ANALISIS KERAGAMAN GENETIK ISOLAT Ganoderma Boninense DARI KELAPA SAWIT (Elaeis Guineensis Jacq.) PT SOCFIN INDONESIA DENGAN METODE SIMPLE SEQUENCE REPEATS (SSR)

ANALISIS KERAGAMAN GENETIK ISOLAT Ganoderma boninense DARI KELAPA SAWIT (Elaeis guineensis Jacq.) PT SOCFIN INDONESIA DENGAN METODE SIMPLE SEQUENCE REPEATS (SSR)

TESIS

Oleh

AGUSTIAMAN PURBA 157001008

PROGRAM STUDI MAGISTER AGROTEKNOLOGI FAKULTAS PERTANIAN UNIVERSITAS SUMATERA UTARA 2020 ANALISIS KERAGAMAN GENETIK ISOLAT Ganoderma boninense DARI KELAPA SAWIT (Elaeis guineensis Jacq.) PT SOCFIN INDONESIA DENGAN METODE SIMPLE SEQUENCE REPEATS (SSR)

TESIS

Oleh

AGUSTIAMAN PURBA 157001008

Tesis Sebagai Salah Satu Syarat Untuk Dapat Mendapatkan Gelar Magister di Program Studi Magister Agroteknologi Fakultas Pertanian Universitas Sumatera Utara

PROGRAM STUDI MAGISTER AGROTEKNOLOGI FAKULTAS PERTANIAN UNIVERSITAS SUMATERA UTARA 2020

ABSTRACT

AgustiamanPurba. 2020. “ANALYSIS OF GENETIC DIVERSITY OF Ganoderma boninense ISOLATES FROM OIL PALM (Elaeis guineensis Jacq.) of PT SOCFIN INDONESIA WITH SIMPLE SEQUENCE REPEATS (SSR) METHODS, guided by Mohammad Basyuni and Revandy I. M. Damanik. This study aims to identify the genetic diversity of Ganoderma boninense from several oil palm (Elaeis guineensis Jacq) PT Socfin Indonesia and the other host plants. This research was carried out at the Pathology Laboratory of PT Socfin Indonesia in Kebun Tanah Gambus, Lima Puluh, Batu Bara District and DNA Laboratory at SSPL (Socfindo Seeds Production and Laboratories) Bangun Bandar, Dolok Masihul, Serdang Bedagai District. This research was conducted using the SSR (Simple Sequence Repeats) method and DNA sequence analysis. The results showed that the most informative primer was the KT124399 primer with a PIC value of 1.0. Based on the number of specific primers amplifying, the lontar basal stem rot of fruit body isolate has a tendency of similarity with G.boninense is greater (83%) compared to the rubber basal stem rot of fruit body isolate (50%) the palm rot basal stem rot of fruit body isolate (33%) %). Genetic diversity of G.boninense isolates obtained from several oil palm plantations of PT Socfin Indonesia are low but has high gene flow potential.

Key words : Basal Stem Rot, Ganoderma boninense, genetic diversity, Simple Sequence Repeats

ABSTRAK

AgustiamanPurba. 2020. “ANALISIS KERAGAMAN GENETIK ISOLAT Ganoderma boninense DARI KELAPA SAWIT (Elaeis guineensis Jacq.) PT SOCFIN INDONESIA DENGAN METODE SIMPLE SEQUENCE REPEATS (SSR), dibimbing oleh Mohammad Basyuni dan Revandy I. M. Damanik. Penelitian ini bertujuan untuk mengidentifikasi keragaman genetik Ganoderma boninense dari kelapa sawit (Elaeis guineensis Jacq) PT Socfin Indonesia dan tanaman inang lainnya. Penelitian ini dilaksanakan di Laboratorium Patologi PT Socfin Indonesia di Kebun Tanah Gambus Kecamatan Lima Puluh Kabupaten Batu Bara dan Laboratorium DNA di SSPL (Socfindo Seeds Production and Laboratories) Bangun Bandar Kecamatan Dolok Masihul Kabupaten Serdang Bedagai. Penelitian ini dilakukan menggunakan metode SSR (Simple Sequence Repeats) dan analisis sequence DNA. Hasil penelitian menunjukkan bahwa primer yang paling informatif adalah primer KT124399 dengan nilai PIC adalah 1,0. Berdasarkan banyaknya primer spesifik yang mengamplifikasiI, isolat tubuh buah basal stem rot lontar memiliki kecenderungan kemiripan dengan G.boninense lebih besar (83%) dibandingkan dengan isolat tubuh buah basal stem rot karet (50%) isolat tubuh buah basal stem rot kelapa nyiur (33%). Keragaman genetik isolat G.boninense yang diperoleh dari beberapa kebun kelapa sawit PT Socfin Indonesia adalah rendah namun memiliki potensi aliran gen yang tinggi.

Kata kunci : Basal Stem Rot, Ganoderma boninense, keragaman genetik, Simple Sequence Repeats

KATA PENGANTAR

Puji dan syukur penulis ucapkan kepada Tuhan Yang Maha Esa karena atas berkat dan rahmat-Nya penulis dapat menyelesaikan tesis ini tepat pada waktunya.

Adapun judul dari tesis ini adalah “Analisis Keragaman Genetik Isolat

Ganoderma boninense dari Kelapa Sawit (Elaeis guineensis Jacq.) PT SOCFIN

INDONESIA dengan Metode Simple Sequence Repeats (SSR)” yang merupakan salah satu syarat untuk mendapatkan gelar Magister Program Studi Agroteknologi

Fakultas Pertanian Universitas Sumatera Utara, Medan.

Pada kesempatan ini penulis mengucapkan terima kasih kepada dosen pembimbing yaitu Mohammad Basyuni, S.Hut., M.Si., Ph.D., sebagai Ketua

Komisi Pembimbing dan Ir. Revandy I.M. Damanik, M.Sc., Ph.D., sebagai

Anggota Komisi Pembimbing yang telah membantu dan membimbing dalam menyelesaikan tesis ini.

Penulis juga mengucapkan terima kasih kepada orang tua, keluarga, staf pengajar dan pegawai di Program Studi Magister Agroteknologi, direksi/manajemen, pegawai Laboratorium Patologi dan Laboratorium DNA PT

Socfin Indonesia, dan semua teman yang telah memberi dukungan dan membantu penulis dalam menyelesaikan tesis ini.

Akhir kata penulis mengucapkan terima kasih. Semoga tesis ini bermanfaat bagi seluruh pihak yang membutuhkan.

Medan, Januari 2020

Agustiaman Purba

iii

DAFTAR ISI

Halaman

ABSTRACT ...... i ABSTRAK ...... ii KATA PENGANTAR ...... iii DAFTAR ISI ...... iv DAFTAR TABEL...... vi DAFTAR GAMBAR ...... vii PENDAHULUAN ...... 1 Latar Belakang ...... 1 Tujuan Penelitian ...... 4 Kegunaan Penelitian ...... 4

TINJAUAN PUSTAKA ...... 5 Taksonomi Ganoderma boninense ...... 5 Morfologi dan Ekologi Ganoderma boninense ...... 5 Penyebaran Ganoderma ...... 9 Keragaman Genetik Ganoderma spp...... 11 Simple Sequence Repeats (SSR)...... 11

METODE PENELITIAN ...... 16 Tempat dan Waktu Penelitian ...... 16 Bahan dan Alat Penelitian ...... 16 Metode Penelitian ...... 23 Pelaksanaan Penelitian...... 23 Persiapan Isolat ...... 23 Ekstraksi DNA Ganoderma spp...... 24 Uji kualitas DNA ...... 25 Uji kuantitas DNA ...... 25 Amplifikasi PCR...... 26 Visualisasi Hasil Amplifikasi DNA dengan Penanda SSR ...... 27 Analisis Sekuens DNA ...... 27 Analisis Data...... 28

HASIL DAN PEMBAHASAN ...... 29 Hasil…… ...... 29 Uji Kuantitas DNA ...... 29 Uji Kualitas DNA ...... 33 Analisis Molekuler ...... 35 Amplifikasi PCR dengan Primer KT 124397 ...... 35 Amplifikasi PCR dengan Primer KT 124402 ...... 39 Amplifikasi PCR dengan Primer KT 124403 ...... 44 Amplifikasi PCR dengan Primer KT 124399 ...... 48

Amplifikasi PCR dengan Primer KT 124400 ...... 53 Amplifikasi PCR dengan Primer KT 124394 ...... 57 Analisis Sekuens DNA ...... 62 Uji Statistik dan Migrasi Alel ...... 62 Profil Lokus Mikrosatelit ...... 62 Analisis Varian Molekuler ...... 64 Uji BLASTX ...... 64 Analisis Filogenetik Isolat Ganoderma boninense ...... 66 Pembahasan ...... 67 Amplifikasi PCR...... 67 Analisis Sekuens DNA ...... 69

KESIMPULAN DAN SARAN ...... 75 Kesimpulan ...... 75 Saran…...... 75

DAFTAR PUSTAKA ...... 76

LAMPIRAN ...... 82

DAFTAR TABEL

No. Halaman

1. Jenis-jenis Ganoderma yang ditemukan berasosiasi dengan penyakit Busuk Pangkal Batang ...... 7 2. Daftar nama, origin dan sumber isolat ...... 16 3. Daftar primer spesifik ...... 26 4. Hasil analisis uji kuantitas ...... 29 5. Uji statistik dan total migrasil alel semua populasi pada setiap lokus ... 62 6. Profil lokus mikrosatelit pada semua populasi isolat Ganoderma spp. . 62 7. Analisis varian molekuler ...... 64 8. Hasil analisis sekuenssing dengan BLASTX ...... 64 9. Koefisien kesamaan urutan DNA antara isolat ...... 65

DAFTAR GAMBAR

No. Halaman

1. Bagian permukaan atas dan bawah Ganoderma boninense ...... 6 2. Bagian permukaan atas dan bawah Ganoderma tornatum ...... 6 3. Prosedur subkultur isolat Ganoderma spp...... 23 4. Miselium Ganoderma boninense yang tumbuh pada media PDA ...... 24 5. Uji kualitas DNA ...... 33 6. Pola pita isolat Ganoderma I5-129 dengan marka SSR menggunakan primer KT 124397 ...... 35 7. Pola pita isolat Ganoderma I30-I57 dengan marka SSR menggunakan primer KT 124397 ...... 35 8. Pola pita isolat Ganoderma I58-I90 dengan marka SSR menggunakan primer KT 124397 ...... 36 9. Pola pita isolat Ganoderma I91-I146 dengan marka SSR menggunakan primer KT 124397 ...... 36 10. Pola pita isolat Ganoderma I147-I179 dengan marka SSR menggunakan primer KT 124397 ...... 37 11. Pola pita isolat Ganoderma I180-I198 dengan marka SSR menggunakan primer KT 124397 ...... 37 12. Pola pita isolat Ganoderma I199-NJ73 dengan marka SSR menggunakan primer KT 124397 ...... 38 13. Pola pita isolat Ganoderma NJ75-005MJIR dengan marka SSR menggunakan primer KT 124397 ...... 38 14. Pola pita isolat Ganoderma 004PTPN3-PTNS dengan marka SSR menggunakan primer KT 124397 ...... 39 15. Pola pita isolat Ganoderma I5-I29 dengan marka SSR menggunakan primer KT 124402 ...... 39 16. Pola pita isolat Ganoderma I30-I57 dengan marka SSR menggunakan primer KT 124402 ...... 40 17. Pola pita isolat Ganoderma I58-I90 dengan marka SSR menggunakan primer KT 124402 ...... 40 18. Pola pita isolat Ganoderma I91-I146 dengan marka SSR menggunakan primer KT 124402 ...... 41 19. Pola pita isolat Ganoderma I147-I179 dengan marka SSR menggunakan primer KT 124402 ...... 41 20. Pola pita isolat Ganoderma I180-I198 dengan marka SSR menggunakan primer KT 124402 ...... 42

vii

21. Pola pita isolat Ganoderma I199-NJ73 dengan marka SSR menggunakan primer KT 124402 ...... 42 22. Pola pita isolat Ganoderma NJ75-005MJIR dengan marka SSR menggunakan primer KT 124402 ...... 43 23. Pola pita isolat Ganoderma 004PTPN-PTNS dengan marka SSR menggunakan primer KT 124402 ...... 43 24. Pola pita isolat Ganoderma I5-I29 dengan marka SSR menggunakan primer KT 124403 ...... 44 25. Pola pita isolat Ganoderma I30-I57 dengan marka SSR menggunakan primer KT 124403 ...... 44 26. Pola pita isolat Ganoderma I58-I90 dengan marka SSR menggunakan primer KT 124403 ...... 45 27. Pola pita isolat Ganoderma I91-I146 dengan marka SSR menggunakan primer KT 124403 ...... 45 28. Pola pita isolat Ganoderma I47-I179 dengan marka SSR menggunakan primer KT 124403 ...... 46 29. Pola pita isolat Ganoderma I180-I198 dengan marka SSR menggunakan primer KT 124403 ...... 46 30. Pola pita isolat Ganoderma I199-NJ73 dengan marka SSR menggunakan primer KT 124403 ...... 47 31. Pola pita isolat Ganoderma NJ75-005MJIR dengan marka SSR menggunakan primer KT 124403 ...... 47 32. Pola pita isolat Ganoderma 004PTPN3-PTNS dengan marka SSR menggunakan primer KT 124403 ...... 48 33. Pola pita isolat Ganoderma I5-I29 dengan marka SSR menggunakan primer KT 124399 ...... 48 34. Pola pita isolat Ganoderma I30-I57 dengan marka SSR menggunakan primer KT 124399 ...... 49 35. Pola pita isolat Ganoderma I58-I90 dengan marka SSR menggunakan primer KT 124399 ...... 49 36. Pola pita isolat Ganoderma I91-I146 dengan marka SSR menggunakan primer KT 124399 ...... 50 37. Pola pita isolat Ganoderma I47-I179 dengan marka SSR menggunakan primer KT 124399 ...... 50 38. Pola pita isolat Ganoderma I180-I198 dengan marka SSR menggunakan primer KT 124399 ...... 51 39. Pola pita isolat Ganoderma I199-NJ73 dengan marka SSR menggunakan primer KT 124399 ...... 51 40. Pola pita isolat Ganoderma NJ75-005MJIR dengan marka SSR menggunakan primer KT 124399 ...... 52

viii

41. Pola pita isolat Ganoderma 004PTPN3-PTNS dengan marka SSR menggunakan primer KT 124399 ...... 52 42. Pola pita isolat Ganoderma I5-I29 dengan marka SSR menggunakan primer KT 124400 ...... 53 43. Pola pita isolat Ganoderma I30-I57 dengan marka SSR menggunakan primer KT 124400 ...... 53 44. Pola pita isolat Ganoderma I58-I90 dengan marka SSR menggunakan primer KT 124400 ...... 54 45. Pola pita isolat Ganoderma I91-I146 dengan marka SSR menggunakan primer KT 124400 ...... 54 46. Pola pita isolat Ganoderma I47-I179 dengan marka SSR menggunakan primer KT 124400 ...... 55 47. Pola pita isolat Ganoderma I180-I198 dengan marka SSR menggunakan primer KT 124400 ...... 55 48. Pola pita isolat Ganoderma I199-NJ73 dengan marka SSR menggunakan primer KT 124400 ...... 56 49. Pola pita isolat Ganoderma NJ75-005MJIR dengan marka SSR menggunakan primer KT 124400 ...... 56 50. Pola pita isolat Ganoderma 004PTPN3-PTNS dengan marka SSR menggunakan primer KT 124400 ...... 57 51. Pola pita isolat Ganoderma I5-I29 dengan marka SSR menggunakan primer KT 124394 ...... 57 52. Pola pita isolat Ganoderma I30-I57 dengan marka SSR menggunakan primer KT 124394 ...... 58 53. Pola pita isolat Ganoderma I58-I90 dengan marka SSR menggunakan primer KT 124394 ...... 58 54. Pola pita isolat Ganoderma I91-I146 dengan marka SSR menggunakan primer KT 124394 ...... 59 55. Pola pita isolat Ganoderma I47-I179 dengan marka SSR menggunakan primer KT 124394 ...... 59 56. Pola pita isolat Ganoderma I180-I198 dengan marka SSR menggunakan primer KT 124394 ...... 60 57. Pola pita isolat Ganoderma I199-NJ73 dengan marka SSR menggunakan primer KT 124394 ...... 60 58. Pola pita isolat Ganoderma NJ75-005MJIR dengan marka SSR menggunakan primer KT 124394 ...... 61 59. Pola pita isolat Ganoderma 004PTPN3-PTNS dengan marka SSR menggunakan primer KT 124394 ...... 61 60. Pohon filogenetik isolate Ganoderma spp. dengan metode neighbor-joining ...... 66

PENDAHULUAN

Latar Belakang

Ganoderma merupakan cendawan Basidiomycota yang bersifat tular tanah dan sebagai penyebab utama penyakit akar putih pada tanaman berkayu dengan menguraikan lignin. Sebagian besar siklus Ganoderma ada di dalam tanah atau jaringan tanaman. Penularan penyakit busuk pangkal batang melalui tiga cara, yaitu kontak akar tanaman dengan sumber inokulum Ganoderma, udara dengan basidiospora, dan inokulum sekunder berupa tunggul tanaman atau inang alternatif (Susanto, 2013).

