e.g., a male sterility phenotype. Plants regenerated taining photosynthetic activity; (g) an increased transpira from the plant cells of the invention are also a feature of the 55 tion: (h) an increased stomatal conductance: (i) an increased invention. CO assimilation: (i) an increased maintenance of CO. The invention also provides for knockout plants that com assimilation; or (k) any combination of (a)-(); compared to a prise a staygreen potential phenotype. For example, the corresponding control plant, and the like. invention provides for a knockout plant that comprises a One aspect of the invention provides knockout or trans staygreen potential phenotype, where the Staygreen potential 60 genic plants including sterility phenotypes, e.g., a male or phenotype results from a disruption in at least one endog female sterility phenotype. Thus, one class of embodiments enous ACC synthase gene. In one embodiment, the disruption provides a knockout plant comprising a male sterility pheno includes one or more transposons, and inhibits expression or type (e.g., reduced pollen shedding) which results from at activity of at least one ACC synthase protein compared to a least one disruption in at least one endogenous ACC synthase corresponding control plant. In another embodiment, the dis 65 gene. The disruption inhibits expression or activity of at least ruption includes one or more point mutations in the endog one ACC synthase protein compared to a corresponding con enous ACC synthase gene and inhibits expression or activity trol plant. In one embodiment, the at least one disruption US 7,838,730 B2 5 6 results in reduced ethylene production by the knockout plant viral vector). The vector or expression cassette can comprise as compared to the control plant. In one embodiment, the at a promoter (e.g., a constitutive, tissue-specific, or inducible least one disruption includes one or more transposons, promoter) operably linked to the polynucleotide. A poly wherein the one or more transposons are in the at least one nucleotide of the invention can be linked to the promoter in an endogenous ACC synthase gene. In another embodiment, the antisense orientation or a sense orientation, be configured for at least one disruption comprises one or more point muta RNA silencing or interference, or the like. tions, wherein the one or more point mutations are in the at The invention also provides methods for inhibiting ethyl least one endogenous ACC synthase gene. In yet another ene production in a plant (and plants produced by Such meth embodiment, the at least one disruption is introduced into the ods). For example, a method of inhibiting ethylene produc knockout plant by introducing at least one polynucleotide 10 tion comprises inactivating one or more ACC synthase genes sequence comprising one or more Subsequences of an ACC in the plant, wherein the one or more ACC synthase genes synthase nucleic acid sequence configured for RNA silencing encode one or more ACC synthases, wherein at least one of or interference. In certain embodiments, the at least one the one or more ACC synthases comprises, e.g., at least about endogenous ACC synthase gene comprises a nucleic acid 70%, at least about 75%, at least about 80%, at least about sequence comprising, e.g., at least about 70%, at least about 15 85%, at least about 90%, at least about 95%, at least about 75%, at least about 80%, at least about 85%, at least about 99%, about 99.5% or more identity to SEQ ID NO:7 90%, at least about 95%, at least about 99%, about 99.5% or (pACS2), SEQID NO:8 (pACS6), SEQID NO:9 (pAC7) or more, sequence identity to SEQID NO:1 (gACS2), SEQID SEQID NO:11 (pCCRA178R). NO:2 (gACS6), or SEQID NO:3 (gACS7), or a complement In one embodiment, the inactivating step comprises intro thereof. Essentially all of the features noted above apply to ducing one or more mutations into an ACC synthase gene this embodiment as well, as relevant. sequence, wherein the one or more mutations in the ACC Another class of embodiments provides a transgenic synthase gene sequence comprise one or more transposons, knockout plant comprising a male sterility phenotype result thereby inactivating the one or more ACC synthase genes ing from at least one introduced transgene which inhibits compared to a corresponding control plant. In another ethylene synthesis. The at least one introduced transgene 25 embodiment, the inactivating step comprises introducing one comprises a nucleic acid sequence encoding at least one ACC or more mutations into an ACC synthase gene sequence, synthase, which nucleic acid sequence comprises at least wherein the one or more mutations in the ACC synthase gene about 85% sequence identity to SEQID NO:1 (gACS2), SEQ sequence comprise one or more point mutations, thereby ID NO:2 (gACS6), SEQID NO:3 (gACS7), SEQID NO:4 inactivating the one or more ACC synthase genes compared to (cACS2), SEQID NO:5 (cACS6), SEQID NO:6 (cACS7) or 30 a corresponding control plant. The one or more mutations can SEQID NO:10 (CCRA178R), or a subsequence thereof, or a comprise, for example, a homozygous disruption in the one or complement thereof, and is in a configuration that modifies a more ACC synthase genes, a heterozygous disruption in the level of expression or activity of the at least one ACC synthase one or more ACC synthase genes, or a combination of both (e.g., an antisense, sense or RNA silencing or interference homozygous disruptions and heterozygous disruptions if configuration). In certain embodiments, the transgene 35 more than one ACC synthase gene is disrupted. In certain includes a tissue-specific promoter or an inducible promoter. embodiments, the one or more mutations are introduced by a Essentially all of the features noted above apply to this sexual cross. In certain embodiments, at least one of the one embodiment as well, as relevant. or more ACC synthase genes is, e.g., at least about 70%, at Polynucleotides are also a feature of the invention. In cer least about 75%, at least about 80%, at least about 85%, at tain embodiments, an isolated or recombinant polynucleotide 40 least about 90%, at least about 95%, at least about 99%, about comprises a member selected from the group consisting of 99.5% or more, identical to SEQID NO:1 (gACS2), SEQID (a) a polynucleotide, or a complement thereof, comprising, NO:2 (gACS6) or SEQ ID NO:3 (gAC7), or a complement e.g., at least about 70%, at least about 75%, at least about thereof). 80%, at least about 85%, at least about 90%, at least about In another embodiment, the inactivating step comprises: 95%, at least about 99%, about 99.5% or more sequence 45 (a) introducing into the plant at least one polynucleotide identity to SEQID NO:1 (gACS2), SEQID NO:2 (gACS6), sequence, wherein the at least one polynucleotide sequence SEQ ID NO:3 (gACS7), SEQ ID NO.4 (cACS2), SEQ ID comprises a nucleic acid encoding one or more ACC Syn NO:5 (cACS6), SEQ ID NO:6 (cACS7) or SEQID NO:10 thases, or a Subsequence thereof, and a promoter, which pro (CCRA178R), or a subsequence thereof, or a conservative moter functions in plants to produce an RNA sequence; and, variation thereof; (b) a polynucleotide, or a complement 50 (b) expressing the at least one polynucleotide sequence, thereof, encoding a polypeptide sequence of SEQ ID NO:7 thereby inactivating the one or more ACC synthase genes (pACS2), SEQID NO:8 (pACS6), SEQID NO.:9 (pACS7), compared to a corresponding control plant (e.g., its non or SEQID NO:11 (pCCRA178R), or a subsequence thereof, transgenic parent or a non-transgenic plant of the same spe or a conservative variation thereof (c) a polynucleotide, or a cies). For example, the at least one polynucleotide sequence complement thereof, that hybridizes under stringent condi 55 can be introduced by techniques including, but not limited to, tions over substantially the entire length of a polynucleotide electroporation, micro-projectile bombardment, Agrobacte Subsequence comprising at least 100 contiguous nucleotides rium-mediated transfer, and the like. In certain aspects of the of SEQID NO:1 (gACS2), SEQID NO:2 (gACS6), SEQID invention, the polynucleotide is linked to the promoter in a NO:3 (gACS7), SEQ ID NO.4 (cACS2), SEQ ID NO:5 sense orientation oran antisense orientation, or is configured (cACS6), SEQ ID NO:6 (cACS7), or SEQ ID NO:10 60 for RNA silencing or interference. Essentially all of the fea (CCRA178R), or that hybridizes to a polynucleotide tures noted above apply to this embodiment as well, as rel sequence of (a) or (b); and, (d) a polynucleotide that is at least eVant. about 85% identical to a polynucleotide sequence of (a), (b) Methods for modulating staygreen potential in plants are or (c). In certain embodiments, the polynucleotide inhibits also a feature of the invention (as are plants produced by Such ethylene production when expressed in a plant. 65 methods). For example, a method of modulating staygreen The polynucleotides of the invention can comprise or be potential comprises: a) selecting at least one ACC synthase contained within an expression cassette or a vector (e.g., a gene (e.g., encoding an ACC synthase, for example, SEQID US 7,838,730 B2 7 NO:7 (pACS2), SEQ ID NO:8 (pACS6), SEQ ID NO:9 tis, Eremochloa, Eremopoa, Eremopyrum, Erianthus, Eri (pAC7) or SEQID NO:11 (pCCRA178R)) to mutate, thereby coma, Erichloa, Eriochrysis, Erioneuron, Euchlaenia, providing at least one desired ACC synthase gene; b) intro Euclasta, Eulalia, Eulaliopsis, Eustachys, Fargesia, Festuca, ducing a mutant form (e.g., an antisense or sense configura Festulolium, Fingerhuthia, Fluminia, Garnotia, Gastridium, tion of at least one ACC synthase gene or Subsequence Gaudinia, Gigantochloa, Glyceria, Graphephorum, Gymno thereof, an RNA silencing configuration of at least one ACC pogon, Gynerium, Hackelochloa, Hainardia, Hakonechloa, synthase gene or Subsequence thereof, a heterozygous muta Haynaldia, Heleocliloa, Helictotrichon, Hemarthria, Hes tion in the at least one ACC synthase gene, a homozygous perochloa, Hesperostipa, Heteropogon, Hibanobambusa, mutation in the at least one ACC synthase gene or a combi Hierochloe, Hilaria, Holcus, Homalocenchrus, Hordeum, nation of homozygous mutation and heterozygous mutation if 10 Hydrochloa, Hymenachne, Hyparrhenia, Hypogynium, Hys more than one ACC synthase gene is selected, and the like) of trix, Ichnanthus, Imperata, Indocalamus, Isachne, Ischae the at least one desired ACC synthase gene into the plant; and, mum, Ixophorus, Koeleria, Korycarpus, Lagurus, Lamarckia, c) expressing the mutant form, thereby modulating staygreen Lasiacis, Leersia, Leptochloa, Leptochloopsis, Leptocory potential in the plant. In one embodiment, selecting the at phium, Leptoloma, Leptogon, Lepturus, Lerchenfeldia, Leu least one ACC synthase gene comprises determining a degree 15 copoa, Leynostachys, Leymus, Limnodea, Lithachne, (e.g., weak, moderate or strong) of Staygreen potential Lolium, Lophochlaena, Lophochloa, Lophopyrum, Ludolfia, desired. In certain embodiments, the mutant gene is intro Luziola, Lycurus, Lygeum, Maltea, Manisuris, Megastachya, duced by Agrobacterium-mediated transfer, electroporation, Melica, Melinis, Mibora, Microchloa, Microlaeiza, Micros micro-projectile bombardment, a sexual cross, or the like. regium, Milium, Miscanthus, Mnesithea, Molinia, Monani Essentially all of the features noted above apply to this thochloe, Monerma, Monroa, Muhlenbergia, Nardus, Nas embodiment as well, as relevant. sella, Nazia, Neeragrostis, Neoschischkinia, Neostapfia, Detection of expression products is performed either quali Nevraudia, Nothoholcus, Olivra, Opizia, Oplismenus, Orcut tatively (by detecting presence or absence of one or more tia, Oryza, Oryzopsis, Otatea, Oxytenanthera, Particularia, product of interest) or quantitatively (by monitoring the level Panicuni, Pappophorum, Parapholis, Pascopyrum, Paspal of expression of one or more product of interest). In one 25 idium, Paspalum, Pennisetum, Phalaris, Phalaroides, Phan embodiment, the expression product is an RNA expression opyrum, Pharus, Phippsia, Phleum, Pholiurus, Phragmites, product. Aspects of the invention optionally include monitor Phyllostachys, Piptatherum, Piptochaetiuni, Pleioblastus, ing an expression level of a nucleic acid, polypeptide or Pleopogon, Pleuraphis, Pleuropogon, Poa, Podagrostis, chemical (e.g., ACC, ethylene, etc.) as noted herein for detec Polypogon, Polyrrias, Psathyrostachys, Pseudelymus, Pseu tion of ACC synthase, ethylene production, staygreen poten 30 doroegneria, Pseudosasa, Ptilagrostis, Puccinelia, Pucci tial, etc. in a plant or in a population of plants. phippsia, Redfieldia, Reimaria, Reimarochloa, Rhaphis, The compositions and methods of the invention can Rhombolytruin, Rhynchelytrum, Roegneria, Rostraria, Rott include a variety of plants, e.g., a plant of the Poaceae boelia, Rytilix, Saccharum, Sacciolepis, Sasa, Sasaella, (Gramineae) family. Examples of members of the Poaceae Sasamorpha, Savastana, Schedonnardus, Schismus, family include, by are not limited to. A camptoclados, Ach 35 Schizachine, Schizachyrium, Schizostachyum, Sclerochloa, matherum, Achnella, Acroceras, Aegilops, Aegopgon, Agroe Scleropoa, Scleropogon, Scolochloa, Scribizeria, Secale, lymus, Agrohordeum, Agropogon, Agropyron, Agrositanion, Semiarundinaria, Sesleria, Setaria, Shibataea, Sieglingia, Agrostis, Aira, Allolepis, Alloteropsis, Alopecurus, Ambly Sinarundinaria, Sinobambusa, Sinocalamus, Sitanion, opyrum, Ammophila, Ampelodesmos, Amphibromus, Amphi Sorghastrum, Sorghum, Spartina, Sphenopholis, Spodio carpum, Amphilophis, Anastrophus, Anatherum, Andropo 40 pogon, Sporobolus, Stapfia, Steinchisma, Stenotaphrum, grOn, Anemathele, Aneurolepidium, Anisantha, Stipa, Stipagrostis, StipOryzopsis, Swallenia, Syntherisma, Anthaenantia, Anthephora, Anthochloa, Anthoxanthum, Taeniatherum, Terrellia, Terrellymus, Thamnocalamus, Apera, Apluda, Archtagrostis, Arctophila, Argillochloa, Aris Themeda, Thinopyrum, Thuarea, Thysanolaena, Torresia, tida, Arrhenatherum, Arthravon, Arthrostylidium, Arundi Torrevochloa, Trachynia, Trachypogon, Tragus, Trichachne, naria, Arundinella, Arundo, Aspiris, Atheropogon, Avena, 45 Trichloris, Tricholaena, Trichoneura, Tridens, Triodia, Tri Avenella, Avenochloa, Avenula, Axonopus, Bambusa, Beck plasis, Tripogon, Tripsacum, Trisetobromus, Trisetum, Triti mannia, Blepharidachhne, Blepharoneuron, Bothriochloa, cosecale, Triticum, Tuctoria, Uniola, Urachne, Uralepis, Bouteloua, Brachiaria, Brachyelytrum, Bracliypodium, Urochloa, Vahlodea, Valota, Vaseyochloa, Ventenata, Briza, Brizopyrum, Bromelica, Bromopsis, Bromus, Buchloe, Vetiveria, Vilfa, Vulpia, Willkommia, Yushania, Zea, Zizania, Bulbilis, Calamagrostis, Calamovilfa, Campulosus, Cap 50 Zizaniopsis, and Zoysia. In one embodiment, the plant is Zea riola, Catabrosa, Catapodium, Cathestecum, Celicthropsis, mays, wheat, rice, Sorghum, barley, oat, lawn grass, rye, Soy Cenchrus, Centotheca, Ceratochloa, Chaetochloa, Chas bean, tomato, potato, pepper, broccoli, cabbage, a commer manthium, Chimonobambusa, Chionochloa, Chloris, Chon cial corn line, or the like. drosum, Chrysopon, Chusquea, Cinna, Cladoraphis, Coelo Kits which incorporate one or more of the nucleic acids or rachis, Coix, Coleanthus, Colpodium, Coridochloa, 55 polypeptides noted above are also a feature of the invention. Cornucopiae, Cortaderia, Corynephorus, Cottea, Critesion, Such kits can include any of the above noted components and Crypsis, Ctenium, Cutandia, Cylindropyrum, Cymbopogon, further include, e.g., instructions for use of the components in Cynodon, Cynosurus, Cytrococcum, Dactylis, Dactylocte any of the methods noted herein, packaging materials, con nium, Danthonia, Dasyochloa, Dasyprum, Davyella, Den tainers for holding the components, and/or the like. For drocalamus, Deschampsia, Desmazeria, Deyeuxia, Diarina, 60 example, a kit for modulating staygreen potential in a plant Diarrhena, Dichanthelium, Dichanthium, Dichelachne, includes a container containing at least one polynucleotide Diectomus, Digitaria, Dimeria, DimiorpOstachys, Dinebra, sequence comprising a nucleic acid sequence, where the Diplachne, Dissanthelium, Dissochondrus, Distichlis, nucleic acid sequence is, e.g., at least about 70%, at least Drepanostachyum, Dupoa, Dupontia, Echinochloa, about 75%, at least about 80%, at least about 85%, at least Ectosperna, Ehrharta, Eleusine, Ely hordeum, Elyleymus, 65 about 90%, at least about 95%, at least about 99%, about Elymordeum, Elymus, Elyonurus, Elysitanion, Elytesion, 99.5% or more, identical to SEQID NO:1 (gACS2). SEQID Elytrigia, Enneapogon, Enteropogon, Epicampes, Eragros NO:2 (gACS6), SEQ ID NO:3 (gACS7), SEQ ID NO:4 US 7,838,730 B2 9 10 (cACS2), SEQID NO:5 (cACS6), SEQID NO:6 (cAC7) or constructs, sense constructs, RNA silencing constructs, RNA SEQID NO:10 (CCRA178R), or a subsequence thereof, or a interference, genomic disruptions (e.g., transposons, tilling, complement thereof. In a further embodiment, the kit homologous recombination, etc.), and the like. The term includes instructional materials for the use of the at least one “knockout plant” refers to a plant that has a disruption in at polynucleotide sequence to control staygreen potential in a least one of its ACC synthase genes in at least one cell. plant. Essentially all of the features noted above apply to this The term “transgenic’ refers to a plant that has incorpo embodiment as well, as relevant. rated nucleic acid sequences, including but not limited to As another example, a kit for modulating sterility, e.g., genes, polynucleotides, DNA, RNA, etc., which have been male sterility, in a plant includes a container containing at introduced into a plant compared to a non-introduced plant. least one polynucleotide sequence comprising a nucleic acid 10 The term "endogenous” relates to any gene or nucleic acid sequence, wherein the nucleic acid sequence is, e.g., at least sequence that is already present in a cell. about 70%, at least about 75%, at least about 80%, at least A “transposable element' (TE) or “transposable genetic about 85%, at least about 90%, at least about 95%, at least element' is a DNA sequence that can move from one location about 99%, about 99.5% or more, identical to SEQID NO:1 to another in a cell. Movement of a transposable element can (gACS2), SEQID NO:2 (gACS6), SEQID NO:3 (gACS7), 15 occur from episome to episome, from episome to chromo SEQ ID NO.4 (cACS2), SEQ ID NO:5 (cACS6), SEQ ID Some, from chromosome to chromosome, or from chromo NO:6 (cAC7) or SEQ ID NO:10 (CCRA178R), or a subse Some to episome. Transposable elements are characterized by quence thereof, or a complement thereof. The kit optionally the presence of inverted repeat sequences at their termini. also includes instructional materials for the use of the at least Mobilization is mediated enzymatically by a “transposase.” one polynucleotide sequence to control sterility, e.g., male Structurally, a transposable element is categorized as a “trans sterility, in a plant. Essentially all of the features noted above poson.” (“TN’) or an “insertion sequence element.” (IS ele apply to this embodiment as well, as relevant. ment) based on the presence or absence, respectively, of genetic sequences in addition to those necessary for mobili DEFINITIONS Zation of the element. A mini-transposon or mini-IS element 25 typically lacks sequences encoding a transposase. Before describing the invention in detail, it is to be under The term “nucleic acid' or “polynucleotide' is generally stood that this invention is not limited to particular devices or used in its art-recognized meaning to refer to a ribose nucleic biological systems, which can, of course, vary. It is also to be acid (RNA) or deoxyribose nucleic acid (DNA) polymer, or understood that the terminology used herein is for the purpose analog thereof, e.g., a nucleotide polymer comprising modi of describing particular embodiments only, and is not 30 fications of the nucleotides, a peptide nucleic acid, or the like. intended to be limiting. As used in this specification and the In certain applications, the nucleic acid can be a polymer that appended claims, the singular forms “a”, “an and “the includes multiple monomer types, e.g., both RNA and DNA include plural referents unless the content clearly dictates Subunits. A nucleic acid can be, e.g., a chromosome or chro otherwise. Thus, for example, reference to “a cell' includes a mosomal segment, a vector (e.g., an expression vector), an combination of two or more cells, and the like. 35 expression cassette, a naked DNA or RNA polymer, the prod Unless defined otherwise, all technical and scientific terms uct of a polymerase chain reaction (PCR), an oligonucleotide, used herein have the same meaning as commonly understood a probe, etc. A nucleic acid can be e.g., single-stranded and/or by one of ordinary skill in the art to which the invention double-stranded. Unless otherwise indicated, a particular pertains. In describing and claiming the present invention, the nucleic acid sequence of this invention optionally comprises following terminology will be used in accordance with the 40 or encodes complementary sequences, in addition to any definitions set out below. sequence explicitly indicated. The term “plant” refers generically to any of whole plants, The term “polynucleotide sequence' or “nucleotide plant parts or organs (e.g., leaves, stems, roots, etc.), shoot sequence” refers to a contiguous sequence of nucleotides in a Vegetative organs/structures (e.g. leaves, stems and tubers), single nucleic acid or to a representation, e.g., a character roots, flowers and floral organs/structures (e.g. bracts, sepals, 45 string, thereof. That is, a “polynucleotide sequence' is a poly petals, stamens, carpels, anthers and ovules), seed (including mer of nucleotides (an oligonucleotide, a DNA, a nucleic embryo, endosperm, and seed coat), fruit (the mature ovary), acid, etc.) or a character string representing a nucleotide plant tissue (e.g. vascular tissue, ground tissue, and the like), polymer, depending on context. From any specified poly tissue culture callus, and plant cells (e.g. guard cells, egg nucleotide sequence, either the given nucleic acid or the cells, trichomes and the like), and progeny of same. Plant cell, 50 complementary polynucleotide sequence (e.g., the comple as used herein, further includes, without limitation, cells mentary nucleic acid) can be determined. obtained from or found in: Seeds, cultures, Suspension cul The term “subsequence' or “fragment” is any portion of an tures, embryos, meristematic regions, callus tissue, leaves, entire sequence. roots, shoots, gametophytes, sporophytes, pollen, and A "phenotype' is the display of a trait in an individual plant microspores. Plant cells can also be understood to include 55 resulting from the interaction of gene expression and the modified cells, such as protoplasts, obtained from the afore environment. mentioned tissues. An 'expression cassette' is a nucleic acid construct, e.g., The term "dicot' refers to a dicotyledonous plant. Dicoty vector, Such as a plasmid, a viral vector, etc., capable of ledonous plants belong to large Subclass of Angiosperms that producing transcripts and, potentially, polypeptides encoded have two seed-leaves (cotyledon). 60 by a polynucleotide sequence. An expression vector is The term “monocot” refers to a monocotyledonous plant, capable of producing transcripts in an exogenous cell, e.g., a which in the developing plant has only one cotyledon. bacterial cell, or a plant cell, in vivo or in vitro, e.g., a cultured The term “knockout plant cell refers to a plant cell having plant protoplast. Expression of a product can be either con a disruption in at least one ACC synthase gene in the cell, stitutive or inducible depending, e.g., on the promoter where the disruption results in a reduced expression or activ 65 selected. Antisense, sense or RNA interference or silencing ity of the ACC synthase encoded by that gene compared to a configurations that are not or cannot be translated are control cell. The knockout can be the result of, e.g., antisense expressly included by this definition. In the context of an US 7,838,730 B2 11 12 expression vector, a promoter is said to be “operably linked' accompany or interact with it in its naturally occurring envi to a polynucleotide sequence if it is capable of regulating ronment. The isolated material optionally comprises material expression of the associated polynucleotide sequence. The not found with the material in its natural environment, e.g., a term also applies to alternative exogenous gene constructs, cell. For example, if the material is in its natural environment, Such as expressed or integrated transgenes. Similarly, the Such as a cell, the material has been placed at a location in the term operably linked applies equally to alternative or addi cell (e.g., genome or genetic element) not native to a material tional transcriptional regulatory sequences such as enhanc found in that environment. For example, a naturally occurring ers, associated with a polynucleotide sequence. nucleic acid (e.g., a coding sequence, a promoter, an A polynucleotide sequence is said to “encode a sense or enhancer, etc.) becomes isolated if it is introduced by non antisense RNA molecule, or RNA silencing or interference 10 naturally occurring means to a locus of the genome (e.g., a molecule or a polypeptide, if the polynucleotide sequence can vector, such as a plasmid or virus vector, or amplicon) not be transcribed (in spliced or unspliced form) and/or translated native to that nucleic acid. An isolated plant cell, for example, into the RNA or polypeptide, or a subsequence thereof. can be in an environment (e.g., a cell culture system, or “Expression of a gene' or “expression of a nucleic acid purified from cell culture) other than the native environment means transcription of DNA into RNA (optionally including 15 of wild-type plant cells (e.g., a whole plant). The term “vari modification of the RNA, e.g., splicing), translation of RNA ant' with respect to a polypeptide refers to an amino acid into a polypeptide (possibly including Subsequent modifica sequence that is altered by one or more amino acids with tion of the polypeptide, e.g., posttranslational modification), respect to a reference sequence. or both transcription and translation, as indicated by the con text. The variant can have "conservative changes, wherein a The term “gene' is used broadly to refer to any nucleic acid Substituted amino acid has similar structural or chemical associated with a biological function. Genes typically include properties, e.g., replacement of leucine with isoleucine. Alter coding sequences and/or the regulatory sequences required natively, a variant can have “nonconservative' changes, e.g., for expression of Such coding sequences. The term "gene’ replacement of a glycine with a tryptophan. Analogous minor applies to a specific genomic sequence, as well as to a cDNA 25 variation can also include amino acid deletion or insertion, or oran mRNA encoded by that genomic sequence. Genes also both. Guidance in determining which amino acid residues can include non-expressed nucleic acid segments that, for be substituted, inserted, or deleted without eliminating bio example, form recognition sequences for other proteins. Non logical or immunological activity can be found using com expressed regulatory sequences include promoters and puter programs well known in the art, for example, DNAS enhancers, to which regulatory proteins such as transcription 30 TAR software. Examples of conservative substitutions are factors bind, resulting in transcription of adjacent or nearby also described below. sequences. A "host cell', as used herein, is a cell which has been A "polypeptide' is a polymer comprising two or more transformed or transfected, or is capable of transformation or amino acid residues (e.g., a peptide or a protein). The polymer transfection, by an exogenous polynucleotide sequence. can additionally comprise non-amino acid elements such as 35 "Exogenous polynucleotide sequence' is defined to mean a labels, quenchers, blocking groups, or the like and can option sequence not naturally in the cell, or which is naturally ally comprise modifications such as glycosylation or the like. present in the cell but at a different genetic locus, in different The amino acid residues of the polypeptide can be natural or copy number, or under direction of a different regulatory non-natural and can be unsubstituted, unmodified, Substi element. tuted or modified. 40 A "promoter', as used herein, includes reference to a The term “recombinant indicates that the material (e.g., a region of DNA upstream from the start of transcription and cell, a nucleic acid, or a protein) has been artificially or involved in recognition and binding of RNA polymerase and synthetically (non-naturally) altered by human intervention. other proteins to initiate transcription. A “plant promoter is The alteration can be performed on the material within, or a promoter capable of initiating transcription in plant cells. removed from, its natural environment or state. For example, 45 Exemplary plant promoters include, but are not limited to, a “recombinant nucleic acid' is one that is made by recom those that are obtained from plants, plant viruses, and bacteria bining nucleic acids, e.g., during cloning, DNA shuffling or which comprise genes expressed in plant cells, such as Agro other procedures: a “recombinant polypeptide' or “recombi bacterium or Rhizobium. Examples of promoters under nant protein’ is a polypeptide or protein which is produced by developmental control include promoters that preferentially expression of a recombinant nucleic acid. Examples of 50 initiate transcription in certain tissues. Such as leaves, roots, recombinant cells include cells containing recombinant or seeds or spatially in regions such as endosperm, embryo, or nucleic acids and/or recombinant polypeptides. meristematic regions. Such promoters are referred to as “tis The term “vector” refers to the means by which a nucleic sue-preferred or “tissue-specific''. A temporally regulated acid can be propagated and/or transferred between organ promoter drives expression at particular times, such as isms, cells, or cellular components. Vectors include plasmids, 55 between 0-25 days after pollination. A "cell-type-preferred viruses, bacteriophage, pro-viruses, phagemids, transposons, promoter primarily drives expression in certain cell types in and artificial chromosomes, and the like, that replicate one or more organs, for example, vascular cells in roots or autonomously or can integrate into a chromosome of a host leaves. An “inducible' promoter is a promoter that is under cell. A vector can also be a naked RNA polynucleotide, a environmental control and may be inducible or de-repress naked DNA polynucleotide, a polynucleotide composed of 60 ible. Examples of environmental conditions that may effect both DNA and RNA within the same strand, a poly-lysine transcription by inducible promoters include anaerobic con conjugated DNA or RNA, a peptide-conjugated DNA or ditions or the presence of light. Tissue-specific, cell-type RNA, a liposome-conjugated DNA, or the like, that are not specific, and inducible promoters constitute the class of “non autonomously replicating. constitutive' promoters. A “constitutive' promoter is a In the context of the invention, the term "isolated’ refers to 65 promoter that is active under most environmental conditions a biological material. Such as a nucleic acid or a protein, and in all or nearly all tissues, at all or nearly all stages of which is substantially free from components that normally development. US 7,838,730 B2 13 14 “Transformation, as used herein, is the process by which FIG. 8 illustrates a peptide consensus sequence alignment a cell is “transformed by exogenous DNA when such exog with ACC synthase sequences of A47 (also known as ACS2 or enous DNA has been introduced inside the cell membrane. ACC2), A50 (also known as ACS7 or ACC7), and A65 (also Exogenous DNA may or may not be integrated (covalently known as ACS6 or ACC6) with both dicot (AtACS, LeACS) linked) into chromosomal DNA making up the genome of the and monocot (OsiaCS, OsjaCS, TaACS, and MaACS) spe cell. In prokaryotes and yeasts, for example, the exogenous cies. The alignment is done with a most stringent criteria DNA may be maintained on an episomal element, Such as a (identical amino acids) and the plurality is 26.00, the thresh plasmid. With respect to higher eukaryotic cells, a stably old is 4, the AveWeight is 1.00, the AveMatch is 2.78 and the transformed or transfected cell is one in which the exogenous AvMisMatch is -2.25. SEQID NOs are as follows: A47 pep DNA has become integrated into the chromosome so that it is 10 SEQID NO:25; A50pep SEQID NO:26: osiacs1 pep SEQID inherited by daughter cells through chromosome replication. NO:27: osacs1 pep SEQ ID NO:28: TaACS2pep SEQ ID This stability is demonstrated by the ability of the eukaryotic NO:29: AtACS1 pep SEQ ID NO:30; AtACS2pep SEQ ID cell to establish cell lines or clones comprised of a population NO:31: LeACS2pep SEQ ID NO:32: LeACS4pep SEQ ID of daughter cells containing the exogenous DNA. NO:33; MaACS1 pep SEQID NO:34; MaACSSpep SEQID 15 NO:35; LeACS1Apep SEQID NO:36; LeACS1Bpep SEQ BRIEF DESCRIPTION OF THE DRAWINGS ID NO:37: LeACS6pep SEQID NO:38: AtACS6pep SEQID NO:39; A65pep SEQID NO:40; osiacs2pep SEQID NO:41: The patent or application file contains at least one drawing AtACS5pep SEQ ID NO:42: AtACS9 SEQ ID NO:43: executed in color. Copies of this patent or patent application AtACS4pep SEQ ID NO:44: AtACS8 SEQ ID NO:45; publication with color drawing(s) will be provided by the MaACS2pep SEQID NO:46; MaACS3pep SEQID NO:47: Office upon request and payment of the necessary fee. LeACS3pep SEQ ID NO:48: LeACS7pep SEQ ID NO:49; FIG. 1 schematically illustrates ethylene biosynthetic and OsjaCS2pep SEQ ID NO:50: OsjaCS3 SEQ ID NO:51: signaling genes in plants, e.g., Arabidopsis. OsiaCS3pep SEQID NO:52; and AtACS7 SEQID NO:53. FIG. 2 schematically illustrates isolated and mapped ACC FIG. 9 illustrates a peptide consensus sequence alignment synthase genes and Mu insertion mutations. ACC6 is also 25 with ACC synthase sequences of A47 (also known as ACS2 or known as ACS6, ACC2 is also known as ACS2, and ACC7 is ACC2), A50 (also known as ACS7 or ACC7), and A65 (also also known as ACS7. known as ACS6 or ACC6) with both dicot (AtACS, LeACS) FIG. 3, Panels A, B, C, and D illustrate heterozygous ACC and monocot (OsiaCS, OSACS, TaACS, MaACS) species synthase knockouts in plants, e.g., maize. Panel A and Panel (SEQID NOS:25-53). The alignment is done with a stringent B illustrate heterozygous ACC synthase knockout plants in a 30 criteria (similar amino acid residues) and the plurality is field of wild-type plants. Panel C and Panel D illustrate leaves 26.00, the threshold is 2, the AveWeight is 1.00, the AveMatch from a heterozygous ACC synthase knockout plant, left side is 2.78 and the AvMisMatch is -2.25. of panel, compared to leaves from an ACC synthase wild-type FIG.10 illustrates a peptide consensus sequence alignment plant, right side of panel. with ACC synthase sequences of A47 (also known as ACS2 or 35 ACC2), A50 (also known as ACS7 or ACC7), and A65 (also FIG. 4 illustrates an enhanced staygreen trait observed in known as ACS6 or ACC6) with both dicot (AtACS, LeACS) leaves of plants that are homozygous ACC synthase knock and monocot (OsiaCS, OSACS, TaACS, MaACS) species outs (right) compared to wild type leaves (left) and heterozy (SEQ ID NOS:25-53). The alignment is done with a less gous knockout leaves (middle). stringent criteria (somewhat similar amino acid residues) and FIG. 5, Panels A, B, C, D, E, and F illustrate leaf transpi 40 the plurality is 26.00, the threshold is 0, the AveWeight is ration (Panels A and D), stomatal conductance (Panels B and 1.00, the AveMatch is 2.78 and the AvMisMatch is -2.25. E) and CO assimilation (Panels C and F) for wild-type (B73, FIG. 11 illustrates a peptide consensus sequence alignment +/+) and ACS6 null (15, O/O) mutant leaves under control with ACC synthase sequences of A47 (also known as ACS2 or conditions (Panels A, B, and C) or drought conditions (Panels ACC2), and A50 (also known as ACS7 or ACC7) with D, E, and F). For control conditions, plants were grown under 45 sequences that are most similar to ACS2 and ACS7 (SEQID well-watered conditions and each leaf on a plant was mea NOs:25-39). The alignment is done with most stringent cri Sured at forty days after pollination (dap). For drought con teria (identical amino acids) and the plurality is 15.00, the ditions, plants were grown under limited water conditions and threshold is 4, the AveWeight is 1.00, the AveMatch is 2.78 each leaf on a plant was measured at forty days after pollina and the AVMisMatch is -2.25. tion. Values represent a mean of six determinations. 