DOCSLIB.ORG

Addiction to Golgi-Resident PI4P Synthesis in Chromosome 1Q21.3–Amplified Lung Adenocarcinoma Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Addiction to Golgi-Resident PI4P Synthesis in Chromosome 1Q21.3–Amplified Lung Adenocarcinoma Cells Addiction to Golgi-resident PI4P synthesis in chromosome 1q21.3–amplified lung adenocarcinoma cells Lei Shia, Xiaochao Tana, Xin Liua, Jiang Yua, Neus Bota-Rabassedasa, Yichi Niub,c, Jiayi Luob,d, Yuanxin Xie, Chenghang Zongb, Chad J. Creightone,f,g, Jeffrey S. Glennh,i, Jing Wange, and Jonathan M. Kuriea,1 aDepartment of Thoracic/Head and Neck Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX 77030; bDepartment of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030; cGenetics and Genomics Graduate Program, Baylor College of Medicine, Houston, TX 77030; dCancer and Cell Biology Graduate Program, Baylor College of Medicine, Houston, TX 77030; eDepartment of Bioinformatics and Computational Biology, The University of Texas MD Anderson Cancer Center, Houston, TX 77030; fDepartment of Medicine, Baylor College of Medicine, Houston, TX 77030; gDan L Duncan Comprehensive Cancer Center, Baylor College of Medicine, Houston, TX 77030; hDivision of Gastroenterology and Hepatology, Department of Medicine, Stanford University School of Medicine, Stanford, CA 94305; and iDepartment of Microbiology and Immunology, Stanford University School of Medicine, Stanford, CA 94305 Edited by Melanie H. Cobb, University of Texas Southwestern Medical Center, Dallas, TX, and approved May 13, 2021 (received for review November 12, 2020) A chromosome 1q21.3 region that is frequently amplified in diverse here, we postulated that chromosome 1q21.3 amplifications confer cancer types encodes phosphatidylinositol (PI)-4 kinase IIIβ (PI4KIIIβ), an addiction to Golgi-resident PI-4 kinase activity. a key regulator of secretory vesicle biogenesis and trafficking. Chro- mosome 1q21.3–amplified lung adenocarcinoma (1q-LUAD) cells rely Results on PI4KIIIβ for Golgi-resident PI-4-phosphate (PI4P) synthesis, prosur- 1q-LUAD Cells Are Addicted to Golgi-Resident PI-4 Kinase Activity. vival effector protein secretion, and cell viability. Here, we show that Using small molecules IN-9 or compound B, which inhibit PI4KIIIβ 1q-LUAD cells subjected to prolonged PI4KIIIβ antagonist treatment with >1,000-fold selectivity over related PI-3 kinase family members acquire tolerance by activating an miR-218-5p–dependent competing (11), we exposed 1q-LUAD cell lines H2122 and H3122 to esca- endogenous RNA network that up-regulates PI4KIIα, which provides lating doses and found that, after 12 wk in culture, the cells dem- an alternative source of Golgi-resident PI4P that maintains prosur- onstrated three- to fivefold reduced sensitivity to these compounds CELL BIOLOGY vival effector protein secretion and cell viability. These findings dem- in proliferation, colony formation, and apoptosis assays (Fig. 1 A–D onstrate an addiction to Golgi-resident PI4P synthesis in a genetically and SI Appendix,Fig.S1). PI4KB gene copy numbers and PI4KIIIβ defined subset of cancers. protein levels were lower in drug-tolerant than parental 1q-LUAD cells (Fig. 1 E and F), suggesting reduced selection pressure on the cancer | oncogene addiction | Golgi | lipids 1q21.3 amplicon. However, small-interfering RNA (siRNA)-medi- ated depletion of the PI4KIIIβ–dependent secreted proteins clus- he term “oncogene addiction” was coined to describe cancer terin (CLU) and stanniocalcin-2 (STC2) induced apoptosis of drug- Tcells’ exquisite dependence on individual oncogenes to sustain tolerant cells (Fig. 1G), suggesting that drug-tolerant cells remained the malignant phenotype (1, 2). Examples