Penyebab penyakit busuk pangkal batang akibat serangan cendawan dari genus Ganoderma pertama kali diungkapkan pada tahun 1915 di Republik

Kongo, Afrika Barat (Abadi, 1987). Menurut penelitian Hushiarian et al, (2013)

Ganoderma boninense merupakan patogen utama penyebab penyakit busuk pangkal batang yang menyerang kelapa sawit sampai tingkat mematikan. Banyak perkebunan kelapa sawit mengalami kerugian karena penyakit busuk pangkal batang yang disebabkan oleh G.boninense. Ganoderma dapat menyerang tanaman muda dan biasanya akan mati dalam kurun waktu 6-24 bulan setelah gejala awal kelihatan, sedangkan tanaman menghasilkan dapat bertahan hidup selama 2-3 tahun atau lebih. Pada awalnya penyakit ini susah untuk didiagnosa, dan patogen dapat hadir tanpa munculnya gejala-gejala, namun secara alami sudah menginfeksi tanaman (Corley dan Tinker, 2003).

Di Sumatera Utara, pada saat usia tanaman memasuki masa replanting

(umur 25 tahun), 40–50 % tanaman telah hilang, dimana kebanyakan tanaman

menunjukkan gejala terserang BSR. Kehilangan tanaman tersebut berdampak secara ekonomi (Cooper et al, 2011).

Praktek kultur teknis agronomis dan pengelolaan fitosanitari dapat mengurangi dampak penyakit namun harus sejalan dengan penggunaan bahan tanaman yang tahan terhadap G. boninense. Ketahanan total tanaman terhadap jamur belum ada dilaporkan, namun banyak contoh yang sudah diamati, termasuk kelapa sawit (Durand-Gasselin et al, 2014).

Tidak seperti patogen tanaman lainnya, Ganoderma sp. mempunyai karakteristik biologi dan penyebaran yang spesifik. Ganoderma sp. memiliki perkembangan pertumbuhan yang lambat, namun memiliki kemampuan bertahan yang lama karena adanya resting spore dan pseudosklerotium. Berdasarkan hal ini maka diperlukan penanganan khusus dalam pengendalian Ganoderma sp.

Pada tingkat serangan yang ringan, gejala yang terjadi sangat bervariasi di lingkungan yang berbeda dan baru muncul sangat spesifik pada serangan lanjut.

Ketika gejala secara kasat mata terlihat, pada umumnya tanaman sudah tidak dapat tertolong lagi dan tidak lama kemudian mati. Atas dasar hal ini sangat diperlukan deteksi dini dalam usaha penanggulangan serangan Ganoderma sp. khususnya pada tingkat serangan ringan (Dewantara et al, 2014).

Penyakit Busuk Pangkal Batang (BPB) diketahui dapat disebabkan oleh patogen Ganoderma yang berbeda-beda di setiap negara (Ariffin et al, 2000).

Penyebab penyakit BPB kelapa sawit di beberapa negara dilaporkan berbeda- beda, yaitu beberapa spesies Ganoderma saprofitik dari kelompok Basidimycota.

Di Afrika Barat, penyebab BPB diidentifikasikan sebagai G. lucidum, di Nigeria diidentifikasikan sebagai G. zonatum, G. encidum, G. colossus, dan G.

applanatum (Breton et al, 2006). Darmono et al, (1998) menyatakan bahwa G. boninense yang ditemukan di Indonesia mempunyai perbedaan secara molekuler.

G. boninense dari beberapa daerah di Indonesia tidak mempunyai hubungan yang sangat dekat.

Untuk mengontrol BPB, pengetahuan tentang ciri, sifat, dan perilaku dari

Ganoderma spp. sangat diperlukan. Salah satu tahap awal untuk karakterisasi ialah identifikasi secara molekuler. Metode klasifikasi secara konvensional mempunyai batasan dalam membedakan karena karakteristik morfologi

Ganoderma spp. dapat berubah bergantung pada kondisi lingkungannya. Hal ini dalam beberapa aspek menyebabkan kerancuan terhadap identitas spesies

Ganoderma yang menyerang kelapa sawit di Malaysia (Ho dan Nawawi 1985;

Latiffah et al, 2002).

Seo dan Kirk (2000) menyatakan bahwa dalam identifikasi Ganoderma tidak cukup jika hanya berdasarkan bentuk basidiokarp saja tetapi harus memperhatikan dua kriteria utama yaitu karakteristik spora dan morfologi hifa.

Penelitian Ratnaningtyas dan Samiyarsih (2012) menunjukkan bahwa identifikasi

Ganoderma berdasarkan karakter makromorfologi dan mikromorfologi juga harus dilengkapi dengan identifikasi secara molekuler.

Keragaman fenotipik Ganoderma ditemukan di perkebunan PT Socfin

Indonesia dari tanaman kelapa sawit yang terserang penyakit BPB. Ada perbedaan warna, bentuk permukaan, pola pelekatan pada batang kelapa sawit dan pola bagian tepi basidiokarp. Tetapi keragaman genetiknya belum diketahui. Oleh karena itu dilakukan penelitian ini untuk mengetahui keragaman genetik G. boninense penyebab BPB yang ada di dalam dan di luar PT Socfin Indonesia.

Tujuan Penelitian

Penelitian ini bertujuan untuk mengidentifikasi keragaman genetik isolat

Ganoderma dari beberapa kebun kelapa sawit (E. guineensis Jacq.) di PT Socfin

Indonesia berdasarkan metode Simple Sequence Repeats (SSR).

Kegunaan Penelitian

1. Memanfaatkan keragaman genetik isolat-isolat Ganoderma yaitu Ganoderma

boninense pada pengujian early screening test projeni kelapa sawit PT Socfin

Indonesia untuk mendapatkan varietas kelapa sawit MT Gano (Moderat

Tahan Ganoderma).

2. Sebagai langkah awal untuk melakukan perubahan terhadap praktek

pengelolaan penyakit tanaman kelapa sawit dengan mengetahui keragaman

genetik Ganoderma.

TINJAUAN PUSTAKA

Taksonomi Ganoderma boninense

Penyakit busuk pangkal batang merupakan penyakit penting pada tanaman kelapa sawit di Indonesia yang disebabkan oleh jamur G. boninense

(Semangun, 2006). Secara sistematika G. boninense tergolong ke dalam kingdom

Fungi atau Mycota, fylum: Basidiomycota, kelas: Basidiomycetes, ordo:

Polyporales, family: Polyporaceae, divisi: Eymycophyta, genus: Ganoderma dan spesies: boninense (Yanti dan Susanto, 2004).

Morfologi dan Ekologi Ganoderma boninense

Basidiomycota adalah jamur multiseluler yang hifanya bersekat. Hifa vegetatifnya berada di substratnya sendiri seperti di kulit kayu, tanah dan serasah daun. Hifa generatif ada yang membentuk tubuh buah maupun tidak. Tubuh buahnya berukuran maksroskopik. Bentuknya bermacam-macam, ada yang seperti payung, kuping dan setengah lingkaran. Basidiokarp ada yang memiliki batang, ada yang tidak. Bagian bawah tudungnya terdapat bilah, di lembaran inilah terbentuk banyak basidium yang menghasilkan spora basidium yang merupakan spora generatif. Reproduksi terjadi secara aseksual maupun seksual. Aseksual yaitu dengan membentuk konidiospora. Reproduksi seksual terjadi antar hifa yang berbeda jenis menghasilkan spora seksual, spora basidium (Nadiah, 2013).

Ada dua tipe Ganoderma yang tumbuh pada kelapa sawit (kelapa sawit yang hidup dan mati) dan kelapa nyiur yang mati. Tipe “palma”, Ganoderma boninense, merupakan patogen utama pada kelapa sawit dan biasanya ditemukan dalam jumlah yang besar pada kayu kelapa nyiur yang mati. Tipe „hutan‟,

Ganoderma tornatum, 6

biasanya tumbuh sebagai saprofit pada batang kelapa sawit dan kelapa nyiur dan tunggul. Juga sangat biasa tumbuh pada kayu-kayu yang keras (Pilotti, 2006).

Gambar 1. Bagian permukaan atas dan bawah Ganoderma boninense

Gambar 2. Bagian permukaan atas dan bawah Ganoderma tornatum

Tubuh buah Ganoderma dapat mencapai diameter 30 cm. Warna permukaan atas tubuh buah berwarna kecoklatan dengan garis putih kekuningan.

Pada saat matang, bagian atas tubuh buah mengkilat. Permukaan bawah berwarna putih suram yang terdiri atas pori tempat terbentuknya basidium berupa tabung

hialin bulat dengan diameter 12 µm, basidiospora berwarna kecoklatan dengan ukuran 11 µm x 7-8 µm (Susanto et al., 2013). Secara mikroskopis basidiospora

G. boninense adalah uniseluler, haploid, berbentuk ellipsoid, bujur atau truncate.

Jing (2007) melaporkan bahwa massa spora G. boninense berwarna pirang kekuningan. Panjang basidiospora adalah 7,1-13,8 µm dan lebar 4,8-8,3 µm.

Tabel 1. Jenis-jenis Ganoderma yang ditemukan berasosiasi dengan penyakit Busuk Pangkal Batang

Jenis Ganoderma Sinonim Negara yang melaporkan Ivory Coast, Dahomey, Sao Tome Principe, Zaire, Angola, G. applanatum Fomes applanatus Indonesia, Malaysia (Semenanjung) G. boninense - Malaysia (Semenanjung) G. chalceum - Malaysia (Semenanjung), Sabah G. cochlear - Indonesia G. colossus - Nigeria G. fornicatum - Zaire G. laccatum - Indonesia Ghana, Nigeria, Sao Tome Principe, Zaire, Angola, N. G. lucidum F. lucidus Rhodesia, Tanzania, Indonesia, Malaysia (Semenanjung) G. miniatocinctum - Malaysia (Semenanjung) G. pediforme - Zaire G. pseudoferrum - Zaire, Malaysia (Semenanjung) F. applanatus var. tornatum Kamerun, Zaire, Malaysia G. tornatum G. applanatum var. tornatum (Semenanjung) G. australe G. tropicum - Indonesia G. xylonoides - Zaire Ghana, Nigeria, Sao Tome, G. zonatum G. tumidum Zaire, Tanzania Kolombia, Zaire, Malaysia Ganoderma spp. - (Semenanjung) (Turner, 1981)

Beberapa jenis Ganoderma memproduksi enzim amylase, ekstraseluler, oksidase, invertase, koagulase, protease, renetase, pektinase dan selulose.

Ganoderma boninense memproduksi manganese peroksidase (MnP) dan laktase

(Corley dan Tinker, 2003).

Moncalvo (2000), memasukkan G. boninense ke dalam grup fungi yang menyerang tanaman palem-paleman. Ganoderma termasuk dalam salah satu ordo dari 32 ordo fungi kelas Basidiomycetes yang berperan sebagai patogen

(Vidhyasekaran, 2004). Grup ini dibagi dalam tiga kelompok kecil berdasarkan daerah penyebarannya yaitu G. zonatum di Florida; G. boninense di Asia

Tenggara, daerah Pasifik dan Jepang; dan kelompok fungi yang menyerang palem-paleman yang tidak mampu diidentifikasikan lebih lanjut, di daerah

Zimbabwe dan India tidak masuk dalam klasifikasi.

Sumber Ganoderma yaitu inokulum yang ditinggalkan oleh tanaman inang alternatif, inokulum yang berasal dari kelapa sawit terinfeksi (disebarkan oleh kontak akar) dan basidiospora yang diterbangkan angin (diproduksi dan dilepaskan oleh tubuh buah atau sporofor) (Fee, 2011).

Spesies-spesies yang dapat menularkan Ganoderma pada tanaman kelapa sawit, sangat luas cakupannya. Terdapat 44 spesis dari 34 genus; diantaranya itu ada 11 legum, kelapa, pinang, dan beberapa palma. Lebih dari 7 spesis legum terinfeksi Ganoderma boninense (Idris et al, 2004).

Coetzee et al, (2011) mengungkapkan bahwa Ganoderma philippii Karst. merupakan spesies cendawan yang paling sering diketahui berasosiasi dengan penyakit busuk akar di HTI A. mangium di Riau. Identifikasi berdasarkan DNA terhadap isolat yang dikumpulkan menunjukkan bahwa 97% di antaranya

mengarah pada spesies tunggal G. philippii. Sejumlah spesies basidiomycetes lainnya semisal G. mastoporum, Phellinus noxius dan Tinctoporellus epimiltinus juga diisolasi dari akar yang terserang. Juga dilaporkan bahwa perbandingan sekuen DNA dan analisis filogenetik mendapatkan G. philippii sebagai penyebab penyakit busuk akar pada eukaliptus. Ini merupakan laporan pertama bahwa G. philippii merupakan penyebab penyakit busuk akar pada Eucalyptus di Indonesia.

Serangan BSR yang tinggi diamati pada kelapa sawit yang ditanam pada bekas lahan kelapa dan serangan rendah pada lahan bekas karet (Turner, 1981).

Inokulum yang banyak tertinggal pada bekas lahan kelapa kemungkinan menyebabkan serangan BSR yang tinggi.

Penyebaran Ganoderma

Kontak akar dengan sumber inokulum diyakini sebagai metode infeksi dan penyebaran BSR (Turner,1981). Infeksi melalui kontak akar juga telah dijelaskan pada serangan BSR di Zaire. Penanaman ulang kelapa sawit dengan kelapa sawit dapat meningkatkan resiko serangan BSR, karena tertinggalnya substansi jaringan yang sakit di dalam tanah atau tanaman yang tua telah terserang dan menjadi busuk (Fee, 2011).

Di dalam akar, miselium jamur Ganoderma berada dalam sel empulur, korteks, endodermis perisikel dan parenkima (Idris et al, 2004). Jamur ini akan menginfeksi dan bergerak dalam akar menuju ke pangkal batang tanaman kelapa sawit.

Tubuh buah atau sporofor Ganoderma merupakan tempat spora, yang menghasilkan spora dalam jumlah yang banyak. Basidiospora Ganoderma yang sangat kecil ukurannya, tersebar melalui bantuan pergerakan udara dan angin yang

kencang. Menurut Turner (1981), basidiospora tidaklah penting dalam menyebarkan penyakit di perkebunan namun basidiospora berkoloni membentuk substrat baru dan dapat menyebabkan terjadinya infeksi baru. Namun hal ini tidaklah memperkuat fakta bahwa spora merupakan sebagai penyebab utama BSR di lapangan. Jika demikian, seharusnya serangan BSR di lapangan sangatlah tinggi.

Pola penyebaran yang menggunakan basidiospora yang melalui udara mengakibatkan gejala penyakit yang timbul akibat serangan Ganoderma berupa busuk batang atas. Selain angin sebagai agen penyebaran penyakit, serangga juga diketahui berperan dalam mempercepat penyebaran penyakit yang disebabkan oleh cendawan patogen Polyporaceae, termasuk di dalamnya Ganoderma

(Susanto et al, 2013).

Hasil penelitian Kasno et al, (1986) menyebutkan bahwa untuk penyebaran Ganoderma ke daerah yang baru, perananan basidiospora yang dilepaskan dari badan buah sangat besar. Hal ini karena jumlah ukurannya yang sangat kecil, bobotnya sangat ringan dan kemampuan bertahan (dorman) dalam waktu yang sangat lama (bertahun-tahun). Dalam hal ini peranan angin sangat besar dalam penyebaran basidiospora. Sebagai contoh Ganoderma applanatum melepaskan sebanyak 20 juta basidiospora setiap menit selama periode pelepasan basidiospora. Masing-masing basidium akan menghasilkan empat jenis basidiospora yang memiliki genotif beragam (Seo dan Kirk, 2000).

Basidiospora dibebaskan dan menyebar secara besar-besaran pada pukul

22.00-06.00, dan lebih sedikit pada pukul 12.00-16.00. Pemencaran ini juga

dibantu oleh kumbang Oryctes rhinoceros yang larvanya umum ditemukan pada batang kelapa sawit yang busuk (Susanto et al, 2013).

Keragaman Genetik Ganoderma spp.