50 FIG. 12 illustrates a peptide consensus sequence alignment FIG. 6, Panels A, B and Cillustrate leaf transpiration (Panel with ACC synthase sequences of A47 (also known as ACS2 or A), stomatal conductance (Panel B) and CO assimilation ACC2), and A50 (also known as ACS7 or ACC7) with (Panel C) for wild-type (B73, +/+), ACS2 null (7, O/O) and sequences that are most similar to ACS2 and ACS7 (SEQID ACS6 null (15, O/O) mutant leaves. Plants were grown under NOs:25-39). The alignment is done with stringent criteria limited water conditions and each leaf on a plant was mea 55 (similar amino acid residues) and the plurality is 15.00, the Sured at forty days after pollination. Values represent a mean threshold is 2, the AveWeight is 1.00, the AveMatch is 2.78 of six determinations. and the AVMisMatch is -2.25. FIG. 7 schematically illustrates phylogenetic analysis of FIG. 13 illustrates a peptide consensus sequence alignment ACC synthase gene sequences, where maize sequences are with ACC synthase sequences of A65 (also known as ACS6 or indicated by (A47 (also known as ACS2 or ACC2 herein), 60 ACC6) with sequences that are most similar to ACS6 (SEQ A50 (also known as ACS7 or ACC7 herein), A65 (also known ID NOs:40-53). The alignment is done with most stringent as ACS6 or ACC6 herein)), Arabidopsis sequences are indi criteria (identical amino acids) and the plurality is 14.00, the cated by (AtACS . . . ), tomato sequences are indicated by threshold is 4, the AveWeight is 1.00, the AveMatch is 2.78 (LeACS . . . ), rice sequences are indicated by (indica (Osi and the AVMisMatch is -2.25. ACS . . . ), & japonica (OSACS. . . )), wheat sequences are 65 FIG. 14 illustrates a peptide consensus sequence alignment indicated by (TaACS . . . ), and banana sequences are indi with ACC synthase sequences of A65 (also known as ACS6 or cated by (MaACS . . . ). ACC6) with sequences that are most similar to ACS6 (SEQ US 7,838,730 B2 15 16 ID NOs:40-53). The alignment is done with stringent criteria ACS2 hairpin (a terminal repeat consisting of TR1 and TR2). (similar amino acid residues) and the plurality is 14.00, the RB represents the Agrobacterium right border sequence. A threshold is 2, the AveWeight is 1.00, the AveMatch is 2.78 4126 bp fragment of the 49682 bp cassette is illustrated. Panel and the AvMisMatch is -2.25. B presents the sequence of ZM-ACS2TR1 (SEQID NO:54), FIG.15 illustrates a peptide consensus sequence alignment 5 and Panel C presents the sequence of ZM-ACS2 TR2 (SEQ with ACC synthase sequences of A47 (also known as ACS2 or ID NO:55). ACC2), A50 (also known as ACS7 or ACC7), and A65 (also FIG.22 Panels A-C illustrate the ACS6 hairpin construct. known as ACS6 or ACC6) (SEQID NOS:25-26 and 40). The Panel A is a schematic diagram of PHP20323 containing a alignment is done with most stringent criteria (identical ubiquitin promoter (UBI1ZMPRO) driving expression of the amino acids) and the plurality is 3.00, the threshold is 4, the 10 ACS6 hairpin (a terminal repeat consisting of TR1 and TR2). AveWeight is 1.00, the AveMatch is 2.78 and the AvMis RB represents the Agrobacterium right border sequence. A Match is -2.25. 3564bp fragment of the 49108bp cassette is illustrated. Panel FIG.16 illustrates a peptide consensus sequence alignment B presents the sequence of ZM-ACS6 TR1 (SEQID NO:56), with ACC synthase sequences of A47 (also known as ACS2 or and Panel C presents the sequence of ZM-ACS6 TR2 (SEQ ACC2), A50 (also known as ACS7 or ACC7), and A65 (also 15 ID NO:57). known as ACS6 or ACC6) (SEQID NOS:25-26 and 40). The FIG. 23 Panels A and B illustrate events generated for alignment is done with stringent criteria (similar amino acid ACS2- and ACS6-hairpin constructs. Panel A presents a dia residues) and the plurality is 3.00, the threshold is 2, the gram showing the number of individual events for ACS2 AveWeight is 1.00, the AveMatch is 2.78 and the AvMis hairpin (PHP20600) and the associated transgene copy num Match is -2.25. ber per event. Panel B presents a diagram showing the number FIG. 17 Panels A, B, C, and D illustrate total chlorophyll of individual events for ACS6 hairpin (PHP20323) and the data for wild-type and ACC synthase knockout plants. Panels associated transgene copy number per event. A and B illustrate total chlorophyll data for wild-type (B73, +/+), ACS2 null (0/0), and ACS6 null (0/0) plants 40 days DETAILED DESCRIPTION after pollination for plants grown under normal conditions 25 (Panel A) or drought conditions (Panel B). Panel C compares "Stay-green' is a term commonly used to describe a plant total chlorophyll for wild-type (B73, +/-) and ACS6 null (0/0) phenotype. Staygreen is a desirable trait in commercial agri plants 40 days after pollination under normal and drought culture, e.g., a desirable trait associated with grain filling. As conditions. Panel D illustrates a comparison of total chloro described herein, five fundamentally distinct types of stay phyll for B73 (wild-type) plants collected at 30 and 40 days 30 green have been described, including Types A, B, C, D, and E after pollination. (see, e.g., Thomas H and Smart C M (1993) Crops that stay FIG. 18 Panels A, B, C, and Dillustrate soluble protein data green. Annals of Applied Biology 123: 193-219; and Thomas for wild-type and ACC synthase knockout plants. Panels A Hand Howarth CJ (2000) Five ways to stay green. Journal of and B illustrate soluble protein data for wild-type (B73, +/+), Experimental Botany 51: 329-337). However, there is very ACS2 null (0/0), and ACS6 null (0/0) plants 40 days after 35 little description of the biochemical, physiological or pollination for plants grown under normal conditions (Panel molecular basis for genetically determined stay-green. See, A) or drought conditions (Panel B). Panel C compares soluble e.g., Thomas and Howarth, Supra. This invention provides a protein for wild-type (B73, +/+) and ACS6 null (0/0) plants 40 molecular/biochemical basis for staygreen potential. days after pollination under normal and drought conditions. A number of environmental and physiological conditions Panel D illustrates a comparison of soluble protein for B73 40 have been shown to significantly alter the timing and progres (wild-type) plants collected at 30 and 40 days after pollina sion of leafsenescence and can provide some insight into the tion. basis for this trait. Among environmental factors, light is FIG. 19, Panels A and B illustrate ethylene production in probably the most significant, and it has long been established seedling leaves. Panel A illustrates various lines. In Panel B, that leaf senescence can be induced in many plant species by the seedling leaves are averaged by genotype. In Panel C. 45 placing detached leaves in darkness. See, e.g., Weaver LM ethylene production was determined for every leaf of wild and Amasino RM (2001) Senescence is induced in individu type (i.e., B73) plants at 20, 30, and 40 DAP. Leaf 1 represents ally darkened Arabidopsis leaves, but inhibited in whole the oldest surviving leaf and leaf 11 the youngest. Three darkened plants. Plant Physiology 127: 876-886. Limited replicates were measured and the average and standard devia nutrient and water availability have also been shown- to tion reported. 50 induce leaf senescence prematurely. See, e.g., Rosenow DT. FIG. 20 Panel A illustrates chlorophyll data, Panel B et al. (1983) Drought-tolerant sorghum and cotton germ soluble protein, and Panel C Rubisco expression. The level of plasm. Agricultural Water Management 7: 207-222. Among chlorophyll a+b (Panel A) and soluble protein (Panel B) was physiological determinants, growth regulators play a key role measured in the third oldest leaf (Leaf 3), sixth oldest leaf in directing the leaf senescence program. Modification of (Leaf6), and ninth oldest leaf (Leaf 9) of adult wild-type (i.e., 55 cytokinin levels can significantly delay leaf senescence. For ACS6/ACS6), acs2/acs2, and acs6/acs6 plants following dark example, plants transformed with isopentenyl transferase treatment for 7 days. Plants were watered daily. Additional (ipt), an Agrobacterium gene encoding a rate-limiting step in acs6/acs6 plants were watered daily with 100LLMACC during cytokinin biosynthesis, when placed under the control of a the treatment. acs6/acs6 leaves watered with 100LMACC but senescence inducible promoter, resulted in autoregulated kept unsheathed are also shown. The average and standard 60 cytokinin production and a strong stay-green phenotype. See, deviation of leaves from three individual plants is shown. e.g., Gan Sand Amasino RM (1995) Inhibition of leafsenes (Panel C) Western analysis of the same leaves was performed cence by autoregulated production of cytokinin. Science 270: using rice anti-Rubisco antiserum. Soluble protein from leaf 1986-1988. However, there are other factors that are involved samples of equal fresh weight was used. with this trait. FIG. 21 Panels A-C illustrate the ACS2 hairpin construct. 65 For example, ethylene has also been implicated in control Panel A is a schematic diagram of PHP20600 containing a ling leaf Senescence, (see, e.g., Davis K M and Grierson D ubiquitin promoter (UBI1ZMPRO) driving expression of the (1989) Identification of cDNA clones for tomato (Lycopersi US 7,838,730 B2 17 18 con esculentum Mill.) mRNAs that accumulate during fruit regulatory roles that ethylene plays throughout plant devel ripening and leafsenescence in response to ethylene. Planta opment as well as its role in regulating responses to stress, 179: 73-80) and some dicot plants impaired in ethylene pro e.g., drought, crowding, etc. duction or perception also show a delay in leaf senescence Ethylene in Plants (see, e.g., Picton S. etal. (1993) Altered fruit ripening and leaf 5 Ethylene (CH) is a gaseous planthormone. It has a varied senescence in tomatoes expressing an antisense ethylene spectrum of effects that can be tissue and/or species specific. forming enzyme transgene. The Plant Journal 3: 469-481; For example, physiological activities include, but are not Grbic V and Bleeker AB (1995) Ethylene regulates the timing limited to, promotion of food ripening, abscission of leaves of leaf senescence in Arabidopsis. The Plant Journal 8: and fruit of dicotyledonous species, flower senescence, stem 95-102; and, John I, et al. (1995) Delayed leafsenescence in 10 extension of aquatic plants, gas space (aerenchyma) develop ethylene-deficient ACC-Oxidase antisense tomato plants. ment in roots, leaf epinastic curvatures, stem and shoot Swell molecular and physiological analysis. The Plant Journal 7: ing (in association with stunting), femaleness in curcubits, 483-490), which can be phenocopied by exogenous applica fruit growth in certain species, apical hook closure in eti tion of inhibitors of ethylene biosynthesis and action (see, olated shoots, root hair formation, flowering in the Bromeli e.g., Abeles F B, et al. (1992) Ethylene in Plant Biology. 15 aceae, diageotropism of etiolated shoots, and increased gene Academic Press, San Diego, Calif.). expression (e.g., of polygalacturonase, cellulase, chitinases, Ethylene perception involves membrane-localized recep B-1,3-glucanases, etc.). Ethylene is released naturally by rip tors that, e.g., in Arabidopsis include ETR1, ERS1, ETR2, ening fruit and is also produced by most plant tissues, e.g., in ERS2, and EIN4 (see FIG. 1). ETR1, ETR2, and EIN4 are response to stress (e.g., drought, crowding, disease or patho composed of three domains, an N-terminal ethylene binding gen attack, temperature (cold or heat) stress, wounding, etc.), domain, a putative histidine protein kinase domain, and a and in maturing and Senescing organs. C-terminal receiver domain, whereas ERS1 and ERS2 lack Ethylene is generated from methionine by a well-defined the receiver domain. These genes have been grouped into two pathway involving the conversion of S-adenosyl-L-methion subfamilies based on homology, where ETR1 and ERS1 com ine (SAM or AdoMet) to the cyclic amino acid 1-aminocy prise one subfamily and ETR2, ERS2 and EIN4 comprise the 25 clopropane-1-carboxylic acid (ACC) which is facilitated by other. In Arabidopsis, analysis of loss-of-function mutants ACC synthase (see, e.g., FIG. 1). Sulphur is conserved in the has revealed that ethylene inhibits the signaling activity of process by recycling 5'-methylthioadenosine. these receptors and subsequently their ability to activate ACC synthase is an aminotransferase which catalyzes the CTR1, a negative regulator of ethylene responses that is rate limiting step in the formation of ethylene by converting related to mammalian RAF-type serine/threonine kinases. 30 S-adenosylmethionine to ACC. Typically, the enzyme Ethylene signal transduction pathway Suggests that ethylene requires pyridoxal phosphate as a cofactor. ACC synthase is binding to the receptor inhibits its own kinase activity, result typically encoded in multigene families. Examples include ing in decreased activity of CTR1, and consequently, an SEQID NOs: 1-3, described herein. Individual members can increase in EIN2 activity (which acts downstream of CTR1) exhibit tissue-specific regulation and/or are induced in ultimately leads to increases in ethylene responsiveness. Dif 35 response to environmental and chemical stimuli. Features of ferential expression of members of the ethylene receptor fam the invention include ACC synthase sequences and Subse ily has been observed, both developmentally and in response quences. See the section herein entitled “Polynucleotides and to ethylene. Polypeptides of the Invention.” The identification and analysis of mutants in Arabidopsis Ethylene is then produced from the oxidation of ACC and tomato that are deficient in ethylene biosynthesis and 40 through the action of ACC oxidase (also known as the ethyl perception are valuable in establishing the role that ethylene ene forming enzyme) with hydrogen cyanide as a secondary plays in plant growth and development. Mutant analysis has product that is detoxified by 3-cyanoalanine synthase. ACC also been instrumental in identifying and characterizing the oxidase is encoded by multigene families in which individual ethylene signal transduction pathway. While many ethylene members exhibit tissue-specific regulation and/or are induced mutants have been identified indicot plants (e.g., Arabidopsis 45 and tomato), no Such mutants have been identified in mono in response to environmental and chemical stimuli. Activity cots (e.g., rice, wheat, and corn). Herein are described, e.g., of ACC oxidase can be inhibited by anoxia and cobalt ions. ethylene mutants (e.g., in a monocot) deficient in ACC Syn The ACC oxidase enzyme is stereospecific and uses cofac thase, the first enzyme in the ethylene biosynthetic pathway. tors, e.g., Fe", O, ascorbate, etc. Finally, ethylene is This invention provides ACC synthase polynucleotide 50 metabolized by oxidation to CO or to ethylene oxide and sequences from plants, which modulate staygreen potential in ethylene glycol. plants and ethylene production, exemplified by, e.g., SEQID Polynucleotides and Polypeptides of the Invention NO:1 through SEQID NO:6 and SEQID NO:10 and, e.g., a The invention features the identification of gene set of polypeptide sequences which modulate staygreen sequences, coding nucleic acid sequences, and amino acid potential in plants and/or ethylene production, e.g., SEQID 55 sequences of ACC synthase, which are associated, e.g., with NO:7 through SEQID NO:9 and SEQID NO:11. The inven staygreen potential in plants and/or ethylene production. The tion also provides knockout plant cells deficient in ACC Syn sequences of the invention can influence staygreen potential thase and knockout plants having a staygreen potential phe in plants by modulating the production of ethylene. notype, as well as knockout plants having a male sterility Polynucleotide sequences of the invention include, e.g., the phenotype. The plants of the invention can have the charac 60 polynucleotide sequences represented by SEQ ID NO:1 teristic of regulating responses to environmental stress better through SEQID NO:6 and SEQIDNO:10, and subsequences than control plants, e.g., higher tolerance to drought stress. thereof. In addition to the sequences expressly provided in the Plants of the invention can also have a higher tolerance for accompanying sequence listing, the invention includes poly other stresses (e.g., crowding in, e.g., maize) compared to a nucleotide sequences that are highly related structurally and/ control plants. Thus, plants of the invention can be planted at 65 or functionally. For example, polynucleotides encoding higher densities than currently practiced by farmers. In addi polypeptide sequences represented by SEQID NO:7 through tion, plants of the invention are critical in elucidating the SEQID NO:9 and SEQID NO:11, or subsequences thereof, US 7,838,730 B2 19 20 are one embodiment of the invention. In addition, polynucle at least 7 out of 10 amino acids within a window of compari otide sequences of the invention include polynucleotide son are identical to the reference sequence selected, e.g., from sequences that hybridize under stringent conditions to a poly SEQ ID NO:7-9 and 11. Frequently, such sequences are at nucleotide sequence comprising any of SEQID NO:1-SEQ least about 70%, at least about 75%, at least about 80%, at ID NO:6 and SEQID NO:10, or a subsequence thereof (e.g., least about 85%, at least about 90%, at least about 95%, at a Subsequence comprising at least 100 contiguous nucle least about 98%, at least about 99%, or at least about 99.5%, otides). Polynucleotides of the invention also include ACC identical to the reference sequence, e.g., at least one of SEQ synthase sequences and/or Subsequences configured for RNA ID NO:7 to SEQID NO:9 or SEQID NO:11. Subsequences production, e.g., mRNA, antisense RNA, sense RNA, RNA of the polypeptides of the invention described above, e.g., silencing and interference configurations, etc. 10 SEQID NOS:7-9 and 11, including, e.g., at least about 5, at In addition to the polynucleotide sequences of the inven least about 10, at least about 15, at least about 20, at least tion, e.g., enumerated in SEQID NO:1 to SEQID NO:6 and about 25, at least about 50, at least about 75, at least about 100, SEQ ID NO:10, polynucleotide sequences that are substan at least about 500, about 1000 or more, contiguous amino tially identical to a polynucleotide of the invention can be acids are also a feature of the invention. Conservative variants used in the compositions and methods of the invention. Sub 15 of amino acid sequences or Subsequences of the invention are stantially identical or Substantially similar polynucleotide also amino acid sequences of the invention. Polypeptides of sequences are defined as polynucleotide sequences that are the invention are optionally immunogenic, enzymatically identical, on a nucleotide by nucleotide bases, with at least a active, enzymatically inactive, and the like. Subsequence of a reference polynucleotide, e.g., selected Where the polynucleotide sequences of the invention are from SEQ ID NOs: 1-6 and 10. Such polynucleotides can translated to form a polypeptide or Subsequence of a polypep include, e.g., insertions, deletions, and Substitutions relative tide, nucleotide changes can result in either conservative or to any of SEQID NOs: 1-6 and 10. For example, such poly non-conservative amino acid substitutions. Conservative nucleotides are typically at least about 70% identical to a amino acid substitutions refer to the interchangeability of reference polynucleotide selected from among SEQID NO:1 residues having functionally similar side chains. Conserva through SEQ ID NO:6 and SEQID NO:10, or subsequence 25 tive Substitution tables providing functionally similar amino thereof. For example, at least 7 out of 10 nucleotides within a acids are well known in the art. Table 1 sets forth six groups window of comparison are identical to the reference sequence which contain amino acids that are “conservative Substitu selected, e.g., from SEQID NO:1-6 and 10. Frequently, such tions” for one another. Other conservative substitution charts sequences are at least about 70%, at least about 75%, at least are available in the art, and can be used in a similar manner. about 80%, at least about 85%, at least about 90%, at least 30 about 95%, at least about 98%, at least about 99%, or at least TABLE 1 about 99.5%, identical to the reference sequence, e.g., at least one of SEQ ID NO:1 to SEQ ID NO:6 or SEQ ID NO:10. Conservative Substitution Group Subsequences of the polynucleotides of the invention Alanine (A) Serine (S) Threonine (T) described above, e.g., SEQID NOs: 1-6 and 10, including, 35 Aspartic acid (D) Glutamic acid (E) e.g., at least about 5, at least about 10, at least about 15, at least Asparagine (N) Glutamine (Q) Arginine (R) Lysine (K) about 20, at least about 25, at least about 50, at least about 75, Isoleucine (I) Leucine (L) Methionine (M) Valine (V) at least about 100, at least about 500, about 1000 or more, Phenylalanine (F) Tyrosine (Y) Tryptophan (W) contiguous nucleotides or complementary Subsequences thereofare also a feature of the invention. Such subsequences 40 can be, e.g., oligonucleotides, such as synthetic oligonucle One of skill in the art will appreciate that many conserva otides, isolated oligonucleotides, or full-length genes or tive substitutions of the nucleic acid constructs which are cDNAS. disclosed yield functionally identical constructs. For In addition, polynucleotide sequences complementary to example, as discussed above, owing to the degeneracy of the any of the above described sequences are included among the 45 genetic code, “silent Substitutions” (i.e., Substitutions in a polynucleotides of the invention. nucleic acid sequence which do not result in an alteration in Polypeptide sequences of the invention include, e.g., the an encoded polypeptide) are an implied feature of every amino acid sequences represented by SEQID NO:7 through nucleic acid sequence which encodes an amino acid. Simi SEQIDNO:9 and SEQID NO:11, and subsequences thereof. larly, "conservative amino acid substitutions in one or a few In addition to the sequences expressly provided in the accom 50 amino acids in an amino acid sequence (e.g., about 1%, 2%, panying sequence listing, the invention includes amino acid 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10% or more) are substituted sequences that are highly related structurally and/or function with different amino acids with highly similar properties, are ally. For example, in addition to the amino acid sequences of also readily identified as being highly similar to a disclosed the invention, e.g., enumerated in SEQ ID NO:7 to SEQ ID construct. Such conservative variations of each disclosed NO:9 and SEQ ID NO:11, amino acid sequences that are 55 sequence are a feature of the invention. substantially identical to a polypeptide of the invention can be Methods for obtaining conservative variants, as well as used in the compositions and methods of the invention. Sub more divergent versions of the nucleic acids and polypeptides stantially identical or Substantially similar amino acid of the invention, are widely known in the art. In addition to sequences are defined as amino acid sequences that are iden naturally occurring homologues which can be obtained, e.g., tical, on an amino acid by amino acid bases, with at least a 60 by screening genomic or expression libraries according to any Subsequence of a reference polypeptide, e.g., selected from ofa Variety of well-established protocols, see, e.g., Ausubelet SEQID NOS:7-9 and 11. Such polypeptides can include, e.g., al. Current Protocols in Molecular Biology (supplemented insertions, deletions, and substitutions relative to any of SEQ through 2004) John Wiley & Sons, New York (“Ausubel'); ID NOS:7-9 and 11. For example, such polypeptides are typi Sambrook et al. Molecular Cloning A Laboratory Manual cally at least about 70% identical to a reference polypeptide 65 (2nd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold selected from among SEQID NO:7 through SEQ ID NO:9 Spring Harbor, N.Y., 1989 (“Sambrook”), and Berger and and SEQID NO:11, or a subsequence thereof. For example, Kimmel Guide to Molecular Cloning Techniques, Methods in US 7,838,730 B2 21 22 Enzymology Volume 152 Academic Press, Inc., San Diego, Determining Sequence Relationships Calif. (“Berger), additional variants can be produced by any The nucleic acid and amino acid sequences of the invention of a variety of mutagenesis procedures. Many Such proce include, e.g., those provided in SEQ ID NO:1 to SEQ ID dures are known in the art, including site directed mutagen NO:11 and subsequences thereof, as well as similar esis, oligonucleotide-directed mutagenesis, and many others. sequences. Similar sequences are objectively determined by For example, site directed mutagenesis is described, e.g., in any number of methods, e.g., percent identity, hybridization, Smith (1985) “In vitro mutagenesis' Ann. Rev. Genet. immunologically, and the like. A variety of methods for deter 19:423-462, and references therein, Botstein & Shortle mining relationships between two or more sequences (e.g., (1985) "Strategies and applications of in vitro mutagenesis' identity, similarity and/or homology) are available and well 10 known in the art. The methods include manual alignment, Science 229:1193-1201; and Carter (1986) “Site-directed computer assisted sequence alignment and combinations mutagenesis' Biochem. J. 237:1-7. Oligonucleotide-directed thereof, for example. A number of algorithms (which are mutagenesis is described, e.g., in Zoller & Smith (1982) generally computer implemented) for performing sequence “Oligonucleotide-directed mutagenesis using M13-derived alignment are widely available or can be produced by one of vectors: an efficient and general procedure for the production 15 skill. These methods include, e.g., the local homology algo of point mutations in any DNA fragment' Nucleic Acids Res. rithm of Smith and Waterman (1981) Adv. Appl. Math. 2:482; 10:6487-6500). Mutagenesis using modified bases is the homology alignment algorithm of Needleman and Wun described e.g., in Kunkel (1985) “Rapid and efficient site sch (1970) J. Mol. Biol. 48:443; the search for similarity specific mutagenesis without phenotypic selection Proc. method of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. Natl. Acad. Sci. USA 82:488-492, and Taylor et al. (1985) (USA) 85:2444; and/or by computerized implementations of “The rapid generation of oligonucleotide-directed mutations these algorithms (e.g., GAP, BESTFIT. FASTA, and TFASTA at high frequency using phosphorothioate-modified DNA' in the Wisconsin Genetics Software Package Release 7.0, Nucl. Acids Res. 13: 8765-8787. Mutagenesis using gapped Genetics Computer Group, 575 Science Dr. Madison, Wis.). duplex DNA is described, e.g., in Kramer et al. (1984) “The For example, Software for performing sequence identity gapped duplex DNA approach to Oligonucleotide-directed 25 (and sequence similarity) analysis using the BLAST algo mutation construction' Nucl. Acids Res. 12: 9441-94.60). rithm is described in Altschul et al. (1990) J. Mol. Biol. Point mismatch mutagenesis is described, e.g., by Kramer et 215:403-410. This software is publicly available, e.g., al. (1984) “Point Mismatch Repair' Cell 38:879-887). through the National Center for Biotechnology Information Double-strand break mutagenesis is described, e.g., in Man on the world wide web at ncbi.nlm.nih.gov. This algorithm decki (1986) “Oligonucleotide-directed double-strand break 30 involves first identifying high scoring sequence pairs (HSPs) repair in plasmids of Escherichia coli: a method for site by identifying short words of length W in the query sequence, specific mutagenesis' Proc. Natl. Acad. Sci. USA, 83:7177 which either match or satisfy some positive-valued threshold 7181, and in Arnold (1993) “Protein engineering for unusual score T when aligned with a word of the same length in a environments' Current Opinion in Biotechnology database sequence. T is referred to as the neighborhood word 4:450-455). Mutagenesis using repair-deficient host strains is 35 score threshold. These initial neighborhood word hits act as described, e.g., in Carter et al. (1985) “Improved oligonucle seeds for initiating searches to find longer HSPs containing otide site-directed mutagenesis using M13 vectors' Nucl. them. The word hits are then extended in both directions Acids Res. 13:4431-4443. Mutagenesis by total gene synthe along each sequence for as far as the cumulative alignment sis is described e.g., by Nambiar et al. (1984) “Total synthesis score can be increased. Cumulative scores are calculated and cloning of a gene coding for the ribonuclease Sprotein' 40 using, for nucleotide sequences, the parameters M (reward Science 223: 1299-1301. DNA shuffling is described, e.g., by score for a pair of matching residues; always >0) and N Stemmer (1994) “Rapid evolution of a protein in vitro by DNA (penalty score for mismatching residues; always <0). For shuffling' Nature 370:389-391, and Stemmer (1994) “DNA amino acid sequences, a scoring matrix is used to calculate shuffling by random fragmentation and reassembly. In vitro the cumulative score. Extension of the word hits in each recombination for molecular evolution.' Proc. Natl. Acad. 45 direction are halted when: the cumulative alignment score Sci., USA 91:10747-10751. falls off by the quantity X from its maximum achieved value: Many of the above methods are further described in Meth the cumulative score goes to Zero or below, due to the accu ods in Enzymology Volume 154, which also describes useful mulation of one or more negative-scoring residue alignments; controls for trouble-shooting problems with various or the end of either sequence is reached. The BLAST algo mutagenesis methods. Kits formutagenesis, library construc 50 rithm parameters W. T. and X determine the sensitivity and tion and other diversity generation methods are also commer speed of the alignment. The BLASTN program (for nucle cially available. For example, kits are available from, e.g., otide sequences) uses as defaults a wordlength (W) of 11, an Amersham International plc (Piscataway, N.J.) (e.g., using expectation (E) of 10, a cutoff of 100, M-5, N=-4, and a the Eckstein method above), Bio/Can Scientific (Missis comparison of both Strands. For amino acid sequences, the sauga, Ontario, CANADA), Bio-Rad (Hercules, Calif.) (e.g., 55 BLASTP (BLAST Protein) program uses as defaults a using the Kunkel method described above), Boehringer Man wordlength (W) of 3, an expectation (E) of 10, and the BLO nheim Corp. (Ridgefield, Conn.), Clonetech Laboratories of SUM62 scoring matrix (see, Henikoff & Henikoff (1989) BD Biosciences (Palo Alto, Calif.), DNA Technologies Proc. Natl. Acad. Sci. USA 89:10915). (Gaithersburg, Md.), Epicentre Technologies (Madison, Additionally, the BLAST algorithm performs a statistical Wis.) (e.g., the 5 prime 3 prime kit); Genpak Inc. (Stony 60 analysis of the similarity between two sequences (see, e.g., Brook, N.Y.), Lemargo Inc (Toronto, CANADA), Invitrogen Karlin & Altschul (1993) Proc. Natl. Acad. Sci. USA Life Technologies (Carlsbad, Calif.), New England Biolabs 90:5873-5787). One measure of