include the BCR-ABL dependent on PI4P-driven effector protein secretion for survival. oncogene produced by a chromosome 9:22 translocation in chronic Golgi-resident PI4P levels, Golgi localization of the PI4P-binding myelogenous leukemia and the somatically mutated EGFR onco- protein GOLPH3, and the levels of PI4KIIIβ–dependent secreted gene in lung adenocarcinoma (LUAD) (3–5).Inbothcancertypes, proteins in conditioned medium (CM) samples decreased in pa- the mutant kinases are bona fide oncogenes in vitro and in vivo rental but not drug-tolerant 1q-LUAD cells (Fig. 2 A–F and SI (6, 7). Although patients treated with selective kinase inhibitors Appendix,Figs.S2andS3), and Golgi-resident PI4P levels remained attain profound clinical responses (8), chronic exposure of patients stable following short hairpin RNA (shRNA)-mediated PI4KIIIβ to targeted therapeutics is followed by disease relapse owing to an depletion in parental 1q-LUAD cells (Fig. 2G), supporting a almost universal reactivation of mutant kinase activity, demonstrat- ing that most cancers retain an underlying addiction to oncogene- Significance induced signaling pathways (2, 9). Elucidating the molecular under- pinnings of oncogene reactivation may lead to improved therapeutic Our findings identify a type of oncogene addiction process driven strategies. by a lipid that controls prosurvival effector protein secretion. The Heightened secretion of protumorigenic effector proteins pro- crosstalk between functionally redundant phosphatidylinositol motes metastasis and acquired resistance to targeted therapeutics (PI) 4-kinases maintains addiction and can be targeted with small (10, 11). The conventional secretory pathway directs the transport molecule kinase inhibitors that might be applicable to a geneti- of secretory vesicles from the endoplasmic reticulum to the plasma cally defined subset of cancers for which there are no effective membrane via the Golgi apparatus (12). Tensile forces exerted targeted therapies. on Golgi membranes activate secretory vesicle biogenesis and are mediated by a Golgi phosphoprotein-3 (GOLPH3)/F-actin protein Author contributions: L.S., X.T., and J.M.K. designed research; L.S., X.T., X.L., J.Y., N.B-R., complex (13). GOLPH3 binds to phosphatidylinositol (PI)-4-phos- Y.N., J.L., and C.Z. performed research; J.S.G. contributed new reagents/analytic tools; L.S., phate (PI4P), which tethers GOLPH3 to Golgi membranes and is Y.X., C.Z., C.J.C., and J.W. analyzed data; and J.M.K. wrote the paper. generated by the Golgi-resident PI-4 kinases PI4KIIα and PI4KIIIβ Competing interest statement: J.M.K. has received consulting fees from Halozyme. This (10, 13, 14). activity is unrelated to the current study. A chromosome 1q21.3 region that is frequently amplified in di- This article is a PNAS Direct Submission. verse cancer types encodes PI4KIIIβ (11, 15). Chromosome 1q21.3– This open access article is distributed under Creative Commons Attribution-NonCommercial- amplified LUAD (1q-LUAD) cells undergo apoptosis following NoDerivatives License 4.0 (CC BY-NC-ND). treatment with small-molecule PI4KIIIβ antagonists or depletion 1To whom correspondence may be addressed. Email: [email protected]. of PI4KIIIβ–dependent secreted proteins (11), establishing that This article contains supporting information online at https://www.pnas.org/lookup/suppl/ PI4KIIIβ–dependent secreted proteins are prosurvival effectors doi:10.1073/pnas.2023537118/-/DCSupplemental. in 1q-LUAD cells. On the basis of this conceptual framework, Published June 21, 2021. PNAS 2021 Vol. 118 No. 25 e2023537118 https://doi.org/10.1073/pnas.2023537118 | 1of9 Downloaded by guest on October 1, 2021 AB Comp B(μM) : 0 1 2 IN-9 (μM) : 0 1 