Keragaman genotip Ganoderma spp. pada kelapa sawit cukup tinggi. Hal ini mungkin dapat dijelaskan oleh sifat tubuh buah yang merupakan hasil perkawinan heterokarion antar hifa yang berbeda. Untuk menghasilkan tubuh buah, Ganoderma spp. harus melakukan reproduksi seksual dengan hifa yang berbeda. Dengan demikian, rekombinasi DNA yang terjadi waktu reproduksi seksual berkontribusi terhadap keragaman genetika yang tinggi (Purnamasari et al, 2012).

Taksonomi tradisional terhadap Ganoderma berdasarkan pada ciri morfologinya. Ganodermataceae terdiri dari 4 genera : Ganoderma,

Amaurodama, Haddowia dan Humphreya. Ganoderma terdiri dari subgenus

Ganoderma yaitu termasuk Sect. Ganoderma dan Sect. Phaenema, subgenus

Eflvingia dan subgenus Trachyderma (Zhao dan Zhang, 2000). Dibawah kondisi pengaruh lingkungan, variabilitas, interhibridisasi dan perbedaan morfologi individu, membuat pengidentifikasian Ganoderma menjadi sulit. Teknik cetak

DNA, dapat dipergunakan untuk mengidentifikasikan spesies dan kultivar

Ganoderma.

Simple Sequence Repeats (SSR)

Adanya suatu sarana biologi molekuler yang baru, bersamaan dengan ekplorasi informasi genetik, telah memungkinkan untuk membuat penanda genetik, termasuk mikrosatelit. Mikrosatelit juga dikenal dengan sebagai Simple

Sequence Repeats (SSR) yaitu wilayah DNA yang terdiri dari unit-unit tandem

repeat yang pendek dari satu sampai 6 pasang basa. Polimorfik mikrosatelit telah menjadi sesuatu yang populer dan biasa digunakan sebagai penanda molekuler untuk mempelajari keragaman genetik, genealogi dan ekologi molekuler (Jarne dan Lagoda, 1996). Secara khusus, mikrosatelit sangat berguna untuk mempelajari sifat genetik populasi dan penyebaran secara geografis dari patogen tanaman (Schoebel et al, 2013, Presti dan Wasko, 2014).

Mikrosatelit juga dikenal dengan simple sequence repeat (SSRs), short tandem repeats (STRs) atau simple sequence length polymorphisms (SSLPs) yang merupakan short tandem repeats, dengan panjang 1 sampai 10 bp (Litt dan Luty,

1989). Beberapa literatur mendefinisikan mikrosatelit dengan 2-8 bp, 1-6 bp, atau bahkan 1-5 bp. SSRs memiliki variable yang tinggi dan bahkan didistribusikan pada genom dan biasanya pada eukaryotik, jumlah unit repeatnya sangat luas tergantung pada spesies tanaman. Sekuens repeatnya sangat sederhana, berisikan dua, tiga atau empat nukleotida (di, tri, dan tetranukleotida).

Pola mikrosatelit jamur juga dikenal memiliki jumlah repetisi yang rendah

(kebanyakan tidak lebih daripada delapan), dengan proporsi pola mononukleotida yang tinggi, hal ini menyebabkan sulitnya untuk menemukan polimorfisme SSRs yang tinggi (Dutech et al, 2007).

Untuk melawan G. boninense lebih efektif, kita harus mengubah pengertian kita tentang biologinya. Pengetahuan fisiologi (Pilotti, 2005; Rees et al, 2007)) dan genetika (Miller et al, 1999; Pilotti et al, 2003) dari G. boninense tidaklah cukup untuk menjelaskan penyebarannya di wilayah seluas Asia

Tenggara. Pada tahun-tahun sekarang ini, sifat genetik populasi telah berkembang menjadi sebuah alat yang penting untuk memahami biologi dan penyebaran

penyakit tanaman. Pola keragaman genetik dapat mempersiapkan informasi tentang kontribusi respektif dari klonal dan reproduksi seksual (Travadon et al,

2012) dan keberadaan dari pembatas aliran gen (Ali et al, 2014).

Reaksi PCR untuk SSRs dilakukan dengan adanya primer forward dan reverse yang menempel pada ujung 5‟ dan 3‟ dari template DNA secara berurutan.

Polimorfisme ini teridentifikasi dengan membangun primer PCR untuk mengapit

DNA pada wilayah mikrosatelit.Fragmen PCR biasanya terpisah pada gel poliakrilamid dikombinasikan dengan AgNO3, autoradiografi atau sistem deteksi fluoresens. Gel agaros (biasanya 3%) dengan etidium bromide (EBr) dapat juga dipergunakan ketika ukuran alel berbeda pada sampel-sampel yang ukurannya lebih besar daripada 10 bp (Govindaraj et al, 2015).

Primer turunan mikrosatelit dapat sering dipergunakan dengan banyak variasi dan bahkan pada spesies yang lain sebab DNA yang diapit dapat dipertahankan. Penanda yang diperlukan ini sering didistribusikan pada genom, dengan mudah terotomatisasi dan bersifat polimorfik tinggi dan memiliki resolusi analisa yang baik dan dapat direproduksi sehingga membuatnya menjadi penanda pilihan, secara luas dipakai untuk pemeriksaan genotif individu, evaluasi plasma nutfah, keragaman genetik, pemetaan genom dan filogenetik dan studi evolusioner

(Matsuoka et al, 2002).

Desain primer yang tepat untuk penggenotipan SSR, dapat sesuai pada beberapa kondisi, termasuk pada ukuran produk PCR yang kecil yaitu 100 bp, guna menghindari gangguan yang disebabkan oleh puncak primer atau suhu peleburan (Tm) yang sama bagi kedua primer forward dan reverse (Castoe et al,

2010).

Tingkat keinformatifan primer ditentukan berdasarkan nilai Polymorphic

Information Content (PIC). Nilai PIC dijadikan standart untuk mengevaluasi marka genetic berdasarkan pita DNA hasil amplifikasi. Botstein et al. 1980 mengklasifikasikan nilai PIC menjadi tiga kelas yaitu PIC > 0,5 adalah sangat informatif , 0,25>PIC<0,5 dan PIC< 0,25 memiliki nilai informatif yang rendah.

Semakin besar nilai PIC dalam suatu penanda maka semakin baik penanda tersebut digunakan sebagai penanda molekuler. Penelitian Merciere (2013) menunjukkan bahwa dari 17 marka yang digunakan untuk mengidentifikasi karakteristik ganoderma terdapat marka yang memiliki nilai informativ terbaik yaitu sebesar 0,7.

Kuantitas PIC (Polymorfic Information Value) didasarkan pada jumlah alel yang dapat dihasilkan oleh suatu marka dan frekuensi dari tiap alel dalam set genotipe yang diuji. Nilai ini mengindikasi bahwa marka SSR tersebut cukup informatif digunakan untuk melihat keragaman antar genotip terhadap karakter tahan salin. Semakin besar nilai PIC dalam suatu primer, maka semakin baik primer tersebut untuk marka SSR. Selain nilai PIC, jumlah alel juga dapat kita ketahui dengan marka SSR ini. Jumlah alel efektif merupakan gambaran dari jumlah alel yang terdapat dalam suatu populasi. Ne merupakan sebuah ukuran dari jumlah alel efektif yang diperoleh dari masing-masing karakter. Nilai ini adalah nilai resiprok atau nilai kebalikan dari homozigositas. Semakin tinggi nilai Ne, maka semakin banyak individu yang heterozigot (Anderson et al.1993; Kimura dan Crow, 1964).

Penerapan marka SSR, primer yang digunakan sangat menentukan keberhasilannya. Primer-primer polimorfisme dibutuhkan untuk menganalisa

keragaman individu dengan munculnya pita yang beragam. Secara khusus DNA berdasarkan tingkat polimorfisme merupakan alat yang paling kuat dalam memperoleh similaritas genetik. Polimorfisme dalam populasi tertentu sering disebabkan karena adanya varian genetik yang diwakili oleh jumlah alel pada primer dan frekuensi distribusinya dalam suatu populasi (Dangi, et al. 2004; Liu,

2005; dan Lee, 1995).

Nilai heterozigositas merupakan jumlah penyebaran gen atau alel pada suatu populasi. nilai heterogigotsitas pengamatan Ho biasanya lebih rendah dibandingkan dengan heterozigositas harapan (He). Nilai heterozigositas sesuai dengan probabilitas bahwa dua alel yang diambil dari suatu populasi dapat dibedakan dengan marka yang diuji. Selain itu keragaman alel suatu populasi berdasarkan marka molekuler dapat dilihat dari nilai Fst. Nilai Fst antar populasi berkisar antara 0 sampai 1. Nilai 0 menggambarkan bahwa kedua populasi memiliki alel-alel yang seluruhnya seragam, sedangkan nilai 1 menggambarkan bahwa pada kedua populasi sangat berbeda Nei (1987). Parameter yang telah digunakan secara luas untuk mendeskripsikan struktur populasi. Indeks fiksasi sebagai korelasi antara perpaduan gamet-gamet. Indeks fiksasi untuk masing- masing genotipe homozigot diekspresikan oleh indeks fiksasi untuk genotipe genotipe heterozigot. Agregasi individu dalam plot menunjukkan set genetik individu yang serupa (Dangi, et al. 2004; Nagylaki, 1998; Wright, 1978).

BAHAN DAN METODE

Tempat dan Waktu Penelitian

Penelitian dilaksanakan di Laboratorium Patologi PT Socfin Indonesia di

Kebun Tanah Gambus Kecamatan Lima Puluh Kabupaten Batu Bara dan

Laboratorium DNA di SSPL (Socfindo Seeds Production and Laboratories)

Bangun Bandar Kecamatan Dolok Masihul Kabupaten Serdang Bedagai.

Bahan dan Alat

Bahan-bahan yang digunakan dalam penelitian ini adalah 138 isolat

Ganoderma, air destilasi, peeled potato, tepung agar-agar, dextrose/sucrose, chloramphenicol C0378 Sigma-Aldrich, streptomycin S6501 Sigma-Aldrich, media PDA (Potato Dextrose Agar), media WA (Water Agar), ekstrak DNA

Ganoderma, etanol 70%, liquid nitrogen 0,1 g, polyvinylpyrrolidone (PVPP), buffer CTAB, buffer TAE, buffer TE, NaCl, isopropanol, chloroform, primer spesifik, H2O, agarose gel, GelRed, ladder DNA, loading dye.

Tabel 2. Daftar nama, origin dan sumber isolat No Nama Isolat Origin Isolat Sumber Isolat Jaringan Upper Stem Rot- 1 I5 Bah Lias-Simalungun Kelapa Sawit Tubuh Buah Basal Stem 2 I7 Bah Lias-Simalungun Rot-Kelapa Sawit Jaringan Upper Stem Rot- 3 I8 Tanah Gambus-Batu Bara Kelapa Sawit Tubuh Buah Upper Stem 4 I9 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Jaringan Upper Stem Rot- 5 I10 Tanah Gambus-Batu Bara Kelapa Sawit Tubuh Buah Upper Stem 6 I13 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Upper Stem 7 I15 Bah Lias-Simalungun Rot-Kelapa Sawit Jaringan Upper Stem Rot- 8 I16 Bah Lias-Simalungun Kelapa Sawit Tubuh Buah Basal Stem 9 I21 Bah Lias-Simalungun Rot-Kelapa Sawit Tubuh Buah Basal Stem 10 I22 Bah Lias-Simalungun Rot-Kelapa Sawit 17

Jaringan Upper Stem Rot- 11 I23 Bah Lias-Simalungun Kelapa Sawit Tubuh Buah Upper Stem 12 I24 Bah Lias-Simalungun Rot-Kelapa Sawit Jaringan Upper Stem Rot- 13 I25 Bah Lias-Simalungun Kelapa Sawit Jaringan Upper Stem Rot- 14 I27 Bah Lias-Simalungun Kelapa Sawit Tubuh Buah Upper Stem 15 I28 Bah Lias-Simalungun Rot-Kelapa Sawit Jaringan Upper Stem Rot- 16 I29 Bah Lias-Simalungun Kelapa Sawit Tubuh Buah Basal Stem 17 I30 Bah Lias-Simalungun Rot-Kelapa Sawit Tubuh Buah Upper Stem 18 I31 Bah Lias-Simalungun Rot-Kelapa Sawit Jaringan Upper Stem Rot- 19 I32 Bah Lias-Simalungun Kelapa Sawit Jaringan Upper Stem Rot- 20 I34 Bah Lias-Simalungun Kelapa Sawit Tubuh Buah Upper Stem 21 I35 Bah Lias-Simalungun Rot-Kelapa Sawit Tubuh Buah Upper Stem 22 I37 Bah Lias-Simalungun Rot-Kelapa Sawit Tubuh Buah Upper Stem 23 I39 Bah Lias-Simalungun Rot-Kelapa Sawit Tubuh Buah Upper Stem 24 I41 Bah Lias-Simalungun Rot-Kelapa Sawit Tubuh Buah Upper Stem 25 I43 Bah Lias-Simalungun Rot-Kelapa Sawit Tubuh Buah Upper Stem 26 I45 Bah Lias-Simalungun Rot-Kelapa Sawit Jaringan Upper Stem Rot- 27 I49 Tanah Gambus-Batu Bara Kelapa Sawit Tubuh Buah Upper Stem 28 I50 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Jaringan Upper Stem Rot- 29 I52 Tanah Gambus-Batu Bara Kelapa Sawit Jaringan Upper Stem Rot- 30 I53 Tanah Gambus-Batu Bara Kelapa Sawit Jaringan Upper Stem Rot- 31 I54 Tanah Gambus-Batu Bara Kelapa Sawit Jaringan Upper Stem Rot- 32 I56 Tanah Gambus-Batu Bara Kelapa Sawit Tubuh Buah Upper Stem 33 I57 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Jaringan Upper Stem Rot- 34 I58 Tanah Gambus-Batu Bara Kelapa Sawit Tubuh Buah Upper Stem 35 I60 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Upper Stem 36 I62 Tanah Gambus-Batu Bara Rot-Kelapa Sawit 18

Tubuh Buah Upper Stem 37 I63 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Upper Stem 38 I65 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 39 I70 Dolok-Batu Bara Rot-Kelapa Sawit Jaringan Upper Stem Rot- 40 I71 Dolok-Batu Bara Kelapa Sawit Tubuh Buah Upper Stem 41 I73 Dolok-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 42 I74 Dolok-Batu Bara Rot-Kelapa Sawit Jaringan Basal Stem Rot- 43 I75 Dolok-Batu Bara Kelapa Sawit Tubuh Buah Basal Stem 44 I78 Dolok-Batu Bara Rot-Kelapa Sawit Jaringan Basal Stem Rot- 45 I84 Tanah Gambus-Batu Bara Kelapa Sawit Tubuh Buah Basal Stem 46 I87 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Jaringan Basal Stem Rot- 47 I88 Tanah Gambus-Batu Bara Kelapa Sawit Jaringan Basal Stem Rot- 48 I89 Tanah Gambus-Batu Bara Kelapa Sawit Tubuh Buah Basal Stem 49 I90 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 50 I91 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 51 I92 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Jaringan Basal Stem Rot- 52 I94 Tanah Gambus-Batu Bara Kelapa Sawit Jaringan Basal Stem Rot- 53 I95 Tanah Gambus-Batu Bara Kelapa Sawit Jaringan Basal Stem Rot- 54 I98 Tanah Gambus-Batu Bara Kelapa Sawit Jaringan Basal Stem Rot- 55 I99 Bangun Bandar-Serdang Bedagai Kelapa Sawit Jaringan Basal Stem Rot- 56 I100 Bangun Bandar-Serdang Bedagai Kelapa Sawit Tubuh Buah Basal Stem 57 I105 Bangun Bandar-Serdang Bedagai Rot-Kelapa Sawit Tubuh Buah Basal Stem 58 I106 Bangun Bandar-Serdang Bedagai Rot-Kelapa Sawit Spora Basal Stem Rot- 59 I107 Tanah Gambus-Batu Bara Kelapa Sawit Spora Basal Stem Rot- 60 I108 Tanah Gambus-Batu Bara Kelapa Sawit Tubuh Buah Basal Stem 61 I117 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 62 I129 Tanah Gambus-Batu Bara Rot-Kelapa Sawit 19

