Clonal Expansion of B and T Lymphocytes Defines a Spectrum of Monoclonal Lymphocytosis

Clonal Expansion of B and T lymphocytes Defines a Spectrum of Monoclonal Lymphocytosis

Sadaf Shaukat Memon

A thesis submitted in conformity with the requirements for the degree of Master of Science Laboratory Medicine & Pathobiology University of Toronto

Clonal Expansion of B and T lymphocytes Defines a Spectrum of Monoclonal Lymphocytosis

Sadaf Shaukat Memon

Master of Science

Laboratory Medicine & Pathobiology University of Toronto

2011

ABSTRACT

Monoclonal B lymphocytosis (MBL) has been recognized as a novel diagnostic condition. This

study aims at the identification of clonal lymphocytosis in the patients with asymptomatic

lymphocytosis. A total of 203 patients were evaluated for clonal B and T lymphocytosis by using

flow cytometry and multiplex-PCR. Among them clonal B- or T-cells were detected in 54.2% of the cases, of which 38.4% were clonal B-cells and 15.8% were clonal T-cells cases. By

immunophenotype, MBL was classified into the chronic lymphocytic leukemia (CLL) type

(21.7%) and non-CLL-type (7.4%). Flow cytometry analysis and cell counts were used to

determine the size of clonal population, and the data indicate that MBL and CLL are present in a

continuous spectrum of clonal expansion. The findings may contribute to the current

understanding of MBL and evaluation of incidental lymphocytosis. Further studies are required

to evaluate clonal progression as a precursor stage of lymphoid malignancy.

ACKNOWLEDGEMENTS

I would first like to express my sincere gratitude to my mentor and research supervisor Dr. Chen Wang for his continuous support throughout the term of this project. His guidance, enthusiasm and immense knowledge motivated me to pursue further knowledge and improve my skill set in science.

I whole heartedly thank my committee members Dr. B. Fernandes, Dr. M. Minden, Dr. K. Pritzker for their kind guidance, suggestions and critiques. You are leading minds and I will always be indebted for your kind advice and directions during the completion of my thesis project.

I also wanted to thank G.S.Yang for teaching me PCR techniques and providing me with technical support on my project work and my fellow lab members especially Jianing Zheng for teaching me cell culturing techniques and Edward Parker for his help in editing my thesis writing.

I would pay my sincere gratitude to the department of LMP and U of T for giving me this opportunity to explore this wonderful field of science. I really feel proud to be a part of this wonderful program.

I would like to thank my Dad and Mom for their boundless efforts and love in bringing me up and making me the person I am today. Special thanks also goes to my mom for taking care of my sweet little one year old daughter, without her kind support this task would have been very difficult. I would also like to thank my brother for his help in editing and formatting my thesis, and my sister for criticizing my presentations. Finally I would thank my loving husband for always standing beside me at each and every step of my life.

iii

TABLE OF CONTENTS

List of Abbreviations………………………………………………………………...………….viii

List of Tables……………………………………………………………………………………..vi

List of Figures……………………………………………………………………………...... …..vii

Abstract………………………………………………………………...... ……….....ii

CHAPTER: I Clonal lymphocytosis and its relevance to lymphocytic neoplasia…….....…1

1 Clonal lymphocytosis and discovery of MBL………………………………………………..1

2 MBL as a novel diagnostic entity…………………………………………………………….3

2.1 Clinical and population-screening MBL………………………………………….…8

2.2 CD5-ve MBL (MLUS)……………………………………………………………...9

3 CD5+ MBL as a precursor condition of CLL……………………………………………….11

3.1 Prognostic factors of CLL……………………………………………………….…14

4 Clonal T-Lymphocytosis and T-cell lymphoproliferative disorders………………………..17

4.1 T-cell immunophenotype & T-cell receptor (TCR)……………………………...17

4.2 Precursor T-cell neoplasms and mature/peripheral T-cell neoplasms………...... 20

4.2.1 Precursor T-cell neoplasm……………………………………….…….20

4.2.2 Mature/peripheral T-cell neoplasms…………………………….……..21

CHAPTER: II Laboratory methods for the detection of clonal lymphocytosis………...…24

1 Overview……………………………………………………………………………………..24

2 Flow cytometry……………………………………………………………………………....26

3 Molecular clonality tests…………………………………………………………………..…28

iv 3.1 Southern blot………………………………………………………………………....29

3.2 Polymerase Chain Reaction (PCR)…………………………………………………..29

3.3 BIOMED-2 multiplex PCR……………………………………………………..……30

CHAPTER: III Identification of clonal B and T lymphocytes among patients with peripheral lymphocytosis………………………………………………………………………34

1. Introduction………………………………………………………………………………..34 1.1 Rationale and hypotheses…………………………………………………………..35

2. Patients & Methods……………………………………………………………..…………...36

2.1 Patients…………………………………………………………………………..…36

2.2 Flow cytometry analysis of B & T-lymphocytes……………………………….….37

2.3 PCR amplification for IgH, TCR-β and TCR-γ genes………………………….....40

2.3.1 DNA extraction………………………………...... 40

2.3.2 Primers design for IgH, TCR-β and TCR-γ and multiplex PCR………..…40

2.3.3 PCR product analyses…………………………………………..………….42

3. Results…………………………………...……………………………………………….47

3.1 CD5+ MBL and CLL……………………………………………..……...…………50

3.2 CD5- MBL…………………………………………………………………...…….51

3.3 T-cell clonal……………………………………………………………….……….52

3.4 Comparison of PCR and flow cytometry for B-cell clonality detection…………...53

3.5 The presence of clonal T-cells in Monoclonal B lymphocytosis…………………...53

4 Discussions…………………………………………………………………………….….54

CHAPTER: IV Conclusion & Future Studies…………………………………...…….…....59

REFERENCES………………………………………………………………………………….62

v LIST OF TABLES

1. Table 1: Prevalence of MBL in population studies by using flow cytometry ….…….…5

2. Table 2: Primer numbers in each PCR reaction tube………………………………….…41

3. Table 3: The primer design and multiplex combinations of the standardized BIOMED-2 multiplex PCR protocol ………………………………...……………………………….42

4. Table 4: Summary of 203 patients with asymptomatic peripheral lymphocytosis ……...49

5. Table 5: T-cell clonal cases characteristics………………………………………………53

6. Table 6: The presence of clonal T-cells in MBL ………………………………………..53

7. Table 7: Comparison of PCR and flow cytometry for B-cell clonality detection…….…54

vi LIST OF FIGURES

1. Figure 1: PCR analysis of IgH (VH-JH) rearrangements and BIOMED-2 PCR primers...... 31

2. Figure 2: TCR-β and TCR-γ gene complex and primers…………………………..……...32

3. Figure 3: Detection of non-clonal lymphocytosis & B-lymphocyte clonality by Flow- Cytometry Figure 5: Typical negative patterns for TCR- β, A, B and C…………………39

4. Figure 4: Gel electrophoresis of the PCR products derived from amplification at the IgH locus in clonal and polyclonal controls of well-defined clonality status………………….43

5. Figure 5: Size of PCR products and a typical GeneScan image for VDJ of IgH gene.…..44

6. Figure 6: Positive and negative image patterns for VDJ of IgH gene……………….……45

7. Figure 7: Typical Negative Patterns for TCR- β, A, B and C………………….…….….46

8. Figure 8: Typical Positive Pattern for TCR-β, A, B and C……………………………….46

9. Figure 9: Distribution of lymphocyte counts CLL-type MBL & CLL…………………....51

10. Figure 10: Distribution of lymphocyte counts of CD5-MBL cases……………………….52

vii LIST OF ABBREVIATIONS

ALC: Absolute lymphocyte counts

ADCC: Antibody dependent cytotoxicity

ATLL: Adult T-cell leukemia/lymphoma

B-ALC: Total B-cell count

C-ALC: Total clonal B- cells

CLL: Chronic lymphocytic leukemia

CD: Cluster of Differentiation

CC: Colorectal Carcinoma

D: Diversity

EBV: Epstein - Barr virus

FISH: Fluorescence in situ hybridization

FAP: Familial Adenomatous Polyposis

HTLV-1: Human T-cell leukemia virus type 1

Ig: Immunoglobulin

IgH: Immunoglobulin heavy chain

IGHV: Immunoglobulin heavy variable gene

IWCLL: International Workshop on CLL

J: Joining

viii κ/ λ: Kappa/Lambda

LDT: Lymphocyte doubling time

LPDs: Lymphoproliferative disorders

MBL: Monoclonal B-cell lymphocytosis

MHC: Major histocompatibility complex

MF: Mycosis fungoides

MGUS: Monoclonal gammopathy of undetermined significance

MLUS: Monoclonal lymphocytosis of undetermined significance

MM: Multiple Myeloma

NCI: National Cancer Institute

NHL: Non-Hodgkin lymphoma

PB: Peripheral blood

PBS: Phosphate buffered saline

RBC: Red blood cell

SS: Sézary Syndrome

T-ALC: Total T-cell count

TCR: T-cell receptor

TCR-α: T-cell receptor alpha

TCR-β: T-cell receptor beta

TCR-γ: T-cell receptor gamma

ix TCR-δ: T-cell receptor delta

TdT: Terminal deoxynucleotidyl transferase

T-LGL: T-cell large granular lymphocytic leukemia

T-PLL: T-cell prolymphocytic leukemia

V: Variable

ZAP-70: Zeta-chain-associated protein kinase 70

x CHAPTER: I

Clonal Lymphocytosis and its relevance to lymphocytic neoplasia

1. Clonal lymphocytosis and discovery of MBL

Clonal lymphocytosis refers to the presence of a population of B or T lymphocytes derived from a single common precursor. This phenomenon may involve the lymphocyte populations in any or all of the blood, bone marrow or lymphoid tissues. Lymphoid cells (B- and T-cells) at almost any stage of differentiation or maturation can form a clone of cells which are arrested at a particular stage of development. Thus, clonal cell populations may bear the immunophenotypic markers that one would expect of normal lymphocytes reaching the stage at which maturation has been arrested. However, the significance of detecting clonal lymphocytosis is unclear, and may be attributed to a range of different causes.

Clonal lymphocytosis is a hallmark of lymphoproliferative disorders (LPDs). For instance, if clonal B-cells are found with an immunophenotype that is typical of chronic lymphocytic leukemia (CLL), it could be diagnostic of either monoclonal B-cell lymphocytosis (MBL) or CLL based on the number of circulating B-cells counts. Clonal B-cells may also be diagnostic of other B-lymphoid malignancies, depending on the particular immunophenotypic, morphological or genetic features of the neoplastic cells. Similarly, if clonal T-cells are found with the phenotype of T-cell large granular lymphocytic leukemia (T-LGL), this finding could be attributed to T-LGL. It is also possible that benign clonal lymphocytosis may represent an intermediate condition between a covert clonal population and indolent tumors, for instance during MBL. However, it should be remembered that the finding of clonal lymphocytes may not always be diagnostic of a defined lymphoid malignancy. Several benign clinical conditions might also have a clonal origin, including CD8+ T-lymphocytosis, frequent oligoclonal lymphoproliferations associated with the initial stages of Epstein-Barr Virus (EBV) infection,

various benign cutaneous T-cell proliferations (such as lymphoid papulosis), and benign gammopathies.

In addition, it is interesting to note that clonal lymphocytosis occurs at a high frequency among elderly individuals, suggesting that it may arise as a phenomenon of lymphoid senescence because of age related restriction of the B-cell repertoire [1, 2]. This possibility of age-related decline in the diversity of the B-cell repertoire may be accounted for by the appearance of B-cell clonal expansions. The most striking example is provided by the age-associated increase in the incidence of serum monoclonal immunoglobulins, which occurs in both mice and humans monoclonal gammopathies of undetermined significance (MGUS) [3, 4].

With the availability of a wide range of monoclonal antibodies and advancement in immuno- enzymatic and molecular clonality testing techniques, great strides have been made in the diagnosis of clonal lymphocytosis. In B cells, clonality can be established by the detection of a immunoglobulin (Ig) light chain restriction, either kappa (κ) or lambda (λ), on the circulating lymphoid cells, or by clonal rearrangement of the immunoglobulin (Ig) genes. In T-cells, it is determined by clonal rearrangement of the T-cell receptor (TCR) genes. It is interesting to note that, the vast majority of lymphoid malignancies (>98%) contains identically (clonally) rearranged Ig and/or TCR genes. Based on that, the analysis of TCR and Ig genes has increasingly become a useful tool for determining the presence of clonality and the cell lineage involved in lymphoproliferative disorders [5, 6].

The importance of achieving sensitive techniques for the detection of clonal lymphocytosis was recently emphasized by the remarkable discovery of clonal B-cells in otherwise healthy individuals. In 1991, during a public health survey into the effects of living near environmental hazards, the United States Center for Disease Control discovered clonal B-cells in 9 out of 1499 (0.6%) adults over the age of 45 [7, 8]. Subsequently Rawstron et al, [9] identified monoclonal lymphocytosis in 3.5% of 910 hospital outpatients over the age of 18 years and with no history or indication of hematological disorders, along with a male predominance and an increasing prevalence with age. Later on Ghia et al, [1] also documented monoclonal B-cell populations in over 6% of healthy outpatients over the age of 65. In light of these landmark studies, there has been a growing interest in clonal lymphocytosis as an entity of potential clinical significance. Hence, an international panel of experts designated the term Monoclonal B-cell Lymphocytosis

(MBL) to this newly discovered entity and set up a unified diagnostic criteria to define this unique condition in 2005 [10].

Thus, this revolutionary discovery has highlighted the importance of finding low levels of circulating clonal lymphocytes in healthy population. Based on the above studies on healthy individuals with normal absolute lymphocyte counts (ALC), there may be an even higher chance of discovering clonal lymphocytes in patients with asymptomatic absolute lymphocytosis. Accordingly, the patients with incidental lymphocytosis should not be neglected, and should be evaluated further for the presence of clonal cell populations, especially since it is possible that this condition could be a precursor or early stage of lymphoid malignancy rather than just a reactive or age related senescence phenomenon.

2. MBL as a novel diagnostic entity

Since the initial finding of MBL, this entity has been the area of growing interest. Many studies have indicated that the presence of very low levels of clonal B-cells populations in healthy individuals can be detected by flow cytometry, therefore highlighting the importance of establishing formal diagnostic criteria to describe this revolutionary discovery. Thus, in 2005, MBL was recognized as a novel diagnostic entity, and a set of formal diagnostic criteria were proposed by Marti et al, [10] on behalf of the International Familial CLL Consortium. These diagnostic criteria were based on the identification of clonal lymphocyte populations by immunophenotypic characterization. The unified criteria were proposed in order to avoid variation and facilitate comparisons across geographic, ethnic and different risk group, as well as to standardize and facilitate future scientific studies into this entity.

The criteria of MBL requires the detection of a monoclonal B-cell population in the peripheral blood with an overall kappa: lambda (κ/λ) ratio of >3:1 or <0.3:1 or more than 25% of B cells lack or express low levels of surface immunoglobulin or possess a disease-specific immunophenotype. In addition, on repeat assessment the monoclonal B-cell population should be stable over a period of 3 months. The exclusion criteria for MBL includes lymphadenopathy and organomegaly, the detection of a B-lymphocyte count >5 x109/L, and any other feature diagnostic of a B-lymphoproliferative disorder or associated autoimmune/infectious disease.

The normal polyclonal B-cells have a κ/λ ratio range of 1.0–3.0. All the cells from monoclonal B-cells would express only one type of light chain, i.e they are κ or λ light chain restricted in clonal B-cells and indicate clonal B cell expansion. However, the detection sensitivy based on κ/λ ration is affected the presence of polyclonal B –cells. Practically, a skewed κ/λ ration of >3 or <0.3 is considered the cut off for the presence of a clonal B-cell population.

As several studies have noted phenotypic subgroups of MBL, sub-classification was also formulated as part of this diagnostic framework, which classified MBL into three groups: (i) CLL-like phenotype MBL, (ii) atypical CLL-phenotype MBL, and (iii) non-CLL like phenotype MBL. The CLL-like phenotype MBL accounts for the majority of reported cases, and is characterized by the proliferation of cells with the typical phenotype of CLL, i.e. positive for the surface markers CD19, CD23, and CD5; weakly positive or negative for CD20, CD79b, CD10, and FMC7; and dim expression of surface immunoglobulin (Ig) [11]. On the other hand, the atypical-CLL phenotype MBL co-expresses CD5 with CD19, negative for CD23, brightly expressed CD20, light chain restriction and moderate to bright surface Ig expression. Finally, non-CLL phenotype MBL (CD5- MBL) is positive for CD19, negative for CD5, brightly expressed CD20, light chain restricted and moderate to bright surface Ig expression.

Table: 1 Prevalence of MBL in Population-Studies by using flow cytometry

Study Group Flow cytometry CLL-like MBL prevalence

Population studied Age : # of cases # All ages in > 60 years (median (N) of study % range) colors %

Italy primary care [1] 74 500 4 5.5 5.5 (65-98)

US residential population [8] 53 1926 2 0.6 >0.6 (40-78)

US blood donors [12] 45 5141 2 0.14 0.9 (18-79)

UK hospital outpatients [13] 57 910 4 3.5 5.0 (40-90)

UK hospital outpatients [13] 74 1520 4 5.1 5.1 (60-80)

Italy residential population 55 1725 5 7.4 8.9 [14] (18-102)

Spain primary care [15] 62 608 8 12.0 >20 (40-97)

Among MBL, the CLL-type MBL or CD5+ MBL bears close resemblance to CLL and has the highest reported prevalence amongst the first-degree relatives of CLL patients. Several epidemiological studies have investigated the prevalence of CLL and other lymphoproliferative disorders and reported that relatives of CLL patients have elevated risks of CLL, with the largest study showing an eightfold increase in risk [1, 9]. A study in Sweden used the Swedish Family- Cancer Database [9] to test increased familial risks of CLL and other lymphoproliferative tumors. They assessed 14,336 first-degree relatives of 5918 CLL cases and 28,876 first-degree relatives of 11,778 controls. Cancer risks in relatives of cases were compared with those in relatives of controls and it was noted that the relatives of cases were at significantly increased risk for CLL, with a relative risk (RR) of 7.52. For non-Hodgkin lymphoma (NHL) the RR was 1.45 and for Hodgkin lymphoma the RR was 2.35. It was also concluded that CLL risks were

similar in parents, siblings, and offspring of cases, and both male and female relatives. RR was not affected by the case's age at diagnosis. A second study in Sweden [1] also evaluated the risk of CLL and lymphoproliferative disorders among first-degree relatives of CLL cases compared to first-degree relatives of controls. They used the population-based registry data from Sweden to evaluate outcomes in 26,947 first-degree relatives of 9,717 chronic lymphocytic leukemia patients (diagnosed 1958-2004) compared with 107,223 first-degree relatives of 38,159 matched controls and calculated the RR. Compared to relatives of controls, relatives of chronic lymphocytic leukemia patients had an increased risk for CLL with an RR of 8.5 and other NHLs with RR of 1.9. These studies clearly suggested that relatives of CLL are at higher risk for CLL than the general population.

It is also interesting to note that the proportion of individuals with MBL and the absolute numbers of clonal cells detected in screening studies are closely related to the sensitivity of methods used for detection. The first population-based study on MBL in 1990-1991 used a two- color flow cytometric approach, the common method for immunophenotypic analysis at that time [16, 17]. They obtained lymphocyte subset counts for 1,926 adults aged 40-76 years in a series of environmental health studies between 1991-1994, and conducted two follow-ups in 1997 and 2003 on individuals with B-cell lymphocytosis, including nine participants with MBL. To ascertain the clinical implications of MBL, they reviewed medical records and death certificates. According to their study the overall prevalence of MBL was 0.57% (11/1,926).

Subsequent studies using four color flow cytometry were performed in United Kingdom and Italy [18, 19] assessing the prevalence of clonal B cells in individuals with normal blood counts. These studies showed a much higher prevalence of CD5+ MBL, which was detected in more than 5% of adults, aged over 60 [18, 19]. The UK study [18] involved 910 hospital outpatients with no history of hematological malignancy and with normal blood counts. By using 4-colour flow-cytometry, cells with a CLL phenotype and evidence of light-chain restriction were detected in 3.5% of patients. Additionally, they also observed that the prevalence increased with age, from 2.1% in individuals between 40 and 60 year of age to 5.0% for individuals over the age of 60. The highest prevalence was found in 70 to 79 year-old individuals, with 8.2% of men and 7.3% of women having a detectable CLL phenotype population. Besides age, a male predominance was consistent for all age groups, although the gender bias became less

pronounced in the 70- to 79-year-old group. Thus, this study identified CD5+ MBL cells with the characteristics of CLL in 3.5% of individuals over the age of 40.

The Italian study [19] group used the same 4-color flow cytometry approach on 500 individuals >65 years of age from a rural community referred for routine blood tests, with a normal blood cell count and no evidence of lymphocytosis. By using 4-color staining along with Ig light chain restriction and IgH-PCR analysis they demonstrated the presence of monoclonal B-cell populations in the blood of 3.8% of individuals. Their study also revealed that the prevalence of monoclonal B cells increased with age, being higher in individuals above 75 years, and a male predominance was also evident. With extended cytofluorographic analysis they also demonstrated a heterogeneous phenotype of monoclonal B cells that allowed the classification of circulating clones into classic CLL-like (9 cases), atypical CLL-like (3 cases), and non–CLL-like (7 cases) cells. Thus, both the UK and Italian studies suggested that the prevalence of MBL increases with age and has a male predominance. In addition to CLL-like clones, non-CLL- phenotype MBL cases were detected in 1–2% of individuals based on a perturbation of κ/λ ratio.