similarity provided by the (Beverly, Mass.), Pharmacia Biotech (Peapack, N.J.), BLAST algorithm is the smallest sum probability (p(N)), Promega Corp. (Madison, Wis.), QBiogene (Carlsbad, which provides an indication of the probability by which a Calif.), and Stratagene (La Jolla, Calif.) (e.g., Quick 65 match between two nucleotide or amino acid sequences ChangeTM site-directed mutagenesis kit and ChameleonTM would occur by chance. For example, a nucleic acid is con double-stranded, site-directed mutagenesis kit). sidered similar to a reference sequence (and, therefore, in this US 7,838,730 B2 23 24 context, homologous) if the Smallest Sum probability in a Press at Oxford University Press, Oxford, England (Hames comparison of the test nucleic acid to the reference nucleic and Higgins 2) provide details on the synthesis, labeling, acid is less than about 0.1, or less than about 0.01, and or even detection and quantification of DNA and RNA, including less than about 0.001. oligonucleotides. Another example of a useful sequence alignment algorithm 5 Conditions Suitable for obtaining hybridization, including is PILEUP, PILEUP creates a multiple sequence alignment differential hybridization, are selected according to the theo from a group of related sequences using progressive, pairwise retical melting temperature (T) between complementary alignments. It can also plot a tree showing the clustering and partially complementary nucleic acids. Under a given set relationships used to create the alignment. PILEUP uses a of conditions, e.g., solvent composition, ionic strength, etc., simplification of the progressive alignment method of Feng & 10 the T is the temperature at which the duplex between the Doolittle (1987).J. Mol. Evol. 35:351-360. The method used hybridizing nucleic acid strands is 50% denatured. That is, the is similar to the method described by Higgins & Sharp (1989) T. corresponds to the temperature corresponding to the mid CABIOS 5: 151-153. The program can align, e.g., up to 300 point in transition from helix to random coil; it depends on the sequences of a maximum length of 5,000 letters. The multiple length of the polynucleotides, nucleotide composition, and alignment procedure begins with the pairwise alignment of 15 ionic strength, for long stretches of nucleotides. the two most similar sequences, producing a cluster of two After hybridization, unhybridized nucleic acids can be aligned sequences. This cluster can then be aligned to the next removed by a series of washes, the Stringency of which can be most related sequence or cluster of aligned sequences. Two adjusted depending upon the desired results. Low Stringency clusters of sequences can be aligned by a simple extension of washing conditions (e.g., using higher salt and lower tem the pairwise alignment of two individual sequences. The final 20 perature) increase sensitivity, but can product nonspecific alignment is achieved by a series of progressive, pairwise hybridization signals and high background signals. Higher alignments. The program can also be used to plot a den stringency conditions (e.g., using lower salt and higher tem dogram or tree representation of clustering relationships. The perature that is closer to the T) lower the background signal. program is run by designating specific sequences and their typically with primarily the specific signal remaining. See, amino acid or nucleotide coordinates for regions of sequence 25 also, Rapley, R. and Walker, J. M. eds., Molecular comparison. Biomethods Handbook (Humana Press, Inc. 1998). An additional example of an algorithm that is Suitable for “Stringent hybridization wash conditions” or “stringent multiple DNA, or amino acid, sequence alignments is the conditions’ in the context of nucleic acid hybridization CLUSTALW program (Thompson, J. D. et al. (1994) Nucl. experiments, such as Southern and northern hybridizations, Acids. Res. 22:4673-4680). CLUSTALW performs multiple 30 are sequence dependent, and are different under different pairwise comparisons between groups of sequences and environmental parameters. An extensive guide to the hybrid assembles them into a multiple alignment based on homol ization of nucleic acids is found in Tijssen (1993), supra, and ogy. Gap open and Gap extension penalties can be, e.g., 10 in Hames and Higgins 1 and Hames and Higgins 2, Supra. and 0.05 respectively. For amino acid alignments, the BLO An example of stringent hybridization conditions for SUM algorithm can be used as a protein weight matrix. See, 35 hybridization of complementary nucleic acids which have e.g., Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. more than 100 complementary residues on a filter in a South USA 89: 10915-10919. ernor northern blot is 2xSSC, 50% formamide at 42°C., with Nucleic Acid Hybridization the hybridization being carried out overnight (e.g., for Similarity between ACC synthase nucleic acids of the approximately 20 hours). An example of stringent wash con invention can also be evaluated by “hybridization” between 40 ditions is a 0.2xSSC wash at 65° C. for 15 minutes (see single stranded (or single stranded regions of) nucleic acids Sambrook, Supra for a description of SSC buffer). Often, the with complementary or partially complementary polynucle wash determining the stringency is preceded by a low strin otide sequences. gency wash to remove signal due to residual unhybridized Hybridization is a measure of the physical association probe. An example low stringency wash is 2xSSC at room between nucleic acids, typically, in Solution, or with one of 45 temperature (e.g., 20° C. for 15 minutes). the nucleic acid strands immobilized on a Solid Support, e.g., In general, a signal to noise ratio of at least 2.5x-5x (and a membrane, a bead, a chip, a filter, etc. Nucleic acid hybrid typically higher) than that observed for an unrelated probe in ization occurs based on a variety of well characterized the particular hybridization assay indicates detection of a physico-chemical forces, such as hydrogen bonding, Solvent specific hybridization. Detection of at least stringent hybrid exclusion, base stacking, and the like. Numerous protocols 50 ization between two sequences in the context of the invention for nucleic acid hybridization are well known in the art. An indicates relatively strong structural similarity to, e.g., the extensive guide to the hybridization of nucleic acids is found nucleic acids of ACC synthases provided in the sequence in Tijssen (1993) Laboratory Techniques in Biochemistry and listings herein. Molecular Biology—Hybridization with Nucleic Acid For purposes of the invention, generally, “highly stringent' Probes, part I, chapter 2, "Overview of principles of hybrid- 55 hybridization and wash conditions are selected to be about 5° ization and the strategy of nucleic acid probe assays.” C. or less lower than the thermal melting point (T) for the (Elsevier, N.Y.), as well as in Ausubel et al. Current Protocols specific sequence at a defined ionic strength and pH (as noted in Molecular Biology (supplemented through 2004) John below, highly stringent conditions can also be referred to in Wiley & Sons, New York (Ausubel'); Sambrook et al. comparative terms). Target sequences that are closely related Molecular Cloning A Laboratory Manual (2nd Ed.), Vol. 60 or identical to the nucleotide sequence of interest (e.g., 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, “probe') can be identified under stringent or highly stringent N.Y., 1989 (“Sambrook”), and Berger and Kimmel Guide to conditions. Lower stringency conditions are appropriate for Molecular Cloning Techniques, Methods in Enzymology Vol sequences that are less complementary. ume 152 Academic Press, Inc., San Diego, Calif. (“Berger'). For example, in determining stringent or highly stringent Hames and Higgins (1995) Gene Probes 1. IRL Press at 65 hybridization (or even more stringent hybridization) and Oxford University Press, Oxford, England (Hames and Hig wash conditions, the stringency of the hybridization and wash gins 1) and Hames and Higgins (1995) Gene Probes 2, IRL conditions is gradually increased (e.g., by increasing tem US 7,838,730 B2 25 26 perature, decreasing salt concentration, increasing detergent cation defective. In the latter case, viral propagation generally concentration, and/or increasing the concentration of organic will occur only in complementing host cells. Solvents, such as formamide, in the hybridization or wash), Preferred among vectors, in certain respects, are those for until a selected set of criteria are met. For example, the strin expression of polynucleotides and polypeptides of the present gency of the hybridization and wash conditions is gradually 5 invention. Generally, such vectors comprise cis-acting con increased until a probe comprising one or more polynucle trol regions effective for expression in a host, operably linked otide sequences of the invention, e.g., selected from SEQID to the polynucleotide to be expressed. Appropriate trans NO:1 to SEQID NO:6 and SEQID NO:10, or a subsequence acting factors are Supplied by the host, Supplied by a comple thereof, and/or complementary polynucleotide sequences menting vector or Supplied by the vector itself upon introduc thereof, binds to a perfectly matched complementary target 10 tion into the host. (again, a nucleic acid comprising one or more nucleic acid In certain preferred embodiments in this regard, the vectors sequences or subsequences selected from SEQ ID NO:1 to provide for preferred expression. Such preferred expression SEQID NO:6 and SEQID NO:10, and complementary poly may be inducible expression, temporally limited expression, nucleotide sequences thereof), with a signal to noise ratio that or expression restricted to predominantly certain types of is at least 2.5x, and optionally 5x, or 10x, or 100x or more, as 15 cells, or any combination of the above. Particularly preferred high as that observed for hybridization of the probe to an among inducible vectors are vectors that can be induced for unmatched target, as desired. expression by environmental factors that are easy to manipu Using Subsequences derived from the nucleic acids encod late. Such as temperature and nutrient additives. A variety of ing the ACC synthase polypeptides of the invention, novel vectors Suitable to this aspect of the invention, including target nucleic acids can be obtained; Such target nucleic acids 20 constitutive and inducible expression vectors for use in are also a feature of the invention. For example, Such target prokaryotic and eukaryotic hosts, are well known and nucleic acids include sequences that hybridize under strin employed routinely by those of skill in the art. Such vectors gent conditions to an oligonucleotide probe that corresponds include, among others, chromosomal, episomal and virus to a unique Subsequence of any of the polynucleotides of the derived vectors, e.g., vectors derived from bacterial plasmids, invention, e.g., SEQ ID NOs: 1-6, 10, or a complementary 25 from bacteriophage, from transposons, from yeast episomes, sequence thereof; the probe optionally encodes a unique Sub from insertion elements, from yeast chromosomal elements, sequence in any of the polypeptides of the invention, e.g., from viruses such as baculoviruses, papova viruses, such as SEQID NOs: 7-9 and 11. SV40, Vaccinia viruses, adenoviruses, fowlpox viruses, pseu For example, hybridization conditions are chosen under dorabies viruses and retroviruses, and vectors derived from which a target oligonucleotide that is perfectly complemen 30 combinations thereof. Such as those derived from plasmid and tary to the oligonucleotide probe hybridizes to the probe with bacteriophage genetic elements, such as cosmids and at least about a 5-10x higher signal to noise ratio than for phagemids and binaries used for Agrobacterium-mediated hybridization of the target oligonucleotide to a negative con transformations. All may be used for expression in accor trol non-complimentary nucleic acid. dance with this aspect of the present invention. Higher ratios of signal to noise can be achieved by increas 35 Vectors that are functional in plants can be binary plasmids ing the stringency of the hybridization conditions such that derived from Agrobacterium. Such vectors are capable of ratios of about 15x, 20x, 30x, 50x or more are obtained. The transforming plant cells. These vectors contain left and right particular signal will depend on the label used in the relevant border sequences that are required for integration into the host assay, e.g., a fluorescent label, a calorimetric label, a radio (plant) chromosome. At minimum, between these border 40 sequences is the gene (or other polynucleotide sequence of active label, or the like. the present invention) to be expressed, typically under control Vectors, Promoters and Expression Systems of regulatory elements. In one embodiment, a selectable Nucleic acids of the invention can be in any of a variety of marker and a reporter gene are also included. For ease of forms, e.g., expression cassettes, vectors, plasmids, or linear obtaining Sufficient quantities of vector, a bacterial origin that nucleic acid sequences. For example, vectors, plasmids, as allows replication in E. coli can be used. cosmids, bacterial artificial chromosomes (BACs), YACs The following vectors, which are commercially available, (yeast artificial chromosomes), phage, viruses and nucleic are provided by way of example. Among vectors preferred for acid segments can comprise an ACC synthase nucleic acid use in bacteria are pGE70, pCRE60 and pGE-9, available from sequence or Subsequence thereof which one desires to intro Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, duce into cells. These nucleic acid constructs can further so pNH8A, pNH16a, pNH18A, pNH46A, available from Strat include promoters, enhancers, polylinkers, regulatory genes, agene; and ptrc99a, pKK223-3, pKK233-3, plDR540, pRIT5 etc. available from Pharmacia. Among preferred eukaryotic vec Thus, the present invention also relates, e.g., to vectors tors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG avail comprising the polynucleotides of the present invention, host able from Stratagene; and pSVK3, pBPV, pMSG and pSVL cells that incorporate the vectors of the invention, and the 55 available from Pharmacia. Useful plant binary vectors production of polypeptides of the invention by recombinant include BIN19 and its derivatives available from Clontech. techniques. These vectors are listed solely by way of illustration of the In accordance with this aspect of the invention, the vector many commercially available and well-known vectors that may be, for example, a plasmid vector, a single or double are available to those of skill in the art for use in accordance stranded phage vector, or a single or double-stranded RNA or 60 with this aspect of the present invention. It will be appreciated DNA viral vector. Such vectors may be introduced into cells that any other plasmid or vector suitable for, for example, as polynucleotides, preferably DNA, by well known tech introduction, maintenance, propagation or expression of a niques for introducing DNA and RNA into cells. The vectors, polynucleotide or polypeptide of the invention in a host may in the case of phage and viral vectors, also may be and be used in this aspect of the invention, several of which are preferably are introduced into cells as packaged or encapsi- 65 disclosed in more detail below. dated virus by well known techniques for infection and trans In general, expression constructs will contain sites for tran duction. Viral vectors may be replication competent or repli Scription initiation and termination, and, in the transcribed US 7,838,730 B2 27 28 region, a ribosome-binding site for translation when the con ried out in essentially any of the various ways known to those struct encodes a polypeptide. The coding portion of the skilled in the art of plant molecular biology, including, but not mature transcripts expressed by the constructs will include a limited to, the methods described herein. See, in general, translation-initiating AUG at the beginning and a termination Methods in Enzymology, Vol. 153 (Recombinant DNA Part codon appropriately positioned at the end of the polypeptide D) Wu and Grossman (eds.) 1987, Academic Press, incorpo to be translated. rated herein by reference. As used herein, the term “transfor In addition, the constructs may contain control regions that mation” means alteration of the genotype of a host plant by regulate as well as engender expression. Generally, in accor the introduction of a nucleic acid sequence, e.g., a "heterolo dance with many commonly practiced procedures. Such gous', 'exogenous” or “foreign nucleic acid sequence. The regions will operate by controlling transcription, Such as tran 10 heterologous nucleic acid sequence need not necessarily Scription factors, repressor binding sites and termination sig originate from a different source but it will, at Some point, nals, among others. For secretion of a translated protein into have been external to the cell into which is introduced. the lumen of the endoplasmic reticulum, into the periplasmic In addition to Berger, Ausubel and Sambrook, useful gen space or into the extracellular environment, appropriate eral references for plant cell cloning, culture and regeneration secretion signals may be incorporated into the expressed 15 include Jones (ed) (1995) Plant Gene Transfer and Expres polypeptide. These signals may be endogenous to the Sion Protocols—Methods in Molecular Biology. Volume 49 polypeptide or they may be heterologous signals. Humana Press Towata N.J.; Payne etal. (1992) Plant Cell and Transcription of the DNA (e.g., encoding the polypeptides) Tissue Culture in Liquid Systems John Wiley & Sons, Inc. of the present invention by higher eukaryotes may be New York, N.Y. (Payne); and Gamborg and Phillips (eds) increased by inserting an enhancer sequence into the vector. (1995) Plant Cell, Tissue and Organ Culture, Fundamental Enhancers are cis-acting elements of DNA, usually about Methods Springer Lab Manual, Springer-Verlag (Berlin from 10 to 300 bp that act to increase transcriptional activity Heidelberg N.Y.) (Gamborg). A variety of cell culture media of a promoter in a given host cell-type. Examples of enhanc are described in Atlas and Parks (eds) The Handbook of ers include the SV40 enhancer, which is located on the late Microbiological Media (1993) CRC Press, Boca Raton, Fla. side of the replication origin at bp 100 to 270, the cytomega 25 (Atlas). Additional information for plant cell culture is found lovirus early promoter enhancer, the polyoma enhancer on the in available commercial literature such as the Life Science late side of the replication origin, and adenovirus enhancers. Research Cell Culture Catalogue (1998) from Sigma-Ald Additional enhancers useful in the invention to increase tran rich, Inc (St Louis, Mo.) (Sigma-LSRCCC) and, e.g., the Scription of the introduced DNA segment, include, interalia, Plant Culture Catalogue and supplement (1997) also from viral enhancers like those within the 35S promoter, as shown 30 Sigma-Aldrich, Inc (St Louis, Mo.) (Sigma-PCCS). Addi by Odell et al., Plant Mol. Biol. 10:263-72 (1988), and an tional details regarding plant cell culture are found in Croy, enhancer from an opine gene as described by Fromm et al., (ed.) (1993) Plant Molecular Biology Bios Scientific Publish Plant Cell 1:977 (1989). The enhancer may affect the tissue ers, Oxford, U.K. See also the section herein entitled “Plant specificity and/or temporal specificity of expression of transformations.” sequences included in the vector. 35 In an embodiment of this invention, recombinant vectors Termination regions also facilitate effective expression by including one or more of the ACC synthase nucleic acids or a ending transcription at appropriate points. Useful terminators subsequence thereof, e.g., selected from SEQ ID NO:1 to for practicing this invention include, but are not limited to, SEQ ID NO:6, or SEQ ID NO:10, suitable for the transfor pin II (see Anet al., Plant Cell 1(1): 115-122 (1989)), glb1 (see mation of plant cells are prepared. In another embodiment, a Genbank Accession #L22345), gZ (see gZw64a terminator, 40 nucleic acid sequence encoding for the desired ACC synthase Genbank Accession #S78780), and the nos terminator from RNA or protein or subsequence thereof, e.g., selected from Agrobacterium. The termination region can be native with the among SEQID NO:7 to SEQID NO:9, or SEQID NO:11, is promoter nucleotide sequence, can be native with the DNA conveniently used to construct a recombinant expression cas sequence of interest, or can be derived from another source. sette which can be introduced into the desired plant. In the For example, other convenient termination regions are avail 45 context of the invention, an expression cassette will typically able from the Ti-plasmid of A. tumefaciens. Such as the comprise a selected ACC synthase nucleic acid sequence or octopine synthase and nopaline synthase termination regions. Subsequence in an RNA configuration (e.g., antisense, sense, See also: Guerineau et al. (1991) Mol. Gen. Genet. 262:141 RNA silencing or interference configuration, and/or the like) 144; Proudfoot (1991) Cell 64:671-674; Sanfacon et al. operably linked to a promoter sequence and other transcrip (1991) Genes Dev. 5:141-149; Mogenet al. (1990) Plant Cell 50 tional and translational initiation regulatory sequences which 2:1261-1272; Munroe et al. (1990) Gene 91:151-158; Ballas are sufficient to direct the transcription of the ACC synthase et al. 1989) Nucleic Acids Res. 17:7891-7903; and Joshi et al. RNA configuration sequence in the intended tissues (e.g., (1987) Nucleic Acid Res. 15:9627-9639. entire plant, leaves, anthers, roots, etc.) of the transformed Among known eukaryotic promoters suitable for general plant. ized expression are the CMV immediate early promoter, the 55 In general, the particular promoter used in the expression HSV thymidine kinase promoter, the early and late SV40 cassette in plants depends on the intended application. Any of promoters, the promoters of retroviral LTRs, such as those of a number of promoters can be suitable. For example, the the Rous sarcoma virus (“RSV), metallothionein promoters, nucleic acids can be combined with constitutive, inducible, Such as the mouse metallothionein-I promoter and various tissue-specific (tissue-preferred), or other promoters for plant promoters, such as globulin-1. When available, the 60 expression in plants. For example, a strongly or weakly con native promoters of the ACC synthase genes may be used. stitutive plant promoter that directs expression of an ACC Representatives of prokaryotic promoters include the phage synthase RNA configuration sequence in all tissues of a plant lambda PL promoter, the E. colilac, trp and tac promoters to can be favorably employed. Such promoters are active under name just a few of the well-known promoters. most environmental conditions and States of development or Isolated or recombinant plants, or plant cells, incorporating 65 cell differentiation. Examples of constitutive promoters the ACC synthase nucleic acids are a feature of the invention. include the 1'- or 2'-promoter of Agrobacterium tumefaciens The transformation of plant cells and protoplasts can be car (see, e.g., O'Grady (1995)Plant Mol. Biol. 29:99-108). Other US 7,838,730 B2 29 30 plant promoters include the ribulose-1,3-bisphosphate car 773-778; Lam (1994) Results Probl. Cell Differ. 20:181-196: boxylase Small subunit promoter, the phaseolin promoter, Orozco et al. (1993) Plant Mol. Biol. 23(6):1129-1138; Mat alcohol dehydrogenase (Adh) gene promoters (see, e.g., suoka et al. (1993) Proc Natl. Acad. Sci. USA 90(20):9586 Millar (1996) Plant Mol. Biol. 31:897-904), sucrose synthase 9590; and Guevara-Garcia et al. (1993) Plant J. 4(3):495-505. promoters, C-tubulin promoters, actin promoters, such as the Such promoters can be modified, if necessary, for weak Arabidopsis actin gene promoter (see, e.g., Huang (1997) expression. Plant Mol. Biol. 1997 33:125-139), cab, PEPCase, R gene In certain embodiments, leaf specific promoters can be complex, ACT11 from Arabidopsis (Huang et al. Plant Mol. used, e.g., pyruvate, orthophosphate dikinase (PPDK) pro Biol. 33:125-139 (1996)), Cat3 from Arabidopsis (Zhong et moter from C4 plant (maize), cab-ml Ca+2 promoter from al., Mol. Gen. Genet. 251:196-203 (1996)), the gene encoding 10 maize, the Arabidopsis thaliana myb-related gene promoter Stearoyl-acyl carrier protein desaturase from Brassica napus (Atmyb5), the ribulose biphosphate carboxylase (RBCS) (Solocombe et al. (1994) Plant Physiol. 104:1167-1176), promoters (e.g., the tomato RBCS1, RBCS2 and RBCS3A GPc1 from maize (Martinez et al. (1989).J. Mol. Biol. 208: genes, which are expressed in leaves and light-grown seed 551-565), Gpc2 from maize (Manjunath et al. (1997), Plant lings, while RBCS1 and RBCS2 are expressed in developing Mol. Biol. 33:97-112), and other transcription initiation 15 tomato fruits, and/or a ribulose bisphosphate carboxylase regions from various plant genes known to those of skill. See promoter which is expressed almost exclusively in mesophyll also Holtorf (1995)“Comparison of different constitutive and cells in leaf blades and leaf sheaths at high levels, etc.), and inducible promoters for the overexpression of transgenes in the like. See, e.g., Matsuoka et al., (1993) Tissue-specific Arabidopsis thaliana,' Plant Mol. Biol. 29:637-646. The pro light-regulated expression directed by the promoter of a C4 moter sequence from the E8 gene (see, Deikman and Fischer gene, maize pyruvate, Orthophosphate dikinase, in a C3 plant, (1988) EMBO.J. 7:3315) and other genes can also be used, rice, PNAS USA 90(20):9586-90; (2000) Plant Cell Physiol. along with promoters specific for monocotyledonous species 41(1):42-48; (2001) Plant Mol. Biol. 45(1):1-15; Shiina, T. et (e.g., McElroy D., et al. (1994.) Foreign gene expression in al., (1997) Identification of Promoter Elements involved in the transgenic cereals. Trends Biotech., 12:62-68). Other consti cytosolic Ca+2 mediated photoregulation of maize cab-ml tutive promoters include, for example, the core promoter of 25 expression, Plant Physiol. 115:477-483; Casal (1998) Plant the Rsyn? promoter and other constitutive promoters dis Physiol. 116:1533-1538; Li (1996) FEBS Lett. 379:117-121: closed in WO99/43838 and U.S. Pat. No. 6,072,050; the core Busk (1997) Plant J. 11: 1285-1295; and, Meier (1997) FEBS CaMV 35S promoter (Odell et al. (1985) Nature 313:810 Lett. 415:91-95; and, Matsuoka (1994) Plant J. 6:311-319. 812); rice actin (McElroy et al. (1990) Plant Cell 2:163-171); Other leaf-specific promoters include, for example, Yama ubiquitin (Christensen et al. (1989) Plant Mol. Biol. 12:619 30 moto et al. (1997) Plant J. 12(2):255-265; Kwon et al. (1994) 632 and Christensen et al. (1992) Plant Mol. Biol. 18:675 Plant Physiol. 105:357-67:Yamamoto et al. (1994) Plant Cell 689); pEMU (Last et al. (1991) Theor. Appl. Genet. 81:581 Physiol. 35(5):773-778; Gotoretal. (1993) Plant J. 3:509-18; 588); MAS (Velten-et al. (1984) EMBO J. 3:2723-2730): Orozco et al. (1993) Plant Mol. Biol. 23(6): 1129-1138; and ALS promoter (U.S. Pat. No. 5,659,026), and the like. Yet, Matsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90(20): other constitutive promoters include, for example, U.S. Pat. 35 9586-9590. Nos. 5,608,149; 5,608, 1445,604,121 : 5,569,597; 5,466,785; In certain embodiments, senescence specific promoters 5,399,680: 5,268,463; 5,608,142; and 6,177,611. can be used (e.g., a tomato promoter active during fruit rip In addition to the promoters noted herein, promoters of ening, senescence and abscission of leaves, a maize promoter bacterial origin which operate in plants can be used in the of gene encoding a cysteine protease, and the like). See, e.g., invention. They include, e.g., the octopine synthase promoter, 40 Blume (1997) Plant J. 12:731-746; Griffiths et al., (1997) the nopaline synthase promoter and other promoters derived Sequencing, expression pattern and RFLP mapping of a from Ti plasmids. See, Herrera-Estrella et al. (1983) Nature senescence-enhanced cDNA from Zea Mays with high homol 303:209. Viral promoters can also be used. Examples of viral ogy to Oryzaingamma and aleurain, Plant Mol. Biol. 34(5): promoters include the 35S and 19S RNA promoters of cauli 815-21; Zea mays partial Seel gene for cysteine protease, flower mosaic virus (CaMV). See, Odellet al., (1985) Nature 45 promoter region and 5' coding region, Genbank A J494982; 313:810; and, Dagless (1997) Arch. Virol. 142:183-191. Kleber-Janke, T. and Krupinska, K. (1997) Isolation of cDNA Other examples of constitutive promoters from viruses which clones for genes showing enhanced expression in barley infect plants include the promoter of the tobacco mosaic leaves during dark-induced senescence as well as during virus; cauliflowermosaic virus (CaMV) 19S and 35S promot senescence underfield conditions, Planta 203(3): 332-40: ers or the promoter of Figwort mosaic virus, e.g., the figwort 50 and, Lee, R H et al., (2001) Leafsenescence in rice plants. mosaic virus 35S promoter (see, e.g., Maiti (1997) Trans cloning and characterization of senescence up-regulated genic Res. 6:143-156), etc. Alternatively, novel promoters genes, J. Exp. Bot. 52(358): 1117-21. with useful characteristics can be identified from any viral, In other embodiments, anther-specific promoters can be bacterial, or plant source by methods, including sequence used. Such promoters are known in the art or can be discov analysis, enhancer or promoter trapping, and the like, known 55 ered by known techniques; see, e.g., Bhalla and Singh (1999) in the art. Molecular control of male fertility in Brassica Proc. 10" Tissue-preferred (tissue-specific) promoters and enhancers Annual Rapeseed Congress, Canberra, Australia; Van Tunen can be utilized to target enhanced gene expression within a et al. (1990) Pollen-and anther-specific chi promoters from particular plant tissue. Tissue-preferred (tissue-specific) pro petunia: tandem promoter regulation of the chiA gene. Plant moters include, e.g., those described in Yamamoto et al. 60 Cell 2:393-40; Jeon et al. (1999) Isolation and characteriza (1997) Plant J. 12(2):255-265; Kawamata et al. (1997) Plant tion of an anther-specific gene, RA 8, from rice (Oryza sativa Cell Physiol. 38(7):792-803; Hansen et al. (1997) Mol. Gen. L). Plant Molecular Biology 39:35-44; and Twelletal. (1993) Genet. 254(3):337-343; Russellet al. (1997) Transgenic Res. Activation and developmental regulation of an Arabidopsis 6(2): 157-168; Rinehart et al. (1996) Plant Physiol. 112(3): anther-specific promoter in microspores and pollen of Nic 1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2): 65 otiana tabacum. Sex. Plant Reprod. 6:217-224. 525-535; Canevascini et al. (1996) Plant Physiol. 112(2): Root-preferred promoters are known and can be selected 513-524; Yamamoto et al. (1994) Plant Cell Physiol. 35(5): from the many available from the literature or isolated de US 7,838,730 B2 31 32 novo from various compatible species. See, for example, Hire (Shaw et al., Plant Phys 98:1214-1216, 1992: Zhong Chenet et al. (1992) Plant Mol. Biol. 20(2):207-218 (soybean root al., PNAS USA 100:3525-3530, 2003) However, other pro specific glutamine synthetase gene); Keller and Baumgartner moters useful in the practice of the invention are known to (1991) Plant Cell 3(10): 1051-1061 (root-specific control those of skill in the art such as nucellain promoter (See C. element in the GRP 1.8 gene of French bean); Sanger et al. Linnestad, et al., Nucellain, A Barley Homolog of the Dicot (1990) Plant Mol. Biol. 14(3):433-443 (root-specific pro Vacuolar Processing Proteasem Is Localized in Nucellar moter of the mannopine synthase (MAS) gene of Agrobacte Cell Walls, Plant Physiol. 