Tubuh Buah Basal Stem 63 I141 Bah Lias-Simalungun Rot-Kelapa Nyiur Tubuh Buah Basal Stem 64 I142 Bangun Bandar-Serdang Bedagai Rot-Kelapa Sawit Tubuh Buah Basal Stem 65 I145 Sulawesi Rot-Karet Tubuh Buah Upper Stem 66 I146 Bah Lias-Simalungun Rot-Kelapa Sawit Tubuh Buah Basal Stem 67 I147 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 68 I148 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 69 I149 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Jaringan Basal Stem Rot- 70 I150 Bah Lias-Simalungun Kelapa Sawit Tubuh Buah Basal Stem 71 I155 Bah Lias-Simalungun Rot-Kelapa Sawit Tubuh Buah Basal Stem 72 I157 Bangun Bandar-Serdang Bedagai Rot-Kelapa Sawit Tubuh Buah Basal Stem 73 I158 Bangun Bandar-Serdang Bedagai Rot-Kelapa Sawit Tubuh Buah Basal Stem 74 I161 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah -Kelapa 75 I162 Bah Lias-Simalungun Sawit Tubuh Buah -Kelapa 76 I164 Bah Lias-Simalungun Sawit Tubuh Buah -Kelapa 77 I165 Bah Lias-Simalungun Sawit Tubuh Buah -Kelapa 78 I166 Bah Lias-Simalungun Sawit 79 I172 Bah Lias-Simalungun Jaringan -Kelapa Sawit Tubuh Buah Upper Stem 80 I174 Bah Lias-Simalungun Rot-Kelapa Sawit Tubuh Buah Basal Stem 81 I178 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 82 I179 Bangun Bandar-Serdang Bedagai Rot-Kelapa Sawit Tubuh Buah Basal Stem 83 I180 Bangun Bandar-Serdang Bedagai Rot-Kelapa Sawit Tubuh Buah Basal Stem 84 I182 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 85 I183 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 86 I184 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 87 I185 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 88 I186 Tanah Gambus-Batu Bara Rot-Kelapa Sawit 89 I187 Tanah Gambus-Batu Bara Tubuh Buah Basal Stem 20

Rot-Kelapa Sawit Tubuh Buah Basal Stem 90 I188 Bangun Bandar-Serdang Bedagai Rot-Kelapa Sawit Tubuh Buah Basal Stem 91 I189 Bangun Bandar-Serdang Bedagai Rot-Kelapa Sawit Tubuh Buah Basal Stem 92 I190 Bangun Bandar-Serdang Bedagai Rot-Kelapa Sawit Tubuh buah-pokok mati, 93 I191 Bangun Bandar-Serdang Bedagai tumbang-Kelapa Sawit Tubuh Buah Basal Stem 94 I192 Mata Pao-Serdang Bedagai Rot-Kelapa Sawit Tubuh Buah Basal Stem 95 I194 Fakultas Pertanian USU - Medan Rot-Lontar Tubuh Buah Basal Stem 96 I195 Mata Pao-Serdang Bedagai Rot-Kelapa Sawit Tubuh Buah Basal Stem 97 I196 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 98 I197 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 99 I198 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 100 I199 Tanah Gambus-Batu Bara Rot-Kelapa Sawit Tubuh Buah Basal Stem 101 I202 Aek Loba-Asahan Rot-Kelapa Sawit Tubuh Buah -Kelapa 102 J Bangun Bandar-Serdang Bedagai Sawit Reisolasi Tubuh Buah Pembibitan TG001 - 103 NJ Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG002 - 104 NJ2 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG003 - 105 NJ3 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG051 - 106 NJ51 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG054 - 107 NJ54 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG055 - 108 NJ55 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG056 - 109 NJ56 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG057 - 110 NJ57 Tanah Gambus-Batu Bara Kelapa Sawit 111 NJ58 Tanah Gambus-Batu Bara Reisolasi Tubuh Buah 21

Pembibitan TG058 - Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG066 - 112 NJ66 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG068 - 113 NJ68 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG070 - 114 NJ70 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG072 - 115 NJ72 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG073 - 116 NJ73 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG075 - 117 NJ75 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Miselium Rubber Wood Block 118 NJ85 Tanah Gambus-Batu Bara TG085 Reisolasi Miselium Rubber Wood Block 119 NJ88 Tanah Gambus-Batu Bara TG088 Reisolasi Miselium Rubber Wood Block 120 NJ89 Tanah Gambus-Batu Bara TG089 Reisolasi Tubuh Buah Pembibitan TG090 - 121 NJ90 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG095 - 122 NJ95 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG096 - 123 NJ96 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG097 - 124 NJ97 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG099 - 125 NJ99 Tanah Gambus-Batu Bara Kelapa Sawit Reisolasi Tubuh Buah Pembibitan TG104 - 126 NJ104 Tanah Gambus-Batu Bara Kelapa Sawit Tubuh Buah Basal Stem 127 001 MJIR Labuhan Batu Utara Rot-Kelapa Sawit Tubuh Buah Basal Stem 128 001 PTPN3 Sei Dadap-Asahan Rot-Kelapa Sawit Tubuh Buah Basal Stem 129 002 MJIR Labuhan Batu Utara Rot-Kelapa Sawit 22

Tubuh Buah Basal Stem 130 005 MJIR Labuhan Batu Utara Rot-Kelapa Sawit Tubuh Buah Basal Stem 131 006 MJIR Labuhan Batu Utara Rot-Kelapa Sawit Tubuh Buah Basal Stem 132 004 PTPN3 Sei Dadap-Asahan Rot-Kelapa Sawit Tubuh Buah Basal Stem 133 006 PTPN3 Sei Dadap-Asahan Rot-Kelapa Sawit Tubuh Buah Basal Stem 134 CS1 Sumatera Barat Rot-Kelapa Sawit Tubuh Buah Basal Stem 135 CS3 Sumatera Selatan Rot-Kelapa Sawit Tubuh Buah Basal Stem 136 CS7 Sumatera Selatan Rot-Kelapa Sawit Jaringan Basal Stem Rot- 137 PT Paya Pinang Tebing Tinggi-Sumatera Utara Kelapa Sawit Tubuh Buah Basal Stem 138 PT NS Sirandorung - Tapanuli Tengah Rot-Kelapa Sawit

Alat-alat yang digunakan dalam penelitian ini adalah tisu, aluminium foil, label kertas, spidol permanen, pulpen, scalpel blade, scalpel handle, beaker glass volume 500 cc, magnetic bar, sarung tangan karet, hair cap, masker, wheaton tube, inkubator Liebhr, pipet mikro ukuran 1-50 µl, 100-500 µl, tips pipet (warna putih, kuning dan biru), peeler, panci, kompor gas, tabung gas, hot plate Cimarex, autoclave horizontal Mednif, indicator tape for sterilization, cawan petri plastik steril berdiameter 9 cm, cawan petri kaca berdiameter 9 cm, needle for spinal anaesthesia Spinocan size 0,53 x 88 mm, parafilm, laminar airflow Esco, lampu bunsen, kulkas, particle counter Handilaz, mortar, pinset, oven Memmert, freezer, tabung eppendorf, micro tube 2,0 ml dan 1,5 ml, alat PCR, spektrometer, perangkat elekroforesis, elektroforesis (Power PAC 3000, biorad), PCR (Thermal cycler) applied biosystem, Gel Doc (Doc its), timbangan analitik Sartorius

TE313S, erlenmeyer, spatula, centrifuge (Eppendorf 5415), spectrophotometer, fumehood, microwafe, tang penjepit, kamera, buku tulis, komputer.

Metode Penelitian

Penelitian ini menggunakan metode SSR (Simple Sequence Repeats)

dengan prinsip PCR (Polymerase Chain Reaction), menggunakan 6 primer SSR.

Pelaksanaan Penelitian

Persiapan Isolat

Isolat telah dikonservasi, disimpan di dalam inkubator dengan suhu 200C.

Persiapan isolat dilakukan dalam laminar airflow dengan kondisi steril. Miselium

diambil dari potongan PDA dari dalam wheaton tube dengan menggunakan

needle, lalu disubkultur ke media WA (+chloramphenicol, streptomycin)

sebanyak 3 cawan petri, yang telah dipersiapkan 5 hari sebelum subkultur

dilakukan. Lalu dimasukkan ke dalam ruang inkubasi dalam kondisi gelap

dengan suhu 280C selama sekitar 10 hari.

Miselium yang tumbuh pada media WA, disubkultur ke media PDA

(+chloramphenicol) sebanyak 5 cawan petri yang telah dipersiapkan 5 hari

sebelum subkultur dilakukan. Lalu diinkubasi dalam kondisi gelap pada suhu

280C selama sekitar 10 hari.

WA medium + chl, str PDA medium + chl

Gambar 3. Prosedur subkultur isolat Ganoderma spp.

Wheaton tube (WT)

Gambar 4. Miselium Ganoderma spp. yang tumbuh pada media PDA

Ekstraksi DNA Ganoderma spp.

Ekstraksi DNA memedomani kepada protokol Dolezel MATAB. Miselium

Ganoderma spp. yang tumbuh pada medium PDA digunakan untuk ekstraksi

DNA. Miselium diskrap dari media PDA dalam cawan petri, kemudian digerus di dalam mortar dengan menambahkan nitrogen cair + PVPP secukupnya sampai menjadi bubuk halus. Sekitar 20-25 mg dari bubuk tersebut dimasukkan ke dalam tabung Eppendorf ditambah dengan 1 ml buffer ekstraksi, lalu dikocok bolak- balik dan kemudian diovenkan pada suhu 650C selama 30 menit. Setelah itu dikeluarkan dari oven, dibiarkan dingin pada suhu kamar, lalu dibagi-bagi kedalam beberapa micro tube dengan menambahkan 1 volume chloroform: isoamilalkohol (Cl) untuk dilakukan ekstraksi DNA.

Sampel disentrifius dengan kecepatan 12.000 rpm pada suhu 40C selama

10 menit. Supernatan diambil dan dipindahkan ke tabung 2 ml yang baru lalu ditambahkan 1 volume chloroform : isoamilalkohol (Cl), dikocok bolak-balik.

Larutan disentrifius lagi dengan kecepatan 12.000 rpm dengan suhu 40C selama 10 menit. Kembali supernatan diambil dan dipindahkan ke dalam tabung 2 ml yang baru, kemudian ditambahkan isopropanol dingin sebanyak 1 volume. Lalu dikocok 25

perlahan hingga homogen, kemudian disimpan di dalam kulkas dengan suhu 40C selama 1-4 jam. Setelah itu disentrifius lagi dengan kecepatan 12.000 rpm pada suhu 40C selama 10 menit. Diperiksa dan dilihat apakah ada pellet (berupa endapan putih), jika ada buanglah cairan dengan hati-hati agar pellet tidak terbuang. Pellet dicuci dengan etanol 70%, lalu dikeringkan-anginkan, setelah kering ditambahkan buffer TE sebanyak 100 µl, lalu dihomogenkan.

Selanjutnya ditambahkan etanol absolut dingin, lalu dibolak-balik hingga homogen. Setelah itu diinkubasi dalam freezer (-200C) selama 30 menit, kemudian disentrifius lagi dengan kecepatan 12.000 rpm pada suhu 40C selama 10 menit.

Keluarkan tube dari sentrifius, buanglah etanol dengan menunggingkan tube. Lalu ditambahkan buffer TE untuk melarutkan DNA, digoncang-goncang agar larut dan disimpan di dalam freezer selama 1 malam.

Uji Kuantitas DNA

Uji kuantitas DNA dilakukan dengan metode nanophotometer yaitu pada panjang gelombang (λ) 260 dan 280 nm dengan menggunakan stok DNA murni.

Menurut Sambrook dan Russell (2001), DNA mempunyai kemurnian tinggi jika ratio nilai absorbansi pada panjang gelombang 260 nm dan 280 nm berkisar antara

1,8-2,0.

Uji Kualitas DNA

Gel agaros 1% dibuat dari 0,2 g agaros dan 20 ml buffer TAE 1x, dimasukkan ke dalam erlenmeyer kemudian diguncang. Lalu dimasukkan ke dalam microwave selama 1,5 menit. Setelah itu dikeluarkan dari microwave dan ditambahkan GelRed 0,5 µl dan dituang ke dalam cetakan gel elektroforesis yang telah dipasang sisir (cetakan 12 sumur), ditunggu 30 menit hingga gel memadat. 26

Gel yang sudah memadat dipindahkan ke dalam bak elektroforesis. Sampel yang akan dielektroforesis dicampur dengan loading dye dengan perbandingan DNA dengan loading dye yaitu 5:1. Setelah itu dilakukan penginjeksian ke dalam sumur gel agaros dengan menggunakan pipet mikro. Setelah semua sampel diinjeksi, alat elektroforesis dihubungkan ke power supply dengan tegangan 75 volt, daya 50 watt dan amper sebesar 400 mA selama 50 menit. Kemudian buanglah larutan buffer yang masih tersisa di agaros, lalu diamati pada UVilluminator dan didokumentasikan dengan menggunakan Gel doc.

Amplifikasi PCR PCR (Polymerase Chain Reaction) adalah sebuah reaksi enzimatik untuk perbanyakan in vitro dari sebuah fragmen DNA spesifik. Pada penelitian ini primer SSR yang digunakan ada 6 primer, yaitu:

Tabel 3. Daftar primer spesifik No Aksesi Repeat F Start Ukuran Tm Lokus Primer sequences (5’-3’) Gen Bank Motif / R End (bp) (0C) F: CGCCATGCCCACCACCAGAG 6268 60,04 20d KT 124397 (GCA)9 283-325 R:GACCCGGCTGCCCGAATGAG 6545 59,84 F:ACAAGGCTCAAGGCAGCGCA 17415 59,55 42d KT 124402 (GT)9 212-224 R:GCACACCCCAGCAACAGGAGG 17621 59,91 F:GGCGACGAGGGCACGAGAGA 392 60,66 47d KT 124403 (GA)10 273-297 R:CCGCACTTTCGCCAACCACC 655 59,09 F:GCACAGGCACAAGCGCAAGG 10128 59,71 24d KT 124399 (CAG)11 204-267 R:CGACGACCGCCCCAAAGGAT 10359 59,14 F:AGCTCCCCTCCCAGCTCCAAC 43018 33a KT 124400 (CCA)9 171-186 59,90 R:GAATGCGGCGGGGAAACGGA 43188 60,04 F:CGGGAAGTGGTGAACGGTGGT 7604 58,98 17b KT 124394 (AGC)19 234-243 R:GGGTGGCTTGACAGCGGCAT 7820 59,97

Untuk 50 ng template DNA, ditambahkan masing-masing primer (F/R) sebanyak 7,5 µl serta 37,5 µl Go Taq per sampel. Untuk amplifikasi PCR dilakukan pada Eppendorf Mastercycler ep 384 (Eppendorf, Wertbuy, New

York, USA). Program amplifikasi terdiri dari siklus denaturasi awal pada suhu 27

95°C selama 4 menit, diikuti denaturasi selama 10 detik pada suhu 940C, penempelan primer pada suhu 52°C selama 75 detik, dan proses pemanjangan pada suhu 72°C selama 90 detik dan pemanjangan akhir pada suhu 720C selama 8 menit.

Visualisasi Hasil Amplifikasi DNA dengan Penanda SSR

Hasil amplifikasi DNA dilakukan dengan elektroforesis horizontal (MS Major

Science Mini-300) dengan gel agaros 2%., yaitu 0,4 g agaros dilarutkan ke dalam 20 ml buffer TAE, didiamkan selama 30 menit agar gel agaros memadat. Disiapkan gel plate, spacer, dan sisir, dicuci dengan air dan etanol, kemudian alat-alat tersebut dirangkai. Gel agaros yang telah memadat dimasukkan ke dalam tangki elektroforesis horizontal dan dimasukkan buffer TAE 1x. Kemudian diambil produk dari mesin PCR sebanyak 3 µl ditambah dengan ladder DNA sebanyak 1,5 µl, dipastikan benar-benar tercampur, lalu campuran tersebut dimasukkan ke dalam sumur gel pertama sebagai ladder.

Kemudian diambil produk PCR berikutnya sebanyak 3 µl tanpa menambahkan ladder DNA, dan dimasukkan ke dalam sumur sampai selesai sumur kedelapan.

Elektroforesis horizontal dijalankan pada tegangan 75 volt selama 50 menit.

Larutan buffer yang masih ada di gel agaros dibuang kemudian dibawa ke

UVilluminator. Hasil elektroforesisi diamati dan didokumentasikan dengan UV- transilluminator (UV-Doc-its) dan Gel-Doc (U Doc-its) (Sambrook dan Russell,

2001).

Analisa Sekuens DNA

Produk PCR dikirim untuk dilakukan sekuensing di PT Genetika Science

Indonesia. Hasil sekuensing bermanfaat untuk membangun sebuah pohon filogenetik dari sampel-sampel yang dipakai. Hasil sekuens akan dibandingkan 28

dengan BLAST (Basic Local Alignment Search Tool) pada database NCBI

(National Center for Biotechnology Information). BLAST adalah suatu metode yang khusus dikembangkan untuk membandingkan sekuens asam nukleat atau protein yang belum dikenal dengan semua yang sudah dikenal yang ada pada bank nukleat (http://www.ncbi.nlm.nih.gov/BLAST). Program pembandingan sekuens dimaksud untuk mengidentifikasi apakah ada keidentikan atau kesamaan region diantara dua sekuens sehingga dapat membuat suatu kesimpulan dalam arti biologis terhadap apa yang diuji dan diamati (Altschul et al, 1997).