2 H2122-P H2122-P H2122-BT H2122-9T D C E F G PI4KIIIβ 1 0.7 0.6 TGN46 Golgi fraction Fig. 1. Characterization of PI4KIIIβ antagonist-tolerant 1q-LUAD cells. (A) Proliferation assays on parental (P), compound B-tolerant (BT), and IN-9–tolerant (9T) H2122 cells. Cells were treated for 4 d with the indicated concentrations of compound B or IN-9. Half-maximal inhibitory (IC50) concentrations were determined. (B) Anchorage-independent colony formation assays on cell lines described in A. Values were normalized to DMSO controls. (C) Apoptosis quantified by Annexin V/Propidium iodide (PI) flow cytometry analysis on cells after treatment with compound B (Left)orIN-9(Right). (D) WB analysis of cleaved caspase-3 in cells treated with indicated concentrations of compound B (Upper)orIN-9(Lower). (E) Quantitative real-time PCR analysis of PI4KB gene copy numbers. (F) WB analysis of PI4KIIIβ in Golgi-enriched cellular fractions. TGN46 served as loading control. (G) Apoptosis quantified by Annexin V/PI flow cytometry analysis on H2122-BT cells and H2122-9T cells transfected with control (CTRL) or targeted siRNAs (siCLU or siSTC2). Data are shown as mean ± SEM of triplicate biological replicates. P values: two-sided t test in B and C and one-way ANOVA in E and G.*P < 0.05 and **P < 0.01. reactivation of PI-4 kinase activity in PI4KIIIβ–deficient cells. but not ectopic PI4KIIα–expressing H2122 cells (SI Appendix,Fig. Moreover, siRNA-mediated GOLPH3 depletion induced apopto- S4), suggesting that the increase in PI4KIIα–derived PI4P synthesis sis to a similar extent in parental and drug-tolerant cells (Fig. 2H), in ectopic PI4KIIα–expressing cells uncoupled GOLPH3 function suggesting that drug-tolerant cells remain dependent on GOLPH3- from PI4KIIIβ activity. Thus, PI4KIIα reactivated Golgi-resident driven secreted proteins for survival. PI4P synthesis in drug-tolerant cells. To assess the molecular basis for PI4KIIα up-regulation in PI4KIIIβ Inhibition Activates an miR-218-5p–Dependent Competing drug-tolerant cells, we performed chromatin immunoprecipitation Endogenous RNA Network to Up-Regulate PI4KIIα Expression. We (ChIP) assays on the PI4K2A gene promoter and found no evi- sought to identify an alternative source of PI-4 kinase activity in dence for enhanced recruitment of RNA polymerase II or active drug-tolerant
Load more

Recommended publications
  • Datasheet PDF (RUO)
    BioVendor - Laboratorní medicína a.s. Karásek 1767/1 621 00 Brno-Řečkovice a Mokrá Hora Date of issue: 05.01.2021 PRODUCT DATASHEET Stanniocalcin 2 Human HEK293 Cat. No.: RD172096100 Type: Recombinant protein Size: 0.1 mg Source: HEK293 Species: Human Description Total 289 AA. Mw: 31.9 kDa (calculated). C-Terminal Flag-tag, 12AA (highlighted). The AA sequence is identical to Swiss-Prot- O76061 (STC2, aa 25–302). Other names Stanniocalcin-related protein, STC-related protein, STCRP, STC2 Introduction to the molecule Stanniocalcin 2 (STC2) is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues including muscle, heart, pancreas, kidney, spleen, prostate, small intestine, colon and peripheral blood leukocytes. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. STC2 may have autocrine or paracrine functions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. STC2 is also known to be involved in the regulation of unfolded protein response in the endoplasmic reticulum (ER), as well as in the regulation of cell proliferation under hypoxic conditions. In addition, a series of recent studies have shown that STC2 is also associated with cancer development. The expression of STC2 is up-regulated in several cancer types, including gastric cancer, neuroblastoma, colon cancer, prostate cancer and breast cancer.