118: 1169-80 (1998), kn1 promoter rium tumefaciens); and Miao et al. (1991) Plant Cell3(1): 11 (See S. Hake and N. Ori. The Role of knotted1 in Meristem 22 (full-length cDNA clone encoding cytosolic glutamine Functions, B8: INTERACTIONS AND INTERSECTIONS IN PLANT PATH synthetase (GS), which is expressed in roots and root nodules 10 WAYS, COEUR DALENE, IDAHO, KEYSTONE SYMPOSIA, Feb. 8-14, of soybean). See also Bogusz et al. (1990) Plant Cell 207): 1999, at 27), and F3.7 promoter (Baszczynski et al., Maydica 633-641, where two root-specific promoters isolated from 42: 189-201 (1997)), etc. In certain embodiments, spatially hemoglobin genes from the nitrogen-fixing nonlegume Para acting promoters such as glb1, an embryo-preferred pro sponia andersonii and the related non-nitrogen-fixing nonle moter, or gamma Zein, an endosperm-preferred promoter, or gume Trema tomentosa are described. The promoters of these 15 a promoteractive in the embryo-Surrounding region (see U.S. genes were linked to a B-glucuronidase reporter gene and patent application Ser. No. 10/786,679, filed Feb. 25, 2004), introduced into both the nonlegume Nicotiana tabacum and or BETL1 (See G. Hueros, et al., Plant Physiology 121:1143 the legume Lotus corniculatus, and in both instances root 1152 (1999) and Plant Cell 7:747-57 (June 1995)), are useful, specific promoter activity was preserved. Leach and Aoyagi including promoters preferentially active in female reproduc (1991) describe their analysis of the promoters of the highly tive tissues, and those active in meristematic tissues, particu expressed rolC and rolD root-inducing genes of Agrobacte larly in meristematic female reproductive tissues. See also, rium rhizogenes (see Plant Science (Limerick) 79(1):69-76). WO 00/12733, where seed-preferred promoters from end 1 They concluded that enhancer and tissue-preferred DNA and end2 genes are disclosed. determinants are dissociated in those promoters. Teeri et al. A tissue-specific promoter can drive expression of oper (1989) used gene fusion to lacZ to show that the Agrobacte 25 ably linked sequences in tissues other than the target tissue. rium T-DNA gene encoding octopine synthase is especially Thus, as used herein, a tissue-specific promoter is one that active in the epidermis of the root tip and that the TR2 gene drives expression preferentially in the target tissue, but can is root specific in the intact plant and stimulated by wounding also lead to Some expression in other tissues as well. in leaf tissue (see, e.g., EMBO.J. 8(2):343-350). The TR1' The use of temporally-acting promoters is also contem gene, fused to mptII (neomycin phosphotransferase II) 30 plated by this invention. For example, promoters that act from showed similar characteristics. Additional root-preferred 0-25 days after pollination (DAP), 4-21, 4-12, or 8-12 DAP promoters include the VfBNOD-GRP3 gene promoter can be selected, e.g., promoters such as cim1 and ltp2. Pro (Kuster et al. (1995) Plant Mol. Biol. 29(4):759-772); and moters that act from -14 to 0 days after pollination can also be rolB promoter (Capana et al. (1994) Plant Mol. Biol. 25(4): used, such as SAG12 (See WO 96/29858, Richard M. Ama 681-691. See also, U.S. Pat. Nos. 5,837,876; 5,750,386; 35 sino, published 3 Oct. 1996) and ZAG1 or ZAG2 (See R. J. 5,633,363; 5,459,252: 5,401,836; 5,110,732; and 5,023,179. Schmidt, et al., Identification and Molecular Characteriza “Seed-preferred promoters include both “seed-specific' tion of ZAG1, the Maize Homolog of the Arabidopsis Floral promoters (those promoters active during seed development Homeotic Gene AGAMOUS, Plant-Cell 5(7): 729-37 (July Such as promoters of seed storage proteins) as well as “seed 1993)). Other useful promoters include maize Zag2.1, Zap germinating promoters (those promoters active during seed 40 (also known as ZmMADS; U.S. patent application Ser. No. germination). See, e.g., Thompson et al. (1989) BioEssays 10/387,937; WO 03/078590); and the maize th1 promoter 10:108, herein incorporated by reference. Such seed-pre (see also Hubbarda et al., Genetics 162:1927-1935, 2002). ferred promoters include, but are not limited to, Cim1 (cyto Where overexpression of an ACC synthase RNA configu kinin-induced message); cz19B1 (maize 19 kDa zein); milps ration nucleic acid is detrimental to the plant, one of skill will (myo-inositol-1-phosphate synthase); m7E40-2, also known 45 recognize that weak constitutive promoters can be used for as Zm-40 (U.S. Pat. No. 6,403,862): nuclc (U.S. Pat. No. low-levels of expression (or, in certain embodiments, induc 6,407.315); and celA (cellulose synthase) (see WO ible or tissue-specific promoters can be used). In those cases 00/11177). Gama-Zein is an endosperm-specific promoter. where high levels of expression are not harmful to the plant, Glob-1 is an embryo-specific promoter. For dicots, seed a strong promoter, e.g., a t-RNA, or other pol III promoter, or specific promoters include, but are not limited to, bean 50 a strong pol II promoter (e.g., the cauliflower mosaic virus B-phaseolin, napin, B-conglycinin, soybean lectin, cruciferin, promoter, CaMV, 35S promoter), can be used. and the like. For monocots, seed-specific promoters include, Where low level expression is desired, weak promoters but are not limited to, a maize 15 kDa Zein promoter, a 22 kDa will be used. Generally, by “weak promoter' is intended a Zein promoter, a 27 kDa Zein promoter, a g-Zein promoter, a promoter that drives expression of a coding sequence at a low 27 kDY-Zein promoter (such as gZw64A promoter, see Gen 55 level. By low level is intended at levels of about /1000 tran bank Accession #S78780), a waxy promoter, a shrunken 1 Scripts to about/100,000 transcripts to about/S00,000 transcripts. promoter, a shrunken 2 promoter, a globulin 1 promoter (see Alternatively, it is recognized that weak promoters also Genbank Accession it. L22344), an Itp2 promoter (Kalla, et encompass promoters that drive expression in only a few cells al., Plant Journal 6:849-860 (1994); U.S. Pat. No. 5,525,716), and not in others to give a total low level of expression. Where cim1 promoter (see U.S. Pat. No. 6,225.529) maize end1 and 60 a promoter drives expression at unacceptably high levels, end2 promoters (See U.S. Pat. No. 6,528,704 and application portions of the promoter sequence can be deleted or modified Ser. No. 10/310,191, filed Dec. 4, 2002); nucl promoter (U.S. to decrease expression levels. Such weak constitutive pro Pat. No. 6,407.315); Zm40 promoter (U.S. Pat. No. 6,403, moters include, for example, the core promoter of the Rsyn? 862): eep 1 and eep2; lec1 (U.S. patent application Ser. No. promoter (WO 99/43838 and U.S. Pat. No. 6,072,050), the 09/718,754); thioredoxinH promoter (U.S. provisional patent 65 core 35S CaMV promoter, and the like. application 60/514,123); mlip 15 promoter (U.S. Pat. No. In certain embodiments of the invention, an inducible pro 6.479,734); PCNA2 promoter; and the shrunken-2 promoter. moter can be used. For example, a plant promoter can be US 7,838,730 B2 33 34 under environmental control. Such promoters are referred to 1n2-2 promoter, activated by benzenesulfonamide herbicide as “inducible' promoters. Examples of environmental condi safeners, can be used (De Veylder (1997) Plant Cell Physiol. tions that can alter transcription by inducible promoters 38:568-577); application of different herbicide safeners include pathogen attack, anaerobic conditions, elevated tem induces distinct gene expression patterns, including expres perature, and the presence of light. For example, the invention sion in the root, hydathodes, and the shoot apical meristem. incorporates the drought-inducible promoter of maize (Busk An ACC synthase coding sequence or RNA configuration can (1997) Plant J. 11: 1285-1295); the cold, drought, high salt also be under the control of, e.g., tetracycline-inducible and inducible promoter from potato (Kirch (1997) Plant Mol. tetracycline-repressible promoters (see, e.g., Gatz et al. Biol. 33:897-909), and the like. (1991) Mol. Gen. Genet. 227:229-237; U.S. Pat. Nos. 5,814, Pathogen-inducible promoters include those from patho 10 618 and 5,789,156; and, Masgrau (1997) Plant J. 11:465-473 genesis-related proteins (PR proteins), which are induced (describing transgenic tobacco plants containing the Avena following infection by a pathogen; e.g., PR proteins, SAR sativa L. (oat) arginine decarboxylase gene with a tetracy proteins, beta-1,3-glucanase, chitinase, etc. See, for example, cline-inducible promoter); or, a salicylic acid-responsive ele Redolfietal. (1983) Neth, J. Plant Pathol. 89:245-254; Uknes ment (Stange (1997) Plant J. 11:1315-1324. Other chemical etal. (1992) Plant Cell 4:645-656; and VanLoon (1985) Plant 15 inducible promoters are known in the art and include, but are Mol. Virol. 4:111-116. See also the application entitled not limited to, the maize GST promoter, which is activated by “Inducible Maize Promoters’, U.S. patent application Ser. hydrophobic electrophilic compounds that are used as pre No. 09/257,583, filed Feb. 25, 1999. emergent herbicides, and the tobacco PR-1a promoter, which Of interest are promoters that are expressed locally at or is activated by Salicylic acid. Other chemical-regulated pro near the site of pathogen infection. See, for example, moters of interest include steroid-responsive promoters (see, Marineau et al. (1987) Plant Mol. Biol. 9:335-342; Matton et for example, the glucocorticoid-inducible promoter in al. (1989) Molecular Plant-Microbe Interactions 2:325-331; Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88: 10421 Somsisch et al. (1986) Proc. Natl. Acad. Sci. 83:2427-2430; 10425 and McNellis et al. (1998) Plant J. 14(2):247-257). Somsisch et al. (1988) Mol. Gen. Genet. 2:93-98; and Yang Endogenous promoters of genes related to herbicide toler (1996) Proc. Natl. Acad. Sci. 93:14972-14977. See also, 25 ance and related phenotypes are also useful for driving Chen et al. (1996) Plant J. 10:955-966: Zhang et al. (1994) expression of ACC synthase RNA configuration nucleic Proc. Natl. Acad. Sci. 91:2507-2511; Warner et al. (1993) acids, e.g., P450 monooxygenases, glutathione-S-trans Plant J. 3:191-201: Siebertz et al. (1989) Plant Cell 1:961 ferases, homoglutathione-S-transferases, glyphosate oxi 968; U.S. Pat. No. 5,750,386 (nematode-inducible): and the dases and 5-enolpyruvylshikimate-2-phosphate synthases. references cited therein. Of particular interest is the inducible 30 For example, a plant promoter attached to a polynucleotide of promoter for the maize PRms gene, whose expression is the invention can be useful when one wants to turn on expres induced by the pathogen Fusarium moniliforme (see, for sion in the presence of a particular condition, e.g., drought example, Cordero et al. (1992) Physiol. Mol. Plant. Path. conditions, short growing conditions, density, etc. 41:189-200). Additionally, as pathogens find entry into plants through 35 Tissue specific promoters can also be used to direct expres wounds or insect damage, a wound-inducible promoter may sion of polynucleotides of the invention, including the ACC be used in the constructions of the invention. Such wound synthase RNA configuration nucleic acids, such that a poly inducible promoters include potato proteinase inhibitor (pin nucleotide of the invention is expressed only in certain tissues or stages of development, e.g., leaves, anthers, roots, shoots, II) gene (Ryan (1990) Ann. Rev. Phytopath. 28:425-449; etc. Tissue specific expression can be advantageous, for Duan et al. (1996) Nature Biotechnology 14:494-498); wun1 40 example, when expression of the polynucleotide in certain and wun2, U.S. Pat. No. 5,428, 148; win1 and win2 (Stanford tissues is desirable while expression in other tissues is unde et al. (1989) Mol. Gen. Genet. 215:200-208): systemin sirable. Tissue specific promoters are transcriptional control (McGurl et al. (1992) Science 225: 1570-1573); WIP1 (Ro elements that are only active in particular cells or tissues at hmeier et al. (1993) Plant Mol. Biol. 22:783-792: Eckelkamp specific times during plant development, Such as in vegetative et al. (1993) FEBS Letters 323:73-76); MPI gene (Corderok 45 et al. (1994) Plant J. 6(2):141-150); and the like. tissues or reproductive tissues. Examples of tissue-specific Alternatively, plant promoters which are inducible upon promoters under developmental control include promoters exposure to plant hormones, such as auxins, are used to that initiate transcription only (or primarily only) in certain express the polynucleotides of the invention. For example, the tissues, such as Vegetative tissues, e.g., roots or leaves, or invention can use the auxin-response elements E1 promoter 50 reproductive tissues, such as fruit, ovules, seeds, pollen, pis Subsequence (AuXREs) from the Soybean (Glycine max L.) tols, flowers, or any embryonic tissue. Reproductive tissue (Liu (1997) Plant Physiol. 115:397–407); the auxin-respon specific promoters may be, e.g., anther-specific, ovule-spe sive Arabidopsis GST6 promoter (also responsive to salicylic cific, embryo-specific, endosperm-specific, integument acid and hydrogen peroxide) (Chen (1996) Plant J. 10: 955 specific, seed and seed coat-specific, pollen-specific, petal 966); the auxin-inducible parC promoter from tobacco; a 55 specific, sepal-specific, or some combination thereof. plant biotin response element (Streit (1997) Mol. Plant. It will be understood that numerous promoters not men Microbe Interact. 10:933-937); and the promoter responsive tioned are suitable for use in this aspect of the invention, are to the stress hormone abscisic acid (Sheen (1996) Science well known and readily may be employed by those of skill in 274: 1900-1902). the manner illustrated by the discussion and the examples Plant promoters which are inducible upon exposure to 60 herein. For example, this invention contemplates using, when chemical reagents which can be applied to the plant, such as appropriate, the native ACC synthase promoters to drive the herbicides or antibiotics, are also used to express the poly expression of the enzyme (or of ACC synthase polynucleotide nucleotides of the invention. Depending upon the objective, sequences or Subsequences) in a recombinant environment. the promoter can be a chemical-inducible promoter, where In preparing expression vectors of the invention, sequences application of the chemical induces gene expression, or a 65 other than those associated with the endogenous ACC Syn chemical-repressible promoter, where application of the thase gene, mRNA or polypeptide sequence, or Subsequence chemical represses gene expression. For example, the maize thereof, can optionally be used. For example, other regulatory US 7,838,730 B2 35 36 elements such as introns, leader sequences, polyadenylation tance to chloramphenicol, Herrera Estrella et al. (1983) regions, signal/localization peptides, etc. can also be EMBO J. 2:987-992; methotrexate, Herrera Estrella et al. included. (1983) Nature 303:209-213: Meijer et al. (1991) Plant Mol. The vector comprising a polynucleotide of the invention Biol. 16:807-820; hygromycin, Waldron et al. (1985) Plant can also include a marker gene which confers a selectable 5 Mol. Biol. 5:103-108; Zhijian et al. (1995) Plant Science phenotype on plant cells. For example, the marker can encode 108:219–227; streptomycin, Jones et al. (1987) Mol. Gen. biocide tolerance, particularly antibiotic tolerance, such as Genet. 210:86-91; spectinomycin, Bretagne-Sagnard et al. tolerance to kanamycin, G418, bleomycin, hygromycin, or (1996) Transgenic Res. 5:131-137; bleomycin, Hille et al. herbicide tolerance, such as tolerance to chlorosulfuron, or (1990) Plant Mol. Biol. 7:171-176; sulfonamide, Guerineau phosphinothricin. Reporter genes which are used to monitor 10 et al. (1990) Plant Mol. Biol. 15:127-136; bromoxynil, gene expression and protein localization via visualizable Stalker et al. (1988) Science 242:419–423; glyphosate, Shaw reaction products (e.g., beta-glucuronidase, beta-galactosi et al. (1986) Science 233:478-481; phosphinothricin, dase, and chloramphenicol acetyltransferase) or by direct DeBlocket al. (1987) EMBO.J. 6:2513-2518. visualization of the gene product itself (e.g., green fluorescent Another class of useful marker genes for plant transforma protein, GFP. Sheen et al. (1995) The Plant Journal 8:777) 15 tion with the DNA sequence requires screening of presump can be used for, e.g., monitoring transient gene expression in tively transformed plant cells rather than direct genetic selec plant cells. tion of transformed cells for resistance to a toxic Substance Vectors for propagation and expression generally will Such as an antibiotic. These genes are particularly useful to include selectable markers. Such markers also may be Suit quantitate or visualize the spatial pattern of expression of the able for amplification or the vectors may contain additional DNA sequence in specific tissues and are frequently referred markers for this purpose. In this regard, the expression vectors to as reporter genes because they can be fused to a gene or preferably contain one or more selectable marker genes to gene regulatory sequence for the investigation of gene expres provide a phenotypic trait for selection of transformed host Sion. Commonly used genes for Screening presumptively cells. Preferred markers include dihydrofolate reductase or transformed cells include B-glucuronidase (GUS), B-galac neomycin resistance for eukaryotic cell culture, and tetracy 25 tosidase, luciferase, and chloramphenicol acetyltransferase cline or amplicillin resistance genes for culturing E. coli and (Jefferson, Plant Mol. Biol. Rep. 5:387 (1987); Teeri et al., other prokaryotes. Kanamycin and herbicide resistance genes EMBO.J. 8:343 (1989): Koncz et al., Proc. Nat'l Acad. Sci. (PAT and BAR) are generally useful in plant systems. (USA) 84:131 (1987); De Block et al., EMBO J. 3:1681 Selectable marker genes, in physical proximity to the intro (1984)). Examples of other suitable reporter genes known in duced DNA segment, are used to allow transformed cells to be 30 the art can be found in, for example: Jefferson et al. (1991) in recovered by either positive genetic selection or screening. Plant Molecular Biology Manual, ed. Gelvin et al. (Kluwer The selectable marker genes also allow for maintaining selec Academic Publishers), pp. 1-33; DeWet et al. (1987) Mol. tion pressure on a transgenic plant population, to ensure that Cell. Biol. 7:725-737; Goffet al. (1990) EMBO J. 9:2517 the introduced DNA segment, and its controlling promoters 2522; Kainet al. (1995) BioTechniques 19:650-655; and Chiu and enhancers, are retained by the transgenic plant. 35 etal. (1996) Current Biology 6:325-330. Another approach to Many of the commonly used positive selectable marker the identification of relatively rare transformation events has genes for plant transformation have been isolated from bac been use of a gene that encodes a dominant constitutive regu teria and code for enzymes that metabolically detoxify a lator of the Zea mays anthocyanin pigmentation pathway selective chemical agent which may be an antibiotic or a (Ludwig et al., Science 247:449 (1990)). herbicide. Other positive selection marker genes encode an 40 The appropriate DNA sequence may be inserted into the altered target which is insensitive to the inhibitor. An example vector by any of a variety of well-known and routine tech of a selection marker gene for plant transformation is the BAR niques. In general, a DNA sequence for expression isjoined to or PAT gene, which is used with the selecting agent bialaphos an expression vector by cleaving the DNA sequence and the (Spenceret al., J. Theor. Appl’d Genetics 79:625-631 (1990)). expression vector with one or more restriction endonucleases Another useful selection marker gene is the neomycin phos 45 and then joining the restriction fragments together using T4 photransferase II (nptII) gene, isolated from Tn5, which con DNA ligase. The sequence may be inserted in a forward or fers resistance to kanamycin when placed under the control of reverse orientation. Procedures for restriction and ligation plant regulatory signals (Fraley et al., Proc. Nat'l Acad. Sci. that can be used to this end are well known and routine to (USA) 80:4803 (1983)). The hygromycin phosphotransferase those of skill. Suitable procedures in this regard, and for gene, which confers resistance to the antibiotic hygromycin, 50 constructing expression vectors using alternative techniques, is a further example of a useful selectable marker (Vanden which also are well known and routine to those of skill, are set Elzen et al., Plant Mol. Biol. 5:299 (1985)). Additional posi forth in great detail in Sambrook et al., MOLECULAR tive selectable marker genes of bacterial origin that confer CLONING, A LABORATORY MANUAL, 2nd Ed.: Cold resistance to antibiotics include gentamicin acetyl trans Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. ferase, streptomycin phosphotransferase, aminoglycoside-3'- 55 (1989). adenyl transferase and the bleomycin resistance determinant A polynucleotide of the invention, optionally encoding the (Hayford et al., Plant Physiol. 86:1216 (1988); Jones et al., heterologous structural sequence of a polypeptide of the Mol. Gen. Genet. 210:86 (1987); Svab et al., Plant Mol. Biol. invention, generally will be inserted into the vector using 14:197 (1990); Hille et al., Plant Mol. Biol. 7:171 (1986)). standard techniques so that it is operably linked to the pro Other positive selectable marker genes for plant transfor 60 moter for expression. (Operably linked, as used herein, mation are not of bacterial origin. These genes include mouse includes reference to a functional linkage between a promoter dihydrofolate reductase, plant 5-enolpyruvylshikimate-3- and a second sequence, wherein the promoter sequence ini phosphate synthase and plant acetolactate synthase (Eich tiates and mediates transcription of the DNA corresponding holtz et al., Somatic Cell Mol. Genet. 13:67 (1987); Shah et to the second sequence. Generally, operably linked means al., Science 233:478 (1986); Charest et al., Plant Cell Rep. 65 that the nucleic acid sequences being linked are contiguous 8:643 (1990)). Other examples of suitable selectable marker and, where necessary to join two protein coding regions, genes include, but are not limited to: genes encoding resis contiguous and in the same reading frame.) When the poly US 7,838,730 B2 37 38 nucleotide is intended for expression of a polypeptide, the The transformation vector, comprising the promoter of the polynucleotide will be positioned so that the transcription present invention operably linked to an isolated nucleotide start site is located appropriately 5' to a ribosome binding site. sequence in an expression cassette, can also contain at least The ribosome-binding site will be 5' to the AUG that initiates one additional nucleotide sequence for a gene to be co-trans translation of the polypeptide to be expressed. Generally, formed into the organism. Alternatively, the additional there will be no other open reading frames that begin with an sequence(s) can be provided on another transformation vec initiation codon, usually AUG, and lie between the ribosome tOr. binding site and the initiation codon. Also, generally, there The vector containing the appropriate DNA sequence as will be a translation stop codon at the end of the polypeptide described elsewhere herein, as well as an appropriate pro and there will be a polyadenylation signal in constructs for 10 moter, and other appropriate control sequences, may be intro use in eukaryotic hosts. Transcription termination signals duced into an appropriate host using a variety of well-known appropriately disposed at the 3' end of the transcribed region techniques suitable to expression therein of a desired RNA may also be included in the polynucleotide construct. and/or polypeptide. The present invention also relates to host For nucleic acid constructs designed to express a polypep cells containing the above-described constructs. The host cell tide, the expression cassettes can additionally contain 5' 15 can be a higher eukaryotic cell. Such as a plant cell, or a lower leader sequences. Such leader sequences can act to enhance eukaryotic cell. Such as a yeast cell, or the host cell can be a translation. Translation leaders are known in the art and prokaryotic cell. Such as a bacterial cell. include: picornavirus leaders, for example: EMCV leader Introduction of the construct into the host cell can be (Encephalomyocarditis 5' noncoding region), Elroy-Stein et effected by calcium phosphate transfection, DEAE-dextran al. (1989) Proc. Nat. Acad. Sci. USA 86:6126-6130; potyvirus mediated transfection, microinjection, cationic lipid-medi leaders, for example, TEV leader (Tobacco Etch Virus), Alli ated transfection, electroporation, transduction, scrape load son et al. (1986); MDMV leader (Maize Dwarf Mosaic ing, ballistic introduction, infection or other methods. Such Virus), Virology 154:9-20; human immunoglobulin heavy methods are described in many standard laboratory manuals, chain binding protein (BiP), Macejak et al. (1991) Nature such as Davis et al., BASIC METHODS IN MOLECULAR 353:90-94: untranslated leader from the coat protein mRNA 25 BIOLOGY, (1986) and Sambrook et al., MOLECULAR of alfalfa mosaic virus (AMV RNA 4), Jobling et al. (1987) CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Nature 325:622-625); tobacco mosaic virus leader (TMV), Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Gallie et al. (1989) Molecular Biology of RNA, pages 237 (1989). 256; and maize chlorotic mottle virus leader (MCMV) Lom Representative examples of appropriate hosts include bac meletal. (1991) Virology 81:382-385. See also Della-Cioppa 30 terial cells, such as streptococci, Staphylococci, E. coli, Strep et al. (1987) Plant Physiology 84:965-968. The cassette can tomyces and Salmonella typhimurium cells; fungal cells. Such also contain sequences that enhance translation and/or as yeast cells and Aspergillus cells; insect cells such as Droso mRNA stability such as introns. The expression cassette also phila S2 and Spodoptera Sf9 cells; animal cells such as CHO, typically includes, at the 3' terminus of the isolated nucleotide COS and Bowes melanoma cells; and plant cells. The plant 35 cells may be derived from a broad range of plant types, sequence of interest, a translational termination region, e.g., particularly monocots such as the species of the Family one functional in plants. Graminiae including Sorghum bicolor and Zea mays, as well In those instances where it is desirable to have the as dicots such as Soybean (Glycine max) and canola (Brassica expressed product of the isolated nucleotide sequence napus, Brassica rapa ssp.). Preferably, plants include maize, directed to a particular organelle, particularly the plastid, 40 Soybean, Sunflower, Safflower, canola, wheat, barley, rye, amyloplast, or to the endoplasmic reticulum, or secreted at alfalfa, rice, oat, lawn grass, and Sorghum.; however, the iso the cell's surface or extracellularly, the expression cassette lated nucleic acid and proteins of the present invention can be can further comprise a coding sequence for a transit peptide. used in species from the genera: Ananas, Antirrhinum, Ara Such transit peptides are well known in the art and include, bidopsis, Arachis, Asparagus, Atropa, Avena, Brassica, Bro but are not limited to: the transit peptide for the acyl carrier 45 mus, Browaalia, Camellia, Capsicum, Ciahorium, Citrus, protein, the small subunit of RUBISCO, plant EPSP synthase, Cocos, Cofea, Cucumis, Cucurbita, Datura, Daucus, Digi and the like. talis, Ficus, Fragaria, Geranium, Glycine, Gossypium, In preparing the expression cassette, the various DNA frag Helianthus, Heterocallis, Hordeum, Hyoscyamus, Ipomoea, ments can be manipulated, so as to provide for the DNA Juglans, Lactuca, Linum, Lolium, Lotus, Lycopersicon, sequences in the proper orientation and, as appropriate, in the 50 Majorana, Mangifera, Manihot, Medicago, Musa, Nemesis, proper reading frame. Toward this end, adapters or linkers can Nicotiana, Olea, Onobrychis, Oryza, Panieum, Pelargonium, be employed to join the DNA fragments or other manipula Pennisetum, Persea, Petunia, Phaseolus, Pisum, Psidium, tions can be involved to provide for convenient restriction Ranunculus, Raphanus, Rosa, Salpiglossis, Secale, Senecio, sites, removal of superfluous DNA, removal of restriction Solanum, Sinapis, Sorghum, Theobroma, Triticum, Trifo sites, or the like. For this purpose, in vitro mutagenesis, 55 lium, Trigonella, Vigna, Vitis, and Zea, among many other primer repair, restriction digests, annealing, and resubstitu examples (e.g., other genera noted herein). tions such as transitions and transversions, can be involved. The promoter regions of the invention may be isolated from As noted herein, the present invention provides vectors any plant, including, but not limited to, maize (corn; Zea capable of expressing genes of interest under the control of mays), canola (Brassica napus, Brassica rapa Ssp.), alfalfa the regulatory elements. In general, the vectors should be 60 (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), functional in plant cells. At times, it may be preferable to have Sorghum (Sorghum bicolor, Sorghum vulgare), Sunflower vectors that are functional in other host cells, e.g., in E. coli (Helianthus annuus), wheat (Triticum aestivum), soybean (e.g., for production of protein for raising antibodies, DNA (Glycine max), tobacco (Nicotiana tabacum), potato sequence analysis, construction of inserts, or obtaining quan (Solanum tuberosum), peanuts (Arachis hypogaea), cotton tities of nucleic acids). Vectors and procedures for cloning 65 (Gossypium hirsutum), Sweet potato (Ipomoea batatus), cas and expression in E. coli are discussed in Sambrook et al. Saya (Manihot esculenta), coffee (Cofea spp.), coconut (Co (Supra). cos nucifera), pineapple (Ananas Comosus), citrus trees (Cit US 7,838,730 B2 39 40 rus spp.), cocoa (Theobroma cacao), tea (Camelia sinensis), a sense orientation or in an antisense orientation or is config banana (Musa spp.), avocado (Persea americana), fig (Ficus ured for RNA silencing or interference. Casica), guava (Psidium guajava), mango (Mangifera In certain situations it may be preferable to silence or indica), olive (Olea europaea), oats, barley, vegetables, orna down-regulate certain genes, such as ACC synthase genes. mentals, and conifers. Preferably, plants include maize, soy Relevant literature describing the application of homology bean, Sunflower, safflower, canola, wheat, barley, rye, alfalfa, dependent gene silencing includes: Jorgensen, Trends Bio rice, oat, lawn grass, and Sorghum. technol. 8 (12):340-344 (1990); Flavell, Proc. Natl. Acad. Hosts for a great variety of expression constructs are well Sci. (USA) 91:3490-3496 (1994); Finnegan et al., Bio/Tech known, and those of skill will be enabled by the present nology 12:883-888 (1994); Neuhuberet al., Mol. Gen. Genet. disclosure readily to select a host for expressing a polypeptide 10 244:230-241 (1994); Flavell et al. (1994) Proc. Natl. Acad. in accordance with this aspect of the present invention. Sci. USA 91:3490-3496; Jorgensen et al. (1996) Plant Mol. The engineered host cells can be cultured in conventional Biol. 31.957-973: Johansen and Carrington (2001) Plant nutrient media, which may be modified as appropriate for, Physiol. 126:930-938: Broinet al. (2002) Plant Cell 14:1417 inter alia, activating promoters, selecting transformants or 1432; Stoutjesdijk et al. (2002) Plant Physiol. 129: 1723 amplifying genes. Culture conditions, such as temperature, 15 1731: Yu et al. (2003) Phytochemistry 63:753-763; and U.S. pH and the like, previously used with the host cell selected for Pat. Nos. 5,034.323, 5,283,184, and 5,942,657. Alternatively, expression generally will be suitable for expression of nucleic another approach to gene silencing can be with the use of acids and/or polypeptides of the present invention, as will be antisense technology (Rothstein et al. in Plant Mol. Cell. Biol. apparent to those of skill in the art. 6:221-246 (1989); Liu et al. (2002) Plant Physiol. 129: 1732 Mature proteins can be expressed in mammalian cells, 1743 and U.S. Pat. Nos. 5,759,829 and 5,942,657. yeast, bacteria, or other cells under the control of appropriate Use of antisense nucleic acids is well known in the art. An promoters. Cell-free translation systems can also be antisense nucleic acid has a region of complementarity to a employed to produce such proteins using RNAs derived from target nucleic acid, e.g., an ACC synthase gene, mRNA, or the DNA constructs of the present invention. cDNA. The antisense nucleic acid can be RNA, DNA, a PNA Following transformation of a suitable host strain and 25 or any other appropriate molecule. A duplex can form growth of the host strain to an appropriate cell density, where between the antisense sequence and its complementary sense the selected promoter is inducible it is induced by appropriate sequence, resulting in inactivation of the gene. The antisense means (e.g., temperature shift or exposure to chemical nucleic acid can inhibit gene expression by forming a duplex inducer) and cells are cultured for an additional period. with an RNA transcribed from the gene, by forming a triplex Cells typically then are harvested by centrifugation, dis 30 with duplex DNA, etc. An antisense nucleic acid can be rupted by physical or chemical means, and the resulting crude produced, e.g., for an ACC synthase gene by a number of extract retained for further purification. Microbial cells well-established techniques (e.g., chemical synthesis of an employed in expression of proteins can be disrupted by any antisense RNA or oligonucleotide (optionally including convenient method, including freeze-thaw cycling, Sonica modified nucleotides and/or linkages that increase resistance tion, mechanical disruption, or use of cell lysing agents. Such 35 to degradation or improve cellular uptake) or in vitro tran methods are well known to those skilled in the art. Scription). Antisense nucleic acids and their use are described, e.g., in U.S. Pat. No. 6.242.258 to Haselton and Methods of Inhibiting Ethylene Production Alexander (Jun. 5, 2001) entitled “Methods for the selective The invention also provides methods for inhibiting ethyl regulation of DNA and RNA transcription and translation by ene production in a plant (and plants produced by Such meth 40 photoactivation”; U.S. Pat. No. 6,500,615: U.S. Pat. No. ods). For example, a method of inhibiting ethylene produc 6,498,035; U.S. Pat. No. 6,395,544: U.S. Pat. No. 5,563,050: tion comprises inactivating one or more ACC synthase genes E. Schuch et al (1991) Symp Soc. Exp Biol 45: 117-127; de in the plant, wherein the one or more ACC synthase genes Lange et al., (1995) Curr Top Microbiol Immunol 197:57-75; encodes one or more ACC synthases. Typically, at least one of Hamilton et al. (1995) Curr Top Microbiol Immunol 197:77 the one or more ACC synthases comprises, e.g., at least about 45 89: Finnegan et al., (1996) Proc Natl AcadSci USA 93:8449 70%, at least about 75%, at least about 80%, at least about 8454; Uhlmann and A. Pepan (1990), Chem. Rev. 90:543; P. 85%, at least about 90%, at least about 95%, at least about D. Cook (1991), Anti-Cancer Drug Design 6:585; J. Good 99%, about 99.5% or more identity to SEQ ID NO:7 child, Bioconjugate Chem. 1 (1990) 165; and, S. L. Beaucage (pACS2), SEQID NO:8 (pACS6), SEQID NO:9 (pAC7) or and R. P. Iyer (1993), Tetrahedron 49:6123; and F. Eckstein, SEQID NO:11 (pCCRA178R). 