Analisa Data

Analisa data dilakukan berdasarkan skoring pada pita DNA yang diterjemahkan menjadi data biner berdasarkan ada atau tidaknya pita yang dimiliki secara bersama oleh individu isolat yang dianalisis. Pita diskor secara manual sebagai data biner dengan nilai satu (1) diberikan untuk yang memiliki pita dan nilai nol (0) untuk yang tidak memiliki pita. Estimasi kemiripan genetik diperoleh berdasarkan jumlah pita yang dimiliki bersama. Pengelompokan data matriks dan pembuatan dendogram dilakukan dengan metode UPGMA menggunakan software

DARwin software versi 6.0.014. DARwin adalah suatu paket software yang dikembangkan untuk analisis keragaman dan filogenetik berdasarkan perbedaan evolusioner (Perreira dan Jacquemoud-Collet, 2016).

HASIL DAN PEMBASAHAN

Hasil

Uji Kuantitas DNA

Sebanyak 138 isolat Ganoderma diuji kuantitasnya menggunakan spektrofotometer, hasil yang diperoleh berupa serapan panjang gelombang pada

A260, A280, A320 dan konsentrasi DNA yang tersedia pada Tabel 4 berikut ini.

Tabel 4. Hasil analisis uji kuantitas Konsentrasi No Sample A[260] A[280] Bg[320] Ratio (ng/ul) Blanko 0.0008 0.0003 -0.0001 2.1 1 Isolat 001 MJIR 0.0385 0.0302 0.0196 1.7 90 2 Isolat 001 SCK 0.0338 0.0204 0.0042 1.8 80 3 Isolat 004 PTPN 3 0.0455 0.0255 0.0051 1.9 110 4 Isolat 005 MJIR 0.0198 0.0135 0.0066 1.9 45 5 Isolat 006 PTPN 3 0.0411 0.0222 0.0031 1.99 100 6 Isolat 10 0.1308 0.0684 0.0013 1.92 325 7 Isolat 100 0.0227 0.0157 0.009 2.0 55 8 Isolat 105 0.0471 0.0269 0.007 2.0 115 9 Isolat 106 0.0137 0.0082 0.0032 2.1 30 10 Isolat 107 0.0193 0.0157 0.0115 1.8 45 11 Isolat 13 0.0245 0.0145 0.0041 1.9 55 12 Isolat 141 0.1345 0.0596 0.0068 2.4 330 13 Isolat 148 0.0539 0.0314 0.0059 1.8 130 14 Isolat 149 0.0543 0.0326 0.0097 1.9 130 15 Isolat 157 0.0302 0.0178 0.0036 1.8 70 16 Isolat 16 0.0172 0.0122 0.0068 1.9 40 17 Isolat 162 0.0219 0.0141 0.006 1.9 50 18 Isolat 164 0.025 0.0158 0.0066 1.9 60 19 Isolat 165 0.0199 0.0131 0.0066 2.0 45 20 Isolat 174 0.0178 0.0131 0.0067 1.7 40 21 Isolat 178 0.0172 0.0126 0.007 1.8 40 22 Isolat 180 0.0459 0.0248 0.0045 2.0 110 23 Isolat 182 0.0287 0.0196 0.0086 1.8 70 24 Isolat 183 0.0284 0.0201 0.0108 1.8 65 25 Isolat 185 0.0381 0.0216 0.004 1.9 90 26 Isolat 186 0.0332 0.0205 0.0058 1.8 80 27 Isolat 187 0.0162 0.01 0.0031 1.8 35 28 Isolat 189 0.0676 0.0384 0.0092 2.0 165 29 Isolat 192 0.0501 0.0385 0.0239 1.7 120 30

30 Isolat 195 0.0361 0.0263 0.0146 1.8 85 31 Isolat 197 0.0258 0.0157 0.0056 1.9 60 32 Isolat 199 0.0311 0.0179 0.0033 1.9 75 33 Isolat 202 0.1049 0.0547 0.0036 1.9 260 34 Isolat 21 0.0562 0.0332 0.0074 1.8 135 35 Isolat 22 0.0331 0.0207 0.0069 1.8 80 36 Isolat 23 0.0223 0.0163 0.0085 1.7 50 37 Isolat 24 0.0628 0.035 0.0027 1.8 155 38 Isolat 25 0.0509 0.0283 0.0041 1.9 125 39 Isolat 28 0.0469 0.0258 0.0065 2.0 115 40 Isolat 29 0.0114 0.0081 0.0043 1.8 25 41 Isolat 30 0.0243 0.0136 0.0028 1.9 55 42 Isolat 31 0.0622 0.0348 0.0077 2.0 150 43 Isolat 37 0.0555 0.0337 0.0111 1.9 135 44 Isolat 39 0.0515 0.031 0.0084 1.9 125 45 Isolat 45 0.0183 0.0118 0.0049 1.9 40 46 Isolat 5 0.0237 0.0149 0.0041 1.8 55 47 Isolat 50 0.0748 0.0414 0.0067 1.9 185 48 Isolat 52 0.0412 0.0251 0.006 1.8 100 49 Isolat 53 0.0472 0.0283 0.0103 2.0 115 50 Isolat 56 0.0262 0.0144 0.0079 2.7 60 51 Isolat 57 0.0324 0.0226 0.0128 1.9 75 52 Isolat 65 0.0054 0.0032 0.0004 1.7 10 53 Isolat 7 0.0325 0.0214 0.0078 1.8 75 54 Isolat 70 0.077 0.0432 0.008 1.9 190 55 Isolat 73 0.0098 0.0075 0.0059 2.4 20 56 Isolat 74 0.0227 0.0144 0.0053 1.9 55 57 Isolat 8 0.0337 0.019 0.0038 1.9 80 58 Isolat 84 0.0398 0.0252 0.0075 1.8 95 59 Isolat 88 0.0343 0.0205 0.0051 1.8 80 60 Isolat 89 0.0371 0.0222 0.0071 1.9 90 61 Isolat 9 0.0436 0.0264 0.0069 1.8 105 62 Isolat 90 0.0328 0.0186 0.0041 1.9 80 63 Isolat 91 0.0414 0.0264 0.0085 1.8 100 64 Isolat 92 0.0267 0.0138 0.0003 1.9 65 65 Isolat 95 0.0163 0.0121 0.007 1.8 35 66 Isolat 98 0.0376 0.0211 0.0054 2.0 90 67 Isolat CS 1 0.0391 0.0242 0.0085 1.9 95 68 Isolat CS 7 0.0259 0.0153 0.0038 1.9 60 69 Isolat J 0.0281 0.0153 0.0037 2.1 65 70 Isolat NJ 2 0.0175 0.0118 0.005 1.8 40 71 Isolat NJ 51 0.0292 0.0193 0.0086 1.9 70 72 Isolat NJ 55 0.0492 0.0288 0.0082 1.9 120 73 Isolat NJ 56 0.0567 0.0335 0.0074 1.8 140

74 Isolat NJ 57 0.0355 0.0205 0.0061 2.0 85 75 Isolat NJ 58 0.1083 0.0575 0.0023 1.9 265 76 Isolat NJ 66 0.0636 0.0383 0.0097 1.8 155 77 Isolat NJ 70 0.0271 0.0169 0.0048 1.8 65 78 Isolat NJ 72 0.0349 0.0187 0.0022 1.9 85 79 Isolat NJ 85 0.021 0.0128 0.005 2.0 50 80 Isolat NJ 90 0.0898 0.0475 0.0012 1.9 220 81 Isolat NJ 95 0.0554 0.033 0.0098 1.9 135 82 Isolat NJ 96 0.1223 0.0662 0.0085 1.9 300 83 Isolat NJ 97 0.0279 0.017 0.005 1.9 65 84 Isolat NJ 99 0.0711 0.0394 0.0043 1.9 175 85 Isolat Paya Pinang 0.0471 0.0253 0.0041 2.0 115 86 I15 0.0175 0.0118 -0.0149 1.21 44 87 I27 0.0617 0.0436 0.0041 1.46 154 88 I32 0.0689 0.0423 -0.0043 1.57 172 89 I34 0.0432 0.0286 -0.0048 1.44 108 90 I35 0.0591 0.0431 -0.0046 1.34 148 91 I43 0.0549 0.0353 -0.0046 1.49 137 92 I49 0.0386 0.0278 -0.003 1.35 97 93 I54 0.0352 0.0275 -0.0008 1.27 88 94 I58 0.0255 0.0203 -0.0038 1.22 64 95 I60 2.4417 2.3684 2.2284 1.52 6104 96 I62 2.4491 2.3655 2.2189 1.57 6123 97 I63 0.3062 0.278 0.2392 1.73 766 98 I71 0.2834 0.2629 0.2336 1.70 709 99 I75 0.0789 0.0641 0.0343 1.50 197 100 I78 0.1843 0.1647 0.1364 1.69 461 101 I87 0.5212 0.4917 0.4476 1.67 1303 102 I94 0.0999 0.0592 0.0021 1.71 250 103 I99 0.0682 0.0436 0.0018 1.59 171 104 I108 0.4231 0.404 0.3723 1.60 1058 105 I117 0.1007 0.08 0.0469 1.62 252 106 I129 0.3237 0.2971 0.2551 1.63 809 107 I142 1.7771 1.7141 1.6107 1.61 4443 108 I145 0.03 0.0202 -0.011 1.31 75 109 I146 3.1241 3.0886 2.8822 1.17 7810 110 I147 0.3922 0.3676 0.3358 1.77 981 111 I179 0.4308 0.387 0.3363 1.86 1077 112 I172 0.415 0.3768 0.3345 1.90 1038 113 I166 0.4611 0.4044 0.3357 1.82 1153 114 I161 0.4199 0.3827 0.3429 1.94 1050 115 I158 0.4145 0.38 0.3348 1.76 1036 116 I155 0.3765 0.358 0.3339 1.77 941 117 I150 0.3899 0.3679 0.3353 1.67 975

118 I188 0.4193 0.3815 0.3342 1.80 1048 119 I191 0.3873 0.3625 0.3351 1.90 968 120 I194 0.3915 0.3706 0.334 1.57 979 121 I196 0.4019 0.3724 0.3335 1.76 1005 122 I198 0.3919 0.3653 0.3349 1.88 980 123 NJ 0.372 0.3522 0.3264 1.77 930 124 I88 0.3696 0.3482 0.3237 1.87 924 125 I75 0.371 0.3532 0.3207 1.55 928 126 NJ73 0.4207 0.3728 0.319 1.89 1052 127 I68 0.3825 0.3567 0.3215 1.73 956 128 NJ89 0.3748 0.3494 0.3208 1.89 937 129 NJ54 0.3915 0.3612 0.3215 1.77 979 130 NJ3 0.3725 0.3473 0.3204 1.94 931 131 002MJIR 0.398 0.3607 0.3197 1.91 995 132 006MJIR 0.4436 0.3864 0.3218 1.88 1109 133 001PTPN.3 0.4037 0.3655 0.3207 1.85 1009 134 I190 0.3797 0.3594 0.3261 1.61 949 135 NJ72 0.3728 0.3462 0.3187 1.97 932 136 I184 0.3861 0.356 0.3215 1.87 965 137 PT.NS 0.3682 0.3469 0.3183 1.75 921 138 I41 0.3842 0.3568 0.3183 1.72 961

Berdasarkan uji kuantitas ini dapat diketahui konsentrasi masing-masing isolat sebagai penentu banyaknya DNA yang berhasil diekstrak dari proses isolasi

DNA dan rasio panjang gelombang serapan DNA maupun protein. Konsentrasi tertinggi dimiliki oleh isolat 141 sebesar 350 ng/ul dan konsentrasi terendah dimiliki oleh isolat 29 dengan konsentrasi sebesar 10 ng/ul. Ratio serapan panjang gelombang juga menentukan kuantitas DNA yang dihasilkan. Rasio A260/A280 yang diinginkan berkisar 1,8-2,0 , namun terdapat beberapa isolat yang memiliki rasio

A260/A280 > 2,0 adalah isolat : 106, 141, 56, 73 dan isolat J sementara isolat yang memiliki A260/A280 < 1,8 adalah isolat : 001MJIR, 74, 192, 23 dan isolat 65.

Uji Kualitas DNA

Uji kualitas DNA dilakukan untuk melihat baik tidaknya performa DNA atau kualitas DNA saat elektroforesis. Hasil uji kualitas dapat dilihat pada Gambar

5 berikut ini.

Gambar 5. Hasil Uji Kualitas DNA

Analisis Molekuler

Amplifikasi PCR dengan primer KT 124397

Isolat Ganoderma sebanyak 138 isolat diamplifikasi dengan marka SSR

menggunakan 6 primer spesifik. Hasil amplifikasi dapat ditunjukkan pada Gambar

berikut ini.

M I5 I7 I8 I9 I10 I13 I15 I16 I21 I22 I23 I24 I25 I27 I28 I29

500 bp

400 bp 350 bp 300 bp 250 bp 200 bp Gambar 6. Pola pita isolat Ganoderma I5-I29 dengan marka SSR menggunakan primer KT 124397

Berdasarkan Gambar 6 pola pita menunjukkan bahwa isolat I5 dan I7 tidak

teramplifikasi, sementara ukuran fragmen basa pita yang teramplifikasi berkisar

antara 417 bp (I22, I24) - 444 bp (I8).

M I30 I31 I32 I34 I35 I37 I39 I43 I45 I49 I50 I52 I53 I54 I56 I57

400 bp 350 bp 300 bp 250 bp 200 bp 150 bp

Gambar 7. Pola pita isolat Ganoderma I30-I57 dengan marka SSR menggunakan primer KT 124397

Berdasarkan Gambar 7, pola pita menunjukkan bahwa isolat I45 tidak teramplifikasi, sementara ukuran fragmen basa pita yang teramplifikasi berkisar antara 327 bp (I52) – 379 bp (I39).

M I58 I60 I62 I63 I65 I70 I71 I73 I74 I75 I78 I84 I87 I88 I89 I90

300 bp 250 bp 200 bp 150 bp

100 bp

Gambar 8 . Pola pita isolat Ganoderma I58-90 dengan marka SSR menggunakan primer KT 124397

Berdasarkan Gambar 8 pola pita menunjukkan bahwa isolat I63 tidak teramplifikasi, sementara ukuran fragmen basa pita yang teramplifikasi berkisar antara 277 bp (I84) – 305 bp (I71, 173).

M I91 I92 I94 I95 I98 I99 I100 I105 I106 I107 I108 I117 I129 I141 I145 I146

400 bp 350 bp 300 bp 250 bp 200 bp

150 bp

Gambar 9. Pola pita isolat Ganoderma I91-I146 dengan marka SSR menggunakan primer KT 124397

Berdasarkan Gambar 9 pola pita menunjukkan bahwa isolat I141 dan I145

tidak teramplifikasi, sementara ukuran fragmen basa pita yang teramplifikasi

bekisar antara 348 bp (I95) – 409 bp (I107).

M I147 I148 I149 I150 I155 I157 I158 I161 I162 I164 I165 I166 I172 I174 I178 I179

350 bp 300 bp 250 bp 200 bp 150 bp 100 bp

50 bp

Gambar 10. Pola pita isolat Ganoderma I147-I179 dengan marka SSR menggunakan primer KT 124397

Berdasarkan Gambar 10 pola pita menunjukkan bahwa isolat I147 tidak

teramplifikasi, sementara ukuran fragmen basa pita yang teramplifikasi berkisar

antara 286 bp (I179) – 359 bp (I155).

M I180 I182 I183 I185 I186 I187 I188 I189 I190 I191 I192 I194 I195 I196 I197 I198

350 bp 300 bp 250 bp 200 bp 150 bp 100 bp

50 bp

Gambar 11. Pola pita isolat Ganoderma I180-I198 dengan marka SSR menggunakan primer KT 124397

Berdasarkan Gambar 11 pola pita menunjukkan bahwa isolat I187 tidak

teramplifikasi, sementara ukuran fragmen basa pita yang teramplifikasi berkisar

antara 279 bp (I185) – 313 bp (I191, I194).