Both the groups have subsequently performed further studies on MBL in the general population, with a focus on biological investigations. The second Italian study [20] used an even more sensitive flow cytometry approach (5-color) and identified a higher prevalence (7.4%) of MBL among 1725 healthy individuals belonging to a rural population in Northern Italy, with a mean age of 55.2 years. Monoclonal B lymphocytes were detected in 128 of the 1725 participants (7.4%), and included 20 CD5- MBL cases, 19 atypical CLL MBL cases, and 89 CLL-like MBL cases, the latter being detected in 5.2% of the whole population studied. Analysis of IGHV-D-J rearrangements was performed only in the monoclonal CLL-like MBL cases and demonstrated a distinct monoclonal rearrangement in each of those patients. This revealed that the Ig gene repertoire in low-count MBL differs from both mutated and unmutated CLL, suggesting that the detection of MBL in an otherwise healthy subject is not always equivalent to a preleukemic state.

A more recent study from Salamanca (Spain) [21] used the highest sensitivity flow cytometry approach available to analyze peripheral blood cells in primary care individual. Using this strategy the investigators identified a very high prevalence of CLL phenotype cells in the general population, which were detectable in more than one in five individuals over 60 years old. They investigated the frequency of circulating monoclonal B cells in 608 healthy subjects older than 40 years with normal blood counts, using a highly sensitive 8-color flow cytometry approach which 7

involved the screening of at least 5 x 106 peripheral blood (PB) leukocytes. This technique revealed that a markedly higher frequency of PB monoclonal B cells, with CLL-like B cells detected in approximately 12% of participants, thus supporting the notion that detection of MBL may be largely dependent on the sensitivity of the flow cytometry approach being applied.

Thus, it is evident that the proportion of individuals with MBL and the absolute numbers of abnormal cells detected in these studies are closely related to the sensitivity of methods used for detection. The discovery of MBL has raised a host of clinical and biologic questions that have been the focus of intense investigation over the last two decades. Future studies of MBL should be directed towards determining its relationship to clinical disease, particularly in individuals from families with a genetic predisposition towards developing CLL.

2.1 Clinical and population-screening MBL

A further distinction can be made between MBL cases detected during population screening surveys or research studies, known as population-screening MBL, and those detected during routine clinical practice, typically referred to as clinical MBL. The majority of clinical MBL cases (85%) are identified during the clinical evaluation of abnormal blood counts, mostly due to lymphocytosis. Studies suggest that the average risk of progression requiring therapy among individuals with clinical CLL-like MBL is approximately 1-2% per year [19, 22, 23].

By using high sensitivity assays clinical and population-screening MBL can be identified in up to 20% of the general population using [15]. As population screening for MBL is not used outside of epidemiologic studies, the issue oncologists currently encounter is how to counsel individuals with MBL identified in routine practice [24, 25]. An area of controversy has also surrounded whether or not if it is ethical to inform individuals with population-screening MBL identified during research studies, as it may lack clinical significance. However there has been a consensus that the research subjects should be informed of new information gained from their participation [25]. It is also evident that this fact might increase undue anxiety and possibly raise the issue of discrimination by their employees and health insurance companies [24]

Although studies have suggested that there is a measurable risk of progression in patients with clinical CD5+ MBL, progression risk is presumed to be extremely rare in population screening 8

MBL. It is also interesting to note that the biology of population screening MBL differs from that of CLL [14, 26]. While seemingly a marginal discrepancy, the vast majority of clinical MBL cases occurs within the context of absolute lymphocytosis and have an abnormal B-cell count in excess of 1.9 x 109 cells/L [27]. Given the strong link that has been documented between circulating abnormal B-cell count and clinical outcome in MBL patients [19, 22] these observations strongly support the notion that MBL cases identified in the context of incidental lymphocytosis represent a clinically significant subgroup that requires follow-up and further investigation. Thus, it is recommended that clinical MBL patients undergo regular evaluation by a hematologist and the individuals with population-screening MBL undergo a routine annual examination by their primary care provider.

2.2. CD5- MBL (MLUS):

Clonal B-cells of CD5- phenotype in otherwise healthy individuals was first described over 20 years ago. One population-based study revealed a prevalence of approximately 1-2% of CD5- MBL in adult outpatients with a median age of 78 years and no associated hematologic abnormalities [1]. Another study observed non-CLL-like MBL in 1.4% of 500 healthy people [9]. Despite this prevalence, little is known about the biology or clinical significance of this condition [28, 29]. Several studies have commented on the close resemblance of MLUS (monoclonal lymphocytosis of undetermined significance) cells to normal B-cells rather than CLL B-cells [28, 29].

Han et al. [30] first reported a group of benign variant CLL cases. The group of patients was identified among stage 0 CLL for their benign clinical course, without disease progression during a follow-up period of 6–24 years. They initially proposed the term benign monoclonal B cell lymphocytosis for these patients, and considered them as a benign variant of CLL. Subsequently, a series of studies by Aman and Mellistedt [28] suggested those patients with benign clonal B lymphocytosis represented a B cell disorder different from CLL. Unlike CLL-phenotype MBL, CD5- MBL probably bears no relationship to CLL and the lack of CD5 expression possibly suggests a cell origin different from that of CLL or CLL-phenotype MBL [31]. The clinical outcome and progression risk of this condition remain unclear as fewer studies have specifically addressed the biological or clinical characteristics of this entity. However, based on the phenotype and morphology of clonal cells, CD5- MBL has been implicated in the etiology of 9

non-CLL B lymphocyte neoplasia such as splenic B-cell lymphoma/leukemia, hairy cell leukemia and lymphoplasmacytic lymphoma [27, 31]. In contrast to CLL-type MBL, a clear disease-specific immunophenotype is lacking for CD5-ve MBL, therefore making the detection of clonality particularly important for the diagnosis of this subgroup.

Our lab [32] has previously reported three patients with MLUS, which morphologically were similar to CLL but lacked the typical CLL phenotype. Based on the morphology of the clonal B- lymphocytes all the three cases were initially considered as CLL, but immunophenotypic analysis revealed its non-CLL phenotype i.e. CD5-ve and CD23-ve. In all these cases, clonal B- cells were detected by light chain restriction. Another interesting finding of this study was the surface Ig expression, which was of high density in two of these cases, therefore contrasting with the low density Ig expression observed in CLL. The clonal B-cells were also negative for CD25, CD10 and CD11c in all three cases. The patients were followed for a period of 3-10 years, in which their lymphocytosis was non-progressive and asymptomatic. In view of phenotypic results of this study, it is unlikely that MLUS represents a pre-CLL or an early stage of CLL development. Immunophenotyping therefore aids in the clear differentiation of MLUS cases from CLL cases.

The second study by our group [33] was a retrospective analysis of 128 patients with CLL using available immunophenotypic records. Out of these, 14 cases were initially considered as CD5-ve CLL. With further detailed analysis by using immunophenotypic, hematological and clinical data 7 of the 14 CD5-ve CLL cases were reclassified as typical CLL based on the presence of weak (dim) CD5 expression. Four cases were recognized as MLUS, and the remaining three were consistent with prolymphocytic leukemia (PLL) or mixed PLL/CLL. All four patients with MLUS in this study were typical in their non-progressive lymphocytosis and lack of symptoms over the follow-up period of 3–10 years. This study suggested that patients documented with a CD5- phenotype do not typically qualify for CLL, and false negatives may arise due to heterogeneity in the intensity of CD5 expression and for CLL cases in progression.

With additional clinical follow-up and extended phenotypic characterization, our lab [31] has performed molecular and karyotypic analysis of an additional 7 MLUS cases. We found that 6 of 7 cases had somatic hypermutations (<98% homology to germline sequence) of the VH gene, indicating an origin from a germinal center or post–germinal center B lymphocyte. In addition, cytogenetic aberrations were found in 5 of the 6 cases, with 2 clones bearing isochromosome 17q 10

that resulted in loss of p53, and 2 other clones with 7q abnormalities. The VH gene usage and karyotypic changes were different from those common and typical in CLL.

Thus, in light of the above studies, it is evident that MLUS is characterized by lymphocytosis that is persistent but non-progressive and asymptomatic. Although clinically it is indistinguishable from early CLL (Rai stage 0 CLL, see section 3.1), immunophenotypically it is clearly different from CLL. Additionally, the VH gene mutations and karyotypic changes are different from those common and typical in CLL. Together, these findings suggest a cell of origin that is different from that of CLL. It is still questionable as to whether or not MLUS is precursor state to an unknown lymphoid malignancy. Several follow-up studies are needed to determine whether MLUS patients always possess similar cytogenetic and molecular changes and thus whether additional cytogenetic or molecular insults will lead to the development of clinical malignancy.

3. CD5+ MBL as a precursor condition of CLL

CD5+ MBL is also referred to as CLL-like MBL as it bears a close resemblance with CLL. Immunophenotypically, CD5+ MBL express the same markers as CLL. In addition to the typical panel of CLL-associated immunophenotypic markers, Rawstron et al, [17] performed a flow cytometric analysis of 18 additional B-cell markers (CD10, CD21, CD22, CD24, CD25, CD27, CD31, CD37, CD39, CD40, CD69, CD81, CD82, CCR6, CCR7, CXCR4, CXCR5 and LAIR-1) on 11 CLL phenotype MBL cases, 9 CLL samples, 7 controls and 26 other B- lymphoproliferative disorders. They found that individuals with CLL-phenotype MBL have no additional or specific proteins that can reliably distinguish them from patients with CLL.

Beside the identical immunophenotypic markers, a high incidence of CD5+MBL (>10%) has been reported among relatives of patients with familial CLL [34]. Rawstron et al, [17] examined whether the detection of MBL is indicative of an inherited predisposition. To achieve this goal, they investigated 59 healthy, first-degree relatives from 21 families of CLL for the presence of CD5+MBL and found that CLL phenotype cells were detected in the peripheral blood of 8/59 (13.5%) relatives from seven families. The absolute numbers of CLL-phenotype cells were on average 1000-fold lower than required for a diagnosis of CLL (median, 0.005 x 109/L). By

contrast, among the control group of 23 healthy unrelated family members, only one sample had detectable CLL-phenotype cells. Thus, this study strongly supports the notion that CD5+MBL cases are highly prevalent amongst the relatives of CLL patient.

In a subsequent study [19], the same group examined 1520 subjects aged 62-80 with a normal blood count and 2228 subjects with lymphocytosis (>4000 lymphocytes per cubic millimeter) for the presence of MBL using flow cytometry. It was found that CLL-phenotype MBL cells were detected in 5.1% of subjects (78 of 1520) with a normal blood count and 13.9% (309 of 2228) with lymphocytosis. With further characterization of CD5+ Monoclonal B cells by means of cytogenetic and molecular analyses, it was found that CLL-phenotype MBL had a frequency of 13q14 deletion and trisomy 12 similar to that of CLL, and showed a skewed repertoire of the immunoglobulin heavy variable group (IGHV) genes. This study therefore suggests that CLL- phenotype cells found in the general population and in subjects with lymphocytosis have features in common with CLL cells.

The high prevalence of CD5+ MBL cases in CLL relatives, alongside its close resemblance to CLL, has not only reserved its place as a unique diagnostic entity but has also changed the 1996 definition of CLL. In 2008, the International Workshop on CLL (IWCLL) updated the National Cancer Institute (NCI) 1996 guidelines for CLL by requiring an absolute B-cell count (B-ALC) of 5000/μL rather than the previous absolute lymphocyte count (ALC) of 5000/μL [35]. Several publications have addressed concerns over the amendment in the diagnostic criterion between CLL and MBL, and the use of an ALC threshold has been the area of controversy since 1996. Based on this new criterion, the diagnosis of CLL is based on the presence of clonal CD5+B- lymphocytes, rather than total lymphocytes. An important consequence of the change in the diagnostic criteria of CLL from an ALC to a B-ALC of ≥ 5x 109/L has been a shift in the diagnosis of patients previously labeled as Rai Stage 0 CLL (see section 3.1) patients to the newer benign condition MBL. Thus, those patients that were once labeled to possess malignancy (Rai Stage 0 CLL) were now considered benign (MBL).

Several studies have addressed the clinical relationship between MBL and CLL. In particular, Landgren et al, [36] conducted a prospective study on the individuals that participated in the nationwide Prostrate, Lung, Colorectal and Ovarian Cancer Screening Trial. Using six-color flow cytometry and IGHV gene analysis by reverse transcriptase PCR, they identified that 44 of the 45 CLL cases were preceded by MBL, which strongly suggested that MBL is a precursor state to 12

CLL. This contrasts with the study conducted by Dagklis et al 2009, which reported that screening MBL and CLL can be strikingly distinct with regard to the usage of IGHV genes, therefore implicating that MBL does not necessarily represent a precursor leukemic state.

Rossi et al. [37], while comparing the cytogenetic lesions in individuals with MBL and Rai Stage 0 CLL (see section 3.1), found a lower prevalence of high risk cytogenetic aberrations in patients with MBL. They documented a lower frequency (3.8 vs. 15.2%) of 11q22/17p13 deletions as well as p53 mutations (3.0 vs. 11.5%) in MBL patients as compared to CLL. A subsequent study monitoring and comparing the outcome of patients with Rai Stage 0 CLL and MBL was conducted by Shanafelt et al [22]. They found that CLL-phenotype cells in otherwise healthy subjects have karyotypic abnormalities associated with CLL (such as 13q deletions) [38].

One of the major concerns for persons diagnosed with MBL is whether or not will they develop CLL or another indolent Non-Hodgkin lymphoma (NHL). Given the frequency of this phenomenon it is clear that not all the MBL patients may be considered direct precursors of CLL, despite their phenotypic resemblance. It has recently been demonstrated that MBL present in individuals with lymphocytosis will evolve into a clinically significant leukemic disease needing treatment in only 1.1% of the cases per year, and they carried biological and molecular features similar to indolent, mutated CLL [19].

Thus, based on the identical immunophenotypic markers, elevated prevalence amongst the relatives of CLL patients, and similar karyotypic abnormalities, there is a strong rationale to support the notion that CD5+ MBL is a precursor state of CLL and a diagnostic entity of great clinical significance. This relationship is analogous to the relationship between Monoclonal Gammopathy of Undetermined Significance (MGUS) and Multiple Myeloma (MM) or Familial Adenomatous Polyposis (FAP) and Colorectal Carcinoma (CC). At this time point there is insufficient data to accurately predict which MBL cases will progress to CLL. However two studies have suggested the use of CD38 expression as a significant marker for the future need for therapy [22, 37]. As the initiating factors in CLL remain unknown, CD5+ MBL can possibly provide a better and more powerful tool for identifying oncogenic events that lead to CLL.

3.1 Prognostic factors of CLL:

CLL has a variable course, with the survival ranging from months to decades. One third of patients never require treatment and have a long survival; in another third, an initial indolent phase is followed by disease progression and a requirement for treatment; the remaining third have an aggressive form of CLL at the onset and need immediate treatment [39].

Rai and Binet staging systems: The Rai [40] and Binet [41] staging systems are based on the extent of the disease and the presence of anemia, thrombocytopenia, or both. Essentially, Binet stage A is defined by the involvement of <3 lymphoid sites; stage B involves ≥3 lymphoid sites and stage C requires the presence of anemia or thrombocytopenia. In the Rai classification, stage 0 refers to those patients with the presence of lymphocytosis only; stage I and II requires lymphadenopathy and organomegaly and stage III and IV are those who developed anemia and thrombocytopenia in addition to the other findings.

These staging systems classify patients into three groups: good prognosis (Binet stage A, Rai stages 0 and 1), intermediate prognosis (Binet stage B, Rai stage 2) and poor prognosis (Binet stage C, Rai stages 3 and 4). Although, these staging systems have been the basis of the design of clinical trials, neither can predict the development of progressive disease in patients characterized as having a good prognosis [39, 42]. In western countries, almost 75% of patients with CLL fall into this group.

Lymphocyte doubling time (LDT): LDT is defined as the period of time needed for lymphocytes to double in number the amount found at diagnosis. It has a clear prognostic significance by itself such that a LDT of ≤ 12 months identifies a population of patients with poor prognosis and a LDT >12 months is indicative of good prognosis as substantiated by a long treatment-free period and survival [43]. It has been demonstrated that patients in Stages A and B with rapidly increasing lymphocyte counts progress more frequently (33.3% and 29.1%, respectively, at 12 months after diagnosis) than those with a slow increase (no change in clinical stage at 12 months) [44]. Thus, this simple parameter can be useful in the clinical management of CLL patients.

Cytogenetic abnormalities: By using sensitive molecular techniques, chromosomal abnormalities can be detected in the majority of patients with CLL. About 80% of CLL cases

have cytogenetic abnormalities which may be detected by fluorescence in situ hybridization (FISH) [45]. There are certain genetic abnormalities, often acquired over time, that have been associated with patient outcome. These cytogenetic abnormalities appear to be restricted to B- cells in B-CLL [46]. In addition, it is evident that patients with complex genomic changes appear to have more aggressive disease [47].

Trisomy 12 — the prognostic value of trisomy 12 detected by FISH is still unclear. One study using FISH documented a relationship between trisomy 12 and advanced disease and higher proliferative activity [48], while another study found that median survival in patients with CLL and trisomy 12 detected by FISH was similar to that of patients with CLL and a normal karyotype [45]. Future detailed studies are needed to unravel the true relationship between trisomy 12 and CLL.

Deletion 13q14 — Retinoblastoma (Rb) gene is located at chromosome 13q14 position, so the deletion of this tumor suppressor gene is associated with its inactivation and malignant transformation of this gene [49]. Studies suggests that the loss of Rb gene is not only associated with retinoblastoma but is related to other malignancies as well. Two studies found this deletion in 45 to 55% of the patients with CLL and associated this finding as a good prognostic sign [45, 50]. Interestingly micro-RNA (miR) 15 and miR16 are located at chromosome 13q14 which is deleted in more than half of the cases of CLL patients. Detailed deletion and expression analysis have proved that miR15 and miR16 are located within a 30-kb region of loss in CLL, and that both genes are deleted or down-regulated in the majority (up to 68%) of the cases of CLL [165]. Micro-RNAs are a large family of highly conserved noncoding genes involved in tissue-specific gene regulation. Recent study suggested that del 13q14 is heterogeneous and comprises of multiple subtypes, with deletion of Rb or the miR15a/miR16 loci serving as anatomic landmarks, respectively [166].

11q and 17p deletions — Using FISH techniques, deletions of 11q have been described in 17 to 20 percent of patients and deletions of 17p were found in 7 to 10 percent [45, 50]. Studies suggest that 11q deletions are the commonest type of karyotypic evolution acquired over time [51]. The ataxia telangiectasia mutated (ATM) gene is located on chromosome 11q is responsible for the detection of DNA damage, and plays an important role in the regulation of cell cycle progression. The loss of this gene through 11 q deletion in CLL is associated with aggressive 15

clinical course and worse prognosis. A poor prognosis is also associated with the presence chromosome 17p13 deletion, which is the site of the p53 (TP53) tumor-suppressor gene. As some cytotoxic drugs used for the treatment of CLL disrupt DNA and require an intact p53 protein to eliminate cells with damaged DNA. Thus del 17p13 and 11q23 are the predominant lesions in advanced stages of CLL, particularly in patients without mutated IGHV genes.

Bcl-2 Proto-oncogene: CLL cells are long lived mature B-lymphocytes. A possible molecular explanation of this is that CLL cells typically express the B cell leukemia/lymphoma 2 (Bcl-2) proto-oncogene. Bcl-2 is unique among proto-oncogenes as it is a known suppressor of programmed cell death (apoptosis), thus resulting in prolonged survival of the involved cells [52]. Many in vitro studies have shown that B-CLL cells with higher levels of bcl-2 protein survive longer in culture than those with lower levels [53, 54]. It was previously suggested that Bcl-2 is exclusively observed in follicular lymphomas and some cases of diffuse large cell lymphomas. However, bcl-2 expression is elevated in approximately 95 percent of patients with B-CLL [53, 55]

P53 tumor suppressor gene: The mutation of tumor suppressor genes is thought to contribute to tumor growth by inactivating proteins that normally act to limit cell proliferation. As mentioned previously, p53 is a tumor-suppressor gene located on the short arm of chromosome 17. This gene is quite often inactivated in human malignancies by deletion or point mutation. P53 gene mutations have been identified in 10 to 47 percent of patients with CLL [56-61]. Several studies have highlighted the association of a poorer survival and poor response to therapy among CLL patients with p53 gene deletion as compared with those without a deletion [45, 56, 59, 60, 62]

ZAP-70 expression: ZAP 70 is a Zeta-chain-associated protein tyrosine kinase which is normally expressed by T and NK cells. It is involved in normal T-cell development and plays an important role in the T-cell receptor functioning. It is not normally expressed in B lymphocytes, but when expressed in B cells from a subset of patients with CLL with aggressive disease is associated with a poor prognosis [49, 50]. Studies suggest that clonal evolution has occurred among 10 versus 42 percent of those who were ZAP-70 negative or positive, respectively. The abnormal expression of ZAP-70 in CLL B cells is also strongly associated with the presence of a non-mutated Ig heavy chain variable region gene (IgVH) [46, 51].

IGHV gene mutation status: Both molecular and cellular markers can be helpful in predicting the tendency towards disease progression. One such important molecular marker is the status of 16 immunoglobulin heavy variable group (IGHV) genes in the CLL cells. Patients in whom these genes are not mutated (germ-line) have a worse prognosis than patients in whom the CLL cells harbor mutated IGHV genes [63, 64]. However, usage of the IGHV gene VH3-21, independent of VH mutation status, is an adverse prognostic marker [65].

CD38 expression: Studies suggest that, among other demographic and prognostic parameters, CD38 status is associated with time to treatment [66]. Thus, CD38 is associated with an adverse prognosis [67].