50 Ed. (1991), Oligonucleotides and Analogues A Practical Antisense, Sense, RNA Silencing or Interference Configu Approach, IRL Press. rations Catalytic RNA molecules or ribozymes can also be used to The one or more ACC synthase gene can be inactivated by inhibit expression of ACC synthase genes. It is possible to introducing and expressing transgenic sequences, e.g., anti design ribozymes that specifically pair with virtually any sense or sense configurations, or RNA silencing or interfer 55 target RNA and cleave the phosphodiester backbone at a ence configurations, etc, encoding one or more ACC Syn specific location, thereby functionally inactivating the target thases, or a Subsequence thereof, and a promoter, thereby RNA. In carrying out this cleavage, the ribozyme is not itself inactivating the one or more ACC synthase genes compared to altered, and is thus capable of recycling and cleaving other a corresponding control plant (e.g., its non-transgenic parent molecules. The inclusion of ribozyme sequences within anti or a non-transgenic plant of the same species). See also the 60 sense RNAs confers RNA-cleaving activity upon them, section entitled “Polynucleotides of the Invention.” The at thereby increasing the activity of the constructs. least one polynucleotide sequence can be introduced by tech A number of classes of ribozymes have been identified. For niques including, but not limited to, e.g., electroporation, example, one class of ribozymes is derived from a number of micro-projectile bombardment, Agrobacterium-mediated small circular RNAs that are capable of self-cleavage and transfer, or other available methods. See also, the section 65 replication in plants. The RNAs can replicate either alone entitled “Plant Transformation.” herein. In certain aspects of (viroid RNAs) or with a helper virus (satellite RNAs). the invention, the polynucleotide is linked to the promoter in Examples of RNAs include RNAs from avocado Sunblotch US 7,838,730 B2 41 42 viroid and the satellite RNAs from tobacco ringspot virus, Jorgensen et al., (1996), “Chalcone synthase cosuppression luceme transient streak virus, Velvet tobacco mottle virus, phenotypes in petunia flowers. Comparison of sense vs. anti Solanum modiflorum mottle virus and Subterranean clover sense constructs and single-copy vs. complex T-DNA mottle virus. The design and use of target RNA-specific sequences' Plant Mol. Biol., 31.957-973; Hannon G. J. ribozymes has been described. See, e.g., Haseloffetal. (1988) 5 (2002) “RNA interference' Nature, July 11:418(6894):244 Nature, 334:585-591. 51; Ueda R. (2001) “RNAi a new technology in the post Another method to inactivate an ACC synthase gene by genomic sequencing era 'J. Neurogenet., 15(3–4): 193-204; inhibiting expression is by sense Suppression. Introduction of Ulu et al (2002) “RNA interference: advances and ques expression cassettes in which a nucleic acid is configured in tions' Philos Trans R Soc Lond B Biol Sci. January 29; the sense orientation with respect to the promoter has been 10 357 (1417):65-70; Waterhouse et al., (1998) Proc Natl Acad shown to be an effective means by which to block the tran Sci USA95:133959-13964; Schmid etal (2002) “Combina Scription of a desired target gene. See, e.g., Napoli et al. torial RNAi a method for evaluating the fitnctions of gene (1990), The Plant Cell 2:279-289, and U.S. Pat. Nos. 5,034, families in Drosophila' Trends Neurosci. February, 25(2): 323, 5,231,020, and 5,283,184. 71-4; Zeng et al. (2003) “MicroRNAs and small interfering Isolated or recombinant plants which include one or more 15 RNAs can inhibit mRNA expression by similar mechanisms' inactivated ACC synthase gene can also be produced by using Proc. Natl. Acad. Sci. USA 100:9779-9784: Doench et al. RNA silencing or interference (RNAi), which can also be (2003) siRNAs can fitnction as miRNAs ' Genes & Dev. termed post-transcriptional gene silencing (PTGS) or coSup 17:438-442; Bartel and Bartel (2003) “MicroRNAs. At the pression. In the context of this invention, “RNA silencing root of plant development? Plant Physiology 132:709–717; (also called RNAi or RNA-mediated interference) refers to 20 Schwarz and Zamore (2002) “Why do miRNAs live in the any mechanism through which the presence of a single miRNP?” Genes & Dev. 16:1025-1031: Tang et al. (2003) “A stranded or, typically, a double-stranded RNA in a cell results biochemical frameworkfor RNA silencing in plants' Genes & in inhibition of expression of a target gene comprising a Dev. 17:49-63; Meister et al. (2004) “Sequence-specific inhi sequence identical or nearly identical to that of the RNA, bition of microRNA-and siRNA-induced RNA silencing including, but not limited to, RNA interference, repression of 25 RNA 10:544-550; Nelson et al. (2003) “The microRNA translation of a target mRNA transcribed from the target gene world. Small is mighty' Trends Biochem. Sci. 28:534-540: without alteration of the mRNA's stability, and transcrip Dykxhoornet al. (2003) “Killing the messenger. Short RNAs tional silencing (e.g., histone acetylation and heterochroma that silence gene expression” Nature Reviews Molec. and tin formation leading to inhibition of transcription of the Cell Biol. 4:457-467; McManus and Sharp (2002) “Gene target mRNA). In “RNA interference, the presence of the 30 silencing in mammals by small interfering RNAs Nature single-stranded or double-stranded RNA in the cell leads to Reviews Genetics 3:737-747; Hutvagner and Zamore (2002) endonucleolytic cleavage and then degradation of the target “RNAi Nature abhors a double strand Curr Opin Genet & mRNA. Dev 200:225-232; and Agami (2002) “RNAi and related In one embodiment, a transgene (e.g., a sequence and/or mechanisms and their potential use for therapy” Curr Opin Subsequence of an ACC synthase gene or coding sequence) is 35 Chem Biol 6:829-834. introduced into a plant cell to inactivate one or more ACC The ACC synthase polynucleotide sequence(s) or Subse synthase genes by RNA silencing or interference (RNAi). For quence(s) expressed to induce RNAi can be expressed, e.g., example, a sequence or Subsequence includes a small Subse under control of a constitutive promoter, an inducible pro quence, e.g., about 21-25 bases in length (with, e.g., at least moter, or a tissue specific promoter. Expression from a tissue 80%, at least 90%, or about 100% identity to one or more of 40 specific promoter can be advantageous in certain embodi the ACC synthase gene Subsequences), a larger Subsequence, ments. For example, expression from a leaf-specific promoter e.g., about 25-100 or about 100-2000 (or about 200-1500, can inactivate one or more ACC synthase genes in the leaf. about 250-1000, etc.) bases in length (with at least one region producing a staygreen phenotype, without inactivating ACC of about 21-25 bases of at least 80%, at least 90%, or 100% synthase genes in the root (which can decrease flood toler identity to one or more ACC synthase gene Subsequences), 45 ance). Similarly, expression from an anther-specific promoter and/or the entire coding sequence or gene. In one embodi can inactivate one or more ACC synthase genes in the anther, ment, a transgene includes a region in the sequence or Subse producing a male sterility phenotype, without inactivating quence that is about 21-25 bases in length with at least 80%, ACC synthase genes in the remainder of the plant. Such at least 90%, or about 100% identity to the ACC synthase approaches are optionally combined, e.g., to inactivate one or gene or coding sequence. 50 more ACC synthase genes in both leaves and anthers. Use of RNAi for inhibiting gene expression in a number of Transposons cell types (including, e.g., plant cells) and organisms, e.g., by The one or more ACC synthase genes can also be inacti expression of a hairpin (stem-loop) RNA or of the two strands vated by, e.g., transposon based gene inactivation. In one of an interfering RNA, for example, is well described in the embodiment, the inactivating step comprises producing one literature, as are methods for determining appropriate inter 55 or more mutations in an ACC synthase gene sequence, where fering RNA(s) to target a desired gene, e.g., an ACC synthase the one or more mutations in the ACC synthase gene sequence gene, and for generating such interfering RNAS. For example, comprise one or more transposon insertions, thereby inacti RNA interference is described e.g., in US patent application Vating the one or more ACC synthase gene compared to a publications 20020173478, 20020162126, and 20020182223 corresponding control plant. For example, the one or more and in Cogoni and Macino (2000) “Post-transcriptional gene 60 mutations comprise a homozygous disruption in the one or silencing across kingdoms' Genes Dev., 10:638-643; Guru T. more ACC synthase gene or the one or more mutations com (2000), “A silence that speaks volumes' Nature 404: 804 prise a heterozygous disruption in the one or more ACC 808; Hammond et al., (2001), “Post-transcriptional Gene synthase gene or a combination of both homozygous disrup Silencing by Double-stranded RNA' Nature Rev. Gen. 2: tions and heterozygous disruptions if more than one ACC 110-119; Napoli et al., (1990) “Introduction of a chalcone 65 synthase gene is disrupted. synthase gene into Petunia results in reversible co-suppres Transposons were first identified in maize by Barbara Sion of homologous genes in trans.' Plant Cell 2:279-289; McClintock in the late 1940s. The Mutator family of trans US 7,838,730 B2 43 44 posable elements, e.g., Robertson's Mutator (Mu) transpos For example, DNA from M2 plants is pooled and mutations able elements, are typically used in plant, e.g., maize, gene in an ACC synthase gene are detected by detection of hetero mutagenesis, because they are present in high copy number duplex formation. Typically, DNA is prepared from each M2 (10-100) and insert preferentially within and around genes. plant and pooled. The desired ACC synthase gene is amplified Transposable elements can be categorized into two broad by PCR. The pooled sample is then denatured and annealed to classes based on their mode of transposition. These are des allow formation of heteroduplexes. If a mutation is present in ignated Class I and Class II; both have applications as one of the plants; the PCR products will be of two types: mutagens and as delivery vectors. Class I transposable ele wild-type and mutant. Pools that include the heteroduplexes ments transpose by an RNA intermediate and use reverse are identified by separating the PCR reaction, e.g., by Dena transcriptases, i.e., they are retroelements. There are at least 10 turing High Performance Liquid Chromatography (DPH three types of Class I transposable elements, e.g., retrotrans PLC). DPHPLC detects mismatches in heteroduplexes cre posons, retroposons, SINE-like elements. ated by melting and annealing of heteroallelic DNA. Retrotransposons typically contain LTRS, and genes Chromatography is performed while heating the DNA. Het encoding viral coat proteins (gag) and reverse transcriptase, eroduplexes have lower thermal stability and form melting RnaseH, integrase and polymerase (pol) genes. Numerous 15 bubbles resulting in faster movement in the chromatography retrotransposons have been described in plant species. Such column. When heteroduplexes are present in addition to the retrotransposons mobilize and translocate via a RNA inter expected homoduplexes, a double peak is seen. As a result, mediate in a reaction catalyzed by reverse transcriptase and the pools that carry the mutation in an ACC synthase gene are RNase H encoded by the transposon. Examples fall into the identified. Individual DNA from plants that make up the Ty 1-copia and Ty3-gypsy groups as well as into the SINE-like selected pooled population can then be identified and and LINE-like classifications. A more detailed discussion can sequenced. Optionally, the plant possessing a desired muta be found in Kumar and Bennetzen (1999) Plant Retrotrans tion in an ACC synthase can be crossed with other plants to posons in Annual Review of Genetics 33:479. In addition, remove background mutations. DNA transposable elements such as Ac, Tam1 and En/Spm Other mutagenic methods can also be employed to intro are also found in a wide variety of plant species, and can be 25 duce mutations in an ACC synthase gene. Methods for intro utilized in the invention. ducing genetic mutations into plant genes and selecting plants Transposons (and IS elements) are common tools for intro with desired traits are well known. For instance, seeds or ducing mutations in plant cells. These mobile genetic ele other plant material can be treated with a mutagenic chemical ments are delivered to cells, e.g., through a sexual cross, Substance, according to standard techniques. Such chemical transposition is selected for and the resulting insertion 30 substances include, but are not limited to the following: mutants are screened, e.g., for a phenotype of interest. Plants diethyl sulfate, ethylene imine, and N-nitroso-N-ethylurea. comprising disrupted ACC synthase genes can be introduced Alternatively, ionizing radiation from sources such as X-rays into other plants by crossing the isolated or recombinant or gamma rays can be used. plants with a non-disrupted plant, e.g., by a sexual cross. Any Other detection methods for detecting mutations in an ACC of a number of standard breeding techniques can be used, 35 synthase gene can be employed, e.g., capillary electrophore depending upon the species to be crossed. The location of a sis (e.g., constant denaturant capillary electrophoresis and TN within a genome of an isolated or recombinant plant can single-stranded conformational polymorphism). In another be determined by known methods, e.g., sequencing of flank example, heteroduplexes can be detected by using mismatch ing regions as described herein. For example, a PCR reaction repair enzymology (e.g., CEL I endonuclease from celery). from the plant can be used to amplify the sequence, which can 40 CEL I recognizes a mismatch and cleaves exactly at the 3' side then be diagnostically sequenced to confirm its origin. of the mismatch. The precise base position of the mismatch Optionally, the insertion mutants are screened for a desired can be determined by cutting with the mismatch repair phenotype, such as the inhibition of expression or activity of enzyme followed by, e.g., denaturing gel electrophoresis. ACC synthase, inhibition or reduced production of ethylene, See, e.g., Oleykowski et al., (1998) “Mutation detection using staygreen potential, etc. compared to a control plant. 45 a novel plant endonuclease ' Nucleic Acid Res. 26:4597 4602; and, Colbert et al., (2001) “High-Throughput Screen Tilling ing for Induced Point Mutations' Plant Physiology 126:480 TILLING can also be used to inactivate one or more ACC 484. synthase gene. TILLING is Targeting Induced Local Lesions The plant containing the mutated ACC synthase gene can IN Genomics. See, e.g., McCallum et al., (2000), “Targeting 50 be crossed with other plants to introduce the mutation into Induced Local Lesions IN Genomics (TILLING) for Plant another plant. This can be done using standard breeding tech Functional Genomics' Plant Physiology 123:439-442; niques. McCallum et al., (2000) “Targeted screening for induced Homologous Recombination mutations' Nature Biotechnology 18:455-457; and, Colbert Homologous recombination can also be used to inactivate et al., (2001) “High-Throughput Screening for Induced Point 55 one or more ACC synthase genes. Homologous recombina Mutations' Plant Physiology 126:480–484. tion has been demonstrated in plants. See, e.g., Puchta et al. TILLING combines high density point mutations with (1994), Experientia 50: 277-284; Swoboda et al. (1994), rapid sensitive detection of the mutations. Typically, ethyl EMBO.J. 13: 484-489; Offring a et al. (1993), Proc. Natl. methanesulfonate (EMS) is used to mutagenize plant seed. Acad. Sci. USA 90: 7346-7350; Kempin et al. (1997) Nature EMS alkylates guanine, which typically leads to mispairing. 60 389:802-803; and, Terada et al., (2002) “Efficient gene tar For example, seeds are soaked in an about 10-20 mM solution geting by homologous recombination in rice' Nature Bio of EMS for about 10 to 20 hours; the seeds are washed and technology, 20(10): 1030-1034. then sown. The plants of this generation are known as M1. M1 Homologous recombination can be used to induce targeted plants are then self-fertilized. Mutations that are present in gene modifications by specifically targeting an ACC synthase cells that form the reproductive tissues are inherited by the 65 gene in vivo. Mutations in selected portions of an ACC Syn next generation (M2). Typically, M2 plants are screened for thase gene sequence (including 5' upstream, 3' downstream, mutation in the desired gene and/or for specific phenotypes. and intragenic regions) such as those provided herein are US 7,838,730 B2 45 46 made in vitro and introduced into the desired plant using is selected. In another embodiment, the mutant form includes standard techniques. The mutated gene will interact with the a Subsequence of the at least one desired ACC synthase gene target ACC synthase wild-type gene in Such a way that in an antisense, sense or RNA silencing or interference con homologous recombination and targeted replacement of the figuration. wild-type gene will occur in transgenic plants, resulting in Expression of the mutant form of the ACC synthase gene or Suppression of ACC synthase activity. result of expression of the mutant form can be determined in a number of ways. For example, detection of expression prod Methods for Modulating Staygreen Potential in a Plant ucts is performed either qualitatively (presence or absence of Methods for modulating staygreen potential in plants are one or more product of interest) or quantitatively (by moni also features of the invention. The ability to introduce differ 10 toring the level of expression of one or more product of ent degrees of staygreen potential into plants offers a flexible interest). In one embodiment, the expression product is an and simple approach to introduce this trait in a purpose RNA expression product. The invention optionally includes specific manner: for example, introduction of a strong monitoring an expression level of a nucleic acid or polypep staygreen trait for improved grain-filling or for Silage in areas tide as noted herein for detection of ACC synthase in a plant with longer or dryer growing seasons versus the introduction 15 or in a population of plants. Monitoring levels of ethylene or of a moderate staygreen trait for silage in areas with shorter ACC can also be used for detection of inhibition of expression growing seasons. In addition, the staygreen potential of a or activity of a mutant form of the ACC synthase gene. plant of the invention can include, e.g., (a) a reduction in the In addition to increasing tolerance to drought stress in production of at least one ACC synthase specific mRNA; (b) plants of the invention compared to a control plant, another a reduction in the production of an ACC synthase; (c) a important aspect of the invention is that higher density plant reduction in the production of ethylene; (d) a delay in leaf ing of plants of the invention can be possible, leading to senescence; (e) an increase of drought resistance, (f) an increased yield per acre of corn. Most of the increase yield per increased time in maintaining photosynthetic activity; (g) an acre of corn over the last century has come from increasing increased transpiration: (h) an increased stomatal conduc tolerance to crowding, which is a stress in, e.g., maize. Meth tance: (i) an increased CO assimilation; () an increased 25 ods for modulating stress, e.g., increasing tolerance for maintenance of CO assimilation; or (k) any combination of crowding, in a plant are also a feature of the invention. For (a)-(); compared to a corresponding control plant, and the example, a method of the invention can include: a) selecting like. at least one ACC synthase gene to mutate, thereby providing For example, a method of the invention can include: a) at least one desired ACC synthase gene; b) introducing a selecting at least one ACC synthase gene to mutate, thereby 30 mutant form of the at least one desired ACC synthase gene providing at least one desired ACC synthase gene; b) intro into the plant; and, c) expressing the mutant form, thereby ducing a mutant form of theat least one desired ACC synthase modulating stress in the plant. Plants produced by such meth gene into the plant; and, c) expressing the mutant form, ods are also a feature of the invention. When the ethylene thereby modulating staygreen potential in the plant. Plants production is reduced in a plant by a mutant form of a desired produced by such methods are also a feature of the invention. 35 ACC synthase gene, the plant does not perceive crowding. The degree of Staygreen potential introduced into a plant Thus, plants of the invention can be planted at higher density can be determined by a number of factors, e.g., which ACC than currently practiced by farmers. synthase gene is selected, whether the mutant gene member is In another aspect, inactivation of one or more ACC syn present in a heterozygous or homozygous state, or by the thase genes as described herein can influence response to number of members of this family which are inactivated, or 40 disease or pathogen attack. by a combination of two or more such factors. In one embodi ment, selecting the at least one ACC synthase gene comprises Methods for Modulating Sterility in a Plant determining a degree (e.g., weak (e.g., ACS2), moderate or Methods for modulating sterility, e.g., female or male ste strong (e.g., ACS6)) of Staygreen potential desired. For rility, in plants are also features of the invention. The ability to example, ACS2 lines show a weak staygreen phenotype, with 45 introduce female or male sterility into plants permits rapid a delay in senescence of about 1 week. The ACS6 lines show production of female or male sterile lines, e.g., for use in a strong staygreen phenotype (e.g., leafsenescence is delayed commercial breeding programs, e.g., for production of hybrid about 2-3 weeks or more). The ACS7 lines can also show a seed, where cross-pollination is desired. strong Staygreen phenotype (e.g., leaf senescence is delayed ACC synthase knockout plants, particularly ACS6 knock about 2-3 weeks or more). For example, the ACC synthase 50 outs and ACS2/ACS6 double knockouts, have been observed gene is selected for encoding a specific ACC synthase. Such to shed less pollen than wild-type plants, suggesting disrup as, SEQID NO:7 (pACS2), SEQID NO:8 (pACS6), SEQID tion of ethylene production as a novel means of modulating NO:9 (pAC7), or SEQ ID NO:11 (pCCRA178R). In one plant sterility. embodiment, two or more ACC synthase genes are disrupted For example, a method of the invention can include: a) (e.g., ACS2 and ACS6), e.g., to produce a strong staygreen 55 selecting at least one ACC synthase gene to mutate, thereby phenotype. In other embodiments, three or more ACC syn providing at least one desired ACC synthase gene; b) intro thase genes are disrupted. ducing a mutant form of the at least one desired ACC synthase Once the desired ACC synthase gene is selected, a mutant gene into the plant; and, c) expressing the mutant form, form of the ACC synthase gene is introduced into a plant. In thereby modulating sterility in the plant. Plants produced by certain embodiments, the mutant form is introduced by Agro 60 Such methods are also a feature of the invention. bacterium-mediated transfer, electroporation, micro-projec Essentially all of the features noted above apply to this tile bombardment, homologous recombination or a sexual embodiment as well, as relevant, for example, with respect to cross. In certain embodiments, the mutant form includes, e.g., the number of ACC synthase genes disrupted, techniques for a heterozygous mutation in the at least one ACC synthase introducing the mutant form of the ACC synthase gene into gene, a homozygous mutation in the at least one ACC Syn 65 the plant, polynucleotide constructs, and the like. thase gene or a combination of homozygous mutation and In one class of embodiments, the at least one ACC synthase heterozygous mutation if more than one ACC synthase gene gene is disrupted by insertion of a transposon, by a point US 7,838,730 B2 47 48 mutation, or by constitutive expression of a transgene com phocellulose chromatography, hydrophobic interaction chro prising an ACC synthase polynucleotide in an antisense, matography, affinity chromatography (e.g., using any of the sense, or RNA silencing or interference configuration. Such tagging systems noted herein), hydroxylapatite chromatog lines can be propagated by exogenously providing ethylene, raphy, and lectin chromatography. Protein refolding steps can for example, by spraying the plants at an appropriate devel be used, as desired, in completing configuration of the mature opmental stage with 2-chloroethylphosphonic acid (CEPA), protein. Finally, high performance liquid chromatography which breaks down in water to produce ethylene. (HPLC) can be employed in the final purification steps. In In another class of embodiments, the at least one ACC addition to the references noted above, a variety of purifica synthase gene is disrupted by expression of a transgene com tion methods are well known in the art, including, e.g., those prising an ACC synthase polynucleotide in an antisense, 10 set forth in Sandana (1997) Bioseparation of Proteins, Aca sense, or RNA silencing or interference configuration under demic Press, Inc.; and Bollaget al. (1996) Protein Methods, the control of an inducible promoter, such that sterility can be 2' Edition Wiley-Liss, NY; Walker (1996) The Protein Pro induced and/or repressed as desired. In yet another class of tocols Handbook Humana Press, NJ. Harris and Angal (1990) embodiments, the at least one ACC synthase gene is disrupted Protein Purification Applications. A Practical Approach IRL by expression of a transgene comprising an ACC synthase 15 Press at Oxford, Oxford, England; Harris and Angal Protein polynucleotide in an antisense, sense, or RNA silencing or Purification Methods: A Practical Approach IRL Press at interference configuration under the control of a tissue-spe Oxford, Oxford, England; Scopes (1993) Protein Purifica cific promoter, e.g., an anther-specific promoter to produce tion: Principles and Practice 3" Edition Springer Verlag, male Sterile plants. Again, if necessary, Such lines can be NY: Janson and Ryden (1998) Protein Purification: Prin propagated by exogenously providing ethylene (e.g., by ciples. High Resolution Methods and Applications, Second spraying with CEPA. Edition Wiley-VCH, NY; and Walker (1998) Protein Proto cols on CD-ROM Humana Press, NJ. Screening/Characterization of Plants or Plant Cells of the Chemicals, e.g., ethylene, ACC, etc., can be recovered and Invention assayed from the cell extracts. For example, internal concen The plants of this invention can be screened and/or char 25 trations of ACC can be assayed by gas chromatography-mass acterized either genotypically, biochemically, phenotypically spectroscopy, in acidic plant extracts as ethylene after decom or a combination of two or more of the these to determine the position in alkaline hypochlorite solution, etc. The concen presence, absence, and/or expression (e.g., amount, modula tration of ethylene can be determined by, e.g., gas chroma tion, such as a decrease or increase compared to a control cell, tography-mass spectroscopy, etc. See, e.g., Nagahama, K., and the like) of a polynucleotide of the invention, the pres 30 Ogawa, T., Fujii, T., Tazaki, M., Tanase, S., Morino, Y. and ence, absence, expression, and/or enzymatic activity of a Fukuda, H. (1991) “Purification and properties of an ethyl polypeptide of the invention, modulation of staygreen poten eneforming enzyme from Pseudomonas Syringae J. Gen. tial, modulation of crowding, and/or modulation of ethylene Microbiol. 137: 2281-2286. For example, ethylene can be production. See, e.g., FIG. 19. measured with a gas chromatograph equipped with, e.g., an Genotypic analysis can be performed by any of a number of 35 alumina based column (such as an HP-PLOT A1203 capillary well-known techniques, including PCR amplification of column) and a flame ionization detector. genomic nucleic acid sequences and hybridization of Phenotypic analysis includes, e.g., analyzing changes in genomic nucleic acid sequences or expressed nucleic acid chemical composition (e.g., as described under biochemical sequences with specific labeled probes (e.g., Southern blot analysis), morphology, or physiological properties of the ting, northern blotting, dot or slot blots, etc.). 40 plant. For example, morphological changes can include, but For example, the Trait Utility System for Corn (TUSC), are not limited to, increased Staygreen potential, a delay in developed by Pioneer Hybrid Int., is a powerful PCR-based leafsenescence, an increase in drought resistance, an increase screening strategy to identify Mu transposon insertions in in crowding resistance, etc. Physiological properties can specific genes without the need for an observable phenotype. include, e.g., increased Sustained photosynthesis, increased The system utilizes, e.g., TIR-PCR in which one PCR primer 45 transpiration, increased stomatal conductance, increased is derived from the target gene and the other (Mu-TIR) from CO assimilation, longer maintenance of CO assimilation, the terminal-inverted-repeat (TIR) region of Mu. Using these etc. primers in PCR reactions of DNA pooled from a large popu A variety of assays can be used for monitoring staygreen lation of Mu containing plants, successful amplification is potential. For example, assays include, but are not limited to, identified by Southern hybridization using the target gene as 50 visual inspection, monitoring photosynthesis measurements, the probe. Screening the individuals within a positive pool is and measuring levels of chlorophyll, DNA, RNA and/or pro then performed to identify the candidate line containing tein content of e.g., the leaves. insertion of a Mu element in the target gene. In order to determine whether an insertion event is limited to somatic Plants of the Invention cells or is present in the germ line (and therefore represents a 55 Plant cells of the invention include, but are not limited to, heritable change), progeny from a candidate are optionally meristem cells, Type I, Type II, and Type III callus, immature subjected to the same PCR/Southern hybridization analysis embryos, and gametic cells such as microspores, pollen, used in the original screen. sperm and egg. In certain embodiments, the plant cell of the Biochemical analysis can also be performed for detecting, invention is from a dicot or monocot. A plant regenerated e.g., the presence, the absence or modulation (e.g., decrease 60 from the plant cell(s) of the invention is also a feature of the or increase) of protein production (e.g., by ELISAS, western invention. blots, etc.), the presence and/or amount of ethylene produced, In one embodiment, the plant cell is in a plant, e.g., a hybrid and the like. For example, expressed polypeptides can be plant, comprising a staygreen potential phenotype. In another recovered and purified from isolated or recombinant cell cul embodiment, the plant cell is in a plant comprising a sterility tures by any of a number of methods well known in the art, 65 phenotype, e.g., a male sterility phenotype. Through a series including ammonium sulfate or ethanol precipitation, acid of breeding manipulations, the disrupted ACC synthase gene extraction, anion or cation exchange chromatography, phos can be moved from one plant line to another plant line. For US 7,838,730 B2 49 50 example, the hybrid plant can be produced by sexual cross of least one ACC synthase protein compared to a corresponding a plant comprising a disruption in one or more ACC synthase control plant. In another embodiment, the disruption com genes and a control plant. prises one or more point mutations and inhibits expression or Knockout plant cells are also a feature of the invention. In activity of the at least one ACC synthase protein compared to a first aspect, the invention provides for an isolated or recom 5 a corresponding control. In certain embodiments, the at least binant knockout plant cell comprising at least one disruption one endogenous ACC synthase gene comprises a nucleic acid in at least one endogenous ACC synthase gene (e.g., a nucleic sequence, or complement thereof, comprising, e.g., at least acid sequence, or complement thereof, comprising, e.g., at about 70%, at least about 75%, at least about 80%, at least least about 70%, at least about 75%, at least about 80%, at about 85%, at least about 90%, at least about 95%, at least least about 85%, at least about 90%, at least about 95%, at 10 about 99%, about 99.5% or more, sequence identity to SEQ least about 99%, about 99.5% or more, sequence identity to ID NO:1 (gACS2), SEQID NO:2 (gACS6), or SEQID NO:3 SEQID NO: 1 (gACS2), SEQID NO:2 (gACS6), or SEQID (gACS7), or a complement thereof. In certain embodiments, NO:3 (gACS7)). The disruption inhibits expression or activ the knockout plant is a hybrid plant. ity of at least one ACC synthase protein compared to a cor The invention also features knockout plants that comprise responding control plant cell lacking the disruption. In one 15 a transgenic plant with a staygreen potential phenotype. For embodiment, the at least one endogenous ACC synthase gene example, a transgenic plant of the invention includes a comprises two or more endogenous ACC synthase genes. In staygreen potential phenotype resulting from at least one another embodiment, the at least one endogenous ACC Syn introduced transgene which inhibits ethylene synthesis, thase gene comprises three or more endogenous ACC Syn wherein said at least one introduced transgene comprises a thase genes. In certain embodiments, the at least one disrup nucleic acid sequence encoding at least one ACC synthase or tion results in reduced ethylene production by the knockout Subsequence thereof, which nucleic acid sequence comprises, plant cell as compared to the control plant cell. e.g., at least about 70%, at least about 75%, at least about In one aspect of the invention, the disruption of an ACC 80%, at least about 85%, at least about 90%, at least about synthase gene in a plant cell comprises one or more trans 95%, at least about 99%, about 99.5% or more, sequence posons, wherein the one or more transposons are in the at least 25 identity to SEQID NO:1 (gACS2), SEQID NO:2 (gACS6), one endogenous ACC synthase gene. In another aspect, the SEQ ID NO:3 (gACS7), SEQ ID NO.4 (cACS2), SEQ ID disruption includes one or more point mutations in at least one NO:5 (cACS6), SEQ ID NO:6 (cACS7) or SEQID NO:10 endogenous ACC synthase gene. Optionally, the disruption is (CCRA178R), or a subsequence thereof, or a complement a homozygous disruption in the at least one ACC synthase thereof, and modifies a level of expression or activity of the at gene. Alternatively, the disruption is a heterozygous disrup 30 least one ACC synthase. Typically, the configuration is a tion in the at least one ACC synthase gene. In certain embodi sense, antisense, or RNA silencing or interference configura ments, more than one ACC synthase gene is involved and tion. A transgenic plant of the invention can also include a there is more than one disruption, which can include homozy staygreen potential phenotype resulting from at least one gous disruptions, heterozygous disruptions or a combination introduced transgene which inhibits ethylene synthesis, of homozygous disruptions and heterozygous disruptions. 