M I199 I202 J NJ NJ2 NJ3 NJ NJNJ NJ NJ NJ NJ NJ NJ NJ NJ 51 5454 55 56 57 58 66 68 70 73

350 bp 300 bp 250 bp 200 bp 150 bp 100 bp

Gambar 12 . Pola pita isolat Ganoderma I199-NJ73 dengan marka SSR menggunakan primer KT 124397

Berdasarkan Gambar 12 pola pita menunjukkan bahwa isolat NJ3 dan

NJ68 tidak teramplifikasi, sementara ukuran fragmen basa pita yang

teramplifikasi berkisar antara 305 bp (NJ5) – 337 bp (I199, NJ51, NJ58)

M NJ NJ NJ NJ NJ NJ NJ NJ NJ NJ 001 M NJ NJ NJ NJ NJ NJ NJ NJ NJ NJ 001 006 001 001 002 005 75 85 88 96 MJIR SCK PTPN3 MJIR MJIR 89 90 95 97 99 104 MJIR 75 85 88 89 90 95 96 97 99 104 MJIR

350 bp 300 bp

200 bp 150 bp 100 bp

Gambar 13. Pola pita isolat Ganoderma NJ75-005MJIR dengan marka SSR menggunakan primer KT 124397

30200 bp 10250 bp 35150 bp

Berdasarkan Gambar 13 pola pita menunjukkan bahwa isolat teramplifikasi, ukuran fragmen basa pita yang teramplifikasi berkisar antara 290 bp (001PTP3) – 350 bp (001MJIR).

M 004 006 CS1 CS7 PTPP I142 I41 I184 NJ72 PTNS PTPN3 PTPN3

300 bp 250 bp 200 bp 150 bp

Gambar 14. Pola pita isolat Ganoderma 004PTPN3-PTNS dengan marka SSR menggunakan primer KT 124397

Berdasarkan Gambar 14 pola pita menunjukkan bahwa isolat teramplifikasi, ukuran fragmen basa pita yang teramplifikasi berkisar antara 229 bp (NJ72) – 350 bp (PTPP).

Amplifikasi PCR dengan primer KT 124402

M I5 I7 I8 I9 I10 I13 I15 I16 I21 I22 I23 I24 I25 I27 I28 I29

450 bp 400 bp

350 bp 300 bp 250 bp 200 bp 150 bp Gambar 15. Pola pita isolat Ganoderma I5-I29 dengan marka SSR menggunakan KT 124402

Berdasarkan Gambar 15 pola pita menunjukkan bahwa isolat I5 dan I28 tidak teramplifikasi, ukuran fragmen basa pita yang teramplifikasi berkisar antara

270 bp (I29) – 438 bp (I7).

M I30 I31 I32 I34 I35 I37 I39 I43 I45 I49 I50 I52 I53 I54 I56 I57

450 bp

400 bp

350 bp 300 bp 250 bp

150 bp Gambar 16. Pola pita isolat Ganoderma I30-I57 dengan marka SSR menggunakan KT 124402

Berdasarkan Gambar 16 pola pita menunjukkan bahwa isolat I34, I45, I56 tidak teramplifikasi, ukuran fragmen basa pita yang teramplifikasi berkisar antara

246 bp (I150) – 430 bp (I157).

M I58 I60 I62 I63 I65 I70 I71 I73 I74 I75 I78 I84 I87 I88 I89 I90

350 bp 300 bp 250 bp

150 bp

Gambar 17 . Pola pita isolat Ganoderma I58-I90 dengan marka SSR menggunakan KT 124402

Berdasarkan Gambar 17 pola pita menunjukkan bahwa isolat teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

296 bp (I184) – 362 bp (I170).

M I91 I92 I94 I95 I98 I99 I100 I105 I106 I107 I108 I117 I129 I141 I145 I146

350 bp 300 bp

200 bp

100 bp

Gambar 18 . Pola pita isolat Ganoderma I91-I146 dengan marka SSR menggunakan KT 124402

Berdasarkan Gambar 18 pola pita menunjukkan bahwa isolat teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

249 bp (I107 – 346 bp (I91).

M I147 I148 I14I149 9 I150 I155 I157 I158 I161 I162 I164 I165 I166 I172 I174 I178 I179

500 bp

450 bp 400 bp 350 bp 300 bp 250 bp

Gambar 19 . Pola pita isolat Ganoderma I147-I179 dengan marka SSR menggunakan KT 124402

Berdasarkan Gambar 19 pola pita menunjukkan bahwa isolat teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

685 bp (I148. I158) – 746 bp (I147, I172).

M I180 I182 I183 I185 I186 I187 I188 I189 I19 I191 I192 I194 I195 I196 I197 I198 0

500 bp

450 bp 400 bp 350 bp 300 bp 250 bp

Gambar 20. Pola pita isolat Ganoderma I1801-I198 dengan marka SSR menggunakan KT 124402

Berdasarkan Gambar 20 pola pita menunjukkan bahwa isolat I187 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

339 bp (I198) – 958 bp (I196).

M I199 I202 J NJ NJ2 NJ3 NJ NJ NJ NJ NJ NJ NJ NJ NJ NJ 51 54 55 56 57 58 66 68 70 73

500 bp 450 bp 400 bp 350 bp 300 bp 250 bp 200 bp

Gambar 21. Pola pita isolat Ganoderma I1991-NJ73 dengan marka SSR menggunakan KT 124402

Berdasarkan Gambar 21 pola pita menunjukkan bahwa isolat NJ66 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

268 bp (NJ58) – 470 bp (I199).

Gambar 22. Pola pita isolat Ganoderma NJ75-005MJIR dengan marka SSR menggunakan KT 124402

Berdasarkan Gambar 22 pola pita menunjukkan bahwa isolat teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

300 bp 005MJIR) – 401 bp (NJ75).

M 004 006 CS1 CS7 PT I142 I41 I184 NJ72 PTNS PTPN3PTPN3 PTPN3 PP

500 bp 450 bp 400 bp 350 bp 300 bp 250 bp 200 bp Gambar 23. Pola pita isolat Ganoderma 004PTPN-PTNS dengan marka SSR menggunakan KT 124402

Berdasarkan Gambar 23 pola pita menunjukkan bahwa isolat

teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

252 bp (PTNS) – 389 bp (006PTPN3).

Amplifikasi PCR dengan Primer KT 124403

M I5 I7 I8 I9 I10 I13 I15 I16 I21 I22 I23 I24 I25 I27 I28 I29

500 bp 450 bp 400 bp 350 bp 300 bp 250 bp

200 bp

Gambar 24 . Pola pita isolat Ganoderma I5-I29 dengan marka SSR menggunakan primer KT 124403

Berdasarkan Gambar 24 pola pita menunjukkan bahwa isolat

teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

264 bp (I22) – 35447bp (I5).

Gambar 25. Pola pita isolat Ganoderma I30-I57 dengan marka SSR menggunakan primer KT 124403

Berdasarkan Gambar 25 pola pita menunjukkan bahwa isolat I45 tidak teramplifikasi sementara ukuran fragmen basa pita yang teramplifikasi berkisar antara 222 bp (I57) – 354 bp (I34).

Gambar 26. Pola pita isolat Ganoderma I58-I90 dengan marka SSR menggunakan primer KT 124403

Berdasarkan Gambar 26 pola pita menunjukkan bahwa isolat I65 tidak teramplifikasi sementara ukuran fragmen basa pita yang teramplifikasi berkisar antara 232 bp (I88) – 291 bp (I60).

Gambar 27. Pola pita isolat Ganoderma I91-I146 dengan marka SSR menggunakan primer KT 124403

Berdasarkan Gambar 27 pola pita menunjukkan bahwa isolat teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

213 bp (I146) – 297 bp (I92).

Gambar 28. Pola pita isolat Ganoderma I47-I179 dengan marka SSR menggunakan primer KT 124403

Berdasarkan Gambar 28 pola pita menunjukkan bahwa isolat teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

204 bp (I174) – 338 bp (I147).

Gambar 29. Pola pita isolat Ganoderma I180-I198 dengan marka SSR menggunakan primer KT 124403

Berdasarkan Gambar 29 pola pita menunjukkan bahwa isolat teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

276 bp (I197) – 434 bp (I180).

Gambar 30. Pola pita isolat Ganoderma I199-NJ73 dengan marka SSR menggunakan primer KT 124403

Berdasarkan Gambar 30 pola pita menunjukkan bahwa isolat teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

409 bp (NJ58) – 483 bp (NJ).

Gambar . Pola pita isolat Ganoderma NJ75-005MJIR dengan marka SSR menggunakan primer KT 124403

Gambar 31. Pola pita isolat Ganoderma NJ75-NJ73 dengan marka SSR menggunakan primer KT 124403

Berdasarkan Gambar 31 pola pita menunjukkan bahwa isolat teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

295 bp (001PTPN3) – 370 bp (NJ75).

Gambar 32. Pola pita isolat Ganoderma 004PTPN3-PTNS dengan marka SSR menggunakan primer KT 124403

Berdasarkan Gambar 32 pola pita menunjukkan bahwa isolat I42 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

442 bp (PTNS) – 578 bp (NJ72).

Amplifikasi PCR dengan primer KT 124399

Gambar 33. Pola pita isolat Ganoderma I5-I29 dengan marka SSR menggunakan primer KT 124399

Berdasarkan Gambar 33 pola pita menunjukkan bahwa isolat I5 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

309 bp (I29) – 361 bp (I8).

Gambar 34. Pola pita isolat Ganoderma I30-I57 dengan marka SSR menggunakan primer KT 124399

Berdasarkan Gambar 34 pola pita menunjukkan bahwa isolat I45 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

295 bp (I30) – 323 bp (I30).

Gambar 35. Pola pita isolat Ganoderma I58-I90 dengan marka SSR menggunakan primer KT 124399

Berdasarkan Gambar 35. pola pita menunjukkan bahwa isolat teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

241 bp (I84) – 314 bp (I62).

Gambar 36. Pola pita isolat Ganoderma I91-I146 dengan marka SSR menggunakan primer KT 124399

Berdasarkan Gambar 36 pola pita menunjukkan bahwa isolat teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

234 bp (I146) – 257 bp (I91,I92).

Gambar 37. Pola pita isolat Ganoderma I91-I146 dengan marka SSR menggunakan primer KT 124399

Berdasarkan Gambar 37 pola pita menunjukkan bahwa isolat I147, 149 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara 235 bp (I174) – 309 bp (I148).

Gambar 38. Pola pita isolat Ganoderma I180-I198 dengan marka SSR menggunakan primer KT 124399

Berdasarkan Gambar 38 pola pita menunjukkan bahwa isolat I187, 196 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara 205 bp (I198) – 265 bp (I183).

Gambar 39. Pola pita isolat Ganoderma I180-I198 dengan marka SSR menggunakan primer KT 124399

Berdasarkan Gambar 39 pola pita menunjukkan bahwa isolat NJ3 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

260 bp (J) – 200 bp (NJ70).

Gambar 40. Pola pita isolat Ganoderma NJ75-005MJIR8 dengan marka SSR menggunakan primer KT 124399

Berdasarkan Gambar 40 pola pita menunjukkan bahwa isolat 002MJIR tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara 256 bp (001SCK) – 324 bp (NJ85).

Gambar 41. Pola pita isolat Ganoderma 004PTPN3-PTNS dengan marka SSR menggunakan primer KT 124399

Berdasarkan Gambar 41 pola pita menunjukkan bahwa isolat I42 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

272 bp (NJ72) – 317 bp (004PTPN4).

Amplifikasi Isolat Ganoderma dengan primer KT 124400

Gambar 42. Pola pita isolat Ganoderma I5-I29 dengan marka SSR menggunakan primer KT 124400

Berdasarkan Gambar 42 pola pita menunjukkan bahwa isolat I5 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

482 bp (I13) – 482 bp (I24, I25).

Gambar 43. Pola pita isolat Ganoderma I30-I57 dengan marka SSR menggunakan primer KT 124400

Berdasarkan Gambar 43 pola pita menunjukkan bahwa isolat I34, I45 tidak teramplifikasi sementara ukuran fragmen basa pita yang teramplifikasi berkisar antara 291bp (I50) – 360 bp (I32).

Gambar 44. Pola pita isolat Ganoderma I58-I90 dengan marka SSR menggunakan primer KT 124400

Berdasarkan Gambar 44 pola pita menunjukkan bahwa isolat I58, I60, I65,

I73,I90 tidak teramplifikasi sementara ukuran fragmen basa pita yang teramplifikasi berkisar antara 251 bp (I88) – 338 bp (I62).

Gambar 45. Pola pita isolat Ganoderma I91-I146 dengan marka SSR menggunakan primer KT 124400

Berdasarkan Gambar 45 pola pita menunjukkan bahwa isolat I105,

I106,I107,I141,I145 tidak teramplifikasi sementara ukuran fragmen basa pita yang teramplifikasi berkisar antara 350 bp (I146) – 401 bp (I94).

Gambar 46. Pola pita isolat Ganoderma I147-I179 dengan marka SSR menggunakan primer KT 124400

Berdasarkan Gambar 46 pola pita menunjukkan bahwa isolat I147,I161,

I162 tidak teramplifikasi sementara ukuran fragmen basa pita yang teramplifikasi berkisar antara 321 bp (I179) – 395 bp (I157, I164).

Gambar 47. Pola pita isolat Ganoderma I180-I198 dengan marka SSR menggunakan primer KT 124400

Berdasarkan Gambar 47 pola pita menunjukkan bahwa isolat I187,I196 tidak teramplifikasi sementara ukuran fragmen basa pita yang teramplifikasi berkisar antara 401 bp (I195, I197) – 455 bp (I157, I183)

Gambar 48. Pola pita isolat Ganoderma I199-NJ73 dengan marka SSR menggunakan primer KT 124400

Berdasarkan Gambar 48 pola pita menunjukkan bahwa isolat teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

271bp (NJ66) – 363 bp (I199).

Gambar 49. Pola pita isolat Ganoderma NJ75-005MJIR dengan marka SSR menggunakan primer KT 124400

Berdasarkan Gambar 49 pola pita menunjukkan bahwa isolat NJ96, NJ99,

001MJIR, OO5MJIR tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara 301 bp (001PTPN3) – 381 bp (NJ85).

Gambar 50. Pola pita isolat Ganoderma 004PTPN3-PTNS dengan marka SSR menggunakan primer KT 124400

Berdasarkan Gambar 50 pola pita menunjukkan bahwa isolat I142 dan

PTNS tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara 315 bp (NJ72) – 400 bp (006PTPN3).

Amplifikasi Isolat Ganoderma dengan primer KT 124394

Gambar 51. Pola pita isolat Ganoderma M5-I29 dengan marka SSR menggunakan primer KT 124394

Berdasarkan Gambar 51 pola pita menunjukkan bahwa isolat I5,I16 dan

I24 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara 287 bp (I27) – 399 (I9).

Gambar 52. Pola pita isolat Ganoderma I30-I57 dengan marka SSR menggunakan primer KT 124394

Berdasarkan Gambar 52 pola pita menunjukkan bahwa isolat I45, I54 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara 338 bp (I56) – 391 bp(I35).

Gambar 53. Pola pita isolat Ganoderma I58-I90 dengan marka SSR menggunakan primer KT 124394

Berdasarkan Gambar 53 pola pita menunjukkan bahwa isolat I58, I62, I65,

I70,I71,I74, I78, I89 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara 270 bp (I90) – 339 bp (I60).

Gambar 54. Pola pita isolat Ganoderma I91-I146 dengan marka SSR menggunakan primer KT 124394

Berdasarkan Gambar 54 pola pita menunjukkan bahwa isolat I91, I95,

I98, I106, I108, I141, I145 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara 298 bp (II46) – 323 bp (I94).

Gambar 55. Pola pita isolat Ganoderma I147-I179 dengan marka SSR menggunakan primer KT 124394

Berdasarkan Gambar 55 pola pita menunjukkan bahwa isolat I47, I150,

I157, I164, I165, I174, I1785 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara 358 bp (II79) – 455 bp (I148).

Gambar 56. Pola pita isolat Ganoderma I180-I198 dengan marka SSR menggunakan primer KT 124394

Berdasarkan Gambar 56 pola pita menunjukkan bahwa isolat I182, I183,

I186, I187, I119, I194, I196 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara 270 bp (I198) – 341 bp (I185).

Gambar 57. Pola pita isolat Ganoderma I199-I198 dengan marka SSR menggunakan primer KT 124394

Berdasarkan Gambar 57 pola pita menunjukkan bahwa isolat I199 tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

332 bp (NJ57) – 405 bp (NJ).

Gambar 58. Pola pita isolat Ganoderma NJ75-005MJIR dengan marka SSR menggunakan primer KT 124394

Berdasarkan Gambar 58 pola pita menunjukkan bahwa isolat teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara

340 bp (001PTPN3) – 388 bp (NJ85).

Gambar 59. Pola pita isolat Ganoderma 004PTPN3-PTNS dengan marka SSR menggunakan primer KT 124394

Berdasarkan Gambar 59 pola pita menunjukkan bahwa isolat I142, I184 dan PTNS tidak teramplifikasi dan ukuran fragmen basa pita yang teramplifikasi berkisar antara 384 bp (nj72) – 779 bp (004PTPN3).