    [Show full text]
  • Download Download
    Supplementary Figure S1. Results of flow cytometry analysis, performed to estimate CD34 positivity, after immunomagnetic separation in two different experiments. As monoclonal antibody for labeling the sample, the fluorescein isothiocyanate (FITC)- conjugated mouse anti-human CD34 MoAb (Mylteni) was used. Briefly, cell samples were incubated in the presence of the indicated MoAbs, at the proper dilution, in PBS containing 5% FCS and 1% Fc receptor (FcR) blocking reagent (Miltenyi) for 30 min at 4 C. Cells were then washed twice, resuspended with PBS and analyzed by a Coulter Epics XL (Coulter Electronics Inc., Hialeah, FL, USA) flow cytometer. only use Non-commercial 1 Supplementary Table S1. Complete list of the datasets used in this study and their sources. GEO Total samples Geo selected GEO accession of used Platform Reference series in series samples samples GSM142565 GSM142566 GSM142567 GSM142568 GSE6146 HG-U133A 14 8 - GSM142569 GSM142571 GSM142572 GSM142574 GSM51391 GSM51392 GSE2666 HG-U133A 36 4 1 GSM51393 GSM51394 only GSM321583 GSE12803 HG-U133A 20 3 GSM321584 2 GSM321585 use Promyelocytes_1 Promyelocytes_2 Promyelocytes_3 Promyelocytes_4 HG-U133A 8 8 3 GSE64282 Promyelocytes_5 Promyelocytes_6 Promyelocytes_7 Promyelocytes_8 Non-commercial 2 Supplementary Table S2. Chromosomal regions up-regulated in CD34+ samples as identified by the LAP procedure with the two-class statistics coded in the PREDA R package and an FDR threshold of 0.5. Functional enrichment analysis has been performed using DAVID (http://david.abcc.ncifcrf.gov/)
    [Show full text]
  • Chronic Myeloid Leukemia: Mechanisms of Blastic Transformation
    Chronic myeloid leukemia: mechanisms of blastic transformation Danilo Perrotti, … , John Goldman, Tomasz Skorski J Clin Invest. 2010;120(7):2254-2264. https://doi.org/10.1172/JCI41246. Science in Medicine The BCR-ABL1 oncoprotein transforms pluripotent HSCs and initiates chronic myeloid leukemia (CML). Patients with early phase (also known as chronic phase [CP]) disease usually respond to treatment with ABL tyrosine kinase inhibitors (TKIs), although some patients who respond initially later become resistant. In most patients, TKIs reduce the leukemia cell load substantially, but the cells from which the leukemia cells are derived during CP (so-called leukemia stem cells [LSCs]) are intrinsically insensitive to TKIs and survive long term. LSCs or their progeny can acquire additional genetic and/or epigenetic changes that cause the leukemia to transform from CP to a more advanced phase, which has been subclassified as either accelerated phase or blastic phase disease. The latter responds poorly to treatment and is usually fatal. Here, we discuss what is known about the molecular mechanisms leading to blastic transformation of CML and propose some novel therapeutic approaches. Find the latest version: https://jci.me/41246/pdf Science in medicine Chronic myeloid leukemia: mechanisms of blastic transformation Danilo Perrotti,1 Catriona Jamieson,2 John Goldman,3 and Tomasz Skorski4 1Department of Molecular Virology, Immunology and Medical Genetics and Comprehensive Cancer Center, The Ohio State University, Columbus, Ohio, USA. 2Division of Hematology-Oncology, Department of Internal Medicine, University of California at San Diego, La Jolla, California, USA. 3Department of Haematology, Imperial College at Hammersmith Hospital, London, United Kingdom. 4Department of Microbiology and Immunology, Temple University, Philadelphia, Pennsylvania, USA.