35 wherein said at least one introduced transgene comprises a See also sections herein entitled “Transposons and TILL nucleic acid sequence encoding Subsequences of at least one ING ACC synthase, which at least one ACC synthase comprises, In another embodiment, the disruption of an ACC synthase e.g., at least about 70%, at least about 75%, at least about gene is produced by inhibiting expression of the ACC Syn 80%, at least about 85%, at least about 90%, at least about thase gene. For example, a knockout plant cell is produced by 40 95%, at least about 99%, about 99.5% or more, sequence introducing at least one polynucleotide sequence comprising identity to SEQID NO:7 (pACS2), SEQID NO:8 (pACS6), an ACC synthase nucleic acid sequence, or Subsequence SEQID NO.:9 (pACS7), or SEQID NO:11(pCCRA178R), thereof, into a plant cell. Such that the at least one polynucle ora conservative variation thereof, and is in an RNA silencing otide sequence is linked to a promoter in a sense or antisense or interference configuration, and modifies a level of expres orientation. The polynucleotide sequence comprises, e.g., at 45 sion or activity of the at least one ACC synthase. In one least about 70%, at least about 75%, at least about 80%, at aspect, the transgene optionally comprises a tissue-specific least about 85%, at least about 90%, at least about 95%, at promoter or an inducible promoter (e.g., a leaf-specific pro least about 99%, about 99.5% or more sequence identity to moter, a drought-inducible promoter, or the like). SEQ ID NO:1 (gACS2), SEQ ID NO:2 (gACS6), SEQ ID The invention also features knockout plants that have a NO:3 (gACS7), SEQ ID NO.4 (cACS2), SEQ ID NO:5 50 sterility phenotype, e.g., a male or female sterility phenotype. (cACS6), SEQ ID NO:6 (cACS7), or SEQ ID NO.: 10 Thus, one class of embodiments provides a knockout plant (CCRA178R), or a subsequence thereof, or a complement comprising a male sterility phenotype which results from at thereof. For example, the knockout plant cell can be produced least one disruption in at least one endogenous ACC synthase by introducing at least one polynucleotide sequence compris gene. The disruption inhibits expression or activity of at least ing one or more Subsequences of an ACC synthase nucleic 55 one ACC synthase protein compared to a corresponding con acid sequence configured for RNA silencing or interference. trol plant. For example, ACS2. ACS6, and ACS7 can be The polynucleotide optionally comprises a vector, expression disrupted, singly or in any combination (e.g., ACS6, or ACS2 cassette, or the like. In another aspect, the knockout plant cell and ACS6). Typically, the at least one disruption results in is produced by homologous recombination. See also sections reduced ethylene production by the knockout plant as com herein entitled “Antisense, Sense, RNA Silencing or Interfer 60 pared to the control plant. ence Configurations' and “Homologous Recombination.” In one embodiment, the at least one disruption comprises Knockout plants that comprise a staygreen potential phe one or more transposons in the at least one endogenous ACC notype are a feature of the invention. Typically, the staygreen synthase gene. In another embodiment, the at least one dis potential phenotype in the knockout plant results from a dis ruption comprises one or more point mutations in the at least ruption in at least one endogenous ACC synthase gene. In one 65 one endogenous ACC synthase gene. In other embodiments, embodiment, the disruption comprises one or more trans the at least one disruption is introduced into the knockout posons, and the disruption inhibits expression or activity of at plant by introducing at least one polynucleotide sequence US 7,838,730 B2 51 52 comprising one or more Subsequences of an ACC synthase Chrysopon, Chusquea, Cinna, Cladoraphis, Coelorachis, nucleic acid sequence configured for RNA silencing or inter Coix, Coleanthus, Colpodium, Coridochloa, Cornucopiae, ference (or, alternatively, in a sense or antisense configura Cortaderia, Corynephorus, Cottea, Critesion, Crypsis, Cte tion). As noted, the polynucleotide sequence is optionally nium, Cutandia, Cylindropyrum, Cynibopogon, Cynodon, under the control of an inducible or tissue-specific (e.g., Cynosurus, Cytrococcuin, Dactylis, Dactylocteniuni, Dan anther-specific) promoter. thonia, Dasyochloa, Dasyprum, Davyella, Dendrocalamus, In one embodiment, the male Sterility phenotype com Deschanipsia, Desmazeria, Deveuxia, Diarina, Diarrhena, prises reduced pollen shedding by the knockout plantas com Dichanitlelium, Dichanthium, Dichelachne, Diectomus, pared to the control plant. For example, the knockout plant Digitaria, Dimeria, Dimorpostachys, Dinebra, Diplachne, can shed at most 50%, 25%, 10%, 5%, or 1% as much pollen 10 as the control plant, or it can shed no detectable pollen. Dissanthelium, Dissochondrus, Distichlis, Drepa The invention also features knockout plants that comprise nostachyum, Dupoa, Dupontia, Echinochloa, Ectosperna, a transgenic plant with a male sterility phenotype. For Ehrharta, Eleusine, Ely hordeum, Elyleymus, Elymordeum, example, a transgenic plant of the invention includes a male Elymus, Elyonurus, Elysitanion, Elytesion, Elytrigia, Ennea sterility phenotype resulting from at least one introduced 15 pogon, Enteropogon, Epicampes, Eragrostis, Eremochloa, transgene which inhibits ethylene synthesis, wherein said at Eremopoa, Eremopyrum, Erianthus, Ericoma, Erichloa, least one introduced transgene comprises a nucleic acid Eriochrysis, Erioneuron, Euchlaena, Euclasta, Eulalia, sequence encoding at least one ACC synthase or Subsequence Eulaliopsis, Eustachys, Fargesia, Festuca, Festulolium, Fin thereof, which nucleic acid sequence comprises, e.g., at least gerhuthia, Fluminia, Garnotia, Gastridium, Gaudinia, about 70%, at least about 75%, at least about 80%, at least Gigantochloa, Glyceria, Graphephorum, Gymnopogon, about 85%, at least about 90%, at least about 95%, at least Gynerium, Hackelochloa, Hainardia, Hakonechloa, Haynal about 99%, about 99.5% or more, sequence identity to SEQ dia, Heleochloa, Helictotrichon, Hemarthria, Hesperochloa, ID NO:1 (gACS2), SEQID NO:2 (gACS6), SEQID NO:3 Hesperostipa, Heteropogon, Hibanobambusa, Hierochloe, (gACS7), SEQID NO.4 (cACS2), SEQ ID NO:5 (cACS6), Hilaria, Holcus, Homalocenchrus, Hordeum (e.g., barley), SEQID NO:6 (cACS7) or SEQID NO:10 (CCRA178R), or 25 Hydrochloa, Hymenachne, Hyparrhenia, Hypogynium, Hys a Subsequence thereof, or a complement thereof, and modifies trix, Ichnanthus, Imperata, Indocalamus, Isachne, Ischae a level of expression or activity of the at least one ACC mum, Ixophorus, Koeleria, Korycarpus, Lagurus, Lamarckia, synthase. Typically, the configuration is a sense, antisense, or Lasiacis, Leersia, Leptochloa, Leptochloopsis, Leptocory RNA silencing or interference configuration. As noted, the phium, Leptoloma, Leptogon, Lepturus, Lerchenfeldia, Leu transgene optionally comprises a tissue-specific promoter 30 (e.g., an anther-specific promoter) or an inducible promoter. copoa, Leynostachys, Leymus, Limnodea, Lithachne, Essentially any plant can be used in the methods and com Lolium, Lophochlaena, Lophochloa, Lophopyrum, Ludolfia, positions of the invention. Such species include, but are not Luziola, Lycurus, Lygeum, Maltea, Manisuris, Megastachya, restricted to members of the families: Poaceae (formerly Melica, Melinis, Mibora, Microchloa, Microlaena, Microste Graminae, including Zea mays (corn), rye, triticale, barley, 35 gium, Milium, Miscanthus, Mnesithea, Molinia, Monan millet, rice, wheat, oats, etc.); Leguminosae (including pea, thochloe, Monerna, Monroa, Muhlenbergia, Nardus, Nas beans, lentil, peanut, yam bean, cowpeas, Velvet beans, soy sella, Nazia, Neeragrostis, Neoschischkinia, Neostapfia, bean, clover, alfalfa, lupine, Vetch, lotus, Sweet clover, wist Nevraudia, Nothoholcus, Olivra, Opizia, Oplismenus, Orcut eria, Sweetpea, etc.); Compositae (the largest family of vas tia, Oryza (e.g., rice), Oryzopsis, Otatea, Oxytenanthera, cular plants, including at least 1,000 genera, including 40 Particularia, Panicum, Pappophorum, Parapholis, Pascopy important commercial crops such as Sunflower) and Rosaciae rum, Paspalidium, Paspalum, Pennisetum (e.g., millet), (including raspberry, apricot, almond, peach, rose, etc.), as Phalaris, Phalaroides, Phanopyrum, Pharus, Phippsia, well as nut plants (including, walnut, pecan, hazelnut, etc.), Phleum, Pholiurus, Phragmites, Phyllostachys, Piptatherum, forest trees (including Pinus, Ouercus, Pseutotsuga, Sequoia, Piptochaetium, Pleioblastus, Pleopogon, Pleuraphis, Pleu Populus, etc.), and other common crop plants (e.g., cotton, 45 ropogon, Poa, Podagrostis, Polypogon, Polytrias, Psathy Sorghum, lawngrasses, tomato, potato, pepper, broccoli, cab rostachys, Pseudelymus, Pseudoroegneria, Pseudosasa, Pti bage, etc.) lagrostis, Puccinelia, Pucciphippsia, Redfieldia, Reimaria, Additional plants, as well as those specified above, include Reimarochloa, Rhaphis, Rhombolytrum, Rhynchelytrum, plants from the genera: A camptoclados, Achnatherum, Ach Roegneria, Rostraria, Rottboelia, Rytilix, Saccharum, Sac nella, Acroceras, Aegilops, Aegopgon, Agroelvinus, Agrohor 50 ciolepis, Sasa, Sasaella, Sasamorpha, Savastana, Schedon deum, Agropogon, Agropyron, Agrositanion, Agrostis, Aira, nardus, Schismus, Schizachine, Schizachyrium, Allolepis, Alloteropsis, Alopecurus, Amblyopyrum, Ammo Schizostachyum, Sclerochloa, Scleropoa, Scleropogon, phila, Ampelodesmos, Amphibromus, Amphicarpum, Scolochloa, Scribneria, Secale (e.g., rye), Semiarundinaria, Amphilophis, Anastrophus, Anatherum, Andropogron, Ane Sesleria, Setaria, Shibataea, Sieglingia, Sinarundinaria, mathele, Aneurolepidium, Anisantha, Anthaenantia, Anthep 55 Sinobambusa, Sinocalamus, Sitanion, Sorghastrum, Sor hora, Antiochloa, Anthoxanthum, Apera, Apluda, Archita ghum, Spartina, Sphenopholis, Spodiopogon, Sporobolus, grostis, Arctophila, Argillochloa, Aristida, Arrhenatherum, Stapfia, Steinchisma, Stenotaphrum, Stipa, Stipagrostis, Sti Arthraxon, Arthrostylidium, Arundinaria, Arundinella, pOryzopsis, Swallenia, Syntherisma, Taeniatherum, Terrellia, Arundo, Aspiris, Atheropogon, Avena (e.g., oats), Avenella, Terrellymus, Thamnocalamus, Themeda, Thinopyrum, Thua Avenochloa, Avenula, Axonopus, Bambusa, Beckmannia, 60 rea, Thysanolaena, Torresia, Torrevochloa, Trachynia, Trac Blepharidachne, Blepharoneuron, Bothriochloa, Bouteloua, hypogon, Tragus, Trichachne, Trichloris, Tricholaena, Tri Brachiaria, Brachyelytrum, Brachypodium, Briza, Brizopy choneura, Tridens, Triodia, Triplasis, Tripogon, Tripsacum, rum, Bromelica, Bromopsis, Bromus, Buchloe, Bulbilis, Trisetobromus, Trisetum, Triticosecale, Triticum (e.g., Calamagrostis, Calamovilfa, Campulosus, Capriola, Catab wheat), Tuctoria, Uniola, Urachne, Uralepis, Urochloa, rosa, Catapodium, Cathestecum, Cenchropsis, Cenchrus, 65 Vahlodea, Valota, Vaseyochloa, Ventenata, Vetiveria, Vilfa, Centotheca, Ceratochloa, Chaetochloa, Chasmanthium, Vulpia, Willkommia, Yushania, Zea (e.g., corn), Zizania, Ziza Chimonobambusa, Chionochloa, Chloris, Chondrosum, niopsis, and Zoysia. US 7,838,730 B2 53 54 Plant Transformation by Tomes, D. et al., IN: Plant Cell, Tissue and Organ Culture: Nucleic acid sequence constructs of the invention (e.g., Fundamental Methods, Eds. O. L. Gamborg and G. C. Phil isolated nucleic acids, recombinant expression cassettes, etc.) lips, Chapter 8, pgs. 197-213 (1995). (See also Tomes et al., can be introduced into plant cells, either in culture or in the U.S. Pat. Nos. 5,886,244; 6.258,999; 6,570,067; 5,879,918). organs of plants, by a variety of conventional techniques. For Viral vectors which are plant viruses can also be used to example, techniques include, but are not limited to, infection, introduce polynucleotides of the invention into plants. transduction, transfection, transvection and transformation. Viruses are typically useful as vectors for expressing exog The nucleic acid sequence constructs can be introduced alone enous DNA sequences in a transient manner in plant hosts. In or with other polynucleotides. Such other polynucleotides contrast to agrobacterium mediated transformation which can be introduced independently, co-introduced, or intro 10 results in the stable integration of DNA sequences in the plant duced joined to polynucleotides of the invention. genome, viral vectors are generally replicated and expressed Techniques for transforming a wide variety of higher plant without the need for chromosomal integration. Plant virus species are well known and described in the technical and vectors offer a number of advantages, specifically: a) DNA scientific literature. See, e.g., Payne et al. (1992) Plant Cell copies of viral genomes can be readily manipulated in E. coli, and Tissue Culture in Liquid Systems John Wiley & Sons, Inc. 15 and transcribed in vitro, where necessary, to produce infec New York, N.Y. (Payne); Gamborg and Phillips (eds) (1995) tious RNA copies; b) naked DNA, RNA, or virus particles can Plant Cell, Tissue and Organ Culture, Fundamental Methods be easily introduced into mechanically wounded leaves of Springer Lab Manual, Springer-Verlag (Berlin Heidelberg intact plants; c) high copy numbers of viral genomes per cell N.Y.) (Gamborg): Croy, (ed.) (1993) Plant Molecular Biol results in high expression levels of introduced genes; d) com ogy Bios Scientific Publishers, Oxford, U.K., Jones (ed) mon laboratory plant species as well as monocot and dicot (1995) Plant Gene Transfer and Expression Protocols— crop species are readily infected by various virus Strains; e) Methods in Molecular Biology, Volume 49 Humana Press infection of whole plants permits repeated tissue sampling of Towata N.J., and as well as others, etc., as well as, e.g., single library clones: f) recovery and purification of recom Weising et al. (1988) Ann. Rev. Genet. 22:421. See, also, WO binant virus particles is simple and rapid; and g) because 95/06128 entitled “Fertile, Transgenic Maize Plants and 25 replication occurs without chromosomal insertion, expres Methods for Their Production” published on 2 Mar. 1995. sion is not subject to position effects. See, e.g., Scholthof, Numerous protocols for establishment of transformable pro Scholthof and Jackson, (1996) “Plant virus gene vectors for toplasts from a variety of plant types and Subsequent trans transient expression of foreign proteins in plants, 'Annu. Rev. formation of the cultured protoplasts are available in the art of Phytopathol. 34:299-323. and are incorporated herein by reference. For example, see, 30 Plant viruses cause a range of diseases, most commonly Hashimoto et al. (1990) Plant Physiol. 93:857: Fowke and mottled damage to leaves, so-called mosaics. Other symp Constabel (eds) (1994) Plant Protoplasts; Saunders et al. toms include necrosis, deformation, outgrowths, and gener (1993) Applications of Plant In Vitro Technology Symposium, alized yellowing or reddening of leaves. Plant viruses are UPM 16-18; and Lyzniketal. (1991) BioTechniques 10:295, known which infect every major food-crop, as well as most each of which is incorporated herein by reference. Numerous 35 species of horticultural interest. The host range varies methods are available in the art to accomplish chloroplast between viruses, with Some viruses infecting a broad host transformation and expression (e.g., Daniell et al. (1998) range (e.g., alfalfa mosaic virus infects more than 400 species Nature Biotechnology 16:346; O'Neillet al. (1993) The Plant in 50 plant families) while others have a narrow host range, Journal 3:729; Maliga (1993) TIBTECH 11:1). Sometimes limited to a single species (e.g. barley yellow For example, nucleic acid sequences can be introduced 40 mosaic virus). Appropriate vectors can be selected based on directly into the genomic DNA of a plant cell using tech the host used in the methods and compositions of the inven niques such as electroporation, PEG poration, particle bom tion. bardment, silicon fiber delivery, or microinjection of plant In certain embodiments of the invention, a vector includes cell protoplasts or embryogenic callus, or the nucleic acid a plant virus, e.g., either RNA (single or double stranded) or sequence constructs can be introduced directly to plant tissue 45 DNA (single-stranded or doubled-stranded) virus. Examples using ballistic methods, such as particle bombardment. of such viruses include, but are not limited to, e.g., an alfam Exemplary particles include, but are not limited to, tungsten, ovirus, a bromovirus, a capillovirus, a carlavirus, a carmovi gold, platinum, and the like. Alternatively, the nucleic acid rus, a caulimovirus, a closterovirus, a comovirus, a cryptovi sequence constructs can be introduced by infection of cells rus, a cucumovirus, a dianthovirus, a fabavirus, a fijivirus, a with viral vectors, or by combining the nucleic acid sequence 50 furovirus, a geminivirus, a hordeivirus, a ilarvirus, a luteovi constructs with suitable T-DNA flanking regions and intro rus, a machlovirus, a maize chlorotic dwarf virus, a marafi duced into a conventional Agrobacterium tumefaciens host virus, a necrovirus, a nepovirus, a parsnip yellow fleck virus, vector. The virulence functions of the Agrobacterium host a pea enation mosaic virus, a potexvirus, a potyvirus, a reoVi will direct the insertion of the construct and adjacent marker rus, a rhabdovirus, a Sobemovirus, a tenuivirus, a tobamovi into the plant cell DNA when the plant cell is infected by the 55 rus, a tobravirus, a tomato spotted wilt virus, a tombusvirus, a bacteria. See, U.S. Pat. No. 5,591,616. tymovirus, or the like. Microinjection techniques are known in the art and well Typically, plant viruses encode multiple proteins required described in the Scientific and patent literature (see, e.g., for initial infection, replication and systemic spread, e.g. coat Jones (ed) (1995) Plant Gene Transfer and Expression Pro proteins, helper factors, replicases, and movement proteins. tocols—Methods in Molecular Biology, Volume 49 Humana 60 The nucleotide sequences encoding many of these proteins Press Towata N.J., and as well as others). The introduction of are matters of public knowledge, and accessible through any nucleic acid sequence constructs using polyethylene glycol of a number of databases, e.g. (Genbank: available on the precipitation is described in Paszkowski etal (1984) EMBO.J. World Wide Web at ncbi.nlm.nih.gov/genbank? or EMBL: 3:2717. Electroporation techniques are described in Fromm. available on the World Wide Web atebi.ac.uk.embl/). et al. (1985) Proc Nat'l Acad Sci USA 82:5824. Ballistic 65 Methods for the transformation of plants and plant cells transformation techniques are described in Klein et al. (1987) using sequences derived from plant viruses include the direct Nature 327:70; and Weeks et al. Plant Physiol 102: 1077 and transformation techniques described above relating to DNA US 7,838,730 B2 55 56 molecules, see e.g., Jones, ed. (1995) Plant Gene Transfer Other methods of transfection or transformation include: and Expression Protocols, Humana Press, Totowa, N.J. In (1) Agrobacterium rhizogenes-mediated transformation (see, addition, viral sequences can be cloned adjacent T-DNA bor e.g., Lichtenstein and Fuller In: Genetic Engineering, Vol. 6, der sequences and introduced via Agrobacterium mediated PW J Rigby, Ed., London, Academic Press, 1987; and Lich transformation or Agroinfection. tenstein, C. P., and Draper, J., In: DNA Cloning, Vol. 1, D. M. Viral particles comprising the plant virus vectors including Glover, Ed., Oxford, IRI Press, 1985): Application PCT/ polynucleotides of the invention can also be introduced by US87/02512 (WO 88/02405 published Apr. 7, 1988) mechanical inoculation using techniques well known in the describes the use of A. rhizogenes strain A4 and its Riplasmid art; see, e.g., Cunningham and Porter, eds. (1997) Methods in along with A. tumefaciens vectors pARC8 or pARC16, (2) Biotechnology, Vol. 3. Recombinant Proteins from Plants: 10 liposome-mediated DNA uptake (see, e.g., Freeman et al., Production and Isolation of Clinically Useful Compounds, Plant Cell Physiol. 25: 1353, 1984), and (3) the vortexing for detailed protocols. Briefly, for experimental purposes, method (see, e.g., Kindle, Proc. Natl. Acad. Sci. (USA) 87: young plant leaves are dusted with silicon carbide (carborun 1228, (1990). dum), then inoculated with a solution of viral transcript or DNA can also be introduced into plants by direct DNA encapsidated virus and gently rubbed. Large scale adapta 15 transfer into pollen as described by Zhou et al., Methods in tions for infecting crop plants are also well known in the art, Enzymology, 101:433 (1983); D. Hess, Intern. Rev. Cytol., and typically involve mechanical maceration of leaves using 107:367 (1987); Luo et al., Plant Mol. Biol. Reporter; 6:165 a mower or other mechanical implement, followed by local (1988). Expression of polypeptide coding genes can be ized spraying of viral Suspensions, or spraying leaves with a obtained by injection of the DNA into reproductive organs of buffered virus/carborundum Suspensionathigh pressure. Any a plant as described by Pena et al., Nature 325:274 (1987). of these above mentioned techniques can be adapted to the DNA can also be injected directly into the cells of immature vectors of the invention, and are useful for alternative appli embryos and the rehydration of desiccated embryos as cations depending on the choice of plant virus and host spe described by Neuhaus et al., Theor: Appl. Genet., 75:30 cies, as well as the scale of the specific transformation appli (1987); and Benbrook et al., in Proceedings Bio Expo. 1986, cation. 25 Butterworth, Stoneham, Mass., pp. 27-54 (1986). A variety of In some embodiments, Agrobacterium mediated transfor plant viruses that can be employed as vectors are known in the mation techniques are used to transfer the ACC synthase art and include cauliflower mosaic virus (CaMV), geminivi sequences or Subsequences of the invention to transgenic rus, brome mosaic virus, and tobacco mosaic virus. plants. Agrobacterium-mediated transformation is widely Other references describing suitable methods of transform used for the transformation of dicots; however, certain mono 30 ing plant cells include microinjection, Crossway et al. (1986) cots can also be transformed by Agrobacterium. For example, Biotechniques 4:320-334; electroporation, Riggs etal. (1986) Agrobacterium transformation of rice is described by Hiei et Proc. Natl. Acad. Sci. USA 83:5602-5606; Agrobacterium al. (1994) Plant J. 6:271; U.S. Pat. No. 5,187,073: U.S. Pat. mediated transformation, see for example, Townsend et al. No. 5,591,616; Liet al. (1991) Science in China 34:54; and U.S. Pat. No. 5,563,055; direct gene transfer, Paszkowski et Raineri et al. (1990) Bio/Technology 8:33. Transformed 35 al. (1984) EMBO.J. 3:2717-2722; and ballistic particle accel maize, barley, triticale and asparagus by Agrobacterium eration, see for example, Sanford et al. U.S. Pat. No. 4,945, mediated transformation have also been described (Xu et al. 050: Tomes et al. (1995) in Plant Cell, Tissue, and Organ (1990) Chinese J. Bot 2:81). Culture. Fundamental Methods, ed. Gamborg and Phillips Agrobacterium mediated transformation techniques take (Springer-Verlag, Berlin); and McCabe et al. (1988) Biotech advantage of the ability of the tumor-inducing (Ti) plasmid of 40 nology 6:923-926. Also see Weissinger et al. (1988) Annual A. tumefaciens to integrate into a plant cell genome to co Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate transfer a nucleic acid of interest into a plant cell. Typically, Science and Technology 5:27-37 (onion); Christou et al. an expression vector is produced wherein the nucleic acid of (1988) Plant Physiol. 87:671-674 (soybean); McCabe et al. interest, Such as an ACC synthase RNA configuration nucleic (1988) Bio/Technology 6:923-926 (soybean); Datta et al. acid of the invention, is ligated into an autonomously repli 45 (1990) Biotechnology 8:736-740 (rice); Klein et al. (1988) cating plasmid which also contains T-DNA sequences. Proc. Natl. Acad. Sci. USA 85:4305-4309 (maize): Kleinet al. T-DNA sequences typically flank the expression cassette (1988) Biotechnology 6:559-563 (maize): Klein et al. (1988) nucleic acid of interest and comprise the integration Plant Physiol. 91:440-444 (maize): Fromm et al. (1990) Bio sequences of the plasmid. In addition to the expression cas technology 8:833-839; Hooydaas-Van Slogteren et al. (1984) sette, T-DNA also typically includes a marker sequence, e.g., 50 Nature (London) 311:763-764: Bytebier et al. (1987) Proc. antibiotic resistance genes. The plasmid with the T-DNA and Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae); De Wet et al. the expression cassette are then transfected into Agrobacte (1985) in The Experimental Manipulation of Ovule Tissues, rium cells. Typically, for effective transformation of plant ed. G. P. Chapman et al. (Longman, N.Y.), pp. 197-209 (pol cells, the A. tumefaciens bacterium also possesses the neces len); Kaeppleretal. (1990) Plant Cell Reports 9:415-418; and sary vir regions on a plasmid, or integrated into its chromo 55 Kaeppler et al. (1992) Theor: Appl. Genet. 84:560-566 (whis some. For a discussion of Agrobacterium mediated transfor ker-mediated transformation); D. Halluin et al. (1992) Plant mation, see, Firoozabady and Kuehnle, (1995) Plant Cell Cell 4:1495-1505 (electroporation); Li et al. (1993) Plant Tissue and Organ Culture Fundamental Methods, Gamborg Cell Reports 12:250-255 and Christou et al. (1995) Annals of and Phillips (eds.). Botany 75:407-413 (rice); Osjoda et al. (1996) Nature Bio Agrobacterium tumefaciens-meditated transformation 60 technology 14:745-750 (maize via Agrobacterium tumefa techniques are well described in the scientific literature. See, ciens); all of which are herein incorporated by reference. for example Horsch et al., Science 233: 496-498 (1984), and Fraley et al., Proc. Natl. Acad. Sci(USA) 80: 4803 (1983). Regeneration of Isolated, Recombinant or Transgenic Plants Although Agrobacterium is useful primarily indicots, certain Transformed plant cells which are derived by plant trans monocots can be transformed by Agrobacterium. For 65 formation techniques and isolated or recombinant plant cells, instance, Agrobacterium transformation of maize is including those discussed above, can be cultured to regener described in U.S. Pat. No. 5,550,318. ate a whole plant which possesses the desired genotype (i.e., US 7,838,730 B2 57 58 a knockout ACC synthase nucleic acid), and/or thus the Culture, 3" Ed., Cambridge University Press. Transgenic desired phenotype, e.g., Staygreen phenotype, Sterility phe plants of the present invention may be fertile or sterile. notype, crowding resistant phenotype, etc. The desired cells, Regeneration can also be obtained from plant callus, which can be identified, e.g., by selection or screening, are explants, organs, or parts thereof. Such regeneration tech cultured in medium that supports regeneration. The cells can 5 niques are described generally in Klee et al., Ann. Rev. of then be allowed to mature into plants. For example, such Plant Phys. 38: 467-486 (1987). The regeneration of plants regeneration techniques can rely on manipulation of certain from either single plant protoplasts or various explants is well phytohormones in a tissue culture growth medium, typically known in the art. See, for example, Methods for Plant relying on a biocide and/or herbicide marker which has been Molecular Biology, A. Weissbach and H. Weissbach, eds., introduced together with the desired nucleotide sequences. 10 Academic Press, Inc., San Diego, Calif. (1988). This regen Alternatively, Screening can be performed to screen for inhi eration and growth process includes the steps of selection of bition of expression and/or activity of ACC synthase, reduc transformant cells and shoots, rooting the transformant tion in ethylene production conferred by the knockout ACC shoots and growth of the plantlets in soil. For maize cell synthase nucleic acid sequence, etc. Plant regeneration from culture and regeneration see generally, The Maize Handbook, cultured protoplasts is described in Evans et al. (1983) Pro 15 Freeling and Walbot, Eds. Springer, N.Y. (1994); Corn and toplasts Isolation and Culture, Handbook of Plant Cell Cul Corn Improvement, 3' edition, Sprague and Dudley Eds. ture, pp 124-176, Macmillan Publishing Company, New American Society of Agronomy, Madison, Wis. (1988). York; Davey, (1983) Protoplasts, pp. 12-29, Birkhauser, One of skill will recognize that after the recombinant Basal 1983; Dale, Protoplasts (1983) pp. 31-41, Birkhauser, expression cassette is stably incorporated in transgenic plants Basel; and, Binding (1985) Regeneration of Plants, Plant and confirmed to be operable, it can be introduced into other Protoplasts pp 21-73, CRC Press, Boca Raton. Regeneration plants by sexual crossing. Any of a number of standard breed can also be obtained from plant callus, explants, organs, or ing techniques can be used, depending upon the species to be parts thereof. Such regeneration techniques are described crossed. generally in Klee et al. (1987) Ann Rev of Plant Phys38:467. In vegetatively propagated crops, mature transgenic plants See also, e.g., Payne and Gamborg. For transformation and 25 can be propagated by the taking of cuttings or by tissue regeneration of maize see, for example, U.S. Pat. No. 5,736, culture techniques to produce multiple identical plants. Selection of desirable transgenics is made and new varieties 369. are obtained and propagated vegetatively for commercial use. Plants cells transformed with a plant expression vector can In seed-propagated crops, mature transgenic plants can be be regenerated, e.g., from single cells, callus tissue or leaf 30 self-crossed to produce a homozygous inbred plant. The discs according to standard plant tissue culture techniques. It inbred plant produces seed containing the newly introduced is well known in the art that various cells, tissues, and organs heterologous nucleic acid. These seeds can be grown to pro from almost any plant can be successfully cultured to regen duce plants that would produce the selected phenotype. erate an entire plant. Plant regeneration from cultured proto Mature transgenic plants can also be crossed with other plasts is described in Evans et al., Protoplasts Isolation and 35 appropriate plants, generally another inbred or hybrid, Culture, Handbook of Plant Cell Culture, Macmillilan Pub including, for example, an isogenic untransformed inbred. lishing Company, New York, pp. 124-176 (1983); and Bind Parts obtained from the regenerated plant, such as flowers, ing, Regeneration of Plants, Plant Protoplasts, CRC Press, seeds, leaves, branches, fruit, and the like are included in the Boca Raton, pp. 21-73 (1985). invention, provided that these parts comprise cells compris The regeneration of plants containing the foreign gene 40 ing the isolated nucleic acid of the present invention. Progeny introduced by Agrobacterium from leaf explants can be and variants, and mutants of the regenerated plants are also achieved as described by Horsch et al., Science, 227: 1229 included within the scope of the invention, provided that these 1231 (1985). After transformation with Agrobacterium, the plants comprise the introduced nucleic acid sequences. explants typically are transferred to selection medium. One of Transgenic plants expressing the selectable marker can be skill will realize that the selection medium depends on the 45 screened for transmission of the nucleic acid of the present selectable marker that is co-transfected into the explants. In invention by, for example, standard immunoblot and DNA this procedure, transformants are grown in the presence of a detection techniques. Transgenic lines are also typically selection agent and in a medium that induces the regeneration evaluated on levels of expression of the heterologous nucleic of shoots in the plant species being transformed as described acid. Expression at the RNA level can be determined initially by Fraley et al., Proc. Natl. Acad. Sci. (USA)., 80:4803 50 to identify and quantitate expression-positive plants. Stan (1983). This procedure typically produces shoots, e.g., within dard techniques for RNA analysis can be employed and two to four weeks, and these transformant shoots (which are include PCR amplification assays using oligonucleotide typically, e.g., about 1-2 cm in length) are then transferred to primers designed to amplify only the heterologous RNA tem an appropriate root-inducing medium containing the selec plates and Solution hybridization assays using heterologous tive agent and an antibiotic to prevent bacterial growth. Selec 55 nucleic acid-specific probes. The RNA-positive plants can tive pressure is typically maintained in the root and shoot then be analyzed for protein expression by Western immuno medium. blot analysis using the specifically reactive antibodies of the Typically, the transformants will develop roots in about 1-2 present invention. In addition, in situ hybridization and weeks and form plantlets. After the plantlets are about 3-5 cm immunocytochemistry according to standard protocols can in height, they are placed in sterile soil in fiber pots. Those of 60 be done using heterologous nucleic acid specific polynucle skill in the art will realize that different acclimation proce otide probes and antibodies, respectively, to localize sites of dures are used to obtain transformed plants of different spe expression within transgenic tissue. Generally, a number of cies. For example, after developing a root and shoot, cuttings, transgenic lines are usually screened for the incorporated as well as somatic embryos of transformed plants, are trans nucleic acid to identify and select plants with the most appro ferred to medium forestablishment of plantlets. For a descrip 65 priate expression profiles. tion of selection and regeneration of transformed plants, see, Some embodiments comprise a transgenic plant that is e.g., Dodds and Roberts (1995) Experiments in Plant Tissue homozygous for the added heterologous nucleic acid; i.e., a US 7,838,730 B2 59 60 transgenic plant that contains two added nucleic acid toxic proteins (U.S. Pat. Nos. 5,366,892; 5,747,450; 5,737, sequences, one gene at the same locus on each chromosome 514; 5723,756; 5,593,881; Geiser etal (1986) Gene 48:109); of a chromosome pair. A homozygous transgenic plant can be lectins (Van Damme et al. (1994) Plant Mol. Biol. 24:825); obtained by sexually mating (selfing) a heterozygous (aka fumonisin detoxification genes (U.S. Pat. No. 5,792.931); hemizygous) transgenic plant that contains a single added 5 avirulence and disease resistance genes (Jones et al. (1994) heterologous nucleic acid, germinating some of the seed pro Science 266:789; Martinet al. (1993) Science 262:1432; Min duced and analyzing the resulting plants produced for altered drinos et al. (1994) Cell 78: 1089); acetolactate synthase expression of a polynucleotide of the present invention rela (ALS) mutants that lead to herbicide resistance such as the S4 tive to a control plant (i.e., native, non-transgenic). Back and/or Hra mutations; inhibitors of glutamine synthase Such crossing to a parental plant and out-crossing with a non- 10 as phosphinothricin or basta (e.g., bar gene); and glyphosate transgenic plant, or with a plant transgenic for the same or resistance (EPSPS gene)); and traits desirable for processing another trait or traits, are also contemplated. or process products such as high oil (e.g., U.S. Pat. No. It is also expected that the transformed plants will be used 6.232.529): modified oils (e.g., fatty acid desaturase genes in traditional breeding programs, including TOPCROSS pol (U.S. Pat. No. 5,952,544: WO94/11516)): modified starches lination systems as disclosed in U.S. Pat. No. 5,706,603 and 15 (e.g., ADPG pyrophosphorylases (AGPase), starch synthases U.S. Pat. No. 5,704,160, the disclosure of each of which is (SS), starch branching enzymes (SBE) and starch debranch incorporated herein by reference. ing enzymes (SDBE)); and polymers or bioplastics (e.g., U.S. In addition to Berger, Ausubel and Sambrook, useful gen Pat. No. 5,602,321; beta-ketothiolase, polyhydroxybutyrate eral references for plant cell cloning, culture and regeneration synthase, and acetoacetyl-CoA reductase (Schubert et al. include Jones (ed) (1995) Plant Gene Transfer and Expres- 20 (1988) J. Bacteriol. 