Analisis Sekuen DNA

Uji Statistik dan Migrasi Alel

Analisis molekuler isolat Ganoderma spp. menggunakan 6 primer SSR menghasilkan beberapa data yang beragam untuk uji statistik dan total migrasi alel pada setiap lokus.

Tabel 5. Uji statistik dan total migrasi alel semua populasi pada setiap lokus Locus Fis Fit Fst Nm PIC KT124397 0.801 0.862 0.305 0.571 0.560 KT124402 1.000 1.000 0.436 0.323 0.921 KT124403 0.781 0.849 0.310 0.556 0.530 KT124400 1.000 1.000 0.421 0.343 0.150 KT124399 0.758 0.849 0.377 0.413 1.000 KT124394 0.713 0.826 0.396 0.381 0.760 Mean 0.842 0.898 0.374 0.431 0.650 SE 0.051 0.033 0.023 0.044 0.120 Keterangan : Fis=allele frequency correlations between individuals in the subpopulation, Fst= allele frequency correlations between subpopulation, Fit=allele frequency in the population caused by both factors above, Nm=the total of migran, PIC=Polimorfic Information Conten.

Berdasarkan Tabel 5, dapat diketahui bahwa nilai Fis, Fit dan Fst tertinggi terdapat pada lokus KT124402 dan 124400. Total migrasi alel tertinggi terdapat pada lokus KT124397. Nilai PIC yang diperoleh dari keenam lokus berkisar antara 0,150-1,00.

Profil Lokus Mikrosatelit

Keragaman genetik populasi Ganoderma spp. dengan 6 marka SSR dapat diketahui melalui parameter profil lokus mikrosatelit meliputi jumlah alel, jumlah alel pengamatan, jumlah alel efektif, indeks informasi Shannon, heterozigosistas

pengamatan dan heterozigositas harapan dan indeks fiksasi. Beberapa parameter keragaman genetik tersebut dapat dilihat pada Tabel 3.

Tabel 6. Profil lokus mikrosatelit pada semua populasi isolat Ganoderma spp. Population N Na Ne I Ho He U (He) F FBSR-CN 2.500 3.167 2.933 1.108 0.306 0.655 0.828 0.523 FBSR-BF 2.833 3.000 2.844 1.050 0.139 0.632 0.772 0.790 FBSR-EG 51.333 30.833 21.571 3.236 0.033 0.950 0.959 0.965 FUSR-EG 20.000 16.333 12.820 2.659 0.025 0.915 0.938 0.973 FBSR-HB 3.000 2.333 2.233 0.694 0.278 0.417 0.500 0.385 FRWB-HB 3.000 3.500 3.067 1.055 0.500 0.565 0.678 0.193 TUSR-EG 17.000 12.333 10.182 2.372 0.000 0.885 0.911 1.000 TBSR-EG 11.000 9.000 8.201 2.130 0.000 0.871 0.912 1.000 SBSR-EG 3.000 1.667 1.533 0.424 0.000 0.296 0.356 1.000 FB-EG 5.000 4.000 3.615 1.297 0.000 0.693 0.770 1.000 T-EG 3.000 1.000 1.000 0.000 0.000 0.000 0.000 1.033 FBD-EG 3.000 1.000 1.000 0.000 0.000 0.000 0.000 0.500 RFBS-EG 21.000 17.167 15.261 2.779 0.000 0.933 0.955 0.885 Mean 11.205 8.103 6.636 1.446 0.098 0.601 0.660 0.820 SE 1.529 0.994 0.758 0.123 0.026 0.040 0.042 0.041 Keterangan : Jumlah alel per lokus (N), Rata-rata jumlah alel pengamatan (Na), Jumlah alel efektif (Ne) and Shannon of information Index (I). Heterozigositas amatan (Ho), Heterozigositas harapan (He), Unbiased Expected Heterozygosity (uHe), Index Fiksasi (F). FBSR-CN (Fruit Body Basal Stem Rot-Cocos nucifera), FBSR-BF (Fruit Body Basal Stem Rot-Borassus flabellifer), FBSR-EG (Fruit Body Basal Stem Rot-Elaeis guineensis), FUSR-EG (Fruit Body Upper Stem Rot- Elaesis Guineensis), FBSR-HB (Basal Stem Rot-Hevea Brasiliensis), FRWB-HB (Fruit Body Rubber Wood Block-Hevea Brasiliensis), TUSR-EG (Tissue Upper Stem Rot-Elaeis guineensis), TBSR-EG (Tissue Basal Stem Rot-Elaeis guineensis), SBSR-EG (Spore Basal Stem Rot-Elaeis guineensis), FB-EG (Fruit Body-Elaeis guineensis), T-EG (Tissue-Elaeis guineensis), FBD-EG (Fruit Body Died-Elaeis guineensis), (Re-Isolation Fruit Body Seedling-Elaeis guineensis).

Berdasarkan Tabel 6, dketahui bahwa populasi Ganoderma spp. memiliki rataan jumlah alel efektif (Ne) yaitu 6,636 yang lebih rendah dibandingkan rataan jumlah alel pengamatan (Na) yaitu 8,103. Rataan nilai heterozigositas pengamatan

(Ho) yaitu 0,098 lebih rendah dari rataan nilai heterozigositas harapan yaitu 0,601.

Analisis Varian Molekuler

Analisis varian molekuler untuk melihat variasi antar populasi, variasi antar individu dan variasi didalam individu pada isolat Ganoderma dari

B.flabellifer, E. guineensis, dan H. brasiliensis

Tabel 7. AMOVA populasi isolat Ganoderma

Source df SS MS Est. Var. % var Among populations 12 122.51 10.21 0.24 8 Among individuals 134 724.88 5.41 2.65 88 Within individuals 147 16.50 0.12 0.11 4 Total 293 863.89 3.00 100 Keterangan : df = degree freedom; SS = Source of Variation ; MS = Mean Square; Est Var = Estimation of Variant ; Var = Variant

Struktur genetik dapat ditentukan berdasarkan hasil analisis varian molekuler. Berdasarkan AMOVA dapat dilihat bahwa sumber keragaman tertinggi terdapat diantara individu (724,88) dan terendah didalam individu (16,5).

Uji BLASTX

Uji Blast dilakukan untuk membandingkan urutan informasi genetik isolat

Ganoderma spp. yang diamati dan urutan DNA dari database.

Tabel 8. Hasil analisis sequencing dengan BLASTX Identity Total E- Isolates Description/Accession (%) Score value

1. 006PTN3 Ganoderma boninense strain NJ3 95 287 5e-75 microsatellite 17b sequence/KT124394.1

2. I5 Ganoderma boninense strain NJ3 89 228 3e-57 microsatellite 17b sequence/KT124394.1

3. J Ganoderma boninense strain NJ3 99 327 3e-87 microsatellite 17b sequence/KT124394.1

4. CS7 Ganoderma boninense strain NJ3 99 326 1e-86 microsatellite 17b sequence/KT124394.1

5. I202 Ganoderma boninense strain NJ3 98 326 1e-86 microsatellite 17b sequence/KT124394.1

6. Paya Pinang Ganoderma boninense strain NJ3 99 333 7e-89 microsatellite 17b sequence/KT124394.1

7. Isolat 192 Ganoderma boninense strain NJ3 99 327 3e-87 microsatellite 17b sequence/KT124394.1

8. NJ72 Ganoderma boninense strain NJ3 99 333 7e-89 microsatellite 17b sequence/KT124394.1

9. CS1 Ganoderma boninense strain NJ3 96 300 7e-79 microsatellite 17b sequence/KT124394.1

10. I191 Ganoderma boninense strain NJ3 98 316 7e-84 microsatellite 17b sequence/KT124394.1

11. NJ3 Ganoderma boninense strain NJ3 94 285 2e-74 microsatellite 17b sequence/KT124394.1

12. 001MJIR Ganoderma boninense strain NJ3 98 327 3e-87 microsatellite 17b sequence/KT124394.1

13. NJ54 Ganoderma boninense strain NJ3 microsatellite 17b sequence/KT124394.1 99 327 3e-87

Berdasarkan hasil uji blastx, dapat diketahui bahwa semua isolat memiliki

kemiripan dengan Ganoderma boninense strain NJ3 yang diuji dengan marka

KT124394. . Koefisien kesamaan urutan DNA 13 isolat Ganoderma spp. dapat

dilihat pada Tabel 8 sebagai berikut.

Tabel 9. Koefisien Kesamaan Urutan DNA antara Isolat Isolates 1 2 3 4 5 6 7 8 9 10 11 12 13 1. 006PTN3 100

2. I5 90 100

3. J 93 90 100

4. CS57 93 92 94 100

5. I202 90 90 96 94 100

6. Paya Pinang 93 92 96 96 95 100

7. Isolat 192 93 92 97 97 95 97 100

8. NJ72 91 89 96 97 95 98 95 100

9. CS1 93 92 94 94 93 95 96 94 100

10. Isolat 191 90 92 95 96 94 96 98 95 96 100

11. NJ3 90 90 95 93 93 94 94 93 93 93 100

12. 001MJIR 92 90 98 96 94 96 98 98 96 98 94 100

13. NJ54 92 91 96 97 94 96 95 97 95 97 93 98 100

Berdasarkan Tabel 9, dapat diketahui bahwa seluruh isolat memiliki jarak

genetik yang sangat dekat dengan koefisien kesamaan urutan DNA berkisar antara

90-100. Dengan demikian dapat dikatakan bahwa 13 isolat Ganoderma spp. yang

diamati memiliki kemiripan yang tinggi.

Analisis Filogenetik Isolat G.boninense

Analisis filogenetik dilakukan pada 13 populasi dari isolat Ganoderma.

Hasil analisis filogenetik isolat Ganoderma spp. digambarkan melalui pohon filogenetik yang dapat dilihat pada Gambar 60.

Gambar 60. Pohon filogenetik isolat Ganoderma dengan metode Euclidean pada 13 populasi isolat Ganoderma spp.

Berdasarkan Gambar 60, dapat dilihat bahwa isolat Ganoderma spp. terbagi menjadi 2 kelompok besar dan terbagi menjadi 4 sub kelompok. Sub- kelompok pertama terdiri atas 9 isolat, kelompok kedua terdiri dari 2 isolat, kelompok ketiga terdiri dari 1 isolat dan kelompok 4 terdiri atas 1 isolat.

Pembahasan

Amplifikasi PCR

Hasil amplifikasi 138 isolat Ganoderma pada primer KT124397 menunjukkan bahwa terdapat 11 isolat yang tidak teramplifikasi sehingga tidak memunculkan pita pada ekpresinya yaitu pada isolat I5, I7, I45, I65, I141, I145,

I147, I187, I196, NJ3 dan NJ68 sementara ukuran fragmen basa secara keseluruhan berkisar antara 229 bp – 444 bp.

Pada hasil amplifikasi isolat Ganoderma menggunakan primer KT124402 maka terdapat isolat yang tidak teramplifikasi yaitu isolat I5, I28, I34, I45, I56,

I187, NJ66 sementara ukuran fragmen basa yang terbentuk berkisar antara 246 bp

– 958 bp.

Berdasarkan hasil amplifikasi isolat Ganoderma menggunakan primer

KT124403 terdapat 4 isolat yang tidak teramplifikasi diantaranya adalah isolat :

I45, I65, NJ66 dan I142 sementara untuk ukuran fragmen basa pada sampel yang teramplifikasi berkisar antara 204 bp – 578 bp.

Hasil amplifikasi isolat Ganoderma menggunakan primer KT124400 menunjukkan bahwa terdapat 12 isolat tidak teramplifikasi dengan primer spesifik ini diantaranya adalah isolat : I5, I45 , I141, I142, I147, I149, I187, I196, NJ3,

002MJIR, I142 dan PTNS dan ukuran fragmen basa keseluruhan berkisar antara

200 bp-361 bp.

Hasil amplifikasi isolat Ganoderma menggunakan primer KT1244399 menunjukkan bahwa terdapat 24 isolat tidak teramplifikasi dengan primer spesifik ini diantaranya adalah isolat : I5, I34, I45 , I58, I60, I65, I73, I90, I105, I106,

I107, I141, I145, I147,I161, I162, I187,I196, , NJ96, NJ990, 005MJIR, 001MJIR, 68

I142, dan PTNS dan ukuran fragmen basa keseluruhan berkisar antara 251 bp-540 bp.

Hasil amplifikasi isolat Ganoderma menggunakan primer KT124394 terdapat isolat yang tidak teramplifikasi diantaranya adalah isolat : I5, I16, I24 ,

I45, I54, I58, I62, I65, I70, I71, I74, I78, I89, I91, I95, I98, I1O06, II47, I150,

I157, I164, I165, I182, I183, I186, I187, I189, I194, I196, I199, , I141, I142, I184,

PTNS sementara untuk ukuran fragmen basa pada sampel yang teramplifikasi berkisar antara 270 bp – 779 bp.

Berdasarkan dari ke-6 primer spesifik yang digunakan maka isolat Tubuh

Buah Basal Stem Root Karet ( I145) diduga memiliki potensi sebagai G.boninense sebesar 50% karena dari 6 primer yang digunakan hanya 3 primer yang menampilkan isolat ini sebagai G.boninense yaitu primer KT124402, KT124400 dan primer KT124394.

Berdasarkan dari ke-6 primer spesifik yang digunakan maka isolat Tubuh

Buah Basal Stem Root Kelapa Nyiur (I141) diduga memiliki potensi sebagai

G.boninense sebesar 33% karena dari 6 primer yang digunakan hanya 2 primer yang menampilkan isolat ini sebagai G.boninense yaitu primer KT124402,

KT124403.

Berdasarkan dari ke-6 primer spesifik yang digunakan maka isolat Tubuh

Buah Basal Stem Rot Lontar (I194) diduga memiliki potensi sebagai G.boninense sebesar 83% karena dari 6 primer yang digunakan sebanyak 5 primer yang menampilkan isolat ini sebagai G.boninense yaitu primer KT124397, KT124402,

KT124403, KT124400, KT124399. 69

Hasil amplifikasi 138 isolat Ganoderma spp. yang digunakan dalam penelitian ini dengan 6 marka spesifik menunjukkan bahwa isolat I145 (tubuh buah basal stem rot karet) dan I141 (tubuh buah basal stem rot kelapa nyiur) di duga memiliki kemiripan dengan G. boninense yang ditunjukkan dengan teramplifikasinya kedua isolat tersebut pada beberapa primer. Penelitian Elliot et al. (2004), menyatakan bahwa tidak jarang ditemukan satu patogen yang mampu menyerang tanaman kelapa dan kelapa sawit seperti nematoda red ring, cdang- cadang viroid, dan jamur Ganoderma yang berasosiasi dengan basal stem rot.

Analisis Sekuens DNA

Adanya perbedaan hasil amplifikasi isolat Ganoderma dengan hasil sekuenssing, sebagai contoh I5 pada primer-primer spesifik tidak teramplifikasi namun pada sekuenssing dihasilkan band. Hal ini disebabkan karena adanya perbedaan alat, lokasi, prosedur untuk menganalisa antara Laboratorium PT

Genetika Science Indonesia dengan Laboratorium Molekuler PT Socfin

Indonesia.

Primer spesifik KT 124397, KT124402, KT124403, KT124400,

KT124399 dan KT124394 mampu mengampilfikasi 13 populasi isolat yang diujikan. Rataan frekuensi alel adalah kolaborasi antara alel individu yang ditunjukkan dengan nilai Fis 0.842. Rataan frekuensi seluruh populasi isolat berbeda dalam alel diidentifikasi dengan nilai Fit 0.898. Nilai frekuensi alel dalam populasi (Fit) dipengaruhi dari nilai rataan Fis dan nilai rataan Fst. Rataan Fst menunjukkan nilai sebesar 0,374.

Nilai PIC (polimorphic information content) dari marka lokus mikrosatelit yang digunakan terdapat 5 marka yang tergolong sangat informatif yaitu 70

KT124397, KT124402, KT124403, KT124399, KT124394 sementara marka lokus KT124400 tergolong marka yang tidak informatif. Penentuan ini sesuai dengan klasifikasi oleh Botstein (1980) yang menyatakan bahwa nilai PIC > 5 sebagai sangat informatif, 0,25 > PIC >0,5 sebagai moderat informatif dan PIC >

0,25 sebagai kurang informatif. Marka yang paling informatif adalah marka

KT124399 karena memiliki nilai PIC tertinggi sebesar 1,0. Nilai PIC rata-rata 6 marka yang digunakan adalah sebesar 0,650 merupakan nilai yang lebih besar jika dibandingkan dengan penelitian Merciere (2015) yang memiliki nilai PIC rata-rata sebesar 0,604. Namun pada penelitiannya juga disebutkan bahwa marka

KT124399 adalah marka yang paling informatif diantara 17 marka yang digunakan dengan nilai PIC sebesar 0,79.