    [Show full text]
  • Targeting Non-Oncogene Addiction for Cancer Therapy
    biomolecules Review Targeting Non-Oncogene Addiction for Cancer Therapy Hae Ryung Chang 1,*,†, Eunyoung Jung 1,†, Soobin Cho 1, Young-Jun Jeon 2 and Yonghwan Kim 1,* 1 Department of Biological Sciences and Research Institute of Women’s Health, Sookmyung Women’s University, Seoul 04310, Korea; [email protected] (E.J.); [email protected] (S.C.) 2 Department of Integrative Biotechnology, Sungkyunkwan University, Suwon 16419, Korea; [email protected] * Correspondence: [email protected] (H.R.C.); [email protected] (Y.K.); Tel.: +82-2-710-9552 (H.R.C.); +82-2-710-9552 (Y.K.) † These authors contributed equally. Abstract: While Next-Generation Sequencing (NGS) and technological advances have been useful in identifying genetic profiles of tumorigenesis, novel target proteins and various clinical biomarkers, cancer continues to be a major global health threat. DNA replication, DNA damage response (DDR) and repair, and cell cycle regulation continue to be essential systems in targeted cancer therapies. Although many genes involved in DDR are known to be tumor suppressor genes, cancer cells are often dependent and addicted to these genes, making them excellent therapeutic targets. In this review, genes implicated in DNA replication, DDR, DNA repair, cell cycle regulation are discussed with reference to peptide or small molecule inhibitors which may prove therapeutic in cancer patients. Additionally, the potential of utilizing novel synthetic lethal genes in these pathways is examined, providing possible new targets for future therapeutics. Specifically, we evaluate the potential of TONSL as a novel gene for targeted therapy. Although it is a scaffold protein with no known enzymatic activity, the strategy used for developing PCNA inhibitors can also be utilized to target TONSL.
    [Show full text]
  • Pi4k2a (BC022127) Mouse Tagged ORF Clone – MG207674 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MG207674 Pi4k2a (BC022127) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Pi4k2a (BC022127) Mouse Tagged ORF Clone Tag: TurboGFP Symbol: Pi4k2a Synonyms: MGC37783, Pi4k2 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Pi4k2a (BC022127) Mouse Tagged ORF Clone – MG207674 ORF Nucleotide >MG207674 representing BC022127 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACGAGACGAGCCCGCTAGTGTCCCCCGAGCGGGCCCAACCCCCGGAGTACACCTTCCCGTCGGGCT CCGGAGCTCACTTTCCGCAAGTACCGGGGGGCGCGGTCCGCGTGGCGGCGGCGGCCGGCTCCGGCCCGTC ACCGCCGTGCTCGCCCGGCCACGACCGGGAGCGGCAGCCCCTGCTGGACCGGGCCCGGGGCGCGGCGGCG CAGGGCCAGACCCACACGGTGGCGGTGCAGGCCCAGGCCCTGGCCGCCCAGGCGGCCGTGGCGGCGCACG CCGTTCAGACCCACCGCGAGCGGAACGACTTCCCGGAGGACCCCGAGTTCGAGGTGGTGGTGCGGCAGGC CGAGGTTGCCATCGAGTGCAGCATCTATCCCGAGCGCATCTACCAGGGCTCCAGTGGAAGCTACTTCGTC AAGGACTCTCAGGGGAGAATCGTTGCTGTCTTCAAACCCAAGAATGAAGAGCCATATGGGCACCTTAACC CTAAGTGGACCAAGTGGCTGCAGAAGCTATGCTGCCCCTGCTGCTTCGGCCGAGACTGCCTTGTTCTCAA CCAGGGCTATCTCTCAGAGGCAGGGGCTAGCCTGGTGGACCAAAAACTGGAACTCAACATTGTACCACGT
    [Show full text]
  • 1078-0432.CCR-20-1706.Full.Pdf
    Author Manuscript Published OnlineFirst on June 29, 2020; DOI: 10.1158/1078-0432.CCR-20-1706 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Gastrointestinal stromal tumor: challenges and opportunities for a new decade César Serrano1,2, Suzanne George3 1Sarcoma Translational Research Laboratory, Vall d’Hebron Institute of Oncology, Barcelona, Spain. 2Department of Medical Oncology, Vall d’Hebron University Hospital, Barcelona, Spain. 3Department of Medical Oncology, Sarcoma Center, Dana-Farber Cancer Institute, Boston, US. Running title: Review on gastrointestinal stromal tumor Key words: Avapritinib; circulating tumor DNA; gastrointestinal stromal tumor; imatinib; regorafenib; ripretinib; sunitinib. Financial support: This work was supported by grants (to C.S.) from SARC Career Development Award, FIS ISCIII (PI19/01271), PERIS 2018 (SLT006/17/221) and FERO Foundation. Conflicts of interest: C.S. has received research grants from Deciphera Pharmaceuticals, Bayer AG and Pfizer, Inc; consulting fees (advisory role) from Deciphera Pharmaceuticals and Blueprint 1 Downloaded from clincancerres.aacrjournals.org on October 1, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on June 29, 2020; DOI: 10.1158/1078-0432.CCR-20-1706 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Medicines; payment for lectures from Bayer AG and Blueprint Medicines; and travel grants from Pharmamar, Pfizer, Bayer AG, Novartis and Lilly. S.G. has received research funding to her institution from Blueprint Medicines, Deciphera Pharmaceutical, Bayer AG, Pfizer, Novartis; consulting fees (advisory role) from Blueprint Medicines, Deciphera Pharmaceuticals, Eli Lilly, Bayer AG. Corresponding author: Dr. César Serrano, Vall d’Hebron Institute of Oncology (VHIO), Vall d’Hebron University Hospital.