170:5837-5847) facilitate expression of Sion Protocols—Methods in Molecular Biology, Volume 49 polyhydroxyalkanoates (PHAs)), the disclosures of which Humana Press Towata N.J.; Payne etal. (1992) Plant Cell and are hereinincorporated by reference. One could also combine Tissue Culture in Liquid Systems John Wiley & Sons, Inc. the polynucleotides of the present invention with polynucle New York, N.Y. (Payne); and Gamborg and Phillips (eds) otides affecting agronomic traits such as male sterility (e.g., (1995) Plant Cell, Tissue and Organ Culture, Fundamental 25 see U.S. Pat. No. 5,583,210), stalk strength, flowering time, or Methods Springer Lab Manual, Springer-Verlag (Berlin transformation technology traits such as cell cycle regulation Heidelberg N.Y.) (Gamborg). A variety of cell culture media or gene targeting (e.g. WO99/61619; WO 00/17364; WO are described in Atlas and Parks (eds) The Handbook of 99/25821), the disclosures of which are herein incorporated Microbiological Media (1993) CRC Press, Boca Raton, Fla. by reference. (Atlas). Additional information for plant cell culture is found 30 These stacked combinations can be created by any method, in available commercial literature such as the Life Science including but not limited to cross breeding plants by any Research Cell Culture Catalogue (1998) from Sigma-Ald conventional or TopCross methodology, or genetic transfor rich, Inc (St Louis, Mo.) (Sigma-LSRCCC) and, e.g., the mation. If the traits are stacked by genetically transforming Plant Culture Catalogue and supplement (1997) also from the plants, the polynucleotide sequences of interest can be Sigma-Aldrich, Inc (St Louis, Mo.) (Sigma-PCCS). Addi- 35 combined at any time and in any order. For example, a trans tional details regarding plant cell culture are found in Croy, genic plant comprising one or more desired traits can be used (ed.) (1993) Plant Molecular Biology Bios Scientific Publish as the target to introduce further traits by Subsequent trans ers, Oxford, U.K. formation. The traits can be introduced simultaneously in a co-transformation protocol with the polynucleotides of inter "Stacking of Constructs and Traits 40 est provided by any combination of transformation cassettes. In certain embodiments, the nucleic acid sequences of the For example, if two sequences will be introduced, the two present invention can be used in combination (“stacked') sequences can be contained in separate transformation cas with other polynucleotide sequences of interest in order to settes (trans) or contained on the same transformation cas create plants with a desired phenotype. The polynucleotides sette (cis). Expression of the sequences of interest can be of the present invention may be stacked with any gene or 45 driven by the same promoter or by different promoters. In combination of genes, and the combinations generated can certain cases, it may be desirable to introduce a transforma include multiple copies of any one or more of the polynucle tion cassette that will Suppress the expression of a polynucle otides of interest. The desired combination may affect one or otide of interest. This may be accompanied by any combina more traits; that is, certain combinations may be created for tion of other Suppression cassettes or over-expression modulation of gene expression affecting ACC synthase activ- 50 cassettes to generate the desired combination of traits in the ity and/or ethylene production. Other combinations may be plant. designed to produce plants with a variety of desired traits, including but not limited to traits desirable for animal feed Use in Breeding Methods such as high oil genes (e.g., U.S. Pat. No. 6.232,529); bal The transformed plants of the invention may be used in a anced amino acids (e.g. hordothionins (U.S. Pat. Nos. 5,990. 55 plant breeding program. The goal of plant breeding is to 389; 5,885,801; 5,885,802; and 5,703,409); barley high combine, in a single variety or hybrid, various desirable traits. lysine (Williamson et al. (1987) Eur: J. Biochem. 165:99-106: For field crops, these traits may include, for example, resis and WO 98/20122); and high methionine proteins (Pedersen tance to diseases and insects, tolerance to heat and drought, et al. (1986).J. Biol. Chem. 261:6279; Kirihara et al. (1988) reduced time to crop maturity, greater yield, and better agro Gene 71:359; and Musumura et al. (1989) Plant Mol. Biol. 60 nomic quality. With mechanical harvesting of many crops, 12:123)); increased digestibility (e.g., modified storage pro uniformity of plant characteristics Such as germination and teins (U.S. application Ser. No. 10/053,410, filed Nov. 7, stand establishment, growth rate, maturity, and plant and ear 2001); and thioredoxins (U.S. application Ser. No. 10/005, height is desirable. Traditional plant breeding is an important 429, filed Dec. 3, 2001)), the disclosures of which are herein tool in developing new and improved commercial crops. This incorporated by reference. The polynucleotides of the present 65 invention encompasses methods for producing a maize plant invention can also be stacked with traits desirable for insect, by crossing a first parent maize plant with a second parent disease or herbicide resistance (e.g., Bacillus thuringiensis maize plant wherein one or both of the parent maize plants is US 7,838,730 B2 61 62 a transformed plant displaying a staygreen phenotype, a ste screening and identification purposes, e.g., related to the rility phenotype, a crowding resistance phenotype, or the like, activity, distribution, and expression of ACC synthase. as described herein. Antibodies specific for the polypeptides of the invention Plant breeding techniques known in the art and used in a can be generated by methods well known in the art. Such maize plant breeding program include, but are not limited to, antibodies can include, but are not limited to, polyclonal, recurrent selection, bulk selection, mass selection, backcross monoclonal, chimeric, humanized, single chain, Fab frag ing, pedigree breeding, open pollination breeding, restriction ments and fragments produced by an Fab expression library. fragment length polymorphism enhanced selection, genetic Polypeptides do not require biological activity for antibody marker enhanced selection, doubled haploids, and transfor production. The full length polypeptide, Subsequences, frag mation. Often combinations of these techniques are used. 10 ments or oligopeptides can be antigenic. Peptides used to The development of maize hybrids in a maize plant breed induce specific antibodies typically have an amino acid ing program requires, in general, the development of sequence of at least about 10amino acids, and often at least 15 homozygous inbred lines, the crossing of these lines, and the or 20 amino acids. Short stretches of a polypeptide, e.g., evaluation of the crosses. There are many analytical methods selected from among SEQID NO:7-SEQID NO:9 and SEQ available to evaluate the result of a cross. The oldest and most 15 ID NO:11, can be fused with another protein, such as keyhole traditional method of analysis is the observation of pheno limpet hemocyanin, and antibody produced against the chi typic traits. Alternatively, the genotype of a plant can be meric molecule. examined. Numerous methods for producing polyclonal and mono A genetic trait which has been engineered into a particular clonal antibodies are knownto those of skill in the art and can maize plant using transformation techniques can be moved be adapted to produce antibodies specific for the polypeptides into another line using traditional breeding techniques that of the invention, e.g., corresponding to SEQ ID NO:7-SEQ are well known in the plant breeding arts. For example, a ID NO:9 and SEQID NO:11. See, e.g., Coligan (1991) Cur backcrossing approach is commonly used to move a rent Protocols in Immunology Wiley/Greene, N.Y.; and Har transgene from a transformed maize plant to an elite inbred low and Lane (1989) Antibodies: A Laboratory Manual Cold line, and the resulting progeny would then comprise the trans 25 Spring Harbor Press, NY; Stites et al. (eds.) Basic and Clini gene(s). Also, if an inbred line was used for the transforma cal Immunology (4th ed.) Lange Medical Publications, Los tion, then the transgenic plants could be crossed to a different Altos, Calif., and references cited therein; Goding (1986) inbred in order to produce a transgenic hybrid maize plant. As Monoclonal Antibodies. Principles and Practice (2d ed.) used herein, “crossing can refer to a simple X by Y cross, or Academic Press, New York, N.Y.; Fundamental Immunology, the process of backcrossing, depending on the context. 30 e.g., 4" Edition (or later), W. E. Paul (ed.), Raven Press, N.Y. The development of a maize hybrid in a maize plant breed (1998); and Kohler and Milstein (1975) Nature 256: 495-497. ing program involves three steps: (1) the selection of plants Other suitable techniques for antibody preparation include from various germplasm pools for initial breeding crosses; (2) selection of libraries of recombinant antibodies in phage or the selfing of the selected plants from the breeding crosses for similar vectors. See, Huse et al. (1989) Science 246: 1275 several generations to produce a series of inbred lines, which, 35 1281; and Ward, et al. (1989) Nature 341: 544-546. Specific while different from each other, breed true and are highly monoclonal and polyclonal antibodies and antisera will usu uniform; and (3) crossing the selected inbred lines with dif ally bind with a K, of at least about 0.1 uM, preferably at least ferent inbred lines to produce the hybrids. During the inbreed about 0.01 uM or better, and most typically and preferably, ing process in maize, the vigor of the lines decreases. Vigoris 0.001 uM or better. restored when two different inbred lines are crossed to pro 40 duce the hybrid. An important consequence of the homozy Kits for Modulating Staygreen Potential or Sterility gosity and homogeneity of the inbred lines is that the hybrid Certain embodiments of the invention can optionally be created by crossing a defined pair of inbreds will always be provided to a user as a kit. For example, a kit of the invention the same. Once the inbreds that give a superior hybrid have can contain one or more nucleic acid, polypeptide, antibody, been identified, the hybrid seed can be reproduced indefi 45 diagnostic nucleic acid or polypeptide, e.g., antibody, probe nitely as long as the homogeneity of the inbred parents is set, e.g., as a cDNA microarray, one or more vector and/or cell maintained. line described herein. Most often, the kit is packaged in a Transgenic plants of the present invention may be used to suitable container. The kit typically further comprises one or produce, e.g., a single cross hybrid, a three-way hybrid or a more additional reagents, e.g., Substrates, labels, primers, or double cross hybrid. A single cross hybrid is produced when 50 the like for labeling expression products, tubes and/or other two inbred lines are crossed to produce the F1 progeny. A accessories, reagents for collecting samples, buffers, hybrid double cross hybrid is produced from four inbred lines ization chambers, cover slips, etc. The kit optionally further crossed in pairs (AxB and CxD) and then the two F1 hybrids comprises an instruction set or user manual detailing pre are crossed again (AxB)x(CxD). A three-way cross hybrid is ferred methods of using the kit components for discovery or produced from three inbred lines where two of the inbred 55 application of gene sets. When used according to the instruc lines are crossed (AxB) and then the resulting F1 hybrid is tions, the kit can be used, e.g., for evaluating expression or crossed with the third inbred (AxB)xC. Much of the hybrid polymorphisms in a plant sample, e.g., for evaluating ACC vigor and uniformity exhibited by F1 hybrids is lost in the synthase, ethylene production, staygreen potential, crowding next generation (F2). Consequently, seed produced by resistance potential, Sterility, etc. Alternatively, the kit can be 60 used according to instructions for using at least one ACC hybrids is consumed rather than planted. synthase polynucleotide sequence to control staygreen poten Antibodies tial in a plant. The polypeptides of the invention can be used to produce As another example, a kit for modulating sterility, e.g., antibodies specific for the polypeptides of SEQ ID NO:7- male sterility, in a plant includes a container containing at SEQID NO:9 and SEQID NO. 11, and conservative variants 65 least one polynucleotide sequence comprising a nucleic acid thereof. Antibodies specific for, e.g., SEQ ID NOs: 7-9 and sequence, wherein the nucleic acid sequence is, e.g., at least 11, and related variant polypeptides are useful, e.g., for about 70%, at least about 75%, at least about 80%, at least US 7,838,730 B2 63 64 about 85%, at least about 90%, at least about 95%, at least Example 1 about 99%, about 99.5% or more, identical to SEQID NO:1 (gACS2), SEQID NO:2 (gACS6), SEQID NO:3 (gACS7), Isolation of Maize ACC Synthase Knockouts SEQ ID NO.4 (cACS2), SEQ ID NO:5 (cACS6), SEQ ID NO:6 (cAC7) or SEQ ID NO:10 (CCRA178R), or a subse 5 Because ethylene has been associated with promoting leaf quence thereof, or a complement thereof. The kit optionally senescence in Some species, to introduce Staygreen potential also includes instructional materials for the use of the at least into, e.g., maize, we undertook to reduce ethylene biosynthe one polynucleotide sequence to control sterility, e.g., male sis in maize leaves through the inactivation of ACC synthase sterility, in a plant. genes. The maize ACC synthase gene family is composed of 10 three members: ACS2, ACS6, and ACS7. In order to isolate Other Nucleic Acid and Protein Assays ethylene mutants, we screened for disruptions of each mem In the context of the invention, nucleic acids and/or pro ber of the ACC synthase gene family using the Trait Utility teins are manipulated according to well known molecular System for Corn (TUSC). To date, we have determined the biology methods. Detailed protocols for numerous Such pro exact Mu insertion site for 8 mutant lines (three ACS6 and five 15 ACS2) by sequencing across the Mu?ACC synthase junction. cedures are described in, e.g., in Ausubel et al. Current Pro Five insertions were stably inherited; their positions are indi tocols in Molecular Biology (supplemented through 2004) cated in FIG. 2, which also schematically depicts ACS7. John Wiley & Sons, New York (Ausubel'); Sambrook et al. A pronounced Staygreen phenotype was observed in leaves Molecular Cloning A Laboratory Manual (2nd Ed.), Vol. of those plants in which a single gene member of the ACS 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, family was presentina heterozygous mutant state (see FIG.3, N.Y., 1989 (“Sambrook”), and Berger and Kimmel Guide to Panels A, B, C, and D). When present in a homozygous Molecular Cloning Techniques, Methods in Enzymology Vol mutant state, an even more pronounced Staygreen phenotype ume 152 Academic Press, Inc., San Diego, Calif. (“Berger'). was observed (see FIG. 4). In FIG.4, a leaf from the wild-type In addition to the above references, protocols for in vitro (left), heterozygous ACC synthase knockout (middle), and amplification techniques, such as the polymerase chain reac 25 homozygous ACC synthase knockout (right) was sheathed tion (PCR), the ligase chain reaction (LCR), QB-replicase for seven (7) days in the dark. Leaves from homozygous ACC amplification, and other RNA polymerase mediated tech synthase knockout plants exhibited a greater Staygreen trait niques (e.g., NASBA), useful e.g., for amplifying polynucle than leaves of the heterozygous ACC synthase knockout and otides of the invention, are found in Mullis et al. (1987) U.S. exhibited a Substantially greater staygreen trait than leaves of 30 wild type plants. Pat. No. 4,683,202. PCR Protocols A Guide to Methods and The degree of Staygreen potential introduced was gene Applications (Innis et al. eds) Academic Press Inc. San Diego, member specific. Consequently, a strong staygreen trait was Calif. (1990) ("Innis”); Arnheim and Levinson (1990) C&EN introduced with the mutation of one member (e.g., ACS6), 36. The Journal Of NIH Research (1991) 3:81; Kwoh et al. while a less pronounced Staygreen phenotype was introduced (1989) Proc Natl Acad Sci USA 86, 1173; Guatelli et al. 35 with the mutation of another member (e.g., ACS2). Therefore, (1990) Proc Natl AcadSci USA 87: 1874; Lomeletal. (1989) the degree of staygreen potential introduced into a line can be J Clin Chem 35:1826; Landegren et al. (1988) Science 241: controlled by which mutant gene member is introduced, 1077; Van Brunt (1990) Biotechnology 8:291; Wu and Wal whether the mutant gene member is presentina heterozygous lace (1989) Gene 4:560; Barringeretal. (1990) Gene 89:117, or homozygous state, and by the number of members of this and Sooknanan and Malek (1995) Biotechnology 13:563. 40 family which are inactivated (e.g., ACS2/ACS6 double Additional methods, useful for cloning nucleic acids in the mutants have a strong staygreen phenotype). Traits associated context of the invention, include Wallace et al. U.S. Pat. No. with improved hybrid standability include resistance to stalk 5,426,039. Improved methods of amplifying large nucleic rot and leafblights, genetic stalk strength, short plant height acids by PCR are summarized in Cheng et al. (1994) Nature and ear placement, and high staygreen potential. 369:684 and the references therein. 45 Typically, leaves follow a typical progression from initia Certain polynucleotides of the invention can be synthe tion through expansion ultimately ending in senescence. The sized utilizing various Solid-phase strategies involving mono carbon fixation capacity also increases during expansion and nucleotide- and/or trinucleotide-based phosphoramidite cou ultimately declines to low levels throughout senescence. See, pling chemistry. For example, nucleic acid sequences can be e.g., Gay A P. and Thomas H (1995) Leaf development in 50 Lolium temulentum. photosynthesis in relation to growth and synthesized by the sequential addition of activated monomers senescence. New Phytologist 130: 159-168. This is of particu and/or trimers to an elongating polynucleotide chain. See lar relevance to cereal species where yield potential is largely e.g., Caruthers, M. H. et al. (1992) Meth Enzymol 211:3. In dependent upon the ability of the plant to fix carbon and store lieu of synthesizing the desired sequences, essentially any this carbon in the seed, mainly in the form of starch. Both the nucleic acid can be custom ordered from any of a variety of 55 timing at which senescence is initiated and the rate at which it commercial sources, such as The Midland Certified Reagent progresses can have a significantimpact on the overall carbon Company (mcrc(aboligos.com) (Midland, Tex.), The Great a particular leafcan ultimately contribute to a plant. See, e.g., American Gene Company (available on the World WideWeb Thomas H, and Howarth CJ (2000) Five ways to stay green. at genco.com) (Ramona, Calif.), ExpressGen, Inc. (available Journal of Experimental Botany 51: 329-337. This is of par on the World Wide Web at expressgen.com) (Chicago Ill.), 60 ticular relevance to those crops where yield potential is Operon Technologies, Inc. (available on the WorldWide Web reduced by adverse environmental conditions that induce pre at operon.com) (Alameda Calif.), and many others. mature leaf senescence. Stay-green is a general term used to describe a phenotype whereby leaf senescence (most easily EXAMPLES distinguished by yellowing of the leaf associated with chlo 65 rophyll degradation) is delayed compared to a standard ref The following examples are offered to illustrate, but not to erence. See, e.g., Thomas and Howarth, Supra. In Sorghum, limit the claimed invention. several stay-green genotypes have been identified which US 7,838,730 B2 65 66 exhibit a delay in leaf Senescence during grain filling and cotton germplasm. Agricultural Water Management 7: 207 maturation. See, e.g., Duncan R. R. et al. (1981) Descriptive 222). Among physiological determinants, growth regulators comparison of senescent and non-senescent sorghum geno play a key role in directing the leaf senescence program. Of types. Agronomy Journal 73: 849-853. Moreover, under con particular relevance is the observation that modification of ditions of limited water availability, which normally hastens cytokinin levels can significantly delay leaf senescence. For leaf senescence (e.g., Rosenow DT, and Clark L E (1981) example, plants transformed with isopentenyl transferase Drought tolerance in sorghum. In: Loden HD, Wilkinson D, (ipt), an Agrobacterium gene encoding a rate-limiting step in eds. Proceedings of the 36th annual corn and sorghum indus cytokinin biosynthesis, when placed under the control of a try research conference, 18-31), these genotypes retain more senescence inducible promoter, resulted in autoregulated green leaf area and continue to fill grain normally (e.g., 10 cytokinin production and a strong stay-green phenotype. See, McBee G. G. et al. (1983) Effect of senescence and non senescence on carbohydrates in sorghum during late kernel e.g., Gan S. Amasino R M (1995) Inhibition of leaf senes maturity states. CropScience 23: 372-377; Rosenow DT, et cence by autoregulated production of cytokinin. Science 270: al. (1983) Drought-tolerant sorghum and cotton germplasm. 1986-1988. Ethylene has also been implicated in controlling Agricultural Water Management 7: 207-222; and, Borrell A 15 leaf senescence (e.g., Davis K M, and Grierson D (1989) K. Douglas ACL (1996) Maintaining green leafarea in grain Identification of cDNA clones for tomato (Lycopersicon escu Sorghum increases yield in a water-limited environment. In: lentum Mill.) mRNAs that accumulate during fruit ripening Foale MA, Henzell RG, Kneipp JF, eds. Proceedings of the and leaf senescence in response to ethylene. Planta 179: third Australian sorghum conference. Melbourne. Australian 73-80) and plants impaired in ethylene production or percep Institute of Agricultural Science, Occasional Publication No. tion also show a delay in leafsenescence (e.g., Picton S, et al., 93). The stay-green phenotype has also been used as a selec (1993) Altered fruit ripening and leafsenescence in tomatoes tion criterion for the development of improved varieties of expressing an antisense ethylene-forming enzyme transgene. corn, particularly with regard to the development of drought The Plant Journal 3: 469-481, Grbic V, and Bleeker A B tolerance. See, e.g., Russell WA (1991) Genetic improvement (1995) Ethylene regulates the timing of leaf senescence in of maize yields. Advances in Agronomy 46: 245-298; and, 25 Arabidopsis. The Plant Journal 8: 95-102; and, John I, et al., Bruce et al., (2002), Molecular and physiological approaches (1995) Delayed leaf senescence in ethylene-deficient ACC to maize improvement for drought tolerance, Journal of Oxidase antisense tomato plants: molecular and physiologi Experimental Botany, 53 (366): 13-25. cal analysis. The Plant Journal 7: 483-490), which can be Five fundamentally distinct types of stay-green have been phenocopied by exogenous application of inhibitors of eth described. See, e.g., Thomas H, and Smart CM (1993) Crops 30 that stay green. Annals of Applied Biology 123: 193-219; and, ylene biosynthesis and action (e.g., Abeles F B, et al., (1992) Thomas and Howarth, supra. InType A stay-green, initiation Ethylene in Plant Biology. Academic Press, San Diego, of the senescence program is delayed, but then proceeds at a Calif.). normal rate. In Type B stay-green, while initiation of the The identification and analysis of mutants in Arabidopsis senescence program is unchanged, the progression is com 35 and tomato that are deficient in ethylene biosynthesis and paratively slower. In Type C stay-green, chlorophyll is perception are valuable in establishing the important role that retained even though senescence (as determined through ethylene plays in plant growth and development. Mutant measurements of physiological function Such as photosyn analysis has also been instrumental in identifying and char thetic capacity) proceeds at a normal rate. Type D stay-green acterizing the ethylene signal transduction pathway. While is more artificial in that killing of the leaf (i.e. by freezing, 40 many ethylene mutants have been identified in dicot plants boiling or drying) prevents initiation of the senescence pro (e.g., Arabidopsis and tomato), no such mutants have been gram thereby stopping the degradation of chlorophyll. In identified in monocots (e.g., rice, wheat, and corn). Here the Type E stay-green, initial levels of chlorophyll are higher identification of maize mutants deficient in ACC synthase, the while initiation and progression of leaf senescence are first enzyme in the ethylene biosynthetic pathway, are unchanged, thereby giving the illusion of a relatively slower 45 described. These mutants are critical in elucidating the regu progression rate. Type A and B are functional stay-greens as latory roles that ethylene plays throughout cereal develop photosynthetic capacity is maintained along with chlorophyll ment as well as its role in regulating responses to environ content and are the types associated with increased yield and mental stress. Knowledge obtained from Such mutant drought tolerance in Sorghum. Despite the potential impor analysis will increase the understanding of the role of ethyl tance of this trait, in particular the benefits associated with 50 increasing yield and drought tolerance, very little progress ene in maize development and will be pertinent to other cereal has been made in understanding the biochemical, physiologi crop species. cal or molecular basis for genetically-determined stay-green. Mutants were deficient in ethylene production and exhib See, e.g., Thomas and Howarth, Supra. ited a staygreen phenotype. Staygreen was observed under A number of environmental and physiological conditions 55 normal growth conditions and following prolonged condi have been shown to significantly alter the timing and progres tions of drought that induced premature onset of leaf Senes sion of leafsenescence and can provide some insight into the cence in wild-type plants. In addition to the maintenance of basis for this trait. Among environmental factors, light is chlorophyll during water stress, ACC synthase-deficient probably the most significant and it has long been established leaves maintained photosynthetic function and continued to that leaf senescence can be induced in many plant species by 60 assimilate CO. Surprisingly, reducing ethylene production placing detached leaves in darkness. See, e.g., Weaver L. M. improved leaf function in all leaves under normal growth Amasino RM (2001) Senescence is induced in individually conditions and maintained a high level of function in drought darkened Arabidopsis leaves, but inhibited in whole darkened stressed plants even for those leaves in which senescence had plants. Plant Physiology 127: 876-886. Limited nutrient and not been induced in similar age leaves of wild-type plants. water availability have also been shown to induce leaf senes 65 These findings indicate that ethylene may serve to regulate cence prematurely (e.g., Rosenow D T. Quisenberry J. E. leaf function under normal growth conditions as well as in Wendt CW. Clark L E (1983) Drought-tolerant sorghum and response to conditions of drought. US 7,838,730 B2 67 68 Materials and Methods developed by Pioneer Hybrid Int., is a powerful PCR-based Cloning of ACC Synthase Genes from Zea mays screening strategy to identify Mu transposon insertions in To facilitate cloning of ACC synthase gene(s) from maize, specific genes without the need for an observable phenotype. primers were designed to regions highly conserved between This screening approach is best Suited to target genes that multiple monocot and dicot species using sequence informa 5 have been previously isolated from maize. The system uti tion currently available in GenBank. Initial PCR reactions lizes TIR-PCR in which one PCR primer is derived from the were carried out on maize genomic DNA using primers target gene and the other (Mu-TIR) from the terminal-in ACCF1 (ccagatgggcctcgccgagaac, SEQ ID NO:12) and verted-repeat (TIR) region of Mu. Using these primers in ACC1 (gttgg.cgtagcagacgcggaacca; SEQ ID NO:13) and PCR reactions of DNA pooled from a large population of Mu revealed the presence of three fragments of different sizes. All 10 containing plants, successful amplification is identified by three fragments were sequenced and confirmed to be highly Southern hybridization using the target gene as the probe. similar in sequence to other known ACC synthase genes. Screening the individuals within a positive pool is then per To obtain the entire genomic sequences for each of these formed to identify the candidate line containing insertion of a genes, all three fragments were radiolabeled with dCTP using Mu element in the target gene. In order to determine whether the PRIME-A-GENETM labeling system (Promega) and used 15 an insertion eventis limited to Somatic cells or is present in the to screen an EMBL3 maize (B73) genomic library (Strat germline (and therefore represents a heritable change), prog agene) according to methods described in Sambrook, Supra. eny from a candidate are subjected to the same PCR/Southern Hybridization was carried out overnight at 30° C. in buffer hybridization analysis used in the original Screen. containing 5xSSPE, 5xDenhardt's, 50%. Formamide and 1% A research effort was established to identify knockout SDS. Blots were washed sequentially at 45° C. in 1xSSPE mutants in ethylene biosynthesis. To accomplish this, four and 0.1xSSPE containing 0.1% SDS and exposed to film at primers (ACCF1, ccagatgggcctcgccgagaac, SEQID NO:12; -80° C. with an intensifier screen. A total of 36 confluent ACC-1, gttgg.cgtagcagacgcggaacca, SEQID NO:13: ACC-C, plates (150 mm diameter) were screened. Putative positives cagttatgtgagggcacaccctacagcca, SEQ ID NO:16: ACC-D, plaques were Subsequently screened directly by PCR using catcgaatgccacagctcgaacaacttic, SEQ ID NO:17) specific to the above primers to identify which clones contained frag 25 the maize ACC synthase genes discussed above were used to ments corresponding to the three fragments initially identi screen for Mu insertions in combination with the Mu-TIR fied. PCR screening was accomplished using HOTSTAR primer (aagccaacgcca (aft)cgcctc(cft)atttcgt. SEQID NO:18). TAQTM (a hot start Taq DNA polymerase, Qiagen). Reactions The initial screening resulted in the putative identification of contained 1x buffer, 200 uM of each dNTP. 3 uM MgCl, 19 separate lines carrying Mu insertions in the maize ACC 0.250/1 forward and reverse primer, 1.25 U HOTSTAR 30 synthase multigene family. Seed from each of these lines was TAQTM and 1 ul primary phage dilution (1/600 total in SM planted and DNA was extracted from the leaf of each indi buffer) as a template in a total reaction volume of 254 Reac vidual. For DNA isolation, 1 cm of seedling leaf was isolated tion conditions were as follows: 95°C./15 min. (1 cycle); 95° from each plant and placed into a 1.5 ml centrifuge tube C/1 min, 62°C/1 min, 72°C./2 min(35 cycles): 72°C./5 min containing some sand. Samples were quick-frozen in liquid (1 cycle). Samples were separated on a 1% agarose geland the 35 nitrogen and ground to a fine powder using a disposable pestle products were visualized following staining with ethidium (Fisher Scientific). 