In summary, a combination of the Rai or Binet staging system score, presence or absence of genetic markers and IGHV gene mutation status predict a better definition of prognosis of CLL rather than each of them alone. Based on the prognostic factors described above, most cases of CLL that will not progress nor require treatment are of Binet stage A and Rai stage 0 or 1, with a mutated IGHV gene and an absence of the 11q and 17p deletions. Similarly, CLL of Binet stage A and Rai stage 0 or 1 that will progress frequently has an IGHV gene without mutation and in some patients an 11q deletion. Finally, aggressive CLL requiring immediate treatment usually presents in Binet stage B or C and Rai stage 2, 3, or 4 and exhibits a non-mutated IGHV gene and, frequently, chromosomal abnormalities of one or both of 11q or 17p.

4. Clonal T- Lymphocytosis and T-cell lymphoproliferative disorders

4.1 T-cell immuophenotype & T-cell receptor (TCR)

T-lymphocytes are responsible for cell mediated immunity, and account for almost two-thirds of the normal absolute lymphocyte count. They arise from bone marrow precursor cells, although they mature and acquire functional properties in the thymus gland. In the thymic cortex, while T- cells undergo maturation, they express terminal deoxynucleotidyl transferase (TdT), CD1a, CD3, CD5 and CD7. These cortical T-lymphocytes initially lack CD4 and CD8 antigens, but acquire these markers during maturation.

Two-thirds of the T-cells express the glycoprotein CD4 (CD4+ T-cells). These cells are responsible for promoting immune responses, such as antibody production, and are termed T-

helper cells. The remaining third of T-cells express the glycoprotein CD8 (CD8+ T-cells), and are associated with the down-regulation of immune responses and the killing of target cells. Accordingly, these cells are referred to as T-suppressor or cytotoxic cells. Furthermore, T-cell activity is restricted according to major histocompatibility (MHC) molecules, in that CD4+ or helper T-cells recognize peptides bound only to MHC class II molecules; and CD8+ or suppressor T-cells recognize peptides bound to MHC class I molecules. Natural killer cells (NK- cells) are closely related to T-cells and share some of their immunophenotypic and functional properties. They typically express CD2, CD7, CD16 and CD56; sometimes express CD8; variably express CD57; but lack the pan-T-cell antigen CD3. NK cells kill target cells through antibody dependent cytotoxicity (ADCC) or via killer activating and inhibiting receptors. It is interesting to note that NK-cells do not have a complete TCR complex and do not rearrange their TCR genes. Thus, detection of clonality must be made through the analysis of killer inhibiting receptors.

T-cells are typically defined by the presence of a surface receptor referred to as the T-cell receptor (TCR). The TCR is a membrane-bound heterodimer composed of two polypeptide chains the alpha beta (αβ) or gamma delta (γδ), linked by a disulfide bond and associated with a non-polymorphic cytoplasmic membrane-bound complex known as CD3 [68-70]. In concert with CD3, the TCR is involved in antigen-specific activation and signal transduction. In the peripheral blood, most T-cells express αβ receptors and up to 15% express γδ receptors [71-73]. The TCR genes are located on chromosomes 7 and 14. Interestingly the genes encoding TCR-δ chain are located within the TCRα loci on chromosome 14q11–12, whereas the TCR-β and TCR- γ genes are located at chromosomal positions 7q32–35 and 7p15, respectively [74-80] The TCR gene loci contain many different variable (V), diversity (D), and joining (J) gene segments, which are also subject to rearrangement processes during early lymphoid differentiation [70,71]. The TCRα gene consists of 70 Vα segments, 61 Jα segments and 1 Cα segment. The TCRβ gene comprises of 67 Vβ segments, 2 Dβ segments, 13 Jβ segments and 2 Cβ segments. The TCRγ gene consists of 14 Vγ segments, 5 Jγ segments and 2 Cγ segments while the TCRδ gene comprises of 8 Vδ segments, 3 Dδ segments, 4 Jδ segments and 1 Cδ segment.

The V–D–J rearrangements are mediated via a recombinase enzyme complex in which the Recombinase Activating Gene 1 (RAG1) and RAG2 proteins [81, 82] play a key role by recognizing and cutting the DNA at the recombination signal sequences (RSS), which are located

downstream of the V gene segments, at both sides of the D gene segments, and upstream of the J gene segments. The rearrangement process generally starts with a D to J rearrangement followed by a V to D–J rearrangement, as observed in the TCR-β, and TCR-δ genes. Alternatively, direct V to J rearrangements may arise in the TCR-α, and TCR-γ genes. The sequences between rearranging gene segments are generally deleted in the form of a circular excision product, also called the TCR excision circle. The many different combinations of V, D, and J gene segments represent the so-called combinatorial repertoire, which is estimated to be ~3 x 106 for TCRαβ molecules and ~5 x 103 for TCRγδ molecules.

It is interesting to know that the diversity of T-cell repertoire is not solely due to the V, D, J recombination but also from various nucleotides insertions and deletions from the junctional sites [83]. Based on the concept that only a single type of TCR molecule is expressed by a lymphocyte or lymphoid clone, the clonally rearranged genes of mature lymphoid malignancies might be detectable at the protein level.

There are several extrinsic and intrinsic factors that influence the expression of the TCR repertoire. In normal individuals the TCR repertoire is stable and polyclonal. However, clonal T- cell lymphocytosis may represent a diagnostic entity that has been largely overlooked. The vast majority of studies regarding clonal lymphocytosis have focused exclusively on B-cell proliferations. Since the majority of lymphoid malignancies are derived from B-cells, this imbalance would appear to be justified. However, in addition to well-defined T-cell large granular lymphocyte leukemia (T-LGL), T-cell clonopathy of undetermined significance has been proposed as a diagnostic entity analogous to MBL [84] In T-cells, clonal expansions prevalently affect the CD8+ subset, while the CD4+ subset remains largely polyclonal and CD4+ monoclonal expansions are rare [85].

The detection of T-cell clones is very problematic. Unlike the use of skewed κ/λ light chain ratios for the analysis of clonal B-lymphocytes by flow cytometry, there are no simple and practical immunophenotypic techniques for assessing T-cell clonality. Despite the extensive usage of immunophenotyping, difficulties in making a final diagnosis of lymphoid malignancy arise in almost all suspected cases of T-cell proliferations. Although the TCR β chain family may be assessed on cell surface by flow cytometry, the test is extremely complex and not feasible in routine diagnostic laboratories. In addition, the antibodies that are currently available are incomplete to cover the entire TCR V β regions. Abnormal T-cell populations may also be 19

recognized by alterations in the antigen expression, but atypical expression patterns are difficult to interpret and not a reliable indication for clonality. As such, the successful detection of a T- cell clone may require a panel of >20 separate antibodies in order to ensure successful detection of the clonal rearrangement [86]. Thus, molecular analysis of T-cell clonality is of great significance in laboratory diagnostics, where a phenotypic clonal marker is missing.

4.2 Precursor T- cell neoplasms and Mature/Peripheral T-cell neoplasms

T-cells can develop neoplasms in any stage of lymphoid differentiation and development. They can be subdivided into precursor T-cell and mature/peripheral T-cell neoplasms. Most of the T- cell neoplasms arise from mature T-cells. The WHO classification of lymphoid neoplasms adopts the Revised European-American Lymphoma (REAL) classification system proposed by the International Lymphoma Study Group. This classification is based on the use of all available information (which includes immunophenotyping, morphologic, genetic and clinical features) in order to define distinct lymphoid neoplasms. The WHO classification of some of the common precursor and mature T-cell neoplasms are discussed here:

4.2.1 Precursor T- cell neoplasms

T-lymphoblastic leukemia/lymphoma is a neoplasm of precursor T-cells comprising small to moderate sized lymphoblasts with nucleoli and scant cytoplasm. When this condition involves bone marrow (BM) and peripheral blood (PB), the term T-acute lymphoblastic leukemia (T- ALL) is used, while T-acute lymphoblastic lymphoma (T-LBL) is used when involvement is mainly in the form of mass lesions in the lymph nodes, extranodal sites and mediastenum (excluding the PB and BM). T-ALL comprises 15% of the childhood ALL and affects mainly adolescent males. T-LBL, like T-ALL, is frequent in adolescent males but can be seen in any age group, accounting for up to 90% of all lymphoblastic leukemia. These conditions are characterized by the expression of TdT, CD1a, CD2, CD3, CD4, CD5, CD7 and CD8. In addition to TdT, the most specific marker to indicate the precursor nature of T-lymphocytes is CD99, CD34 and CD1a [87]. T-ALL/LBL almost always shows clonal rearrangement of TCR [88] and about 50-70% of cases possess an abnormal karyotype [89, 90]. T-ALL can have an aggressive clinical course in childhood if high risk clinical features are present. In adults, the prognosis is much better due to the lower incidence of cytogenetic abnormalities. The prognosis of T-LBL depends on the age, stage and lactate dehydrogenase (LDH) levels [91] 20

4.2.2 Mature/Peripheral T- cell neoplasms:

T-cell large granular lymphocytic leukemia (T-LGL) is a heterogeneous disorder characterized by a persistent (>6 months) increase in the number of peripheral blood large granular lymphocytes, usually between 2-20 x 109/L without a clearly identified cause [92]. T-LGL accounts for 2-3% of all mature lymphocytic leukemias, and arises with an equal male-to-female ratio. The majority of cases occur in 45-75 year olds, and the condition is rare before age of 30 years. The underlying pathophysiological phenomenon is largely unknown. This disorder is unique in that the clonal T-LGL cells retain many phenotypic and functional properties of normal cytotoxic effector T-cells [93]. The T-LGL is a mature T-cell disorder with a phenotype of cytotoxic T-cells positive for CD3, CD8 and TCR-αβ. Uncommon variants include cases positive for both CD4 and TCR-αβ, or cases expressing TCR-γδ. Approximately 60% of the latter group express CD8, and the remainder are CD4/CD8 negative [94, 95, 96].

Two types of LGL have been described on the basis of their lineages: CD3+ LGL and CD3- LGL. Where CD3+LGL express rearranged TCRs, CD3-LGL is composed of natural killer cells and do not rearrange their TCR genes [97, 98]. While the clonal nature of NK-LGL proliferations typically remains uncertain, TCR clonality is mandatory for the diagnosis of T- LGL. Thus, cases classified as T-LGL leukemia are clonal by definition, as confirmed by TCR gene rearrangement [99]. There is no unique karyotypic abnormality associated with this disorder but numeric and structural abnormalities have been described in a small number of cases [99]. This disease is typically indolent and non-progressive and some investigators feel that it is better regarded as a clonal disorder of undetermined significance rather than leukemia.

One key question in this disorder has been whether LGL represents a reactive or neoplastic proliferation. It should also be noted that oligoclonal/clonal T-cell expansions are frequently seen in the peripheral blood of normal healthy individuals. Such expansions are most prominent among CD8+ T-cells and are increasingly present with age, being very frequent in the elderly (>70 years of age) [100, 101-103]. Although some reports have highlighted that clonality studies and CD8 TCRVB family profiling are useful in monitoring progression and response to treatment in LGL, it has been suggested that morbidity and mortality in LGL is primarily related to neutropenia rather than lymphocytosis [104].

T-cell prolymphocytic leukemia (T-PLL) accounts for 2% of cases of mature lymphocytic leukemias in adults over the age of 30 [105] with a median age of 65 years. It is an aggressive T- cell leukemia characterized by the proliferation of small-medium sized prolymphocytes with a mature post-thymic T-cell phenotype involving peripheral blood, bone-marrow, lymph nodes, liver, spleen and skin (WHO classification 2008). T-cell chronic lymphocytic leukemia was used historically as a synonym for some small cell variants. The immunophenotype of the T- prolymphocyte is TdT-ve, CD1a-ve, CD2+ve, CD3+ve. CD52 is usually expressed at high density and is a target for therapy [106]. 60% of the patients are CD4+ve and CD8-ve; 25% of patients co-express CD4 and CD8; while 15% are CD4-ve and CD8+ve [105]. The TCR-β and TCR-γ are clonally rearranged. The course of the disease is aggressive with a median survival of < 1 year. However, some cases with a chronic course have also been reported [107].

Adult T-cell leukemia/lymphoma (ATLL) is a peripheral T-cell neoplasm caused by the human retrovirus human T-cell leukemia virus type 1(HTLV-1). The disease is closely linked to the prevalence of this virus in the population, with the highest frequency of 2.5% observed in Japan [108]. This disease has a long latent period and the virus is acquired long before disease presentation. The ATLL tumor cells are CD2+, CD3+, CD5+, CD25+, and CD7-. Most of the cases are CD4+, CD8-, and a few are CD4-, CD8+ or CD4 and CD8 double positive. The tumor cells also express the chemokine receptor CCR4 and FOXP3, a feature of regulatory T-cells [110]. The TCR genes are clonally arranged [111]. Patients usually present with generalized lymphadenopathy, with involvement of skin in about 50% of the cases along with PB involvement. Several clinical variants have been identified: acute, lymphomatous, chronic and smoldering [109]. The acute variant is the most common form characterized by tumor cells in blood, widespread lymphadenopathy and skin rash. Patients commonly presents with constitutional symptoms, organomegaly, hypercalcemia with or without lytic bone lesions and increased LDH levels. The lymphomatous variant is characterised by prominent lymphadenopathy but no PB involvement. Most patients presents with advance stage disease similar to acute form with hypercalcemia being less common. The chronic variant on the other hand is associated with exfoliative skin rash, lymphocytosis but no hypercalcemia. The smoldering variant is the least aggressive form and it presents with a white blood cell count within normal limit and >5% of circulating of neoplastic cells. It is noted that progression from chronic or smoldering to acute form occurs in 25% of the affected cases. The prognosis is dependent on the clinical variant, such that the chronic and smoldering forms have a protracted 22

clinical course and better survival [112]. By contrast, the acute and lymphomatous variants have an aggressive course with survival ranging from weeks to more than one year, with the major cause of death being attributed to opportunistic infection [109].

Mycosis fungoides (MF) is a primary cutaneous T-cell lymphoma, characterized by infiltrates of small to medium sized T lymphocytes with cerebriform nuclei [WHO 2008]. It accounts for almost 50% of all primary cutaneous lymphomas [113]. It has an indolent course with slow progression over several years, sometimes decades, from patches to more infiltrated plaques and eventually tumours [113]. The typical phenotype is CD2+, CD3+, TCRβ+, CD5+, CD4+ and CD8-. However rare cases of CD8+ tumors have been reported [114].

Sézary Syndrome (SS) is defined as a triad of erythroderma, generalized lymphadenopathy and the presence of clonally related neoplastic T-cells with cerebriform nuclei (Sézary cells) in the skin, lymph node and peripheral blood. In addition, one or more of the following criteria are required: an absolute Sézary cell count at least 1000 cells/mm3, an expanded CD4+ T-cell population resulting in a CD4/CD8 ratio of more than 10 and / or loss of one or more of T-cell antigen [WHO 2008]. The immunophenotype of SS is CD2+, CD3+, TCRβ+ and CD5+. Most cases are CD4+, while CD8 expression is rare. Sézary cells express cutaneous lymphocyte antigens (CLA) and the skin homing receptors CCR4 [115], and characteristically lacks CD7 and CD26 [116,117, 118]. TCR-genes are clonally rearranged [119, 120, 121]. It has an aggressive course with an overall 5 year survival rate of 10-20% [113]. Prognostic factors include the degree of lymph node and peripheral blood involvement [122], 123].

In spite of this range of T-cell lymphoproliferative disorders, it should be remembered that the presence of clonal TCR gene rearrangements does not necessarily confirm the presence of a malignancy because several benign or reactive inflammatory conditions may show such a pattern. Some benign conditions where clonal T-cell expansions are evident include inflammatory disorders of skin, such as lymphomatoid papulosis and pityriasis lichenoides et varioliformis acuta [124-126]. Similarly, the absence of a clonal gene rearrangement does not rule out malignancy because the population of malignant cells may be at a level below the sensitivity of the detection technique. The current consensus view is that lymphomas can only be defined by a combination of clinical, histological, and immunological data [127]. Whether T-cell clonal lymphocytosis is equivalent to monoclonal B-cell lymphocytosis (MBL) has largely remained unclear. 23

CHAPTER: II

Laboratory methods for the detection of clonal lymphocytosis

1. Overview

The diagnosis of lymphoid malignancies can be supported by clonality assessment based on the principle that all neoplastic cells have a common, clonal origin. Clonality tests are of great importance in establishing the diagnosis of lymphoid malignancies. The observation of lymphocytosis, which is a common finding during routine hematologic tests, can be caused either by neoplastic clonal expansion or reactive immune responses. To clearly establish the cause of this lymphocyte proliferation, an effective diagnostic tool must be present to be able to differentiate between clonally elevated lymphocytes and reactive responses amongst a diverse background of normal, polyclonal blood cells. Under these circumstances, clonality testing serves as an essential and helpful tool in laboratory diagnostics to differentiate between the clonal and reactive causes of lymphocytosis.

In most patients with suspected lymphoproliferative disorders, histomorphology or cytomorphology, supplemented with immunohistology or flow cytometric immunophenotyping, can differentiate between malignant and reactive lymphoproliferations. Currently, flow cytometry is the most widely used technique in routine diagnostic laboratories to evaluate the cause of abnormal lymphocyte proliferations. However, the diagnosis is not straightforward in all patients, and in about 5–10% of cases, making the correct diagnosis can be problematic. In such cases, molecular gene-rearrangement studies have proved to be a useful and more sensitive supplementary diagnostic tool.

The vast majority of lymphoid malignancies belongs to the B-cell lineage (90–95%) with only a minority being T-cell (5–7%) or NK-cell lineage (<2%). It is also true that the vast majority of lymphoid malignancies (>98%) contain identically (clonally) rearranged immunoglobulin (Ig) and/or TCR genes together all of which can serve as markers for clonality [5, 6]. Thus, detection

24 of B-cell clonality by immunoglobulin heavy chain variable (IGHV) gene rearrangement and T- cell clonality by T-cell receptor (TCR) gene rearrangement is gaining increasing interest.

Besides these tools, fluorescence in situ hybridization (FISH) can also be used for the detection of genomic aberrations. For instance, in CLL the most common abnormality is 13q14 deletion, which is reported in approximately 55% of patients, followed by deletion of 11q (ATM) and trisomy 12 in approximately 15–20%, while deletion of 17p (TP53) is seen in a further 5–10% of cases. All these chromosomal abnormalities have prognostic significance and are important for the clinicians for patient monitoring. In particular, the deletion of 13q14 is a sole abnormality is an indicator of prolonged treatment-free interval, whilst the presence 11q or 17p deletions predict a poor outcome [45].

Thus, the implementation of information gained through each of these approaches, in conjunction with traditional morphological and cytochemical analyses, can lead to the discrimination between reactive and neoplastic cell populations in individuals presenting with suspected lymphoproliferative disorders. The current WHO guideline for the diagnosis of hematopoietic and lymphoid neoplasia is to use all available information–morphology, immunophenotyping, genetic features and clinical features.

The high prevalence of clonal lymphocytosis, in addition to its potential role as a precursor of overt malignancy, highlights the crucial importance of adopting accurate and sensitive laboratory assays for clonality detection. In addition, the significance of acquiring reliable methods for the detection of clonality is not only relevant to the effective diagnosis and treatment of many neoplastic disorders, but also to the early detection of malignant cells, which in turn may have substantial value for determining the biological mechanisms of tumor progression.

Hence, there is a significant emphasis on our ability to detect clonal cells accurately and efficiently. Currently, the most common methods are flow cytometry and the molecular assessment of IgH and TCR gene rearrangements.

2. Flow Cytomtery

Flow cytometry is a widely used technique used for the analysis of multiple parameters of individual cells within a heterogeneous population. It provides us with the information of cell size, inner complexity, immunophenotype and viability. It is routinely used to evaluate immunodeficiency and in the immunophenotypic analysis of leukemias and lymphomas [128].

Through a process of hydrodynamic focusing, a suspension of cells stained with fluorescence dye-labeled antibody is funneled into a single file stream of cells by being injected into a hollow column of fluid within the flow cell of the cytometer. Typically the moving fluid column flows at a velocity of nearly 10,000 times faster than the injected cells. Each of the injected cell pass through the laser beam (interrogation point) one at a time, scattering the laser light at all angles: for instance, in forward scatter the light is collected at an angle of 0o. The magnitude of the forward scatter is roughly proportional to the size of the cell. For example, lymphocytes will produce a small amount of forward scatter and neutrophils (which are larger) will produce greater amounts. On a histogram of forward scatter, the lymphocyte will therefore appear towards the left and the neutrophils will appear towards the right. Light scattering at larger angles (i.e. to the side) is caused by structural complexity inside the cell. In this instance, lymphocytes possess low internal complexity and will therefore be on the lowest side of the side scatter, whereas neutrophils and other granulocytes have high granularity will have elevated perpendicular scatter.

In addition to these two parameters, flow cytometer can also determine aspects of cell structure and function through the use of fluorescent labeled antibodies, which have a specific wavelength and color on excitation. Fluorescent antibodies are typically selected to bind to a specific molecule on the cell surface. When laser light of the right wavelength strikes the fluorophore, a fluorecent signal is emitted and detected by the flow cytometer. As each cell crosses the path of the laser, a fluorescent signal is generated and the corresponding fluorescence data can be collected the same way as forward and side scatter.

Based on the usage of cell surface marker, flow cytometry is routinely used for the detection of clonal blood cells in the clinical laboraties. Through this technique, clonal and non-clonal B- lymphocytes are easily detected by expression of Ig light chains (Igκ/Igλ), such that expression of single light chain Igκ or Igλ with the Igκ/Igλ ratio of >4.0 or <0.5, signifies the presence of 26

clonal B-cell population. Whereas the reactive or polyclonal B-lymphocytes would bear the normal Igκ/Igλ ranging between 0.7-2.8 [29-31]. Similarly antibodies against various domains of TCR chains, enables the detection of monotypic Vβ,Vγ and Vδ domains compared to their pertinent reference values [132-137].