    [Show full text]
  • Nuclear PTEN Safeguards Pre-Mrna Splicing to Link Golgi Apparatus for Its Tumor Suppressive Role
    ARTICLE DOI: 10.1038/s41467-018-04760-1 OPEN Nuclear PTEN safeguards pre-mRNA splicing to link Golgi apparatus for its tumor suppressive role Shao-Ming Shen1, Yan Ji2, Cheng Zhang1, Shuang-Shu Dong2, Shuo Yang1, Zhong Xiong1, Meng-Kai Ge1, Yun Yu1, Li Xia1, Meng Guo1, Jin-Ke Cheng3, Jun-Ling Liu1,3, Jian-Xiu Yu1,3 & Guo-Qiang Chen1 Dysregulation of pre-mRNA alternative splicing (AS) is closely associated with cancers. However, the relationships between the AS and classic oncogenes/tumor suppressors are 1234567890():,; largely unknown. Here we show that the deletion of tumor suppressor PTEN alters pre-mRNA splicing in a phosphatase-independent manner, and identify 262 PTEN-regulated AS events in 293T cells by RNA sequencing, which are associated with significant worse outcome of cancer patients. Based on these findings, we report that nuclear PTEN interacts with the splicing machinery, spliceosome, to regulate its assembly and pre-mRNA splicing. We also identify a new exon 2b in GOLGA2 transcript and the exon exclusion contributes to PTEN knockdown-induced tumorigenesis by promoting dramatic Golgi extension and secretion, and PTEN depletion significantly sensitizes cancer cells to secretion inhibitors brefeldin A and golgicide A. Our results suggest that Golgi secretion inhibitors alone or in combination with PI3K/Akt kinase inhibitors may be therapeutically useful for PTEN-deficient cancers. 1 Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of Chinese Ministry of Education, Shanghai Jiao Tong University School of Medicine (SJTU-SM), Shanghai 200025, China. 2 Institute of Health Sciences, Shanghai Institutes for Biological Sciences of Chinese Academy of Sciences and SJTU-SM, Shanghai 200025, China.