600 ul of extraction buffer (100 mM Tris bromide. All fragments amplified were also subjected to (pH 8.0), 50 mM EDTA, 200 mM NaCl, 1% SDS, 10 ul/ml restriction analysis to identify other potential sequence spe B-mercaptoethanol) was added immediately and mixed thor cific differences independent of Subsequence size. oughly. 700 ul Phenol/Chloroform (1:1) was added and To facilitate sequencing the remaining portions of these 40 samples were centrifuged 10 min at 12,000 rpm. 500 ul super genes, primers ACCF1 and ACC1 were used in conjunction natant was removed to a new tube and the nucleic acid pre with primers specific to either the left (gacaaactg.cgcaactcgt cipitated at -20°C. following addition of 1/10 Vol 3M sodium gaaaggt, SEQ ID NO:14) or right (ctcgtcc.gagaataacgagtg acetate and 1 Vol isopropanol. Total nucleic acid was pelleted gatct: SEQID NO:15) arm of the EMBL3 vector to amplify by centrifugation at 12,000 rpm, washed 3x with 75% ethanol each half of the gene. TAKARA LATAQTM (a thermostable 45 and resuspended in 600 ul H.O. PCR screening was accom DNA polymerase having proofreading activity, Panvera) was plished using HOTSTARTAQTM (Qiagen). Reactions con used to amplify the fragments due to the large size. Reactions tained 1x buffer, 200 uM of each dNTP 3 mM MgCl2, 0.25 contained 1 ul phage dilution (1/600 total in SM buffer) and 2 uMACC synthase specific primer (ACCF1, ACC-1, ACC-C uM each primer (final concentration), 1x buffer (final con or ACC-D), 0.25 uM Mu specific primer (MuTIR), 0.25 ul centration), 400 uM dNTP mix (final concentration) and 1.25 50 HOTSTARTAQTM and 1.5ul total nucleic acid as a template U LA Taq in 25 ul total volume. Reactions were carried out in a total reaction volume of 25ul. Reaction conditions were under the following conditions: 98°C./1 min. (1 cycle); 98° as follows: 95°C/15 min. (1 cycle); 95°C/1 min, 62°C/1 C/30 sec, 69°C/15 min. (35 cycles): 72°C./10 min (1 cycle). min, 72° C./2 min (35 cycles): 72° C./5 min (1 cycle). PCR Amplified products were purified using the STRATAPREPTM products were separated on a 1% agarose gel, visualized PCR purification kit (Stratagene) and sent to the sequencing 55 following staining with ethidium bromide and transferred to facility at the University of Florida, Gainesville for direct nylon membranes according to methods described in Sam sequencing. brook et al. (1989). Southern blot analysis was performed as Identification of ACC Synthase Knock Out Mutants described above for library screening except the hybridiza Maize has proven to be a rich source of mutants, in part due tion temperature was increased to 45° C. BC1 (backcross 1) to the presence of active or previously active transposable 60 seed was planted from each of the 13 putative mutant lines element systems within its genome. Depending precisely on and screened by PCR/Southern analysis (as just described). the location of the insertion site in a gene, a transposon can Of these lines, only 5 were found to be stably inherited. These partially or completely inactivate expression of a gene. Gene five lines were backcrossed an additional 4 times to minimize inactivation may or may not have an observable phenotype the effects of unrelated Mu insertions. depending upon the amount of redundancy (i.e. presence of 65 BC5 seed was self-pollinated to generate homozygous null multiple family members and the tissue specificity of the individuals. Homozygous null individual lines were identi family members). Trait Utility System for Corn (TUSC), fied by PCR using Takara LA Taq and the ACCF1 and ACC-1 US 7,838,730 B2 69 70 primers. Reactions contained 1 Juleaf DNA, 2 uMeach primer Ten ml of Phenol/Chloroform (1:1, vol:Vol) is added and (final concentration), 1x buffer (final concentration), 400 uM mixed thoroughly. Samples are centrifuged 10 min at 8,000 dNTP mix (final concentration) and 1.25 ULA Taq in 25ul rpm, the Supernatant is removed to a new tube and the nucleic total volume Reactions were carried out under the following acid is precipitated at -20°C. following addition of /10 vol conditions: 98°C/1 min. (1 cycle): 98° C./30 sec, 69°C/15 3M sodium acetate and 1 vol isopropanol. Total nucleic acid min. (35 cycles): 72°C/10 min (1 cycle). PCR of wild-type is pelleted by centrifugation at 8,000 rpm and resuspended in B73 DNA using these primers and conditions results in the 1 ml TE. One half of the prep is used for DNA purification and amplification of three different sized fragments correspond the remaining half is used for RNA purification. (Alterna ing to the three genes identified. Individuals which are either tively, DNA or total nucleic acids can be extracted from 1 cm wild-type or heterozygous for one of the null insertion-alleles 10 of seedling leaf, quick-frozen in liquid nitrogen, and ground display this characteristic pattern while those which are homozygous for one of the null insertion-alleles are missing to a fine powder. 600 ul of extraction buffer 100 mM Tris (pH the Subsequence corresponding to the gene in which the inser 8.0), 50 mM EDTA,200 mMNaCl, 1% SDS, 10ul/ml B-mer tion is located. captoethanol is added and the sample mixed. The sample is To determine the exact location of the Mu insertion site, 15 extracted with 700 ul phenol/chloroform (1:1) and centri PCR products from each of the lines were amplified using fuged for 10 min at 12,000 rpm. DNA is precipitated and either the ACCF1 or ACC-1 primer in combination with the resuspended in 600 ul H2O.) MuTIR primer. These fragments were then sequenced across For DNA purification, 500 ug DNase-free RNase is added the Mu?target gene junction using the Mu-TIR primer. The to the tube and incubated at 37°C. for 1 hr. Following RNase location of these Mu elements within each of the ACC syn digestion, an equal volume of Phenol/Chloroform (1:1, vol: thase genes is shown in FIG. 2. Vol) is added and mixed thoroughly. Samples are centrifuged Protein Extraction 10 min at 10,000 rpm, the supernatant is removed to a new For total protein isolation, leaves of B73 or mutant plants tube and the DNA precipitated at -20°C. following addition were collected at the indicated times, quick-frozen in liquid of /10 Vol 3M sodium acetate and 1 vol isopropanol. DNA is nitrogen and ground to a fine powder. One ml of extraction 25 resuspended in Sterile water and the concentration is deter buffer (20 mM HEPES (pH 7.6), 100 mM KC1, 10% Glyc mined spectrophotometrically. To determine DNA integrity, erol) was added to approximately 0.1 g frozen powder and mixed thoroughly. Samples were centrifuged 10 min at 20 mg of DNA is separated on a 1.8% agarose gel and visu 10,000 rpm, the supernatant removed to a new tube and the alized following staining with ethidium bromide. RNA is concentration determined spectrophotometrically according 30 purified by 2 rounds of LiCl, precipitation according to meth to the methods of Bradford (1976). See, Bradford MM (1976) ods described by Sambrook et al. supra. A rapid and sensitive method for the quantitation of micro Real-Time RT-PCR Analysis gram quantities of protein utilizing the principle of protein Fifty ug total RNA is treated with RQ1TM DNase dye binding. Anal. Biochem. 72: 248-254. (See FIG. 18). (Promega) to ensure that no contaminating DNA is present. Chlorophyll Extraction 35 Two pg total RNA is used directly for cDNA synthesis using Leaves were frozen in liquid nitrogen and ground to a fine the OMNISCRIPT RTTM reverse transcription kit (Qiagen) powder. Samples of approximately 0.1 g were removed to a with oligo-dT(20) as the primer. 1.5 ml tube and weighed. Chlorophyll was extracted 5x with Analysis of transcriptabundance is accomplished using the 1 ml (or 0.8 ml) of 80% acetone. Individual extractions were QUANTITECTTMSYBR Green PCR kit (Qiagen). Reactions combined and the final volume adjusted to 10 ml (or 15 ml) 40 contain 1x buffer, 0.5ul of the reverse transcription reaction with additional 80% acetone. Chlorophyll content (a+b) was (equivalent to 50 ng total RNA) and 0.25 uM (final concen determined spectrophotometrically according to the methods tration) forward and reverse primers (see table 2 below) in a of Wellburn (1994). See, Wellburn, A. R. (1994) The spectral total reaction volume of 25ul. determination of chlorophylls a and b, as well as total caretenoids, using various solvents with spectrophotometers 45 TABLE 2 of different resolution. J. Plant Physiol. 144: 307-313. (See FIG. 17). Forward Primer Reverse Primer Measurement of Photosynthesis Gene s'-3' (5'-3' Plants were grown in the field under normal and drought ZmACS47 atcgcgtacagcct ct coaag gatagt ctitttgttcaac catc stress conditions. Normal plants were watered for eight hours 50 ga ccataga twice a week. For drought-stressed plants, water was limited SEO ID NO: 19 SEQ ID NO: 2O to approximately four hours per week for a period starting ZmACS50 atcgcgtacagcct ct coaag caacgt citctgtcactctgtg approximately one week before pollination and continuing ga taatgt through three weeks after pollination. During the period of SEO ID NO:21 SEQ ID NO: 22 limited water availability, drought-stressed plants showed 55 ZmACS65 agctgtggaagaaggtggtct agtacgtgaccgtggitttcta visible signs of wilting and leaf rolling. Transpiration, sto tcgaggit tga matal conductance and CO assimilation were determined SEO ID NO :23 SEQ ID NO:24 with a portable TPS-1 Photosynthesis System (PP Systems). Each leaf on a plant was measured at forty days after polli nation. Values represent a mean of six determinations. See 60 Reactions are carried out using an ABI PRISM 7700 FIGS. 5 and 6. sequence detection system under the following conditions: DNA and RNA Purification 95° C./15 min. (1 cycle); 95° C./30 sec, 62° C./30 sec, 72° For total nucleic acid isolation, leaves of B73 are collected C./2 min (50 cycles): 72° C./5 min (1 cycle). Each gene is at desired times, quick-frozen in liquid nitrogen and ground to analyzed a minimum of four times. a fine powder. Ten ml of extraction buffer (100 mM Tris (pH 65 All the primer combinations are initially run and visualized 8.0), 50 mM EDTA, 200 mMNaCl, 1% SDS, 10ul/ml B-mer onanagarose gel to confirm the presence single product of the captoethanol) is added and mixed thoroughly until thawed. correct size. All amplification products are subcloned into the US 7,838,730 B2 71 72 pGEM-T Easy vector system (Promega) to use for generation sponding to the mutant gene. The Mu insertion site for each of standard curves to facilitate conversion of expression data mutant line was determined by sequencing across the to a copy/ug RNA basis. Mu/ACC synthase junction using the Mu-TIR primer (FIG. Ethylene Determination 2). Four of the five insertion lines contained a Mu in ACS2: Ethylene was measured from the second fully-expanded one mutant contained an insertion in the third exon whereas leaf of seedlings leaves at the 4-leaf stage or from the terminal the other three contained insertions in the fourth exon at 15 cm of leaves of plants 20, 30, or 40 days after pollination unique positions (FIG. 2). The fifth insertion line contained a (DAP). Leaves were harvested at the indicated times and Mu in ACS6 in the second intron near the 3' splice site. allowed to recover for 2 hr prior to collecting ethylene, Quantitative real time RT-PCR revealed that all three genes between moist paper towels. Leaves were placed into glass 10 are expressed during maize leaf development and confirmed vials and capped with a rubber septum. Following a 3-4 hour that the Mu insertions resulted in the loss of or a decrease in incubation, 0.9 mL of headspace was sampled from each vial ACS expression. Insertions in ACS7 were identified in the and the ethylene content measured using a 6850 series gas first generation but were not inherited, suggesting that they chromatography system (Hewlett-Packard, Palo Alto, Calif.) were somatic mutants or that expression of ACS7 is required equipped with a HP Plot alumina-based capillary column 15 for germ line development. (Agilent Technologies, Palo Alto, Calif.). Tissue fresh weight For a description of ACC synthase expression patterns was measured for each sample. Three replicates were mea during endosperm and embryo development, see Gallie and Sured and the average and standard deviation reported. Young (2004) The ethylene biosynthetic and perception Western Blot Analysis machinery is differentially expressed during endosperm and B73 leaves were collected at the indicated times and embryo development Mol Gen Genomics 271:267-281. ground in liquid nitrogen to a fine powder. One ml of extrac ACS6 or ACS2 Gene Disruption Reduces Ethylene Syn tion buffer 20 mM HEPES (pH 7.6), 100 mM KC1, 10% thesis glycerol, 1 mM PMSF was added to approximately 0.1 g The level of ethylene evolution in maize leaves increased as frozen powder and mixed thoroughly. Cell debris was pel a function of leaf age (FIG. 19 Panel C). At 20 DAP, the leted by centrifugation at 10,000 rpm for 10 min and the 25 highest level of ethylene was observed in leaf 1 (the oldest protein concentration determined as described (Bradford, surviving leaf) which by 30 DAP had progressed to leaf 3 and 1976). Antiserum raised against the large subunit of rice by 40 DAP (i.e., kernel maturity) to leaves 4-5. To determine Rubisco was obtained from Dr. Tadahiko Mae (Tohoku Uni whether Mu disruptions of ACS6 or ACS2 described above versity, Sendai, Japan). Protein extracts were resolved using reduced ethylene evolution, ethylene was measured from leaf standard SDS-PAGE and the protein transferred to 0.22 Lum 30 4 of wild-type and mutant plants. Ethylene evolution from nitrocellulose membrane by electroblotting. Following trans acs2 plants was approximately 55% of wild-type plants, a fer, the membranes were blocked in 5% milk, 0.01% thime level that was similar for all acs2 mutant alleles (FIG. 19 rosal in TPBS (0.1% TWEEN 20, 13.7 mM NaCl, 0.27 mM Panels A-B). Ethylene evolution from acs6 plants was only KC1, 1 mM Na2HPO4, 0.14 mM KH2PO4) followed by 10% of that from wild-type plants (FIG. 19 Panel B). Ethyl incubation with primary antibodies diluted typically 1:1000 35 ene evolution from acs21 acS6 double mutant plants was simi to 1:2000 in TPBS with 1% milk for 1.5 hrs. The blots were lar to that from acS6 plants. These data Suggest that loss of then washed twice with TPBS and incubated with goat anti ACS6 expression results in a greater reduction in the ability of rabbit horseradish peroxidase-conjugated antibodies (South maize leaves to produce ethylene than does the loss of ACS2 ern Biotechnology Associates, Inc.) diluted to 1:5000 to 1:10, expression. 000 for 1 hr. The blots were washed twice with TPBS and the 40 Disruption of ACS6 Confers a Staygreen Phenotype signal detected typically between 1 to 15 minusing chemilu A substantial increase in ethylene evolution correlated with minescence (Amersham Corp). the appearance of visible signs of Senescence in wild-type leaves, suggesting that ethylene may promote the entry of Results leaves into the senescence program. If so, a delay in the Identification of ACC Synthase Knockout Mutants 45 senescence of acS6 leaves, which produce significantly less Three genes encoding ACC synthase were isolated from ethylene, would be expected. To test this possibility, homozy the inbred B73 and sequenced (see, e.g., SEQID NOs: 1-11). gous (i.e., acS6/acS6), heterozygous (i.e., ACS6/acS6), and Two members of the family (i.e., ACS2 and ACS7) are closely wild-type (i.e., ACS6/ACS6) plants were field-grown until 50 related (97% amino acid identity) whereas the third gene (i.e., days after pollination. At this stage, the oldest wild-type ACS6) is considerably more divergent (54% and 53% amino 50 leaves had senesced, whereas the corresponding ACS6/acs6 acid identity with ACS2 and ACS7, respectively). A reverse leaves were just beginning to senesce and acS6/acS6 leaves genetic approach was used to screen for transposon insertions remained fully green. These observations suggest that the in ACC synthase gene family members (Bensen et al. (1995) level of ethylene evolution may determine the timing of leaf Cloning and characterization of the maize An1 gene. Plant SeSCCC. Cell 7:75-84). 19 candidate lines were identified, 13 of which 55 Senescence can also be induced following prolonged expo were confirmed by terminal-inverted-repeat (TIR)-PCR to sure to darkness. To determine whether a reduction in ethyl harbor a Mu insertion in one of the three ACC synthase genes. ene evolution can delay dark-induced senescence, leaves Of these, 5 lines stably inherited the transposon in the first from adult plants were covered with sheaths to exclude light backcross to B73 which were backcrossed an additional 4 for two weeks. The leaves from younger plants (i.e., 20 DAP) times to reduce unwanted Mu insertions. Plants were then 60 were used to ensure that age-related senescence would not self-pollinated to generate homozygous null individuals occur during the course of the experiment and they remained which were identified by PCR using the ACCF1 and ACC-1 attached to the plant. Greenhouse grown maize was also primers (see Methods). PCR amplification of wild-type lines employed to avoid any heating that might occur in the field as or heterozygous null mutants with these primers resulted in a consequence of the sheathing. Following the two-week three different sized fragments corresponding to the three 65 dark-treatment, senescence was observed for virtually the ACC synthase genes whereas the products of PCR amplifi entire region of wild-type leaves that was covered (the region cation of homozygous null mutants lack the fragment corre covered by the sheath is indicated by the distinct transition US 7,838,730 B2 73 74 from yellow to green, FIG. 4 on left). The tip of ACS6/acs6 of Rubisco was observed in ACC-treated acs6 leaves when leaves had undergone dark-induced senescence but the rest of they remained in the light demonstrating that treatment with the covered region showed significantly less senescence ACC alone did not reduce the level of Rubisco. These data (FIG. 4 in center). In contrast, acs6/acs6 leaves remained fully demonstrate that the staygreen phenotype, which involves green (FIG. 4 on right). The degree of Senescence correlated 5 retention of chlorophyll and leaf protein such as Rubisco, can with the amount of ethylene produced by each, in which be complemented by exogenous ACC, suggesting that the ACS6/acs6 leaves produced just 70% of wild-type ethylene delay in senescence in these plants is a consequence of the and acs6/acs6 leaves produced only 14.6% of wild-type eth reduction in loss of ACC synthase expression in the acs6 ylene. These results suggest that ethylene mediates the onset mutant. of dark-induced senescence as it does natural Senescence. 10 Reducing Ethylene Delays Natural Leaf Senescence and They also indicate that the ACS6/acs6 heterozygous mutant Reduces Loss of Chlorophyll and Protein with a loss of one copy of ACS6 produces less ethylene and Drought is known to induce premature onset of leaf senes exhibits a weak Staygreen phenotype similar to that observed cence. To investigate whether the drought response is medi for the acs2 mutant which also exhibited a moderate (i.e., ated by ethylene and to determine whether reducing ethylene 40%) reduction in ethylene evolution. 15 evolution may increase drought tolerance in maize, homozy To examine if exogenous ACC could complement the acs6 gous acS6 and acs2 mutant plants and wild-type plants were mutant and reverse its staygreen phenotype, the third oldest, field-grown under well-watered (eight hours twice a week) sixth, and ninth leaf from ACS6/ACS6, acs2/acs2, and acs6/ and water-stressed conditions (four hours per week for a one acS6 plants were subject to dark-induced senescence at 20 month period that initiated approximately one week before DAP by covering them with sheaths for 7 days. All leaves pollination and continued for 3 weeks after pollination). Dur were fully green at the onset of the experiment and remained ing the period of limited water availability, drought-stressed attached to the plant. acs6/acS6 plants were watered daily plants exhibited leaf wilting and rolling, visible confirmation with water or 100 uM ACC for 7 days. Following 7 days, of drought stress. Following the water stress treatment, the dark-induced senescence had initiated in wild-type (i.e., extent of leaf senescence and function was measured. ASC6/ASC6) leaves although it had not progressed to the 25 Senescence of the oldest leaves was evident in wild-type extent observed following a 2 week dark treatment. The plants under well-watered conditions and even more signifi extent of dark-induced senescence increased as a function of cantly during drought conditions. Similar results were leaf age such that leaf 3 exhibited more senescence than did observed for acs2 plants. In contrast, no visible sign of senes leaf 6 or leaf 9 (which were younger), Suggesting that com cence was observed in acs6 leaves under well-watered or petency for senescence increases with leafage. Dark-induced 30 drought conditions. Interestingly, anthocyanin production senescence was also observed in leaf 3 of the acs2 homozy was also reduced in acS6 leaves. gous mutant although it was less pronounced than that To confirm that the staygreen phenotype correlates with observed in the corresponding wild-type leaves. Although no enhanced levels of chlorophyll, the level of chlorophylla and acS6 homozygous leaves exhibited dark-induced senescence b was measured. Chlorophyll decreased with leaf age as well consistent with the observations made in FIG. 4, dark-in 35 as with the age of the plants (FIG. 17 Panels A and D). As duced senescence similar to that of wild-type leaves was expected, the greatest decrease in chlorophyll correlated with observed when acs6 leaves were watered with 100 uMACC the visible onset of senescence. Under well-watered condi for 7 days. The ACC treatment did not affect acs6 leaves that tions, the level of chlorophyll in acs6 (ACS6 0/0) leaves was were not sheathed, demonstrating that the senescence up to 8-fold higher than in the corresponding leaves of wild observed for sheathed acs6 leaves was specific to the dark 40 type plants that had initiated senescence. Surprisingly, the treatment. level of chlorophyll in all acS6 leaves, including the youngest, Determination of the level of chlorophyll a+b from leaf 3 was substantially higher than in wild-type plants (FIG. 17 confirmed the visual results in that acs6 leaves retained sub Panel A). The level of chlorophyll inacs2 (ACS2 0/0) leaves stantially more chlorophyll after the 7 day dark treatment than was moderately higher than in wild-type plants. These results did wild-type leaves but did not do so when watered with 100 45 indicate that the increase in chlorophyll content inversely uMACC (FIG. 20 Panel A). The treatment with ACC in itself correlates with the level of ethylene production: the moderate did not induce premature loss of chlorophyll as chlorophyll reduction in ethylene in acs2 plants correlated with a moder was not lost from unsheathed leaves of acS6 mutants watered ate increase in chlorophyll content whereas the large reduc with ACC. acs2 leaves retained only moderately greater tion in ethylene in acS6 plants correlated with a substantial amount of chlorophyll did wildtype leaves. Similar results 50 increase in chlorophyll content. These results also demon were observed for leaf 6 and leaf 9 although the level of strate that reducing ethylene increases the level of chlorophyll chlorophyll in these younger leaves was higher than in the even in young leaves that are exhibiting maximum leaf func older leaf 3 samples as was expected (FIG. 20 Panel A). tion (see below). Similar trends were observed for total soluble leaf protein: Under drought conditions, the level of chlorophyll was acs6 leaves retained substantially more protein following the 55 reduced in mutant and wild-type plants but decreased to an dark treatment than did wild-type leaves but did not do so even greater extent in wild-type plants (FIG. 17 Panels B-C). when watered with 100 uMACC (FIG. 20 Panel B). For example, the level of chlorophyll in leaf 5 of water Western analysis for ribulose biscarboxylase (Rubisco) stressed wild-type plants decreased 2.5-fold relative to non demonstrated a substantial loss of Rubisco from dark-treated drought plants whereas it decreased by only 20% in leaf 5 of B73 leaves that was greater with the oldest leaves (leaf3) than 60 water-stressed acs6 plants (FIG. 17 Panel C). Consequently, the youngest (leaf 9) (FIG. 20 Panel C). Dark-treated acs6 reducing ethylene evolution resulted in a level of chlorophyll leaves retained substantially more Rubisco than did dark in the oldest leaves of acs6 plants that was up to 20-fold higher treated wild-type leaves and acs2 leaves retained a moderate than in the corresponding leaves of wild-type plants. As level of Rubisco (FIG. 20 Panel C). Dark-treated acs6 leaves observed for non-drought plants, the level of chlorophyll was watered with 100 uMACC lost an amount of Rubisco similar 65 higher in all acS6 leaves, including the youngest. Chlorophyll to that of dark-treated B73 leaves suggesting that ACC content inacs2 leaves also remained moderately higher under complemented the loss of ACC synthase expression. No loss drought conditions than in wild-type plants. Thus, loss of US 7,838,730 B2 75 76 ACS6 expression reduced responsiveness to water stress in Discussion that chlorophyll content was substantially maintained under In Summary, ACC synthase mutants affecting the first step those stress conditions that had elicited a significant loss of in ethylene biosynthesis were isolated in maize. These chlorophyll in wild-type plants. mutants exhibited a delay in natural, dark-induced, and Leaf protein also declined with leaf age and with plantage drought-induced leafsenescence and a staygreen phenotype. (FIG. 18 Panel D). As observed for chlorophyll, the most The delay in senescence was reversible following exposure to substantial decrease in protein correlated with the visible ethylene. ACC synthase mutant leaves exhibited a substan onset of senescence (FIG. 18 Panel D). Under non-drought tially higher rate of CO assimilation during growth under conditions, the level of protein in acs6 leaves was up to 2-fold normal or drought conditions. Surprisingly, improved leaf higher than in the corresponding leaves of wild-type plants 10 function was observed in all ACC synthase mutant leaves, that had initiated senescence (FIG. 18 Panel A). As observed including the youngest which had not entered either natural or for chlorophyll, the level of protein in all acs6 leaves, includ drought-induced senescence programs. These observations ing the youngest, was substantially higher than in wild-type Suggest that ethylene mediates the response of maize to water plants and the level of protein in acs2 leaves was moderately stress and that decreasing ethylene production serves as a higher than in wild-type plants (FIG. 18 Panel A). Exposure to 15 means to maintain leaf performance during water stress and conditions of drought resulted in a greater decrease of protein thereby increase its tolerance to drought conditions. As noted, in the oldest wildtype leaves than was observed inacs6 leaves ACC synthase mutants can have other advantageous pheno (FIG. 18 Panels B-C). As observed for non-drought plants, types, e.g., male sterility phenotypes, crowding resistance the level of protein was higherinallacs6 leaves, including the phenotypes, altered pathogen resistance, and the like. youngest. These results parallel those for chlorophyll and The above examples show that ethylene plays a significant indicate that protein content inversely correlates with the role in regulating the onset of leaf senescence in maize level of ethylene evolution. They also demonstrate that loss of whether during growth under well-watered conditions or dur ACC synthase expression in the acS6 mutant reduced respon ing conditions of drought which normally induces premature siveness to water stress in that protein levels were Substan leafsenescence. The reduction in ethylene evolution resulting tially maintained under those stress conditions that had elic 25 from loss of ACS6 expression is largely responsible for ited a significant reduction of protein in wild-type plants. directing natural and drought-induced leaf senescence. While Reducing Ethylene Maintains Leaf Function During Well not intending to be limited by any particular theory, loss of watered and Drought Conditions ACS6 expression may directly delay entry into the senes The maintenance of chlorophyll and protein in acS6 leaves cence program or may affect total ACC synthase expression Suggests that leaf function, e.g., the ability to transpire and 30 from all gene members. Knockout of ACS2 alone reduced assimilate CO, may also be maintained. To investigate this, ethylene production by approximately 40% and did result in the rate of transpiration, stomatal conductance, and rate of a small increase in chlorophyll and protein. In contrast, eth CO assimilation were measured in every leaf of well watered ylene production in acs6 leaves was reduced up to 90% and acs6 and wild-type plants at 40 DAP when the lower leaves of acs6 leaves contained substantially higher levels of chloro wild-type plants had begun to senesce. Theyoungest leaves of 35 phyll and protein. These observations Suggests that entry into acs6 plants exhibited a higher rate of transpiration (FIG. 5 the senescence program may be controlled by more than one Panel A) and stomatal conductance (FIG. 5 Panel B) than gene family member. control plants whereas no significant difference was observed The level of chlorophyll and protein in wild-type leaves in older leaves. In contrast, the rate of CO assimilation was was reduced substantially following water-stress but Substantially higher in all leaves of acS6 plants than in control 40 remained unaffected in acs6 leaves. These results indicate plants (FIG. 5 Panel C). Specifically, older leaves of acs6 two roles for ethylene in maize leaves: under normal growth plants exhibited more than a 2-fold higher rate of CO assimi conditions, ethylene may help to maintain the correct level of lation than wild-type plants and the rate of CO assimilation chlorophyll and protein in a leaf, whereas during water stress, in younger leaves increased from 50 to 100% (FIG. 5 Panel ethylene may serve to reduce the level of both. The observa C). 45 tion that a 40% reduction in ethylene resulted in a moderate The effect of reducing ethylene on the maintenance of leaf increase in chlorophyll and protein whereas a 90% reduction function under drought conditions was also investigated. The resulted in a Substantially larger increase in chlorophyll and rate of transpiration (FIG. 5 Panel D) and stomatal conduc protein Suggests that these leaf components may be quantita tance (FIG.5 Panel E) were significantly reduced in wild-type tively controlled by the level of ethylene produced in leaves. leaves when Subjected to conditions of drought (i.e., four 50 Greater increases in leaf chlorophyll and protein might be hours per week for a one month period starting approximately expected if ethylene production were reduced even further. one week before pollination and continuing through three Loss of chlorophyll and protein in wild-type maize sub weeks after pollination) whereas they remained largely unaf jected to drought conditions was accompanied by decreased fected inacs6 leaves, resulting in a Substantially higher rate of rates of transpiration, stomatal conductance, and CO assimi transpiration (FIG. 5 Panel D) and increased stomatal con 55 lation. In contrast, maintenance of chlorophyll and protein ductance (FIG.5 Panel E) for the mutant. In addition, drought levels in leaves of acS6 plants Subjected to drought conditions treatment resulted in a significant decrease in the rate of CO was accompanied by the maintenance of transpiration, sto assimilation in wild-type leaves but not in acS6 leaves, result matal conductance, and CO assimilation. These results Sug ing in up to a 2.5-fold increase in CO assimilation in younger gest that reducing ethylene not only confers a staygreen phe acS6 leaves and up to a 6-fold increase in older acS6 leaves 60 notype but actually maintains leaf function under stress than in the control (FIG.5 Panel F). These results indicate that conditions. The observation that ethylene controls the onset ethylene controls leaf function during conditions of drought of leaf senescence is consistent with the role of this hormone and a reduction in its production results in a delay of leaf in other species such as Arabidopsis and tomato (Davis and senescence in older leaves while maintaining leaf function in Grierson (1989) Identification of cDNA clones for tomato all leaves thus providing greater tolerance to drought. Similar, 65 (Lycopersicon esculentum Mill.) mRNAs that accumulate though less pronounced, results were obtained for ACS2 during fruit ripening and leafsenescence in response to eth (FIG. 6 Panels A-C). ylene. Planta 179:73-80; Abeles et al. (1992). Ethylene in