The high sensitivity flow cytometry enables the detection of clonal B-cells with a CLL phenotype in numbers as low as 1 per 10,000 normal leukocytes [138]. With this method, CLL phenotype cells have been found in over 3% of adults with otherwise normal blood counts [27]. Studies suggests that by using flow cytometry very low levels of circulating monoclonal B-cell subpopulations can be detected in healthy individuals and has been designated as MBL [10]. Accordingly as discussed earlier the recommended criteria of MBL is the presence of monoclonal B-cell population in the PB with overall κ: λ ratio of >3:1 or <0.3:1. Although this is the cutoff threshold for confirmation of clonality by flow cytometry, it is possible that clonal cells could occur with the κ: λ of < 3:1 and >0.3:1 and the opposite is true for polyclonal or reactive cell population.

When compared to clonal B-cell detection, the detection of T-cell clonality by flow cytometry confronts great challenges. It requires a panel of >20 separate antibodies in order to ensure successful detection of the clonal rearrangement. For instance, the assessment of monotypic TCR-β variable domains requires a panel of almost 20-25 antibodies targeted against separate Vβ gene families) [86], thus making this technique very complex and non-feasible during routine laboratory diagnostics. This could also be due to the fact that only a few large-scale surveys have incorporated the analysis of low-grade T-cell clones to the same extent as MBL studies which is gaining increasing popularity since the last two decades.

Besides that, flow cytometry can detect the expression of monotypic Vβ,Vγ and Vδ in PB or bone marrow samples of B or T lymphoproliferative disorders, but it appears to be more difficult in their respective tissue samples. To accomplish this goal Southern blot was first very widely used which has been gradually replaced by more accurate PCR techniques.

Limitations of flow- cytometry: Unlike B-cells, in which clonality can be easily accessed by a restricted κ: λ light chain distribution using either immunochemistry on histology sections or flow cytometry, there are no simple immunophenotypic techniques for detecting T-cell clonality. Although the TCR β chain family may be assessed on the cell surface by flow cytometry, the test

27 is extremely complex and therefore is not routinely performed in diagnostic laboratories. Furthermore, the antibodies currently available are not sufficient to cover the entire TCR V β regions. Abnormal T-cell populations may be recognized by alterations in antigen expression, but atypical expression patterns are difficult to interpret and not a reliable indication for clonality. Thus, the effective molecular analysis of T-cell clonality is a continuing issue in laboratory diagnostics.

3. Molecular Clonality Tests

Molecular clonality testing is often required for the diagnosis of lymphoid malignancies. The rearrangement of Ig or TCR genes is particularly useful as a clonal marker of B- and T-cell tumors. Molecular clonality assays are based on the principle that all malignant cells possess identical Ig or TCR gene rearrangements.

As mentioned in chapter 1, the Ig and TCR genes contain many V, D and J gene segments that undergo a recombination process during lymphocyte development, resulting in random combination of these gene segments resulting in unique Ig and TCR rearrangements [139, 140]. Since the rearranged Ig or TCR gene is unique to each lymphocyte, a population of reactive or polyclonal lymphocytes will possess a broad diversity of rearranged genes, whereas lymphoid tumors show a pattern of clonal rearrangement.

In laboratory diagnostics, clonality tests may be used for the initial diagnosis of clonality and the detection of minimal disease. About 10% of suspected lymphoid malignancies are difficult to diagnose based solely on morphological and immunophenotypical assessments. In these cases, molecular clonality testing is useful in differentiating reactive processes from malignancies. In addition, in cases where there is limited tissue available and it is not possible to assess tissue architecture, such as needle aspiration or small needle biopsy materials, clonality assessment may provide diagnostically valuable information. In addition, the unique gene rearrangement pattern may serve as a molecular fingerprint which can be used to monitor minimal residual disease following treatment. Specific rearrangement can also be used for evaluation of the clonal relationship between two lymphoid malignancies in a single patient.

3.1 Southern blot

Southern blot has been used as a molecular technique for the detection of B or T-cell clonality. This method was previously considered as the gold standard for testing Ig and TCR gene rearrangement. Despite its high reliability, this technique has some inherent disadvantages. This technique is technically demanding and relies on the availability of large quantities of high- quality DNA (typically 10-20µg) [141]. In addition, it is highly time-consuming and has limited sensitivity requiring the presence of at least 5-10% of clonal cells to see a unique band on the blot [142]. Thus, it is not practical in routine diagnostics and it has been increasingly replaced by the polymerase chain reaction (PCR) based assays for Ig and TCR rearrangement. Recent efforts have therefore focused on the development of PCR-based clonality assays in order to provide fast, sensitive clonality detection from minimal DNA quantities.

3.2 Polymerase Chain Reaction (PCR)

PCR-based detection of Ig gene rearrangements was first described in the early 1990s [143-145]. It is a widely used technique in medical and research laboratories, used to amplify a specific target sequence of a DNA strand (template) across several orders of magnitude, thus generating thousands to millions of copies of it. It has a variety of applications, including the diagnosis of hereditary disorders, paternity testing, DNA clonality testing, molecular clonality testing of Ig and TCR gene rearrangements, and the detection of various infectious diseases such as HIV, and tuberculosis. It follows the principle of thermal cycling, consisting of repeated cycles of heating (denaturation/melting) that enables the DNA double strand to split open into two single strands, followed by priming and subsequent DNA extension. The cooling causes the annealing of strands into double strand again. The newly formed DNA strands further act as a template DNA for amplification, thus this process carries on exponentially generating thousands to millions of copies of the target region. The two main components of PCR are heat stable enzyme DNA polymerase and oligomeric DNA primers which are the key components that enables selective and repeated amplification.

Since their establishment, many PCR-based clonality assays have been developed and modified to achieve better sensitivity and applicability. PCR-based technique offers several advantages

29 over Southern blot analysis, with the principal being that it requires smaller specimens and gives higher detection sensitivity. PCR analysis is based on the extreme heterogeneity in the size of Ig and TCR genes derived from VDJ recombination (due in part to the various numbers of nucleotides added at the joining sites). The rearranged genes contain a number of complementarity determining regions (CDRs) and framework regions (Frs). By using consensus primers for the variable and joining regions of the Ig and TCR genes, PCR generates products of different sizes, depending on the nature of the rearranged fragments. As all cells of a clonal population contain identical Ig and TCR loci, amplification across the CDR gives rise to a single and identically sized PCR product. The PCR products can be analyzed by conventional gel electrophoresis or capillary electrophoresis to distinguish clonal from polyclonal products. More recently, automated DNA sequencers have been used during fragment analysis to enable the rapid analysis of PCR results.

Limitations of PCR: Despite the obvious advantages, PCR method has its drawbacks. As the amplification of gene fragments uses consensus primers, the PCR assay is subject to both false negative and false positive results. False negativity is mainly due to inadequate primer annealing, related to the use of limited consensus primers for the rearranged gene segments. As it is not feasible to have many different primers to cover all V, D and J gene segments, family-specific primers are designed to recognize most or all members of a particular V, D or J gene family. Another cause of false negativity is due to the occurrence of somatic hypermutations in rearranged Ig genes. False positive results may arise due to the high sensitivity of PCR to amplify contaminating templates (i.e false priming) or an insufficient number of reactive and oligoclonal B or T cells in the sample. False positivity may also be due to inadequate analysis to discriminate between monoclonal or polyclonal PCR products. As PCR methods continue to be refined, the optimization, validation and standardization become important issues in moving the PCR-based clonality assay into diagnostic laboratories.

3.3 BIOMED-2 multiplex PCR:

Due to the extreme complexity of human genomic organization and various somatic rearrangements of Ig and TCR genes, many PCR-based clonality assays have suffered from incomplete coverage of Ig and TCR gene rearrangement or improper primer annealing, thus resulting in high rate of false negativity. To address these issues, the European BIOMED-2 30

collaborative study group [141] have designed comprehensive sets of consesnsus primers and standardized PCR protocols for diagnostic clonality analysis of both Ig and TCR gene rearrangement. This collaborative group was organized among 47 institutions from 7 European countries. Their initial publication of the optimized BIOMED-2 protocol was in 2003 and subsequent validations of results were published in 2007. These protocols now form the basis of the most reliable clonality detection methods among the studies of PCR-based Ig and TCR assays. The strength of the BIOMED-2 method lies in the usage of multiple primers for a maximum coverage of nearly all the segments of the Ig and TCR genes. The study was designed for the early diagnosis of lymphoproliferative disorders, with the aim of developing standardized PCR protocols and primer sets for clonality diagnostics. The resulting primer panels consist of specific V-family primers which target conserved sequences among Ig and TCR gene segments. To cover all of the VH segments in a DNA sample, a total of 20 upstream primers targeting the 3 framework regions (FrI, FrII, FrIII) of the V gene segments are combined with a single downstream J consensus primer as shown in the figure 1.

IgH gene complex (chromosome# 14q 32.)

FrI FrII FrIII DH JH CH

6VH primers 7 VH primers 7 VH primers 1 JH primer

(forward) (reverse)

Figure 1: PCR analysis of IgH (VH-JH) rearrangements and BIOMED-2 PCR primers. Schematic diagram of IgH gene following variable (V), diversity (D), joining (J) and constant (C) gene segment rearrangement. The VH gene segment has 3 Frame work region (FrI, FrII, FrIII). The black arrow indicates the location and the number of BIOMED-2 primers for IgH gene. Maximum coverage of IgH gene requires 6 FrI, 7 FrII, 7FrIII forward primers and 1 reverse J primer.

Similarly, the multiplex PCR can be used for detection of complete TCR Vβ-Jβ recombination, with a panel of 23 specific Vβ primers, 2 Dβ primers and 13 Jβ primers. The panels of TCR-γ gene primers (2 forward Vγ, 2 reverse Jγ) can be used for TCRγ gene analysis. The TCRβ and TCRγ gene and BIOMED-2 primers are shown in figure 2 a, b and c.

(2a)

Vβ Dβ Jβ Cβ

Vβ primers Jβ primers (2b)

Dβ Dβ Jβ

Jβ primers Dβ1 primers Dβ2 primers

(2c)

Vγ Jγ Cγ

Vγ primers Jγ primers

Figure 2. TCR-β and TCR-γ gene complex and primers. Figure 2a shows (Vβ- Jβ) and 2b (Dβ-Jβ) rearrangements and the relative position of the 23 Vβ, 2Dβ and 13Jβ BIOMED-2 primers. Figure 2c shows TCR-γ gene complex and 2Vγ and 2-γ primers

TCR-γ gene rearrangements have long been used for DNA PCR detection of lymphoid clonality and it is a preferential target for clonality analysis since it is rearranged during early stage of lymphoid development. Comparing to the TCR-β gene, the structure of TCR- γ gene is relatively simple and the major difference is that TCR- γ gene lacks D segment.

A number of studies have reported the successful application of BIOMED-2 assays to the investigation of Ig and TCR gene rearrangements in lymphoproliferative disorders [146-148]. Others [149,150] have assessed the use of BIOMED-2 PCR primers for clonality analysis at diagnosis in selected specimen types, while [151-153] demonstrated improved clonality 32

detection when compared to Southern-blot or other PCR methods. In 2007 another group [154], demonstrated the efficiency of BIOMED-2 assays during the detection of clonality in routine hematopathological diagnosis, with 96% and 97% detection rates for mature B- and T-cell malignancies respectively. Additionally, the clinical sensitivities and specificities were not significantly different for templates derived from fresh/frozen and paraffin embedded specimen, provided the extracted DNA could be amplified for PCR products of over 300 base pairs (bp).

More recently, the participants of the BIOMED-2 collaborative study group conducted further studies [155,156,157] reporting the use of these PCR assays in large series of B- and T-cell malignancies and reactive lesions, and validated their utility in the reliable detection of clonality in these lymphoid tumors. Two other studies evaluated the use of BIOMED-2 assays on routine samples and found that they enabled a high sensitivity and specificity for the detection of B cell non-hodgkin lymphomas [158], and can therefore reliably replace Southern blot analysis in routine clonality detection [159].

The use of consensus primer sets in the BIOMED-2 approach therefore appears to offer a very effective basis for the detection of B- and T-cell clonality. The information of BIOMED-2 primers has been published and all the primers and multiplex PCR reagent mixes are commercially available. As it has matured into a feasible and reliable method, the BIOMED-2 design may serve as a valuable template in developing clonality tests for different diseases in molecular diagnostics.

CHAPTER: III

Identification of clonal B and T lymphocytes among patients with peripheral lymphocytosis

1 Introduction

Lymphocytosis is a common finding during routine haematological test, and may be attributed to reactive (mostly infectious) proliferations or a neoplastic (lymphoproliferative) phenomenon. In reactive lymphocytosis, the lymphocyte count usually normalizes within ≤2 months of the resolution of the associated medical condition (mostly viral infections, autoimmune disorders and rare bacterial infections). A number of neoplastic lymphoproliferative disorders are also associated with peripheral lymphocytosis in their early stages, and in those cases it may be quite challenging to distinguish them from their reactive counterpart. In order to properly differentiate between these two possibilities, besides conducting serial blood counts for the evaluation of their persistent and clonal nature, it is necessary to perform immunophenotypic analysis by flow cytometry and molecular clonality testing.

With the advent of highly sensitive multi-color flow cytometry techniques, clonal B lymphocytes with CLL-phenotype have been found in over 3% of healthy individuals (with normal lymphocyte counts) above the age of 40 [9]. This condition is now designated MBL, and has increasingly been recognized as a unique diagnostic entity. MBL is currently defined by the presence of a clonal population of B lymphocytes in a healthy individual in the absence of any other haematological abnormality.

Although MBL is recognized to be a pervasive condition among otherwise healthy adults, the incidence of MBL in the context of absolute lymphocytosis remains unclear. As most of the studies done in the past have focused exclusively on population-screening MBL, the incidence of MBL in the context of absolute lymphocytosis is still uncertain. This study is unique as it has focused on the identification of clonal B-lymphocytes in patients presenting with asymptomatic absolute lymphocytosis. Such patients are defined as clinical MBL, which has a significant

tendency of progressing to CLL. This study has further classified and characterized these clonal B-lymphocytes into CLL-type phenotype (CD5+) and non-CLL-type phenotype (CD5-) MBL. Similarly, the clonal proliferation of T-cells may be equally prevalent, yet this condition has been largely overlooked until now. This study has paid equal attention in determining the occurrence of clonal T-lymphocytes, a phenomenon which is usually ignored during the studies of monoclonal lymphocytosis.

1.1 Rationale and hypotheses

Most studies that have been done in the past have focused on population-screening MBL. So far very little data are available on clinical MBL. This study aims to address these gaps in the literature regarding the occurrence of MBL in the context of lymphocytosis. Such studies may provide the information on the occurrence of both CLL-type and non-CLL type MBL in these patient population. Clinical MBL cases are important as they present in the context of lymphocytosis. The finding of clonal lymphocytosis will contribute to the evaluation and clinical management of incidental lymphocytosis. Clinical MBL needs to be monitored for its progresion to CLL or any other B-cell malignancy. The CLL-type MBL cases that will be detected through this study will be helpful in evaluating the relationship between CLL-type MBL and early CLL. Identification of non-CLL-type MBL will also provide the information about the prevalence of this diagnostic entity in patients presenting with absolute lymphocytosis. It is likely that the prevalence of this subcategory of MBL may be more prevalent in the lymphocytosis patient than that of population- screening studies. Furthermore, clonal proliferation of T-cells may also be present, but this condition has been overlooked until now. This could be due to the fact that most studies conducted on MBL were based on flow cytometry technique, which is difficult to detect clonal T-cell populations.

As these issues remain to be addressed, a study on adult patients presenting with asymptomatic absolute lymphocytosis may yield valuable information. The combination of flow cytometry and multiplex-PCR clonality assays may provide an optimal detection for the presence of both clonal B and T-lymphocytes. The study will offer valuable perspectives regarding the most sensitive and accurate methods of clonality detection during routine laboratory hematologic tests. In addition, the study will also determine if molecular clonality assays may detect additional MBL cases that are not recognized by flow cytometry. This study will also determine if PCR-based 35

TCR assays may improve the detection of clonal T lymphocytes which will help in establishing potential clinical significance of the entity monoclonal T-lymphocytosis (MTL), which may be analogous to MBL.

Thus, to our knowledge, for the first time, this study will provide information regarding the occurrence of both clonal B- and clonal T-cell lymphocyte populations in a group of clinical patients. The finding of clonal B and T-lymphocytosis cases will provide guidance for clinical follow-up and further investigations of incidental peripheral lymphocytosis. In particular, clonal lymphocyte populations in the context of an absolute lymphocytosis have the potential to progress from pre-clinical condition to clinical lymphoid malignancies.

As described above, this study is performed to test the following hypotheses:

• Clonal expansion of B or T lymphocytes contributes to incidental lymphocytosis among asymptomatic individuals.

• The relationship of CLL-type MBL and early CLL may be evaluated with patients presenting peripheral lymphocytosis.

• Molecular clonality assays may detect additional MBL cases as compared to flow-cytometry detection.

• PCR- based TCR assays may improve the detection of clonal T lymphocytosis (monoclonal T lymphocytosis, MTL) analogous to MBL.

2 PATIENTS & METHODS:

2.1 Patients: To begin to acquire this type of information we evaluated EDTA (ethylene diamine tetra acetic acid) peripheral blood (PB) samples from 203 patients over the age of 24 years, presenting with asymptomatic peripheral lymphocytosis. Our cut off criteria to define lymphocytosis was >3.50 x109/L or >3500/μL. Among these selected patient population, 71 were males and 132 were females.

Individuals were selected based on findings from routine blood tests at the haematology laboratories of Mount Sinai Hospital and the CML (Canadian Medical Laboratories) Healthcare Centre, Toronto, Canada by using their respective laboratory information systems. This screening process included both hospital-based patients, including those from outpatient clinics, and community-based patients assessed at the CML Healthcare laboratories. Notably, large numbers of samples are potentially available at the CML Healthcare haematology laboratory. Hence, access to this patient population greatly facilitated the patient selection process of this study.

Those who had a history or a suspicion of malignancy were excluded from the study. All individuals included in the study had a normal blood cell count, except for lymphocytosis at the routine blood test. In short, the selected samples were based on the following criteria: 1) patients over the age of 24 years; 2) absolute lymphocyte counts over 3.5 x 109/L but up to 14.9 x 109/L; 3) haemoglobin, granulocyte and platelet counts all within normal limits; 4) no prior history of any haematological disorder or malignancy; and finally 5) no malignant lymphocytes present in blood smears.

The study was performed over the period of 30 months (from May 2008 to November 2010). All samples were processed within 24 hours after blood withdrawal. The blood specimens were collected only following the completion of routine tests, and this study did not interfere any of the standard laboratory procedures. A protocol of collecting blood specimens with lymphocytosis for this study was followed in accordance with the Research Ethics Board.

2.2 Flow cytometry analysis of B & T-lymphocytes:

For each of the 203 samples selected in this study, the immunophenotype of B- and T- lymphocyte was assessed by using flow cytometry. As mentioned earlier flow cytometry is the most widely used technique, and plays an important role in the evaluation of lymphoproliferative disorders. Thus, immunophenotypic analysis was performed with PB using flow cytometry as previously described [32, 33]. Mononuclear cells were prepared by the RBC lysis technique (Immuno Prep, TQ-Prep, Beckman Coulter, Miami, FL). For antigen detection we used the direct

antibody labelling with 4 (for T-cells) or 5 (for B-cells) colors immunophenotyping. Cells were incubated in phosphate-buffered saline (PBS) plus 1% bovine serum albumin at 4oC for 30 minutes with their respective T and B-lymphocytes antibody mixes.

A 5-color flow cytometry protocol was adopted for the detection of B-cell clones. This consisted of a panel of antibodies for CD45-Texas red (ECD), CD19-phycoerythrin-cyanin (PC7), CD5- phycoerythrin-cyanin 5.1 (PC5), and κ-fluorescene isothiocyanate (FITC) and λ-R-phycoerythrin (RPE) light chains in a single tube. Using this protocol, the total lymphocyte population was initially grouped by CD45 and light scatter gating, and the proportion of B-cells within this group was determined by CD19 expression. Subsequently, B-cell clonality was assessed by κ/λ ratio, as defined by the working diagnostic criteria for MBL i.e. markedly skewed κ/λ ratio of >3:1 or <0.3:1 [10]. The number and characteristics of T-lymphocytes was assessed by a mixture of 4-colour panel of antibodies called tetra chrome which includes CD45- FITC, CD3- PC5, CD4-RD1 and CD8-ECD. Following the separation of lymphocytes by CD45 expression, the expression of CD3 (a pan-T-cell marker) was utilized to determine the proportion of T-cells, while the expression of CD4 and CD8 indicated the frequency of T helper cells and cytotoxic T- cells respectively, within this group. All the antibodies were purchased from commercial suppliers (Beckmen Coulter).

The antibody-stained cells were washed twice with phosphate buffered saline (PBS) plus 1% bovine serum albumin before flow cytometric analysis. For each sample, at least 10,000 events were acquired on a Coulter Epics XL Flow Cytometer equipped with a 488-nm argon laser (Beckman Coulter). The data were analyzed with a System II program (Beckman Coulter). Lymphocyte populations were selected by light and side scatters and CD45 and side scatter gating methods. Total B lymphocytes were identified by CD19 and CD45 and light scatter characteristics. Isotype-matched negative control samples were used in all assays for setting cursors to determine positive and negative results. The level of antigen expression was determined by the fluorescent intensity on logarithmic scales.