    [Show full text]
  • Mouse Models for Hereditary Spastic Paraplegia Uncover a Role Of
    University of Dundee Mouse models for hereditary spastic paraplegia uncover a role of PI4K2A in autophagic lysosome reformation Khundadze, Mukhran; Ribaudo, Federico; Hussain, Adeela; Stahlberg, Henry; Brocke- Ahmadinejad, Nahal; Franzka, Patricia Published in: Autophagy DOI: 10.1080/15548627.2021.1891848 Publication date: 2021 Licence: CC BY Document Version Publisher's PDF, also known as Version of record Link to publication in Discovery Research Portal Citation for published version (APA): Khundadze, M., Ribaudo, F., Hussain, A., Stahlberg, H., Brocke-Ahmadinejad, N., Franzka, P., Varga, R-E., Zarkovic, M., Pungsrinont, T., Kokal, M., Ganley, I. G., Beetz, C., Sylvester, M., & Hübner, C. A. (2021). Mouse models for hereditary spastic paraplegia uncover a role of PI4K2A in autophagic lysosome reformation. Autophagy. https://doi.org/10.1080/15548627.2021.1891848 General rights Copyright and moral rights for the publications made accessible in Discovery Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from Discovery Research Portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain. • You may freely distribute the URL identifying the publication in the public portal. Take down policy If you believe that this document breaches
    [Show full text]
  • Bioinformatics Integrated Analysis to Investigate Candidate Biomarkers and Associated Metabolites in Osteosarcoma
    Wang et al. Journal of Orthopaedic Surgery and Research (2021) 16:432 https://doi.org/10.1186/s13018-021-02578-0 RESEARCH ARTICLE Open Access Bioinformatics integrated analysis to investigate candidate biomarkers and associated metabolites in osteosarcoma Jun Wang, Mingzhi Gong, Zhenggang Xiong, Yangyang Zhao and Deguo Xing* Abstract Background: This study hoped to explore the potential biomarkers and associated metabolites during osteosarcoma (OS) progression based on bioinformatics integrated analysis. Methods: Gene expression profiles of GSE28424, including 19 human OS cell lines (OS group) and 4 human normal long bone tissue samples (control group), were downloaded. The differentially expressed genes (DEGs) in OS vs. control were investigated. The enrichment investigation was performed based on DEGs, followed by protein–protein interaction network analysis. Then, the feature genes associated with OS were explored, followed by survival analysis to reveal prognostic genes. The qRT-PCR assay was performed to test the expression of these genes. Finally, the OS- associated metabolites and disease-metabolic network were further investigated. Results: Totally, 357 DEGs were revealed between the OS vs. control groups. These DEGs, such as CXCL12, were mainly involved in functions like leukocyte migration. Then, totally, 38 feature genes were explored, of which 8 genes showed significant associations with the survival of patients. High expression of CXCL12, CEBPA, SPARCL1, CAT, TUBA1A, and ALDH1A1 was associated with longer survival time, while high expression of CFLAR and STC2 was associated with poor survival. Finally, a disease-metabolic network was constructed with 25 nodes including two disease-associated metabolites cyclophosphamide and bisphenol A (BPA). BPA showed interactions with multiple prognosis-related genes, such as CXCL12 and STC2.
    [Show full text]
  • Expression Pattern of the PRDX2, RAB1A, RAB1B, RAB5A and RAB25 Genes in Normal and Cancer Cervical Tissues
    INTERNATIONAL JOURNAL OF ONCOLOGY 46: 107-112, 2015 Expression pattern of the PRDX2, RAB1A, RAB1B, RAB5A and RAB25 genes in normal and cancer cervical tissues ANDREJ NIKOSHKOV1, KRISTINA BROLIDEN2, SANAZ ATTARHA1,3, VITALI SVIATOHA3, ANN-CATHRIN HELLSTRÖM4, MIRIAM MINTS1 and SONIA ANDERSSON1 1Department of Women's and Children's Health, Division of Obstetrics and Gynecology, Karolinska Institute, Karolinska University Hospital Solna, 171 76 Stockholm; 2Department of Medicine Solna, Unit of Infectious Diseases, Center for Molecular Medicine, Karolinska Institute, Karolinska University Hospital, 171 76 Stockholm; 3Department of Oncology-Pathology, Karolinska Institute, 171 76 Stockholm; 4Department of Gynecological Oncology, Radiumhemmet, Karolinska University Hospital, 171 76 Stockholm, Sweden Received July 11, 2014; Accepted August 28, 2014 DOI: 10.3892/ijo.2014.2724 Abstract. Cervical cancer is the second most prevalent RAB1B transcript occurs in normal cervical tissue and in malignancy among women worldwide, and additional preinvasive cervical lesions; not in invasive cervical tumors. objective diagnostic markers for this disease are needed. Given the link between cancer development and alternative Introduction splicing, we aimed to analyze the splicing patterns of the PRDX2, RAB1A, RAB1B, RAB5A and RAB25 genes, which Alternative splicing is a process in which either different are associated with different cancers, in normal cervical combinations of exons or parts of exons are employed to tissue, preinvasive cervical lesions and invasive cervical generate new transcripts through the use of alternative-splicing tumors, to identify new objective diagnostic markers. Biopsies sites. More than 90% of human intron-containing genes of normal cervical tissue, preinvasive cervical lesions and undergo alternative splicing, which allows a single transcript invasive cervical tumors, were subjected to rapid amplification to encode a number of RNAs that produce various protein of cDNA 3' ends (3' RACE) RT‑PCR.