The normal B cell population was represented by the CD19+ve B-lymphocytes with a normal κ/λ ratio. The CLL-type clonal B cells were represented by either kappa or lambda light chain restriction and dual positive expression of CD5 and CD19. The CD5- MBL cases were detected

38 by a clonal B cell population with either κ or λ light chain expression, with B cell population clearly CD5-ve negative as shown in the figure 3 below.

A1 A2 A3

B1 B2 B3 B4

C1 C2 C3 C4

Figure 3: Detection of non-clonal lymphocytosis & B-lymphocyte clonality by Flow-Cytometry. A1- A3, an example of a normal B cell population, as the CD19 B lymphocytes show a normal kappa/lambda ratio. B1-B4 show an example of CLL-type clonal B cells with lambda light chain and dual positive expression of CD5 and CD19. C1-C4 show an example of a clonal B cell population with lambda light chain expression and the B cell population is clearly CD5 negative. SS side scattered; ECD Texas red; FITC fluorescein isothiocyanate; PE phycoerythrin; RD1 rhodamine; PC5 phycoerythrin-cyanin 5.1; PC7 phycoerythrin-cyanin. 39

2.3 PCR amplification for IgH, TCR-β and TCR-γ genes

2.3.1 DNA extraction: Genomic DNA was extracted from white blood cells (WBC) that were separated from the whole blood of the167 available patient’s blood samples, by using Red Blood Cell Sedimentation with Dextran T-500 protocol [160]. The remaining 36 patient blood samples were just enough to conduct flow cytometry only. Alternatively, the whole blood or buffy coat preparations could also be used in the QIAamp protocol to obtain DNA. However we adopted this protocol as high molecular weight DNA could be extracted from WBCs obtained from this method (approximately 60 µg of genomic DNA can be obtained from 107 WBCs). The steps of this procedure are briefly mentioned as below:

• In a 15 mL conical tube, we took 2 mL of whole blood (EDTA, Citrate anti-coagulated), 8 mL of normal saline and 2 mL of 6% Dextran T-500 in distilled water. The mixture was well shaken and allowed to stand on the bench for ~1 hour.

• After 1 hour the upper cell suspension (red blood cell poor) was transferred in to a new tube.

• This suspension was then centrifuged at 2500 rpm for 10 minutes. The supernatant fluid was discarded and the WBCs that were at the bottom of the tube were re-suspended with 200 µL of normal saline.

The WBCs obtained were then used for DNA extraction by QIA amp DNA blood mini kit (50) (Cat # 51106) according to manufacturer’s instructions [161]. The DNA concentration was measured by using Nano Drop Spectrophotometer [162] and approximately 50 ng of DNA per reaction was used during PCR testing.

2.3.2 Primers design for IgH, TCRβ and TCRγ and multiplex PCR: To detect the presence of monoclonal IgH, TCRβ and TCRγ rearrangements, DNA was amplified by using BIOMED-2 multiplex PCR protocol [141]. This protocol was adopted for this study, as it uses multiple consensus primers which enables near complete amplification of the rearrangeable fragments at the IgH, TCRβ and TCRγ loci [141, 163]. In addition to that, this 40

approach represents the most sensitive method currently available for the detection of clonality in B- and T-lymphocytes.

Because of the different gene segments, the family members were divided into different groups so that the entire gene segment could be covered. For IgH gene PCR, it was grouped in three reaction tubes: Tube A, Tube B and Tube C. Each tube tested the designed Framework region (Fr) i.e FrI, FrII and FrIII (figure 1). The TCR-β gene was also divided into three groups: Beta-A, Beta-B and Beta-C, whereas, TCR- γ gene was tested with two tubes: Gamma-A and Gamma-B.

Each reaction tube was composed of different numbers of primers, the sequences of which have been already described previously [141] (figure 2). The primer numbers and design in each reaction tube are given in Table 2 and Table 3 respectively. For amplification, PCR reactions were performed in an automated thermocycler model ABI 9600/9700 system according to the BIOMED-2 multiplex PCR protocol [141].

Table 2: Primer numbers in each PCR reaction tube [141]

Reaction Detection Forward Reverse Amplified Tubes Segment Primers Primers* sizes (nt) Tube A VDJ-FrI V-6 J-1 310-360 IgH gene Tube B VDJ-FrII V-7 J-1 250-295 Tube C VDJ-FrIII V-7 J-1 100-170 Tube A T-β, A Vβ-23 Jβ-9 240-285 β β β TCR-β gene Tube B T- , B V -23 J -4 240-285 170-210 Tube C T-β, C Dβ1+2 Jβ-13 285-325 Tube A T-γ, A Vγ-2 Jγ-2 120-300 TCR-γ gene Tube B T-γ, B Vγ-2 Jγ-2 70-250

Table: 3 The primer design and multiplex combinations of the standardized BIOMED-2 multiplex PCR protocol [141]

Primer Prime Locus Target Primer Sequence (5’ - 3’) Locus Target Primer Sequence (5’ - 3’) Tube r Tube A + B + JH TCRβ A + B Vβ2 AACTATGTTTTGGTATCGTCA IGH CTTACCTGAGGAGACGGTGACC C Consensus Vβ4 CACGATGTTCTGGTACCGTCAGCA Vβ5/1 CAGTGTGTCCTGGTACCAACAG A VH1-FR1 GGCCTCAGTGAAGGTCTCCTGCAAG Vβ6a/11 AACCCTTTATTGGTACCGACA VH2-FR1 GTCTGGTCCTACGCTGGTGAAACCC Vβ6b/25 ATCCCTTTTTTGGTACCAACAG VH3-FR1 CTGGGGGGTCCCTGAGACTCTCCTG Vβ6c AACCCTTTATTGGTATCAACAG VH4-FR1 CTTCGGAGACCCTGTCCCTCACCTG Vβ7 CGCTATGTATTGGTACAAGCA VH5-FR1 CGGGGAGTCTCTGAAGATCTCCTGT Vβ8a CTCCCGTTTTCTGGTACAGACAGAC VH6-FR1 TCGCAGACCCTCTCACTCACCTGTG Vβ9 CGCTATGTATTGGTATAAACAG Vβ10 TTATGTTTACTGGTATCGTAAGAAGC B VH1-FR2 CTGGGTGCGACAGGCCCCTGGACAA Vβ11 CAAAATGTACTGGTATAGACAAG VH2-FR2 TGGATCCGTCAGCCCCCAGGGAAGG Vβ12a/3/ GTATATGTCCTGGTATCGACAAGA VH3-FR2 GGTCCGCCAGGCTCCAGGGAA 13a/15 TGGATCCGCCAGCCCCCAGGGGAAG Vβ13b GGCCATGTACTGGTATAGACAAG VH4-FR2 G Vβ13c/12b/ 14 GTATATGTCCTGGTATCGACAAGA VH5-FR2 GGGTGCGCCAGATGCCCGGGAAAGG Vβ16 TAACCTTTATTGGTATCGACGTGT VH6-FR2 TGGATCAGGCAGTCCCCATCGAGAG Vβ17 GGCCATGTACTGGTACCGACA VH7-FR2 TTGGGTGCGACAGGCCCCTGGACAA Vβ18 TCATGTTTACTGGTATCGGCAG Vβ19 TTATGTTTATTGGTATCAACAGAATCA C VH1-FR3 TGGAGCTGAGCAGCCTGAGATCTGA Vβ20 CAACCTATACTGGTACCGACA VH2-FR3 CAATGACCAACATGGACCCTGTGGA Vβ21 TACCCTTTACTGGTACCGGCAG VH3-FR3 TCTGCAAATGAACAGCCTGAGAGCC Vβ22 ATACTTCTATTGGTACAGACAAATCT VH4-FR3 GAGCTCTGTGACCGCCGCGGACACG Vβ23/8b CACGGTCTACTGGTACCAGCA VH5-FR3 CAGCACCGCCTACCTGCAGTGGAGC Vβ24 CGTCATGTACTGGTACCAGCA VH6-FR3 GTTCTCCCTGCAGCTGAACTCTGTG VH7-FR3 CAGCACGGCATATCTGCAGATCAG A + B Jβ1.1 CTTACCTACAACTGTGAATCTGGTG Primer Jβ1.2 CTTACCTACAACGGTTAACCTGGTC Locus Target Primer Sequence (5’ - 3’) Tube Jβ1.3 CTTACCTACAACAGTGAGCCAACTT TCRγ A + B Jγ1.1/2.1 TTACCAGGCGAAGTTACTATGAGC Jβ1.4 CATACCCAAGACAGAGAGCTGGGTTC Jγ1.3/2.3 GTGTTGTTCCACTGCCAAAGAG Jβ1.5 CTTACCTAGGATGGAGAGTCGAGTC Jβ1.6 CATACCTGTCACAGTGAGCCTG A Vγ1F GGAAGGCCCCACAGCRTCTT Jβ2.2 CTTACCCAGTACGGTCAGCCT Vγ10 AGCATGGGTAAGACAAGCAA Jβ2.6 CTCGCCCAGCACGGTCAGCCT Jβ2.7 CTTACCTGTAACCGTGAGCCTG B Vγ9 CGGCACTGTCAGAAAGGAATC Vγ11 CTTCCACTTCCACTTTGAAA B + C Jβ2.1 CCTTCTTACCTAGCACGGTGA Jβ2.3 CCCGCTTACCGAGCACTGTCA Jβ2.4 CCAGCTTACCCAGCACTGAGA Jβ2.5 CGCGCACACCGAGCAC

C Dβ1 GCCAAACAGCCTTACAAAGAC Dβ2 CTGACACACCCCGAACCTTT

2.3.3 PCR product Analyses:

The PCR products yielded were analyzed by two separate methods. Firstly, gel electrophoresis method was conducted, in which a 2% agarose gel was stained with ethidium bromide that provided a preliminary qualitative assessment of clonality status. Herein, a smear of products was indicative of a polyclonal B or T-cell population, whereas, a single discrete band signalled the presence of a clonal proliferation. 42

The typical gel electrophoresis of the PCR products derived from amplification at the IgH locus in clonal and polyclonal controls of well-defined clonality status is shown in the figure 4, which is based on the BIOMED-2 multiplex primer design. As shown in this figure 4, tube A primers promoted the amplification of rearranged fragments between 310-360 base pairs (bp) in length; tube B amplified products of 240-320 bp; and tube C gave products of 100-175bp. Within these ranges, a single discrete band was obtained in patients with a clonal population of B-cells, while a smear of products indicates the amplification of heterogeneous, or polyclonal, array of IGH rearrangement.

Clonal Polyclonal

1kb Tube A Tube B Tube C Tube A Tube B Tube C

400 bp 300 bp 200 bp

Figure 4: Gel electrophoresis of the PCR products derived from amplification at the IgH locus in clonal and polyclonal controls of well-defined clonality status. Tube A primers amplified rearranged fragments between 310-360 base pairs (bp) in length; tube B & C amplified products of 240-320 bp and 100-175bp respectively. Within these ranges a single discrete band indicates clonal population of B-cells whereas smear indicates the amplification of polyclonal, array of IgH rearrangement.

The second method that we adopted was ABI 3100 Genetic Analyzer (Applied Biosystems) in which the quantitative analysis of PCR products was achieved by using automated sequencing apparatus, whereby PCR products were separated in a polyacrylamide sequencing gel and then analyzed by an automated laser [141]. Where a Gaussian distribution of peaks indicates the presence of many different PCR fragments derived from a polyclonal population, a single and dominant peak in fragment size represents the presence of a monoclonal cell population. Hence, this approach incorporates two separate analytical techniques to provide a reliable assessment of clonality following multiplex PCR.

The IgH gene structure, primer locations (indicated by black bold arrows), size of PCR products and a typical GeneScan image for VDJ of IgH gene is shown in figure 5, for reference to predict where a particular band for each frame work region will be located. Whereas, the actual images from IgH Gene Scan are shown in Figure 6. The typical negative (multiple small peaks) or typical positive (one single narrow peak) peak patterns are easy to judge. The amplification product from a polyclonal population resulted from a number of rearranged Ig genes, thus giving rise to fragments of varying length and resulting in a broad band. Whereas, monoclonality in B- cell population is indicated by the presence of a single discrete fragment. The positive and negative peaks explained are as previously described [141].

FrI FrII FrIII CH DH JH

6 VH primers 7VH primers 7VH primers 1 JH primer

FrI: FrII: FrIII: 310-360 bp 250-295 bp 100-170 bp

Figure 5: Size of PCR products and a typical GeneScan image for VDJ of IgH gene. The IgH gene structure, primer locations (indicated by black bold arrows), size of PCR products and a typical GeneScan image for VDJ of IgH gene is shown here in this figure to predict where a particular band for each frame work region (Fr) will be located.

Figure 6: Positive and negative image patterns for VDJ of IgH gene: the actual images from IgH Gene Scan are shown in Figure 6. The typical negative (multiple small peaks) the top 3 panels (FrI, FrII, FrIII) of the figure and typical positive (one single narrow peak) peak patterns bottom 2 panels (FrI, FrII) are shown here.

Similarly, the images from GeneScan of typical negative patterns for TCR- β, A, B and C are shown in Figure 7, displaying multiple small peaks giving rise to fragments of varying length, resulting in a broad band. The typical positive patterns for TCR- β, A, B and C are shown in Figure 8, displaying one single narrow peak indicated by production of a single discrete fragment. Similarly, the negative and positive patterns for TCR-γ were also seen.

TCR- β-A: (240-285 bp)

TCR- β-B: (240-285 bp)

D2: 170-210 bp D1: 285-325 bp TCR- β-C:

Figure 7: Typical Negative Patterns for TCR- β, A, B and C. The images from GeneScan of typical negative patterns for TCR- β, A, B and C is displayed here by multiple small peaks, giving rise to fragments of varying length, resulting in a broad band.

TCR- β-A: (240-285 bp)

TCR- β-B: (240-285 bp)

D2: 170-210 bp TCR- β-C: D1: 285-325 bp

Figure 8: Typical Positive Pattern for TCR-β, A, B and C. The typical positive patterns for TCR- β, A, B and C are shown in this figure, by displaying one single narrow peak indicated by production of a single discrete fragment

3 RESULTS: A total of 203 patients over the age of 24 years, presenting with asymptomatic absolute lymphocytosis were included in this study. All these patients presented with mild to moderate lymphocytosis, with an absolute lymphocyte count over 3.50 x109/L (range: 3.51-14.9; median: 4.57). The age range was 24-99 years and the median age was 62 years. Among the 203 selected patients, 71 were males and 132 were females, and it was surprising to see more clonal lymphocytes in female population as we had relatively tested more female. However the male and female selection was random.

Each of the 203 samples was assessed for both clonal B- and T- lymphocytes. Clonal B lymphocytes were determined by flow cytometry, including the analysis of kappa: lambda ratio and CLL-associated markers, and clonality were confirmed by PCR for IGH rearrangements. In T-cells, clonality was determined by the PCR-based analysis of TCR-β and -γ gene rearrangements, whereas flow cytometry provided limited information of utility during the assessment of T-cell clonality. Among 203 patients, 110 (54.1%) proved to possess clonal lymphocytes, of which 78 were B-cell clonal and the remaining 32 were T-cell clonal cases.

Based on the expression of CD5 by flow cytometry, the 78 B-cell clonal lymphocyte cases were classified into 63 CLL-type phenotype cases (CD5+ve) and 15 non CLL-type phenotype cases (CD5-ve) cases. Of the 63 CLL-type cases, 19 were re-classified as CLL and 44 as CLL- phenotype MBL based on the B-lymphocyte threshold of > and < 5x109/L for CLL and MBL, respectively.

In 24 of the 44 cases carrying a monoclonal B-cell population with CLL-phenotype, a genomic PCR analysis was performed using consensus primers targeting FRI, FRII, FRIII and JH sequences. A monoclonal rearrangement was demonstrated in 21 of the 24 cases. Similarly, in 8 of the 15 patients with CD5- MBL, genomic PCR analysis detected monoclonal rearrangements in all of the 8 tested cases. Finally, for patients recognized with CLL, IGH-PCR was performed in 14 of the 19 cases, of which monoclonal rearrangements were demonstrated in 13.

During the assessment of T-cell clonality, flow cytometry yielded limited information. Accordingly, PCR-based assays formed the predominant method for the detection of these clonal

expansions. Using this technique, 32 T-cell clonal cases were recognized based on TCR gene rearrangement. Among them, 4 of the 32 patients were TCR-β +ve, 9 were TCR-γ +ve and 19 were positive for both TCR-β and γ. The results of clonality testing and the hematological characteristics across this patient series are summarized in table 4.

Table: 4 Summary of 203 patients with asymptomatic peripheral lymphocytosis

CD5+MBL CD5- MBL CLL T-cell clonal Non-clonal

Total cases # (%) 44 (22) 15 (7) 19 (9) 32 (16) 93 (46)

Age (yrs) range: 31-97 51-86 54-89 41-95 24-99 median: 67 67 72 60 54

Gender M:19, F:25 M:3, F:12 M:8, F:11 M:14, F: 18 M:27, F:66 M:F 0.76 0.25 0.72 0.77 0.40

WBC (X10^9/mm^3) range: 7.16-19.08 7.44-21.3 10.3-20.6 6.6-15.56 5.83-17.1 median: 10.1 10.18 14.07 10.81 10.3

Hb (g/L) range: 109-162 116-151 102 -168 111-168 106-174 median: 141 134 128 136 132

PLT (X10^9/mm^3) range: 124-428 120- 400 122-307 134-375 120-552 median: 205 224 180 250 290

Neutro (X10^9/mm^3) range: 2.12- 10.9 2.7- 8.37 3.0-6.57 1.5- 9.83 1.1-8.77 median: 4.24 4.47 4.22 4.97 4.97

Lymph (X10^9/mm^3) range: 3.51- 6.98 3.58- 14.9 6.43-14.2 3.54-10.64 3.55-8.95 median: 4.89 4.77 8.6 4.15 4.33

B-cells (X10^9/mm^3) range: 0.47-4.96 0.28- 11.59 5.01-11.17 0.18-2.36 0.04-3.29 median: 3.12 2.44 5.95 0.43 0.39

T-cells (X10^9/mm^3) range: 0.31-2.95 0.49-4.51 0.91-4.08 2.41-8.86 0.36-6.28 median: 1.82 2.5 1.56 3.52 2.85

3.1 CLL-phenotype MBL and CLL:

Unlike MBL identified by screening individuals with a normal complete blood count, all the patients in our study were encountered in clinical practice i.e. patients presenting with lymphocytosis. A total of 63 cases of CLL-phenotype cases were identified in this study. By using the B-ALC 2008 cut-off criteria for diagnosis of CLL and MBL, 44 of the 63 patients were re-classified as CLL-type MBL and 19 cases were labelled as CLL (possibly Rai Stage 0). It is interesting to note that CLL-phenotype MBL accounted for the majority (56.4%) of the clonal B- cell cases (44/78) and 21.6% (44/203) of the cases of asymptomatic lymphocytosis.

For CD5+MBL, the median age of presentation was 67 yrs and that of CLL was 72 yrs. In addition, the youngest age of presentation of CD5+MBL in our study group was 31 years. The median white blood cell count (WBC) of CD5+MBL was 10.1 (x109/L) and that of CLL was 14.07 (x109/L), and the WBC range of CD5+MBL and CLL was 7.1-19.8 and 10.3-20.6 respectively. This means that CD5+MBL and CLL can occur even with a normal or slightly elevated WBC count. But by comparing the median values CD5+MBL signifies its occurrence mostly in normal white cell count.

The median ALC in CD5+MBL stayed at 4.89 (range: 3.51-6.98) and clinically silent CLL at 8.6 (3.58-14.9). The differences in median ALC values suggest that the median ALC of CLL is roughly double the median ALC of CD5+MBL. The B-ALC is according to the definition and WHO diagnostic criteria. The median B-ALC of the CD5+MBL group was 3.12 and that of CLL was 5.95, which raise an important point that the median B-ALC of clinically silent CLL was slightly above the cut-off value of >5x109/L, suggesting that in clinical practice it is merely difficult to distinguish between Rai stage 0 CLL and CLL-phenotype MBL.

For clonal B-cells cases, in addition to absolute lymphocyte count (ALC) and B absolute lymphocyte count (B-ALC), we also analyzed the size of clonal B-cells (C-ALC), as shown in figure 9. The figure 9 clearly outlines the close relationship of CLL-phenotype MBL and CLL cases. The clonal population of CLL-phenotype B-cells (including both CD5+MBL & CLL) ranged from 0.08-8.32 (x109/L) and represented 17-99% of B-ALC and 2-80% of ALC. When graphed, a plot of clonal cells from individual cases showed a continuous ascending pattern. It is

CD5+MBL & CLL (clonal-size)

16 ALC 14 B-ALC 12 X10^9/ C-ALC L cells 10 8 Line crosses at 5X 10^9/L 6 4 2 0 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55 57 59 61 63 # of cases (44 +19) =63

Figure: 9 Distribution of lymphocyte counts CLL-type MBL & CLL. The sizes of clonal populations from MBL and CLL can be arranged in continuous ascending pattern, suggest a continuous spectrum of clonal expansion, and there appears no clear separation between MBL and CLL. ALC, absolute lymphocytosis; B-ALC, total B-cells; C-ALC, total clonal B-cells.

evident from the figure that the cases in the centre are so close to the cut-off that it seems that this cut off (5 x109/L) is arbitrary and in clinical practice it is difficult to distinguish between these two entities. The spectrum of clonal size may reflect the process of clonal expansion, although some MBL might still be stable over a long period of time.

3.2 CD5-MBL:

The CD5-MBL accounted for the significant number 19.2% (15/78) of the clonal B-cell cases and 7.4% (15/203) of the total asymptomatic lymphocytosis cases. By flow cytometry 15 samples were found to be CD5-ve, while for molecular clonality testing 8 samples were available and all of them were positive for IgH gene rearrangement mutation. The median age of presentation of CD5-MBL was 67 yrs which was the similar to median age of presentation of CD5+ MBL. However, the starting age range was older than CD5+MBL refer to summary table 3. The median ALC at 4.77 (x109/L) and median B-ALC at 2.44 (x109/L) was less than the respective medians in CD5+MBL. In 4 of the15 CD5-MBL patients, the total B-ALC was >5 x109/L and ranged from 7.01-14.9 (x109/L) as shown in the figure 10 (patient number 12, 13, 14

& 15). The ALC and B-ALC of these 4 patients are 7.01, 9.53, 12.0, 14.9 and 5.06, 7.56, 8.19, 11.59 respectively.

CD5-MBL (MLUS)

16 14 ALC 12 B-ALC Clonal B-cells 10 8 6

10^9/L CellsX 4 2 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 # of Cases 15

Figure 10: Distribution of lymphocyte counts of CD5-MBL cases. ALC, absolute lymphocytosis; B- ALC total B-cells; C-ALC, total clonal B-cells.

3.3 T-cell Clonal: T-cell clonality was assessed by incorporating the standardized BIOMED-2 primer design to examine rearranged fragments at the TCR-β and TCR-γ loci in DNA extracted from each blood specimen. A total of 32 cases were found to have TCR gene re-arrangements. Among them 4 of the 32 cases were TCR-β +ve, 9 were TCR-γ +ve and 19 were positive for both TCR-β and γ. The median age of presentation was 60 years, which is the youngest median ages among all the clonal B-and T-cell cases. The median CD4: CD8 ratio remained within normal limit at 1.22. However the median ALC stayed higher at 4.15 and the median T-ALC at 3.52 as shown in table 5 below.

Table 5: T-cell clonal cases characteristics

Total cases Age (yrs) CD4:CD8 T-ALC ALC TCR-β TCR-γ TCR-β &- Range: Range: (x109/L) (x109/L) +ve +ve γ Median: Median: Range: Range: double Median Median: +ve

n=32 41-95 0.14-4.62 2.41-8.86 3.54-10.64 4/32 9/32 19/32 60 1.22 3.52 4.15

3.4 The presence of clonal T-cells in Monoclonal B lymphocytosis

Among 44 MBL cases, 5 of them were TCR & IGH double positive. Among these 5 cases, 2 were IGH and TCR –γ double positive whereas, other 2 cases were IgH and TCR-β positive and 1 case was IgH and TCR- β / γ triple positive. Beside MBL, 1 CLL case was also double positive for IGH and TCR – γ, as shown in table 6 below.

Table 6: The presence of clonal T-cells in MBL

# Diagnosis Age gender ALC B-ALC T-ALC CD4: κ: λ TCR-β TCR-γ IgH yrs x109/L x109/L x109/L CD8

1 MBL 75 F 3.51 0.87 2.21 0.96 0.16 - + + 2 MBL 77 M 3.85 2.23 - - 43.3 - + + 3 MBL 91 F 4.09 1.63 2.08 0.87 8.2 + - + 4 MBL 81 M 4.97 3.2 - - 42.4 + + + 5 MBL 83 F 5.86 4.28 1.15 1.6 91.5 + - + 6 CLL 78 F 10.25 6.99 2.12 3.07 2.1 - + +

3.5 Comparison of PCR and flow cytometry for B-cell clonality detection Following the evaluation of B-cell clonality by both flow cytometry and multiplex PCR, we matched the patient’s results in order to evaluate the efficacy of traditional κ/λ thresholds during

53 the discrimination of clonal B lymphocytosis. While comparing both the techniques, we achieved surprising results (as shown in table 4).

For CD5+MBL cases flow cytometry yielded 95.45% (42/44) result whereas, multiplex PCR yielded 87.5% (21/24) of the result. The 3 cases that were negative (non-clonal) for IgH mutational status on molecular testing were clearly clonal on flow cytometry based on light chain restriction κ/λ ratios. Their respective κ/λ ratios were 11.33, 0.09 and 0.01. Similarly, the 2 cases that were non-clonal on flow cytometry based on normal κ/λ ratio of 1.22 and 1.17 were clonal on molecular clonality testing. In case of CD5-MBL the yield was 100% for both the testing. However for CLL, flow-cytometry proved to be 100%, whereas, multiplex PCR failed to proof the clonality in 1 patient that was clonal on flow cytometry (κ/λ ratio 0.01).

Table 7: Comparison of PCR and flow cytometry for B-cell clonality detection

Diagnosis Flow cytometry IgH Clonality

n % n %

CD5+MBL (n=44) 42/44 95.45 21/24 87.5

CD5-MBL (n=15) 15/15 100 8/8 100

CLL (n=19) 19/19 100 13/14 92.85

4 DISCUSSION:

In this thesis, we had the opportunity to identify and characterize clonal B and T lymphocytes in a series of 203 patients presenting with asymptomatic peripheral lymphocytosis. The significance of finding clonal lymphocytes is still unclear. The high occurrence of clonal lymphocytes in elderly population may suggest that this finding is a phenomenon of lymphoid senescence or age-related restriction of the B-cell repertoire [1, 2]. Alternatively, it could also be possible that

54 some of these clonal lymphocyte populations may represent a precursor or very early stage of a well-defined lymphoid neoplasm. As a result, the proper follow-up of these clonal lymphocyte populations will determine if they remain stable or evolve into a clinical malignancy.

So far, many studies have been done to assess the prevalence of clonal B-cells in healthy adults with normal lymphocytes counts. This study is unique as it has not only focused on the occurrence of clonal B-lymphocytes in the context of lymphocytosis but has also looked at clonal-T lymphocytes. To our knowledge, this study is the first to determine the prevalence of clonal B and T-lymphocytes in patients presenting with asymptomatic peripheral lymphocytosis. Surprisingly, the presence of clonal lymphocytes was detected in more than half (54.1%) of the cases presenting with asymptomatic peripheral lymphocytosis in this study. Among them, clonal B-lymphocytes accounted for 78 cases, comprising 38.4% of the cases of lymphocytosis. On the other hand, clonal T-cell proliferations surprisingly accounted for 32 cases, accounting for 15.8% of lymphocytosis cases.

Similar to population-screening MBL, CLL-type MBL represented the majority (21.7%) of the cases of clonal B-lymphocytosis in this study. Unlike MBL identified during the screening of individuals with a normal complete blood count, all the patients in our study were encountered in clinical practice. Accordingly, these CLL-like MBL patients fulfilled the typical characteristics of clinical-MBL, a group which is likely at higher risk of progression to CLL due to the presence of absolute lymphocytosis and significant size of the clonal population. Additionally, while comparing CLL-phenotype MBL and CLL, we found that the median age of presentation of CD5+MBL was 67 yrs and that of CLL was 72 years. Another interesting finding was that the youngest age of detection for CD5+MBL in this study was 31 years, whereas the youngest age of presentation of asymptomatic Rai Stage 0 CLL was 54 years, suggesting that MBL occurs at a comparatively younger age than CLL.

An important issue in the diagnosis of CLL and MBL is how best to differentiate between these two entities. This controversy was raised when the recent International Workshop on CLL (IWCLL) updated the 1996 diagnostic criteria for CLL [35]. According to the new criteria, the diagnosis of CLL requires a B-ALC >5x109/L, which differs from the previous requirement based on an ALC of >5x109/L. Although the diagnosis of CLL based on B-ALC was proposed to eliminate the overlap between the diagnosis of CLL and MBL (which requires the B-ALC of

55 <5x109/L), it has created a considerable amount of debate. Many studies have been done to examine the efficacy about this arbitrary threshold criterion for MBL and CLL. Among them, one group [138] found that ALC and B-ALC are not interchangeable terms and concluded that B-ALC was a poor surrogate of ALC, especially when the ALC was <10 x 109/L. In a subsequent study [20] this group tried to determine the most effective criteria for distinguishing between patients with a different clinical outcome. They found that a B-ALC threshold of 11x109/L best predicted the overall survival (OS) and treatment free survival (TFS).

We also looked at this issue, comparing the clonal B-cell cases (CLL-phenotype MBL and CLL) by plotting them in ascending order in terms of B-cell count. We found that the spectrum of clonal size reflected a continuous process of clonal expansion. The cases closer to the diagnostic threshold of MBL and CLL seemed to be arbitrarily divided between these diagnostic groups, and it is virtually impossible to distinguish between them in clinical practice. Thus, we concluded that clinical CD5+ MBL and CLL are present in a continuous spectrum of clonal expansion and the cut-off (5 x 109/L) is arbitrary. Thus, this study suggests that such criteria should be based on clinical outcomes rather than an arbitrary B-ALC cut-off.

Besides the high occurrence of CLL-like MBL, a striking and rather unexpected finding was the significant number of non-CLL like MBL cases detected in this study. CD5-MBL, which is a rare condition in population-screening studies, was found at a higher prevalence of 7.4% (15/203) among the asymptomatic lymphocytosis patients in this study, therefore raising concerns that this condition may be more prevalent in patients presenting with lymphocytosis. Similar to CD5+MBL, the median age of presentation of CD5-MBL was 67 years. One interesting finding in our study was that among these 15 CD5-MBL patients, 4 of them had a total B-lymphocyte count over 5 x109/L. Based on B-ALC count, these patients therefore do not qualify for a diagnosis of MBL. Hence, these patients clinically and hematologically qualify for MBL, but do not fulfill the diagnostic criteria of MBL in terms of B-ALC. These finding clearly suggest that the B-ALC threshold may differentiate CLL-type MBL and CLL, but fails to effectively categorize all patients with CD5- MBL. Additionally the CD5-ve nature of these clonal B- lymphocytes may suggest a benign nature and cell of origin different from that of CLL, as stated in previous studies by our group [31, 32, 33]. Therefore, it is reasonable to suggest CD5-MBL as a separate diagnostic entity since it does not completely fulfill the diagnostic criteria of MBL.

In addition, this study also examined the most sensitive method for the detection of clonality in B-cells. Based on the heightened sensitivity of the molecular assays, the results obtained by multiplex PCR could in principle be utilized to determine the presence of false negatives and false positives during the assessment of clonality by κ/λ ratios. However, in this study, while comparing the results of flow cytometry and multiplex-PCR assays for clonal B-cells, surprising results were yielded. For CD5+MBL cases, flow-cytometry positively identified clonal B-cells in 95.45% (42/44) of cases, whereas multiplex PCR showed clonal rearrangements in 87.5% (21/24). The 2 cases that were negative (non-clonal) for IgH mutational status during molecular testing were clearly clonal on flow cytometric assessment, based on highly skewed κ/λ ratios. This could be possibly due to improper primer annealing or near complete coverage by the consensus primers of the IgH gene.

Similarly, the 2 cases that were non-clonal during flow-cytometry due to the presence of normal κ/λ ratio were IgH clonal during molecular clonality testing, therefore implicating the presence of a clonal B-cell population. In cases of CD5-MBL, the consistency was 100% between both methods. However, for CLL, flow cytometry proved to be 100% efficient during the detection of clonal B-cells, whereas multiplex PCR failed to detect clonal rearrangements in 1 patient that was clonal on flow cytometry.

It has been known for more than a decade that Ig and TCR gene rearrangements are not markers for lineage and Ig and TCR gene rearrangements are not necessarily restricted to respective B- and T-cell lineages. Cross lineage rearrangement - i.e. TCR and IgH gene rearrangements in B and T cell lymphoid neoplasms, respectively - arise relatively frequently [164]. As a result, in this study we were not surprised to observe that 1 CLL and 5 CLL-type MBL patients were positive for both TCR and IgH gene rearrangements. Studies suggest that cross lineage rearrangement are more common in immature lymphoid neoplasms and approximately 25–30% of high grade lymphoid tumours and 5–10% of low grade tumours show cross lineage rearrangements. These cross lineage Ig gene rearrangements are mostly restricted to the Ig heavy chain gene in T cell neoplasia and rearranged Ig light chain gene have rarely been found.

In conclusion, clonal lymphocytes could be detected by either flow cytometry or IGH-PCR in more than half of patients presenting with asymptomatic peripheral lymphocytosis. Similar to

57 population-screening MBL, CLL-like MBL comprised the majority of cases. In addition, the prevalence of CLL-like MBL (CD5+MBL) is much higher when determined in patients presenting with lymphocytosis as compared to healthy adults. The CD5+MBL cases detected in this study are designated as clinical-MBL, and have a greater tendency to develop into CLL than the MBL cases detected during the population-screening studies. These clinical-MBL cases represent suitable candidates for future studies to explore if any additional molecular or cellular events are responsible for their transformation to CLL. The cut-off diagnostic criteria distinguishing CLL from MBL is arbitrary, especially in the CLL and MBL cases closer to the 5 x 109/L threshold, and in clinical practice it is difficult to distinguish between the two entities based on this criterion. Besides CD5+MBL, the striking numbers of CD5-MBL cases reported in this study clearly signifies its higher occurrence in patients with asymptomatic lymphocytosis. This contrasts with the low prevalence of this condition in population screening, during which it is usually neglected. In addition, the CD5 negative feature of this entity may reserve its place as a different diagnostic category than MBL, which is widely regarded as a precursor of CLL. Finally, such a high prevalence of clonal T-cell lymphocytosis observed in this study suggests it as an equally important diagnostic entity that has been previously overlooked. Indeed, clonal T- cell proliferations comprise a heterogeneous spectrum of disorders: in addition to well-defined T- cell large granular lymphocyte leukemia (T-LGL), T-cell clonopathy of undetermined significance has been proposed as a diagnostic entity analogous to MBL [84]. Together, these observations highlight the possibility that silent clonal T-cell proliferations may be more common than previously recognized, thus representing an important focus of further investigation. An important issue is the progression rate of these B- and T-cell clones, and prospective studies are required to determine the progression rate of these conditions. These studies may help to determine clinical and biological factors which most effectively differentiate between progressive and non-progressive B and T-cell clones, and may therefore be used to identify patients who will benefit most from clinical follow-up.

CHAPTER: IV

CONCLUSION & FUTURE STUDIES

Clonal B lymphocytosis has been increasingly recognized as a diagnostic condition. The particular significance of MBL is its potential role as a precursor stage of lymphoid malignancies. The finding of clonal B-lymphocytes is important because most of the monoclonal B-cell populations are detected in otherwise healthy adults usually share an identical immunophenotype with CLL, and are referred as CLL-like MBL.

CLL-like MBL has gained increasing interest due to its entry in the revised National Cancer Institute Working Group (NCI-WG)/International Workshop on CLL (IWCLL) guidelines for the diagnosis and management of CLL [35]. The condition is defined by the presence a B- lymphocyte count of <5x109/L in the PB of otherwise healthy adult with no other history of hematological abnormality [10]. However, a current issue of particular interest is the precise clinical relationship between CLL-like MBL and CLL.

Unlike most population-screening studies on MBL, this study has been designed to address gaps in the literature regarding the occurrence of MBL in asymptomatic lymphocytosis patient. It provides the information on the occurrence of both CLL-type and non-CLL type MBL in these patient population. This study therefore provides a valuable contribution to our current understanding of MBL in the context of lymphocytosis i.e. clinical MBL as well prevalence of clonal T-lymphocytosis which is usually overlooked in the studies of clonal lymphocytosis. Therefore, the finding of these clonal B and T- lymphocytes will be defined as clinical MBL and possibly MTL respectively.

As clinical MBL is detected in patients with lymphocytosis, they may have a heightened risk of developing into a full blown malignancy (CLL). This study has identified a significant number of patients with clinical MBL. Significantly, MBL identified in a clinical setting could lead to information relevant to the risk of progression to CLL or other lymphoid malignancies. Moreover, the future analysis of this patient series may provide further information relating to the progression of MBL to B-cell malignancy, which will require periodic assessments, including

59 clinical examination and laboratory tests of routine complete blood counts with differentials to see to monitor if there is any progression in ALC, by flow cytometry for evaluating the size of the clonal lymphocytes.

In addition to CLL-type MBL, we also analysed patients with non-CLL type MBL (CD5-MBL). Although this group is usually neglected in studies of clonal B-cells, a significant number of non- CLL type cases were detected in this study. Such high occurrence has raised our concern that this entity may be increasingly prevalent in individuals with asymptomatic absolute lymphocytosis. Our lab [31, 32, 33] has previously reported a group of patients with CD5- MBL and have identified translocation t (2; 7) in a CD5- MBL patient. This translocation t (2; 7) (p11; q22) have been reported in association with splenic marginal zone lymphoma, supporting the notion that CD5- MBL could be a precursor to this disease entity. Further study is being performed to characterize this translocations to determine if the translocation t (2; 7) possibly deregulates CDK6 (on chromosome 7) when translocated on chromosome 2 (the Ig Kappa locus).

Similar studies could be done with the CD5- MBL cases identified in this study to evaluate whether this translocation may occur in additional CD5- MBL or MLUS cases. Additional information should also be obtained on this patient population to assess whether they should be given a separate diagnostic term, as the B-cell clones of CD5- phenotype may therefore be derived from a cell origin different from that of CLL.

MBL patients identified during the investigation of mild lymphocytosis may therefore be helpful to determine whether monoclonal B-cell counts tend to be regressive, stable or progressive over time. The follow-up of this patient population may help to resolve this query. Alternatively, the proper follow-up of this population may provide insight into the additional insults or changes which are required to provoke full-blown hematologic malignancy in patients presenting with clinical MBL. Long term prospective studies of these clinical MBL cases will provide a comprehensive model for the pathogenesis of CLL and other B-cell tumours. The recognition of clinical MBL is consistent with a multi hit model of tumourogenesis, and it therefore appears to be analogous to the relationship of MGUS and MM, as well as FAP and CC. At present, the notion that MBL is a precursor of CLL and other non-Hodgkin lymphomas is presumptive and a major goal of future studies should be to better define this relationship.

60 Beside that, the significant number of patients with clonal T-cells detected in this study has opened a new field for consideration of this entity in the studies of clonal lymphocytosis. Future studies could be done to determine the significance of these clonal T-cells. As, it could be possible that the significant number of monoclonal T-cells detected in this group of patients in the study highlights the potential recognition of a novel diagnostic entity MTL [84] (monoclonal T-cell lymphocytosis) analogous to MBL.

Therefore, for the first time, this study provides the information on the occurrence of both clonal B-and clonal T-cell lymphocyte populations in individuals with asymptomatic lymphocytosis. In each of these lineages, the clonal cells are of clinical importance due to their possible role as a precursor or very early stage of well-defined lymphoproliferative disorders or malignancy. Thus it would be important to see if any of these MBL or MTL progress. Therefore, if proper follow- up of these patient by repeat complete blood cell count with differentials (especially ALC), flow cytometry (evaluating the T and B-cell count, clonal B-cell population), molecular testing (including cytogenetics to determine if certain genetic changes such as deletions or translocation) and clinical history (by their attending physicians) will reveal further information about the dynamics of progression from clinical MBL to CLL or other NHLs and MTL to LGL or other T- cell related leukemia or lymphomas.

Finally, a key area for future research is to identify the molecular changes that are related to the occurrence of MBL. As it remains largely unknown, if additional molecular and cellular events occur during the transformation of MBL to CLL. The identification of CLL-phenotype cells in individuals in this study will broaden understanding of the development of the malignant disease. In particular, these cells are readily identifiable and can be isolated to determine gene/protein expression profiles. This information can be correlated to normal B lymphocytes and will be helpful to identify the early stages of oncogenesis and the mechanisms of disease progression to clinical CLL. In turn, advance in our understanding of the molecular events involved in the pathogenesis of transformation of these clonal lymphocytes into leukemia and lymphomas will enable us to find new and effective therapeutic strategies that could prevent their transformation.