    [Show full text]
  • Anti-Aging: Senolytics Or Gerostatics (Unconventional View)
    www.oncotarget.com Oncotarget, 2021, Vol. 12, (No. 18), pp: 1821-1835 Review Anti-aging: senolytics or gerostatics (unconventional view) Mikhail V. Blagosklonny1 1Roswell Park Cancer Institute, Buffalo, NY 14263, USA Correspondence to: Mikhail V. Blagosklonny, email: [email protected], [email protected] Keywords: geroscience; senolytics; hyperfunction theory; aging; sirolimus Received: June 07, 2021 Accepted: July 05, 2021 Published: August 31, 2021 Copyright: © 2021 Blagosklonny. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Senolytics are basically anti-cancer drugs, repurposed to kill senescent cells selectively. It is even more difficult to selectively kill senescent cells than to kill cancer cells. Based on lessons of cancer therapy, here I suggest how to exploit oncogene-addiction and to combine drugs to achieve selectivity. However, even if selective senolytic combinations will be developed, there is little evidence that a few senescent cells are responsible for organismal aging. I also discuss gerostatics, such as rapamycin and other rapalogs, pan-mTOR inhibitors, dual PI3K/mTOR inhibitors, which inhibit growth- and aging-promoting pathways. Unlike senolytics, gerostatics do not kill cells but slow down cellular geroconversion to senescence. Numerous studies demonstrated that inhibition of the mTOR pathways by any means (genetic, pharmacological and dietary) extends lifespan. Currently, only two studies demonstrated that senolytics (fisetin and a combination Dasatinib plus Quercetin) extend lifespan in mice. These senolytics slightly inhibit the mTOR pathway. Thus, life extension by these senolytics can be explained by their slight rapamycin-like (gerostatic) effects.
    [Show full text]
  • CD29 Identifies IFN-Γ–Producing Human CD8+ T Cells with an Increased Cytotoxic Potential
    + CD29 identifies IFN-γ–producing human CD8 T cells with an increased cytotoxic potential Benoît P. Nicoleta,b, Aurélie Guislaina,b, Floris P. J. van Alphenc, Raquel Gomez-Eerlandd, Ton N. M. Schumacherd, Maartje van den Biggelaarc,e, and Monika C. Wolkersa,b,1 aDepartment of Hematopoiesis, Sanquin Research, 1066 CX Amsterdam, The Netherlands; bLandsteiner Laboratory, Oncode Institute, Amsterdam University Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; cDepartment of Research Facilities, Sanquin Research, 1066 CX Amsterdam, The Netherlands; dDivision of Molecular Oncology and Immunology, Oncode Institute, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands; and eDepartment of Molecular and Cellular Haemostasis, Sanquin Research, 1066 CX Amsterdam, The Netherlands Edited by Anjana Rao, La Jolla Institute for Allergy and Immunology, La Jolla, CA, and approved February 12, 2020 (received for review August 12, 2019) Cytotoxic CD8+ T cells can effectively kill target cells by producing therefore developed a protocol that allowed for efficient iso- cytokines, chemokines, and granzymes. Expression of these effector lation of RNA and protein from fluorescence-activated cell molecules is however highly divergent, and tools that identify and sorting (FACS)-sorted fixed T cells after intracellular cytokine + preselect CD8 T cells with a cytotoxic expression profile are lacking. staining. With this top-down approach, we performed an un- + Human CD8 T cells can be divided into IFN-γ– and IL-2–producing biased RNA-sequencing (RNA-seq) and mass spectrometry cells. Unbiased transcriptomics and proteomics analysis on cytokine- γ– – + + (MS) analyses on IFN- and IL-2 producing primary human producing fixed CD8 T cells revealed that IL-2 cells produce helper + + + CD8 Tcells.
    [Show full text]