61 References

1. Ghia P, Prato G, Scielzo C, Stella S, Geuna M, Guida G, Caligaris-Cappio F. Monoclonal CD5+ and CD5- B-lymphocyte expansions are frequent in the peripheral blood of elderly. Blood 2004; 103: 2337-2342 2. Le Maoult J, Szabo P, Weksler ME. Effect of age on humoural immunity selection of the B-cell repertoire and B-cell development. Immunol Rev. 1997; 160: 115-126 3. Radl J. Age-related monoclonal gammapathies: clinical lessons from the aging C57BL mouse. Immunol Today. 1990; 11:234-236 4. Ligthart GJ, Radl J, Corberand JX, Van Nieuwkoop JA, Van Staalduinen GJ, Van Helmond DJ, Hijmans W. Monoclonal gammopathies in human aging: increased occurrence with age and correlation with health status. Mech Ageing Dev. 1990; 52:235-243 5. Van Dongen JJM, Wolvers-Tettero ILM. Analysis of immunoglobulin and T cell receptor genes. Part II: possibilities and limitations in the diagnosis and management of lymphoproliferative diseases and related disorders. Clin Chim Acta 1991; 198: 93–174 6. Jaffe ES, Harris NL, Stein H, Vardiman JW (eds). World Health Organization Classification of Tumours. Pathology and Genetics of Tumours of Haematopoietic and Lymphoid Tissues. Lyon: IARC Press, 2001 7. Vogt RF, Shim YK, Middleton DC, Buffler PA, Campolucci SS, Lybarger JA, Marti GE. Monoclonal B-cell lymphocytosis as a biomarker in environmental health studies. Br J Haematol 2007; 139: 690–700 8. Shim YK, Vogt RF, Middleton D, Abbasi F, Slade B, Lee KY, Marti GE. Prevalence and natural history of monoclonal and polyclonal B-cell lymphocytosis in a residential adult population. Cytometry B Clin Cytom 2007; 72: 344–353 9. Rawstron A, Green M, Kuzmicki A, Kennedy B, Fenton JA, Evans PA, O'Connor SJ, Richards SJ, Morgan GJ, Jack AS, Hillmen P. Monoclonal B lymphocytes with the characteristics of ‘indolent’ chronic lymphocytic leukemia is present in 3.5% of adults with normal blood counts. Blood 2002; 100: 635-639 10. Marti G, Rawstron A, Ghia P, Hillmen P, Houlston RS, Kay N, Schleinitz TA, Caporaso N; International Familial CLL Consortium. Diagnostics criteria for monoclonal B-cell lymphocytosis. British Journal of Haematol 2005; 130: 325-332 11. Boelens J, Lust S, Vanhoecke B, Offner F. Chronic lymphocytic leukaemia. Anticancer Research. 2009; 29: 605-615 12. Rachel JM, Zucker ML, Fox CM, Plapp FV, Menitove JE, Abbasi F, Marti GE. Monoclonal B-cell lymphocytosis in blood donors. Br J Haematol 2007; 139: 832–836 13. Rawstron AC, Bennett FL, O’Connor SJ, Kwok M, Fenton JA, Plummer M, de Tute R, Owen RG, Richards SJ, Jack AS, Hillmen P. Monoclonal B-cell lymphocytosis and chronic lymphocytic leukemia. N Engl J Med 2008; 359: 575–583 14. Dagklis A, Fazi C, Sala C, Cantarelli V, Scielzo C, Massacane R Toniolo D, Caligaris-Cappio F, Stamatopoulos K, Ghia P. The immunoglobulin gene repertoire of population CLL-like MBL is different from CLL: diagnostic implications for clinical monitoring. Blood 2009; 114: 26–32 15. Nieto WG, Almeida J, Romero A, Teodosio C, Lopez A, Henriques AF, Sanchez ML, Jara-Acevedo M, Rasillo A, Gonzalez M, Fernandez-Navarro P, Vega T, Orfao A; Primary Health Care Group of Salamanca for the Study of MBL. Increased frequency (12%) of circulating chronic lymphocytic leukemia-like B-cell clones in healthy subjects using a highly sensitive multicolor flow cytometry approach. Blood 2009; 114: 33–37

62 16. Lanasa MD, Allgood SD, Volkheimer AD, Gockerman JP, Whitesides JF, Goodman BK, Moore JO, Weinberg JB, Levesque MC. Single cell analysis reveals oligoclonality among ‘low count’ monoclonal B cell lymphocytosis. Leukemia 2009 e-pub ahead of print 15 October 2009 17. Rawstron AC, Bennett F, Hillmen P. The biological and clinical relationship between CD5+23+ monoclonal B-cell lymphocytosis and chronic lymphocytic leukaemia. Br J Haematol 2007; 139: 724–729 18. McCarthy BA, Tipping M, Wang XP, Bennet F, Li W, Lesser M. Expression levels of a single gene, lymphoid enhancer binding factor 1, discriminates CLL B-Cells from other B-cell malignancies. Blood 2007; 110: 338a 19. Rawstron A, Bennett FL, O’Connor SJ, Kwok M, Fenton JA, Plummer M, de Tute R, Owen RG, Richards SJ, Jack AS, Hillmen P. Monoclonal B-cell lymphocytosis and chronic lymphocytic leukemia. N Engl J Med 2008; 359: 575–583 20. Shanafelt TD, Kay NE, Jenkins G, Call TG, Zent CS, Jelinek DF, Morice WG, Boysen J, Zakko L, Schwager S, Slager SL, Hanson CA.. B-cell count and survival: differentiating chronic lymphocytic leukemia (CLL) from monoclonal B-cell lymphocytosis (MBL) based on clinical outcome. Blood 2009; 113: 4188–4196 21. Hamblin TJ, Davis Z, Gardiner A, Oscier DG, Stevenson FK. Unmutated IgV(H) genes are associated with a more aggressive form of chronic lymphocytic leukemia. Blood 1999; 94: 1848–1854 22. Shanafelt T, Kay N, Rabe K, Call T, and Zent CS, Maddocks K Jenkins G, Jelinek DF, Morice WG, Boysen J, Schwager S, Bowen D, Slager SL, Hanson CA. Brief report: natural history of individuals with clinically recognized monoclonal B-cell lymphocytosis (MBL) compared to patients with Rai 0 chronic lymphocytic leukemia (CLL). J Clin Oncol 2009; 27: 3959–3963 23. Mulligan CS, Thomas ME, Mulligan SP. Monoclonal B-cell lymphocytosis and chronic lymphocytic leukemia. N Engl J Med 2008; 359: 2065–2066 24. Hardy NM, Grady C, Pentz R, Stetler-Stevenson M, Raffeld M, Fontaine LS Babb R, Bishop MR, Caporaso N, Marti GE. Bioethical considerations of monoclonal B-cell lymphocytosis: donor transfer after haematopoietic stem cell transplantation. Br J Haematol 2007; 139: 824–831 25. Emanuel EJ, Wendler D, Grady C. What makes clinical research ethical? JAMA 2000; 283: 2701– 2711 26. Matos DM, Ismael SJ, Scrideli CA, de Oliveira FM, Rego EM, Falcao RP. Monoclonal B-cell lymphocytosis in first-degree relatives of patients with sporadic (non familial) chronic lymphocytic leukaemia. Br J Haematol 2009; 147: 339–346 27. Shanafelt T, Ghia P Lanasa MC, Landgren O, Rawstron AC. (Monoclonal B-cell lymphocytosis (MBL): biology, natural history and clinical management. Leukemia 2010; 24: 512-520 28. Aman P, Mellstedt H. The leukemic B-cell population of patients with monoclonal lymphocytosis of undetermined significance (MLUS) are functionally distinct from the chronic lymphocytic leukemia (CLL) derived cell population. Leuk Res 1991; 15:715 29. Garcia C, Rosen A, Aguilar-Santelises M, Jondal M, Mellstedt H. Higher proliferative response in B- chronic lymphocytic leukemia (B-CLL) as compared to B-monoclonal lymphocytosis of undetermined significance (B-MLUS) after stimulation with staphylococcus aureus and anti-CD40 monoclonal antibodies. Leuk Res 1993;17: 933 30. Han T, Ozer H, Gavigan M, Gajera R, Minowada J, Bloom ML, Sadamori N, Sandberg AA, Gomez GA, Henderson ES. Benign monoclonal B cell lymphocytosis—a benign variant of CLL: clinical, immunologic, phenotypic and cytogenetic studies in 20 patients. Blood 1984; 64:244 31. Amato D, Oscier D, Davis Z, Mould S, Zheng J, Kolomietz E, Wang C. Cytogenetic aberrations and immunoglobulin VH gene mutations in clinically benign CD5- monoclonal B-cell lymphocytosis. Am J of Clin Pathol 2007; 128: 333-338

63 32. Wang C, Amato D, Fernandes B. CD5-negative phenotype of monoclonal B-lymphocytosis of undetermined significance (MLUS). Am J Hematol. 2002; 69:147-149 33. Wang C, Amato D, Rabah R, Fernandes B. Differentiation of monoclonal B lymphocytosis of undetermined significance (MLUS) and chronic lymphocytic leukemia (CLL) with weak CD5 expression from CD5– CLL. Leuk Res. 2002; 26:1125-1129 34. Rawstron A, Yuille M, Fuller J, Cullen M, Kennedy B, Richards SJ, Jack AS, Matutes E, Catovsky D, Hillmen P, Houlston RS. Predisposition to CLL is detectable as subclinical monoclonal B- lymphocyte expansion. Blood 100: 2289-2290 35. Hallek M, Cheson BD, Catovsky D, Caligaris-Cappio F, Dighiero G, Dohner H, Hillmen P, Keating MJ, Montserrat E, Rai KR, Kipps TJ; International Workshop on Chronic Lymphocytic Leukemia. Guidelines for the diagnosis and treatment of chronic lymphocytic leukemia: a report from the International Workshop on Chronic Lymphocytic Leukemia updating the National Cancer Institute- Working Group 1996 guidelines. Blood 2008; 111: 5446–5456 36. Landgren O, Albitar M, Ma W, Abbasi F, Hayes RB, Ghia P, Marti GE, Caporaso NE. B-cell clones as early markers for chronic lymphocytic leukemia. N Engl J Med 2009; 360: 659–667 37. Rossi D, Sozzi E, Puma A, De Paoli L, Rasi S, Spina V, Gozzetti A, Tassi M, Cencini E, Raspadori D, Pinto V, Bertoni F, Gattei V, Lauria F, Gaidano G, Forconi F. The prognosis of clinical monoclonal B cell lymphocytosis differs from prognosis of Rai 0 chronic lymphocytic leukaemia and is recapitulated by biological risk factors. Br J Haematol 2009; 146: 64–75 38. O’Conner SJM, Rawstron AC, Plummer M. Demonstration of the genotypic relationship between CLUS and clinical B-CLL [abstract]. Leuk Lymphoma. 2003; 44 (suppl 2): S13 39. Dighiero G, Hamblin TJ. Chronic lymphocytic leukaemia. Lancet 2008; 371:1017-1029 40. Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, Pasternack BS. Clinical staging of chronic lymphocytic leukemia. Blood 1975; 46:219-234 41. Binet JL, Auquier A, Dighiero G, Chastang C, Piguet H, Goasguen J, Vaugier G, Potron G, Colona P, Oberling F, Thomas M, Tchernia G, Jacquillat C, Boivin P, Lesty C, Duault MT, Monconduit M, Belabbes S, Gremy F. A new prognostic classification of chronic lymphocytic leukemia derived from a multivariate survival analysis. Cancer 1981; 48:198-206 42. Dighiero G, Maloum K, Desablens B, Cazin B, Navarro M, Leblay R, Leporrier M, Jaubert J, Lepeu G, Dreyfus B, Binet JL, Travade P. Chlorambucil in indolent chronic lymphocytic leukemia. N Engl J Med 1998; 338: 1506-1514 43. Montserrat E, Sanchez-Bisono J, Viñolas N, Rozman C. Lymphocyte doubling time in chronic lymphocytic leukaemia: analysis of its prognostic significance” Br J Haematol. 1986 Mar; 62(3):567- 575 44. Molica S, Alberti A. Prognostic value of the lymphocyte doubling time in chronic lymphocytic leukemia. Cancer. 1987 Dec 1; 60(11):2712-2716 45. Dohner H, Stilgenbauer S, Benner A, Leupolt E, Kröber A, Bullinger L, Döhner K, Bentz M, Lichter P. Genomic abberration and survival in chronic lymphocytic leukemia. NEJM 2000; 343: 1910-1916 46. Knuutila S, Elonen E, Teerenhovi LLeskinen R, Bloomfield CD, de la Chapelle A. Trisomy 12 in B- cells with chronic lympocytic leukemia N Engl J Med 1986; 314:865 47. Kujawski, L, Ouillette, P, Erba, H, Saddler C, Jakubowiak A, Kaminski M, Shedden K, Malek SN. Genomic complexity identifies patients with aggressive chronic lymphocytic leukemia. Blood 2008; 112:1993 48. Garcia-Marco, JA, Price, CM, Ellis, J, Morey M, Matutes E, Lens D, Colman S, Catovsky D. Correlation of trisomy 12 with proliferating cells by combined immunocytochemistry and fluorescence in situ hybridization in chronic lymphocytic leukemia. Leukemia 1996; 10:1705

64 49. Yie Liu, Dan Grander, Stefan Soderhall, Gunnar Juliusson, Gosta Gahrton, and Stefan Einhorn. Retinoblastoma Gene Deletions in 6-Cell Chronic Lymphocytic Leukemia. Genes, Chromosomes & Cancer 4:250-256 (1992) 50. Dohner, H, Stilgenbauer, S, James, MR, Döhner H, Stilgenbauer S, James MR, Benner A, Weilguni T, Bentz M, Fischer K, Hunstein W, Lichter P. 11q deletions identify a new subset of B-cell chronic lymphocytic leukemia characterized by extensive nodal involvement and inferior prognosis. Blood 1997; 89:2516 51. Fegan C, Robinson H, Thompson P,Whittaker JA, White D. Karyotypic evolution in CLL identification of a new sub-group of patients with deletions of 11q and advanced or progressive disease. Leukemia 1995; 9:2003 52. Hockenbery D, Nunez G, Milliman C,Schreiber RD, Korsmeyer SJ. Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature 1990; 348:334 53. Hanada M, Delia D, Aiello A, Stadtmauer E, Reed JC. Bcl-2 gene hypomethylation and high-level expression in B-cell chronic lymphocytic leukemia. Blood 1993; 82:1820 54. Ricciardi M, Petrucci M, Gregorj C, Ariola C, Lemoli RM, Fogli M, Mauro FR, Cerretti R, Foa R, Mandelli F, Tafuri A. Reduced susceptibility to apoptosis correlates with kinetic quiescence in disease progression of chronic lymphocytic leukaemia. Br J Haematol 2001; 113:391 55. Papakonstantinou G, Verbeke C, Hastka J, Bohrer M, Hehlmann R. bcl-2 expression in non- Hodgkin's lymphomas is not associated with bcl-2 gene rearrangements. Br J Haematol 2001; 113:383 56. Dohner H, Fischer K, Bentz M, Hansen K, Benner A, Cabot G, Diehl D, Schlenk R, Coy J, Stilgenbauer S. p53 gene deletion predicts for poor survival and non-response to therapy with purine analogs in chronic B-cell leukemias. Blood 1995; 85:1580 57. El Rouby S, Thomas A, Costin D, Rosenberg CR, Potmesil M, Silber R, Newcomb EW. p53 gene mutation in B-cell chronic lymphocytic leukemia is associated with drug resistance and is independent of MDR1/MDR3 gene expression. Blood 1993; 82:3452 58. Gaidano G, Ballerini P, Gong JZ, Inghirami G, Neri A, Newcomb EW, Magrath IT, Knowles DM, Dalla-Favera R. p53 mutations in human lymphoidmalignancies: association with Burkitt lymphoma and chronic lymphocytic leukemia. Proc Natl Acad Sci U S A 1991; 88:5413 59. Wattel E, Preudhomme C, Hecquet B, Vanrumbeke M, Quesnel B, Dervite I, Morel P, Fenaux P. p53 mutations are associated with resistance to chemotherapy and short survival in hematologic malignancies. Blood 1994; 84:3148 60. Cordone I, Masi S, Mauro FR, Soddu S, Morsilli O, Valentini T, Vegna ML, Guglielmi C, Mancini F, Giuliacci S, Sacchi A, Mandelli F, Foa R. p53 expression in B-cell chronic lymphocytic leukemia: a marker of disease progression and poor prognosis. Blood 1998; 91:4342 61. Barnabas N, Shurafa M, Van Dyke DL, Wolman SR,Clark D, Worsham MJ. Significance of p53 mutations in patients with chronic lymphocytic leukemia: a sequential study of 30 patients. Cancer 2001; 91:285 62. Zenz, T, Krober, A, Scherer, K, Häbe S, Buhler A, Benner A, Denzel T, Winkler D, Edelmann J, Schwanen C, Döhner H, Stilgenbauer S. Monoallelic TP53 inactivation is associated with poor prognosis in chronic lymphocytic leukemia: results from a detailed genetic characterization with long-term follow-up. Blood 2008; 112:3322 63. Hamblin TJ, Davis Z, Gardiner DG, Oscier DG, Stevenson FK. Unmutated Ig V (H) genes are associated with a more aggressive form of chronic lymphocytic leukemia. Blood 1999; 94:1848-54. 64. Damle RN, Wasil T, Fais F, et al. Ig V gene mutation status and CD38 expression as novel prognostic indicators in chronic lymphocytic leukemia. Blood 1999; 94:1840-7

65 65. Tobin G, Thunberg U, Johnson A, Thörn I, Söderberg O, Hultdin M, Botling J, Enblad G, Sällström J, Sundstrom C, Roos G, Rosenquist R. Somatically mutated IgV (H) 3-21 genes characterize a new subset of chronic lymphocytic leukemia (CLL). Blood 2002; 99: 2262-4 66. Rawstron A, Kennedy B, Evans PA, Davies FE, Richards SJ, Haynes AP, Russell NH, Hale G, Morgan GJ, Jack AS, Hillmen P. Quantitation of minimal disease levels in chronic lymphocytic leukemia using a sensitive flow cytometric assay improves the prediction of outcome and can be used to optimize therapy. Blood 2001; 98: 29–35 67. Ghia P, Guida G, Stella S, Gottardi D, Geuna M, Strola G, Scielzo C, Caligaris-Cappio F. The pattern of CD38 expansion defines a distinct subset of chronic lymphocytic leukemia (CLL) patients at risk of disease progression. Blood 2003; 101: 1262-1269 68. Clevers H, Alarcon B, Wileman T, Terhorst C. The T cell receptor/CD3 complex: a dynamic protein ensemble. Annu Rev Immunol 1988;6:629–662 69. Rudd CE, Janssen O, Cai YC, da Silva AJ, Raab M, Prasad KV. Two-step TCR zeta/CD3-CD4 and CD28 signaling in T cells: SH2/SH3 domains, protein-tyrosine and lipid kinases. Immunol Today 1994; 15:225–2234 70. Weiss A, Iwashima M, Irving B, van Oers NS, Kadlecek TA, Straus D, Chan A. Molecular and genetic insights into T cell antigen receptor signal transduction. Adv Exp Med Biol 1994;365:53–62 71. Esin S, Shigematsu M, Nagai S, Eklund A, Wigzell H, Grunewald J. Different percentages of peripheral blood gamma delta + T cells in healthy individuals from different areas of the world. Scand J Immunol 1996;43:593–596 72. Ciccone E, Ferrini S, Bottino C, Viale O, Prigione I, Pantaleo G, Tambussi G, Moretta A, Moretta L. A monoclonal antibody specific for a common determinant of the human T cell receptor gamma/delta directly activates CD3+. J Exp Med 1988; 168:1–11 73. Dechanet J, Merville P, Lim A, Retière C, Pitard V, Lafarge X, Michelson S, Méric C, Hallet MM, Kourilsky P, Potaux L, Bonneville M, Moreau JF. Implication of gammadelta T cells in the human immune response to cytomegalovirus. J Clin Invest 1999; 103:1437–1449 74. Caccia N, Kronenberg M, Saxe D, Haars R, Bruns GA, Goverman J, Malissen M, Willard H, Yoshikai Y, Simon M et al. The T cell receptor beta chain genes are located on chromosome 6 in mice and chromosome 7 in humans. Cell 1984; 37:1091–1099 75. Morton CC, Duby AD, Eddy RL, Shows TB, Seidman JG. Genes for beta chain of human T-cell antigen receptor map to regions of chromosomal rearrangement in T cells. Science 1985; 228:582– 585 76. Isobe M, Erikson J, Emanuel BS, Nowell PC, Croce CM. Location of gene for beta subunit of human T-cell receptor at band 7q35, a region prone to rearrangements in T cells. Science 1985; 228:580–582 77. Griesser H, Champagne E, Tkachuk D, Takihara Y, Lalande M, Baillie E, Minden M, Mak TW. The human T cell receptor alpha-delta locus: a physical map of the variable, joining and constant region genes. Eur J Immunol 1988;4:641–644 78. Wilson RK, Lai E, Concannon P, Barth RK, Hood LE. Structure, organization and polymorphism of murine and human T-cell receptor alpha and beta chain gene families. Immunol Rev 1988; 101:149– 172 79. Rabbitts TH, Lefranc MP, Stinson MA, Sims JE, Schroder J, Steinmetz M, Spurr NL, Solomon E, Goodfellow PN. The chromosomal location of T-cell receptor genes and a T cell rearranging gene: possible correlation with specific translocations in human T cell leukaemia. EMBO J 1985; 4:1461– 1465 80. Lefranc M-P. Locus maps and genomic repertoire of the human T cell repertoire. The Immunologist 2000; 8:72–78

66 81. Oettinger MA, Schatz DG, Gorka C, Baltimore D. RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science 1990; 248:1517–1523 82. Notarangelo LD, Santagata S, Villa A. Recombinase activating gene enzymes of lymphocytes. Curr Opin Haematol 2001; 8:41–46 83. E Hodges, M T Krishna, C Pickard, J L Smith. Diagnostic role of tests for T cell receptor (TCR) genes. J Clin Pathol 2003; 56: 1-11 84. Dhodapkar M, Li CY, Lust JA, Tefferi A, Phyliky RL. Clinical spectrum of clonal proliferations of T- large granular lymphocytes: A T-cell clonopathy of undetermined significance? Blood 1994; 84: 1620-1627 85. Schwab R, Szabo P, Manavalan JS, Weksler ME, Posnett DN, Pannetier C, Kourilsky P, Even J. Expanded CD4+ and CD8+ T cell clones in elderly humans. J Immunol 1997; 158:4493–4499 86. McCoy JP Jr, Overton WR, Schroeder K, Blumstein L, Donaldson MH. Immunophenotypic analysis of the T cell receptor V beta repertoire in CD4+ and CD8+ lymphocytes from normal peripheral blood. Cytometry 1996; 26: 148-153 87. Robertson PB, Neiman RS, Worapongpaiboon S, John K, Orazi A. (013)CD99 positivity in hematologic proliferations correlates with TdT positivity. MOD Pathol 1997; 10: 277-282 88. Pilozzi E, Muller-Hermelink H K, Falini B, de Wolf-Peeters C, Fidler C, Gatter K, Wainscoat J. Gene rearrngements in T-cell lymphoblastic lymphoma. J Pathol 1999; 188: 267-270 89. Graux C, Cools J, Michaux L Vandenberghe P, Hagemeijer A.. Cytogenetics and Molecular Genetics of T-cell acute lymphocytic leukemia from thymocyte to lymphoblast. Leukemia 2006; 20: 1496- 1510 90. Han X, Bueso-Ramos CE Precursor T-cell acute lymphoblastic leukemia/lymphoblastic lymphoma and acute biphenotypic leukemias. Am J Clin Pathol 2007. 127: 528-544 91. Morel P, Lepage E, Brice P, Dupriez B, D'Agay MF, Fenaux P, Gosselin B, Bauters F, Gisselbrecht C. Prognosis and treatment of lymphoblastic lymphoma in adults: a report on 80 patients. J Clin Oncol 1992; 10: 1078-1085 92. Almeida J, Orfao A, Ocqueteau M, Mateo G, Corral M, Caballero MD, Blade J, Moro MJ, Hernandez J, San Miguel JF. High-sensitive immunophenotyping and DNA ploidy studies for the investigation of minimal residual disease in multiple myeloma. Br J Haematol 1999. 107: 121-131 93. Amen F, Horncastle D, Elderfield K, Banham AH, Bower M, Macdonald D, Kanfer E, Naresh KNAbsence of cyclin-D2 and Bcl-2 expression within the germinal centre type of diffuse large B-cell lymphoma identifies a very good prognostic subgroup of patients. Histopathology 2007; 51: 70-79 94. Lima M, Almeida J, Dos Anjos Teixeira M, Alguero Md Mdel C, Santos AH, Balanzategui A, Queiros ML, Barcena P, Izarra A, Fonseca S, Bueno C, Justiça B, Gonzalez M, San Miguel JF, Orfao A.TCR alpha beta+/CD4+ large granular lymphocytosis: a new clonal T-cell lymphoproliferative disorder. Am J Pathol 2003; 163: 763-771 95. Sandberg Y, Almeida J, Gonzalez M Lima M, Bárcena P, Szczepañski T, Van Gastel-Mol EJ, Wind H, Balanzategui A, Van Dongen JJ, Miguel JF, Orfao A, Langerak AW. TCR gamma delta+ large granular lymphocyte leukemias reflect the spectrum of normal antigen selected TCR gammadelta+ T- cells. Leukemia2006; 20: 505-513 96. Semenzato G, Zambello R, Starkebaum G, Oshimi K, Loughran TP Jr. The lymphoproliferative disease of granular lymphocytes: updated criteria for diagnosis. Blood 1997; 89: 256-260 97. Loughran TP, Jr. Clonal diseases of large granular lymphocytes. Blood 1993; 82:1–14 98. Loughran TP. Large granular lymphocytic leukemia: an overview. Hosp Pract (Off Ed) 1998;33:133– 138 99. Lamy T, Loughran TP, Jr. (Clinical features of large granular lymphocyte leukemia. Blood Rev 2003; 13:230-240

67 100. Posnett DN, Sinha R, Kabak S, Russo C. Clonal populations of T cells in normal elderly humans: the T cell equivalent to “benign monoclonal gammapathy”. J Exp Med 1994; 179:609–618. 101. Wack A, Cossarizza A, Heltai S, Barbieri D, D'Addato S, Fransceschi C, Dellabona P, Casorati G.. Age-related modifications of the human alpha beta T cell repertoire due to different clonal expansions in the CD4+ and CD8+ subsets. Int Immunol 1998;10:1281–1288 102. Fitzgerald JE, Ricalton NS, Meyer AC, West SG, Kaplan H, Behrendt C, Kotzin BL. Analysis of clonal CD8+ T cell expansions in normal individuals and patients with rheumatoid arthritis. J Immunol 1995; 154:3538–547 103. Hingorani R, Choi IH, Akolkar P, et al. Clonal predominance of T cell receptors within the CD8+ CD45RO+ subset in normal human subjects. J Immunol 1993; 151:5762–769 104. Loughran TP. Large granular lymphocytic leukemia: an overview. Hosp Pract (Off Ed) 1998; 33:133–138 105. Matutes E, Brito-Babapulle V, Swansbury J Ellis J, Morilla R, Dearden C, Sempere A, Catovsky D. Clinical and laboratory features of 78 cases of T-prolymphocytic leukemia. Blood 1991; 78: 3269- 3274 106. Dearden CE T-cell prolymphocytic leukemia. Med Oncol 2006; 23: 17-22 107. Grand R, Goasguen J, Brizard A, Buisine J, Charpentier A, Claisse JF, Duchayne E, Lagrange M, Segonds C, Troussard X, Flandrin GIndolent course as a relatively frequent presentation in T- prolymphocytic leukemia. Groupe Francais d’Hematologie Cellulaire. Br J Haematol 1998; 103: 488- 494 108. Tajima K, Hinuma Y Epidemiology of HTLV-1/2 in Japan and the world. In: Advances in Adult T- Cell Leukemia and HTLV-1 Research (Gann Monograph on Cancer Research). Takatsuki K, Hinuma Y, Yoshida M, eds. Japan Scientific Societies Press: Tokyo, pp. 129-149. 109. Shimoyama M. Diagnostic criteria and classification of clinical subtypes of adult T-cell leukemia- lymphoma. A report from the Lymphoma Study Group (1984-1987). Br J Haematol 1991; 79: 428- 437 110. Karube K, Ohshima K, Tsuchiya T Yamaguchi T, Kawano R, Suzumiya J, Utsunomiya A, Harada M, Kikuchi M. Expression of FoxP3, a key molecule in CD4CD25 regulatory T cells, in adult T-cell leukemia/lymphoma cells. Br J Haematol 2004; 126: 81-84 111. Ohshima K, Mukai Y, Shiraki H Suzumiya J, Tashiro K, Kikuchi M. Clonal integration and expression of human T-cell lymphotrophic virus type 1 in carriers detected by polymerase chain reaction and inverse PCR. Am J Hematol 1997; 54: 306-312 112. Ohshima K, Suzumiya J, Sato K, Kanda M, Simazaki T, Kawasaki C, Haraoka S, Kikuchi M. Survival of patients with HTLV-1 associated lymph node lesions. J Pathol 1999; 189: 539-545 113. Willemze R, Jaffe ES, Burg G Cerroni L, Berti E, Swerdlow SH, Ralfkiaer E, Chimenti S, Diaz-Perez JL, Duncan LM, Grange F, Harris NL, Kempf W, Kerl H, Kurrer M, Knobler R,Pimpinelli N, Sander C, Santucci M, Sterry W, Vermeer MH, Wechsler J, Whittaker S, Meijer CJ. WHO-EORTC classification for cutaneous lymphomas. Blood 2005; 105: 3768-3785 114. Ralfkiaer E Immunohistological markers for the diagnosis of cutaneous lymphomas. Semin Diagn Pathol 1991; 8: 62-72 115. Fierro MT, Comessatti A, Quaglino P, Ortoncelli M, Osella Abate S, Ponti R, Novelli M, Bernengo MG. Expression pattern of chemokine receptors and chemokine release in inflammatory erythroderma and Sezary syndrome. Dermatology 2006; 213: 284-292 116. Bernengo MG, Novelli M, Quaglino P, Lisa F, De Matteis A, Savoia P, Cappello N, Fierro MT. The relevance of the CD4+. CO26-subset in the identification of circulating Sezary cells. Br J Dermatol 2001; 144: 125-135

68 117. Narducci MG, Scala E, Bresin A, Caprini E, Picchio MC, Remotti D, Ragone G, Nasorri F, Frontani M, Arcelli D, Volinia S, Lombardo GA, Baliva G, Napolitano M, Russo G. Skin homing of Sezary cells involves SDF-1-CXCR4 signaling and down-regulation of CD26/dipeptidylpeptidase 4. Blood. 2006; 107: 1108-1115 118. Sokolowska-Wojdylo M, Wenzel J, Gaffel E Steitz J, Roszkiewicz J, Bieber T, Tüting T. Absence of CD26 expression on skin –homing CLA+CD+ T lymphocytes in peripheral blood is a highly sensitive marker for early diagnosis and therapeutic monitoring of patients with Sezary syndrome. Clin Exp Dermatol 2005; 30: 702-706 119. Ponti R, Quaglino P, Novelli M, Fierro MT, Comessatti A, Peroni A, Bonello L, Bernengo MG. T- cell receptor gamma gene rearrangement by multiplex polymerase chain reaction/heteroduplex analysis in patients with cutaneous T-cell lymphoma (mycosis fungoides/Sezary syndrome) and benign inflammatory disease: Correlation with clinical, histological and immunophenotypical findings. Br J Dermatol 2005; 153: 565-573 120. Whittaker SJ, Smith NP. Diagnostic value of T-cell receptor beta gene rearrangemnt analysis on peripheral blood lymphocytes of patients with erythroderma. J Invest Dermatol 1992; 99: 361-362 121. Whittaker SJ, Smith NP. Analysis of beta, gamma, and delta T-cell receptor genes in mycosis fungoides and Sezary syndrome. Cancer 1991; 68: 1572-1582 122. Klemke CD, Mansmann U, Poenitz N Dippel E, Goerdt S. Prognostic factors and prediction of prognosis by the CTCL Severity index in mycosis fungoides and Sezary syndrome. Br J Dermatol 2005; 153: 118-124 123. Vonderheid EC, Pena J, Nowell P. Sezary cell counts in erythrodermic cutaneous T-cell lymphoma: implications for prognosis and staging. Leuk Lymphoma 2006; 47: 1841-1856 124. Terhune MH, Cooper KD. Gene rearrangements and T-cell lymphomas. Arch Dermatol 1993;129:1484–1490 125. Weiss LM, Wood GS, Ellisen LW, Reynolds TC, Sklar J. Clonal T-cell populations in pityriasis lichenoides et varioliformis acuta (Mucha-Habermann disease). Am J Pathol 1987;126:417–421 126. Wood GS, Strickler JG, Abel EA, Deneau DG, Warnke RA. Immunohistology of pityriasis lichenoides et varioliformis acuta and pityriasis lichenoides chronica. Evidence for their interrelationship with lymphomatoid papulosis. J Am Acad Dermatol 1987;16:559–570 127. Harris NL, Jaffe ES, Stein H, Banks PM, Chan JK, Cleary ML, Delsol G, De Wolf-Peeters C, Falini B, Gatter KC, et al. A revised European–American classification of lymphoid neoplasms: a proposal from the international lymphoma study group. Blood 1994; 84:1361–1392 128. Wintrobe Clinical Hematology. G Lee, J Foerster, J Lukens, F Paraskevas, J P Greer, G M Rodgers. Volume 1. 10th edition 129. Smith BR, Weinberg DS, Robert NJ, Towle M, Luther E, Pinkus GS, Ault KA.. Circulating monoclonal B lymphocytes in non-Hodgkin’s lymphoma. N Engl J Med 1984; 311: 1476–1481 130. Letwin BW, Wallace PK, Muirhead KA, Hensler GL, Kashatus WH, Horan PK. An improved clonal excess assay using flow cytometry and B-cell gating. Blood 1990; 75: 1178–1185 131. Fukushima PI, Nguyen PK, O’Grady P, Stetler-Stevenson M. Flow cytometric analysis of kappa and lambda light chain expression in evaluation of specimens for B-cell neoplasia. Cytometry 1996; 26: 243–252 132. McCoy Jr JP, Overton WR, Schroeder K, Blumstein L, Donaldson MH. Immunophenotypic analysis of the T cell receptor V beta repertoire in CD4+ and CD8+ lymphocytes from normal peripheral blood. Cytometry 1996; 26: 148–153 133. Van Dongen JJM, van den Beemd MWM, Schellekens M, Wolvs- Tettero ILM, Langerak AW, Groeneveld K. Analysis of malignant T cells with the Vb antibody panel. Immunologist 1996; 4: 37– 40

69 134. Van den Beemd MWM, Boor PPC, Van Lochem EG, Hop WCJ, Langerak AW, Wolvers-Tettero ILM et al. Flow ctometric analysis of the Vb repertoire in healthy controls. Cytometry 2000; 40: 336– 345 135. Lima M, Almeida J, Santos AH, dos Anjos Teixeira M, Alguero MC, Queiros ML Balanzategui A, Justiça B, Gonzalez M, San Miguel JF, Orfão A. Immunophenotypic analysis of the TCRVbeta repertoire in 98 persistent expansions of CD3 (+)/TCRalphabeta(+) large granular lymphocytes: utility in assessing clonality and insights into the pathogenesis of the disease. Am J Pathol 2001; 159: 1861–1868 136. Langerak AW, Wolvers-Tettero ILM, van den Beemd MWM, van Wering ER, Ludwig W-D, Hahlen K, Necker A, Van Dongen JJ.. Immunophenotypic and immunogenotypic characteristics of TCRgd+ T cell acute lymphoblastic leukemia. Leukemia 1999; 13: 206–214 137. Langerak AW, van Den Beemd R, Wolvers-Tettero ILM, Boor PP, van Lochem EG, Hooijkaas H, Van Dongen JJ. Molecular and flow cytometric analysis of the Vbeta repertoire for clonality assessment in mature TCRalphabeta T-cell proliferations. Blood 2001; 98: 165–173 138. Shanafelt T, Kay NE, Call TG, Zent CS, Jelinek DF, LaPlant B, Morice WG, Hanson CA. MBL or CLL: which classification best categorizes the clinical course of patients with an absolute lymphocyte count >/= 5 x10(9)L(-1) but a B-cell lymphocyte count <5 x 10(9)L(-1)? Leukemia Research 2008; 32: 1458-1461 139. Tonegawa S. Somatic generation of antibody diversity. Nature 1983; 302: 575–581 140. Davis MM, Bjorkman PJ. T-cell antigen receptor genes and T-cell recognition. Nature 1988; 334: 395–402 141. Van Dongen JJ, Langerak AW, Brüggemann M, Evans PA, Hummel M, Lavender FL, Delabesse E, Davi F, Schuuring E, Garcia-Sanz R, van Krieken JH, Droese J, González D,Bastard C, White HE, Spaargaren M, González M, Parreira A, Smith JL, Morgan GJ, Kneba M, Macintyre EA. Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations: Report of the BIOMED-2 Concerted Action BMH4-CT98-3936. Leukemia 2003; 17: 2257-2317 142. Van Dongen JJ, Wolvers-Tettero ILM. Analysis of immunoglobulin and T cell receptor genes. Part I: basic and technical aspects. Clin Chim Acta 1991; 198: 1–91 143. Bourguin A, Tung R, Galili N, Sklar J. Rapid, nonradioactive detection of clonal T-cell receptor gene rearrangements in lymphoid neoplasms. Proceedings of the National Academy of Sciences of the United States of America. 1990; 87, 8536–8540 144. McCarthy K P, Sloane JP. & Wiedemann L.M. Rapid method for distinguishing clonal from polyclonal B cell populations in surgical biopsy specimens. Journal of Clinical Pathology 1990; 43, 429–432 145. Trainor KJ, Brisco MJ, Story C, Morley AA. Monocloality in B lymphproliferative disorders detected at the DNA level. Blood 1990; 75, 2220–2222 146. Matthews C, Catherwood M, Morris TC, Alexander HD. (2004) Routine analysis of IgVH mutational status in CLL patients using BIOMED-2 standardized primers and protocols. Leukemia & Lymphoma, 45, 1899–1904 147. Matthews C, Catherwood MA, Morris TC, Kettle PJ, Drake M B., Gilmore WS, Denis A.H. Serum TK levels in CLL identify Binet stage A patients within biologically defined prognostic subgroups most likely to undergo disease progression. Euro J of Haematol 2006; 77, 309–317 148. Morgan SM, Hodges E, Mitchell TJ, Harris S, Whittaker SJ, Smith JL. Molecular analysis of T-cell receptor Beta genes in cutaneous T-cell lymphoma reveals jbeta1 bias. The Journal of Investigative Dermatology 2006; 126, 1893–1899

70 149. Lassmann S, Gerlach UV, Technau-Ihling K, Werner M, Fisch, P. Application of BIOMED-2 primers in fixed and decalcified bone marrow biopsies: analysis of immunoglobulin H receptor rearrangements in B-cell non-Hodgkin’s lymphomas. The Journal of Molecular Diagnostics 2005; 7, 582–591 150. Lukowsky A, Marchwat M, Sterry, W. & Gellrich, S. Evaluation of B-cell clonality in archival skin biopsy samples of cutaneous B-cell lymphoma by immunoglobulin heavy chain gene polymerase chain reaction. Leukemia & Lymphoma 2006; 47, 487–493 151. Sandberg Y, Heule F, Lam K, Lugtenburg PJ, Wolvers-Tettero IL, Van Dongen JJ, Langerak AW. Molecular immunoglobulin/ T-cell receptor clonality analysis in cutaneous lymphoproliferations. Experience with the BIOMED-2 standardized polymerase chain reaction protocol. Haematologica 2003; 88, 659–670 152. Droese J, Langerak AW, Groenen PJ, Bruggemann M, Neumann P, Wolvers-Tettero IL, Van Altena MC, Kneba M, Van Dongen JJ. Validation of BIOMED-2 multiplex PCR tubes for detection of TCRB gene rearrangements in T-cell malignancies. Leukemia 2004; 18, 1531–1538 153. Catherwood MA, Gonzalez D, Patton C, Dobbin E, Venkatraman L, Alexander HD. Improved clonality assessment in germinal centre/post germinal centre non-Hodgkin’s lymphomas with high rates of somatic hypermutation. Journal of Clinical Pathology Published Online First: 30 June 2006. doi: 10.1136/ jcp.2006.038984 154. Hongxiang Liu, Anthony J. Bench, Bacon CM, Payne K, Huang Y, Scott MA, Erber WN, Grant JW, Du MQ. A practical strategy for the routine use of BIOMED-2 assays for detection of B- and T- cell clonality in diagnostic hematopathology. Br J Haematol 2007; 138 (1): 31-43 155. Bruggemann M, White H, Gaulard P, Garcia-Sanz R, Gameiro P, Oeschger S, Jasani B, Ott M, Delsol G, Orfao A, Tiemann M, Herbst H, Langerak AW, Spaargaren M, Moreau E,Groenen PJ, Sambade C, Foroni L, Carter GI, Hummel M, Bastard C, Davi F, Delfau-Larue MH, Kneba M, Van Dongen JJ, Beldjord K, Molina TJ. Powerful strategy for polymerase chain reaction-based clonality assessment in T-cell malignancies Report of the BIOMED-2 Concerted Action BHM4 CT98-3936. Leukemia 2007, 21, 215–221 156. Evans PA, Pott Ch, Groenen PJ, Salles G, Davi F, Berger F, Garcia JF, van Krieken JH, Pals S, Kluin P, Schuuring E, Spaargaren M, Boone E, González D, Martinez B, Villuendas R, Gameiro P, Diss TC, Mills K, Morgan GJ, Carter GI, Milner BJ, Pearson D, Hummel M, Jung W, Ott M, Canioni D, Beldjord K, Bastard C, Delfau-Larue MH, Van Dongen JJ, Molina TJ, Cabeçadas J. Significantly improved PCRbased clonality testing in B-cell malignancies by use of multiple immunoglobulin gene targets. Report of the BIOMED-2 Concerted Action BHM4-CT98-3936. Leukemia 2007; 21, 207– 214 157. Langerak AW, Molina TJ, Lavender FL, Pearson D, Flohr T, Sambade C, Schuuring E, al Saati T, Van Dongen JJ, & Van Krieken JH. Polymerase chain reaction-based clonality testing in tissue samples with reactive lymphoproliferations usefulness and pitfalls. A report of the BIOMED-2 Concerted Action BMH4-CT98-3936. Leukemia2007; 21, 222–229 158. McClure RF, Kaur P, Pagel E, Ouillette PD, Holtegaard CE, Treptow CL, Kurtin PJ. Validation of immunoglobulin gene rearrangement detection by PCR using commercially available BIOMED-2 primers. Leukemia 2006; 20, 176–179 159. Sandberg Y, Van Gastel-Mol EJ, Verhaaf B, Lam KH, Van Dongen JJ, Langerak AW. BIOMED-2 multiplex immunoglobulin/T-cell receptor polymerase chain reaction protocols can reliably replace southern blot analysis in routine clonality diagnostics. Journal of Molecular Diagnostics 2005; 7(4): 495-503 160. Red Blood Cell Sedimentation with Dextran T-500- version 1.0 adopted from January 2000 hard copy located in Molecular BTS Procedure binder, Section 1

71 161. QIAamp DNA Blood Mini Kit Handbook, 2003 162. NanoDrop Technologies, Inc, ND-1000 Spectrophotometer V3.3 user's manual, 2006 163. Van Krieken JH, Langerak AW, Macintyre EA, Kneba M, Hodges E, Sanz RG, Morgan GJ, Parreira A, Molina TJ, Cabeçadas J, Gaulard P, Jasani B, Garcia JF, Ott M, Hannsmann ML, Berger F, Hummel M, Davi F, Brüggemann M, Lavender FL, Schuuring E, Evans PA, White H, Salles G, Groenen PJ, Gameiro P, Pott Ch, Dongen JJ. Improved reliability of lymphoma diagnostics via PCR-based clonality testing: Report of the BIOMED-2 Concerted Action BHM4-CT98-3936. Leukemia 2007 21: 201-206 164. Griesser H. Gene rearrangements and chromosomal translocations in T-cell lymphoma—diagnostic applications and their limits. Virchows Arch 1995;426:323–38 165. George A C, Calin D D, Masayoshi S, Roberta B, Simona Z, Evan N, Hansjuerg A, Sashi R, Michael K, Kanti R, Laura R, Thomas K, Massimo N, Florencia B, and Carlo M C. Frequent deletions and down-regulation of microRNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. PNAS 2002; 99: 15524 –15529 166. Ouillette P, Erba H, Kujawski L, Kaminski M, Shedden K, Malek SN. Integrated genomic profiling of chronic lymphocytic leukemia identifies subtypes of deletion 13q14. Cancer Res. 2008; 68: 1012- 1021