Nm menunjukkan total migrasi alel pada semua populasi yang diuji dengan nilai tertinggi 0,571 dan nilai terendah sebesar 0,33 sehingga rataannya menjadi 0,044 dapat dinyatakan bahwa aliran gen (gene flow) pada populasi ini rendah. Bila dibandingkan dengan temuan Midot et al, (2019) bahwa pada populasi Ganoderma yang diuji memiliki nilai migrasi alel (Nm > 4) menunjukkan populasi ini memiliki aliran gen yang tinggi dan diindikasikan populasi tersebut memiliki unit pankreas, lebih jelasnya dinyatakan bahwa populasi ini berasal dari G.boninense yang berhasil bertahan hidup yang mampu menginfeksi dan menyesuaikan diri pada pertanaman kelapa sawit. Purwiastuti et al. (2016) dalam penelitiannya menyatakan bahwa dalam tegakan cendana yang dianalisa cenderung tidak terjadi aliran gen yang secara signifikan mengindikasikan perbedaan genetik antar tegakan rendah. 71

Jumlah alel per lokus (N), rata-rata (Na), jumlah alel efektif (Ne) pada isolat Ganoderma Fruit Body Basal Stem Rot antara tanaman Cocos nucifera,

Borassus flabellifer, Elaesis guineensis paling tinggi ditemukan pada Elaesis

Guineensis dan nilai heterozigositas amatan (Ho) lebih rendah dibandingkan dengan nilai heterozigositas harapan (He) pada semua populasi isolat Ganoderma.

Menurut Arifiin (2010) nilai heterozigositas adalah salah satu parameter yang dapat digunakan untuk mengetahui tingkat keragaman genetik. Apabila nilai heterozigositas mendekati 1 maka nilai heterozigositas dinyatakan tinggi sementara jika nilai heterozigositas mendekati 0 dinyatakan rendah. Semakin tinggi frekuensi heterozigot dalam populasi maka tingkat keragamannya semakin tinggi. Dapat dikatakan bahwa populasi Ganoderma pada penelitian ini memiliki tingkat keragaman genetik yang rendah karena nilai rataan heterozigositas amatan

0,098 ( mendekati 0).

Ukuran yang lebih tepat untuk mengetahui keragaman gen dalam populasi adalah rataan heterozigositas dugaan. Pada penelitian ini, rataan nilai heterozigositas dugaan adalah 0,6 (berada pada rentang 0,3 -0,95). Salah satu faktor yang mempengaruhi dendogram adalah level heterozigositas. Pada beberapa organisme dengan rataan heterozigositas lebih tinggi dari 0,1 menunjukkan dendogram yang akurat (Nei, 1978). Nilai heterpzigositas dugaan bernilai > 0,1. Hal ini berarti menunjukkan bahwa dendogram yang terbentuk sudah termasuk akurat.

Analisis varian molekuler dapat menentukan keragaman yang terbentuk diantara populasi, diantara individu dan didalam populasi. Pada penelitian ini

AMOVA yang terbentuk berasal dari isolat Ganoderma dari B.flabellifer, E. 72

guineensis, dan H. Brasiliensis. Berdasarkan nilai persentasi variansi, maka keragaman tertinggi dibentuk diantara individu (88%) sementara keragaman diantara populasi dan didalam individu masing-masing 8% dan 4% yang tergolong rendah. Struktur genetik G.boninense yang bervariasi diantara individu didukung oleh penelitian sebelumnnya yang melaporkan bahwa struktur populasi merupakan hasil persiapan pertahanan yang panjang dari isolat, kemungkinan berdekatannya area tanaman kelapa dan kelapa sawit ( Pilotti et al, 2003). Hasil penelitian sebelumnya oleh Merciere et al., 2017 menyatakan bahwa hasil

AMOVA menunjukkan adanya keragaman yang rendah diantara lokasi (1,59 %) , dan diantara pertanaman (0,97 &) dan memiliki keragaman yang tinggi didalam sampel (97, 44%) secara keseluruhan hampir sama dengan hasil penelitian ini.

Analisis sesquence dengan BLATSX menujukkan urutan nukelotid yang dianalisis teridentifikasi memiliki persentasi panjang nukleotida selaras sebesar

89-99% dan skor keakuratan pensejajaran sekuens berkisar dari 228-327 yang mengindikasikan tingkat kemiripan yang tinggi dengan spesies Ganoderma boninense strain NJ3. Menurut Dancourt et al, (2000) bahwa persentasi tingkat kemiripan sekuenss berada pada nilai >99% menunjukkan bahwa spesies yang sebanding merupakan spesies yang sama.

Nilai e-value menunjukkan bahwa seluruh isolat memiliki e-value < 10-4 hal ini menunjukkan bahwa urutan database yang sebanding dengan skor

BLASTX memiliki kesamaan yang signifikan dengan isolat yang diujikan

(Bonhert at al, 2001) dalam penelitian ini sebanding dengan urutan database

G.boninense strain NJ3. Nilai expect value yang semakin tinggi menunjukkan tingkat homologi antar sekuenss akan semakin rendah sedangkan nilai e-value 73

yang rendah menunjukkan tingkat homologi antar sekuenss semakin tinggi dan nilai e-value yang bernilai 0 menunjukkan bahwa kedua sekuenss tersebut dapat dinyatakan identik (Claviere dan Notredame, 2003).

Berdasarkan koefisien kesamaan urutan DNA sequence menunjukkan bahwa semua isolat yang diuji memiliki tingkat kemiripan yang tinggi yaitu lebih dari 90%. Menurut Pearson (2013), metode pencarian kesamaan sequence adalah hal pertama yang paling informatif untuk mengidentifikasi sequence.

Berdasarkam hasil analisis filogenetik pada pengelompokkan terbagi menjadi 2 kelompok utaman yaitu kelompok pertama yang terdiri dari populasi

RFBS-EG, FB-EG, FBD-EG, T-EG, SBSR-EG, TBSR-EG, TUSR-EG, FUSR-EG and FBSR-EG. Sementara kelompok dua terdiri dari 4 populasi yaitu FBSR-HB,

FRWB-HB, FBSR-BF, FBSR-CN. G.boninense memiliki kemiripan paling dekat dengan isolat yang berada pada E.guineenis berbeda dengan isolat dari karet

H.Brasiliensis (cluster II), B. flabellifer (cluster III) dan C.nucifera (cluster IV).

Penelitian ini juga mendukung bahwa G.boninense adalah penyebab penyakit utama pada pertanaman E.guneensis di dunia (Gorea et al, 2019). Pada penelitian lain juga telah ditemukan bahwa Ganoderma yang berasal dari teh dan pertanaman karet berhubungan erat dengan Ganoderma yang berada pada kelapa sawit dan tanaman hutan, spesies yang diidentifikasi adalah G. boninense dari E. guineensis dan C.nucifera, dimana G. philippii dari H. brasiliensis (Nusaibah et al, 2011). G. psuedoferreum dilaporkan telah menyebabkan busuk pangkal batang pada pertanaman stump H. brasiliensis (Ogbebor et al, 2010

Berdasarkan hasil penelitian ini, diperoleh bahwa 13 isolat Ganoderma yang diperoleh adalah Ganoderma boninense. G.boninense merupakan patogen 74

virulen pada tanaman kelapa sawit, biasa dikenal sebagai agen penyebab penyakit busuk pangkal batang. Sesuai hasil penelitian Kok et al, (2013) yang menyatakan bahwa isolat Ganoderma yang dihasilkan pada lokasi yang berbeda menunjukkan tingkat virulensi terhadap kelapa sawit secara in vitro. Dengan demikian dapat pula dinyatakan bahwa ke 13 isolat Ganoderma pada penelitian ini merupakan patogen virulen pada tanaman kelapa sawit.

KESIMPULAN DAN SARAN

Kesimpulan

1. Primer yang paling informatif adalah primer KT124399 dengan nilai PIC

adalah 1,0 sementara yang paling tidak informatif adalah primer KT124400.

2. Isolat tubuh buah basal stem rot lontar memiliki kecenderungan kemiripan

dengan G.boninense lebih besar (83%) dibandingkan dengan isolat tubuh buah

basal stem rot karet (50%) isolat tubuh buah basal stem rot kelapa nyiur

(33%) berdasarkan banyaknya primer spesifik yang mengamplifikasi.

3. Keragaman genetik isolat Ganoderma boninense diantara populasi dan

didalam individu yang diperoleh dari beberapa kebun kelapa sawit PT Socfin

Indonesia adalah rendah namun keragaman genetik diantara individu adalah

tinggi.

Saran

Diperlukan penelitian lanjutan dengan menggunakan lebih banyak isolat

Ganoderma spp. yang berasal dari luar Sumatera Utara.

DAFTAR PUSTAKA

Abadi AL. 1987. Biologi Ganoderma boninense Pat Pada Kelapa Sawit (Elaeis guineensis Jacq) dan Pengaruh Beberapa Mikroba Tanah Antagonistic Terhadap Pertumbuhannya. [Disertasi]. PPS IPB. Bogor. 147 p

Ali, S., Gladieux, P., Rahman, H., Saqib, M.S., Fiaz, M., Ahmad, H., Leconte, M., Gautier, A., Justesen, A.F., Hovmoller, M.S., Enjalbert, J., de Vallavieille- Pope, C. 2014. Inferring the contribution of sexual reproduction, migration and off-season survival to the temporal maintenance of microbial population; a case study on the wheat fungal pathogen Puccinia striiformis f.sp.tritici.Mol Ecol 23(3):603-17.

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J. 1997. Gapped BLAST and PSI-BLAST : a new generation of protein database search programs. Nucleic Acids Res. 1997 Sep 1 ; 25 (17) : 3389-402, PMID : 9254694, PMCID : PMC146917.

Anderson JA., Churchill GA., Autrique JE., Tanksley SD. and Sorrells ME. 1993. Optimizing Parental Selection for Genetic Linkage Maps. Genome 36: 181- 186.

Arifin, D., Idris, A.S., Singh, G. 2000. Status of Ganoderma in Oil Palm. Ganoderma Diseases of Perennial Crops. CABI Publishing, Wallingford, UK. Pp 46-68. Arifin, J., dan D. Mulliadi. 2010. Pendugaan Keseimbangan Populasi Heterozigozitas Menggunakan Pila Protein Albumin Darah pada Populasi Domba Ekor Tipis ( Javanese thin tailed) di daerah Indramayu. Jurnal Ilmu Ternak 10 (2) : 65-72

Basyuni, M., Purba, A., Putri, L.A.P., Hayati, R.,Chalil, D., Syahputra, I. 2019. Bioinformatics analysis of predicted Ganoderma boninense from oil palm ( Elaeis guineensis ).IOP Conf.Ser: Journal of Physics: Conf. Ser 1235 012071

Botstein, D., R.L., White, M. Skolnick, R.W. Davis. 1980. Construction of a genetic linkage map in man using resrtriction fragment length polymorphisms. Am.J Hum. Genet. 32:31 14-331.

Breton, F., Hasan, Y., Hariadi, Lubis, Z., de Franqueville, H. 2008. Characterization of Parameter the Development of an Early Screening test for Basal Stem Rot Tolerance in Oil Palm Progenies. Journal of Oil Palm Research (Special Issue – April 2006), p. 24-36

Castoe, T.A., Poole, A.W., Gu, W., Jason, de Koning, A.P., Daza, J.M., Smith, E.N., Pollock, D.D. 2010. Rapid identification of thousands of copperhead snake (Agkistrodon contortrix) microsatellite loci from modest amounts of 454 shotgun genome sequence. Mol Ecol Resour 10(2):341-7. 77

Claviere, J.M., Notradame, C. 2003. Bioionformatics for Duummies. Wiley Publishung, Indianapolis.

Coetzee, M.P.A., Golani, G.D., Tjahjono, B., Gafur, A., Wingfield, B.D., Wingfield, M.J. 2011. A single dominant Ganoderma species is responsible for root rot of Acacia mangium and Eucalyptus di Sumatra. Southern Forests 73:175-180.

Corley, R.H.V., Tinker, P.B., 2003. The Oil Palm. Fourth Edition. Blackwell Publishing. 562pp.

Dangi RK., MD. Lagu, LB. Choudhary, PK. Ranjekar and VS. Gupta. 2004. Assessment of genetic diversity in Trigonella foenum-graecum and Trigonella caerulea using ISSR nd RAPD markers. BMC Plant Biology 4: 13.

Dewantara, D., Widiastuti, H., Mulyani, A.S., Taniwiryono, D. 2014. Cara Penyiapan Bibit Sawit pada Media Tanam Bebas Ganoderma. Balai Penelitian Bioteknologi Perkebunan Indonesia (BPBPI), Bogor.

Drancourt, M., C. Bollrt., A. Carlioz., R. Martelin, J.P., Gayral dan Roult. 2000. 16s Ribosomal DNA Sequence Analysis of Enviromental and Clinical Unidentifiable Bacterial Isolates, Journal Clinical Micribiology, pp. 3623- 3630

Durand-Gasselin, T., de Franqueville H., Turnbull, N., Breton, F., Cochard, B., Indra, S., Sriwijeyen. 2014. Breeding Methodology to Select Oil Palm Planting Material Partially Resistant to Ganoderma boninense International Oil Palm Conference, Bali.

Dutech, C., Enjalbert, J., Fournier, E.,Delmotte, F., Barrers, B., Carlier, J., Tharreau, D., Giraud, T. 2007. Challenges of microsatellite isolation in fungi. Fungal Genet Biol 44(10):933-49.

Elliot, M.L., Broschat, T.K., Uchida, J.Y., G.W. Simon. 2004. Compandium of ornamental palm disease and disorder. The American phytopathology society p68.

Fee, C.G. 2011. Management of Ganoderma Disease in Oil Palm Plantation. The Planter, Kuala Lumpur, 87 (1022); 325-339.

Gorea EA, Godwin ID, Mudge AM. 2019. Ganoderma infection of oil palm-a persistent problem in Papua New Guinea and Solomon Islands. Australasian Plant Pathol. DOI: 10.1007/s13313-019-00673-9

Govindaraj, M., Vetriventhan, M., Srinivasan, M. 2015. Importance of Genetic Diversity Assesment in Crop Plants and Its Recent Advances: An Overview of Its Analytical Perspective. Hindawi Publishing Corporation. Genetics Research International Volume 2015, Article ID 431487, 14 pages. http://dx.doi.org/10.1155/2015/431487

Ho, Y.W., Nawawi, A. 1985. Ganoderma boninense Pat. From basal stem rot of oil palm (Elaeis guineensis) in Peninsular Malaysia. Pertanika 8:425-428.

Hushiarian, R., Yusof, N.A., Dutse, S.W. 2013. Detection and Control of Ganoderma boninense : strategies and perspective. Springer Plus.a Springer Open Journal.

Idris, A.S., D. Kushairi, D. Ariffin & M.W. Basri. 2004. Selection for partial resistance in oil palm progenies to Ganoderma basal stem rot. J. Oil Palm Res., 16:12-18.

Jarne, P., dan Lagoda, P.J.L. 1996. Microsatellites, from molecules to populations and back. Trends Ecol Evol 11(10):424-429.

Jing, C.J. 2007. Pathogenicity of Ganoderma boninense and its biological relationships with Ganoderma spp. From other palm hosts, Thesis Pasca Sarjana Fakultas Pertanian Universiti Sains Malaysia (tidak dipubliaksikan).

Kasno, S., Nuhamara., A.L. Abadi. 1986. Patogenesis dan Mikologi Ganoderma. Balai Penelitian Kelapa Sawit Marihat. Pematang Siantar.p:79-82.

Kimura M., Crow JF. 1964. The number of alleles that can be maintained in a finite population. Genetics 49-4: 725-738.

Kok, S.M., Y.K. Goh., H.J. Tung., K. J. Goh., W. C. Wong, and Y.K. Goh. 2013. In vitro growth of Ganoderma boninense isolate on novel palm extract medium and virulence on oil palm seedlings. Malaysian journal of microbiology Vol.9 (1) pp. 33-42.

Latiffah, Z., Abdullah, F., Harikhrisna, K., Tan, S.G., Ho, Y.W. 2002. Morphological and growth characteristic and somatic incompatibility of Ganoderma from infected oil palm and coconut stumps. Malaysian Appl Biol. 31:37-48.

Lee, N. 1995. DNA marker and plant breeding programs. Journal Advances in Agronomy 55: 265-344.

Liu K., Muse SV. 2005. Power Marker : An integrated analysis environment for genetic marker analysis. Bioinformatics 21: 2128-2129.

Merciere, M., Laybats, A., Lacombe, C.C., Tan, J.S., Klopp, C., Gasselein-D, T., Alwee, S.S.R.S., Kulaindavelu-C, L., Breton. F. 2015. Identification and

Development of New Polymorphic microsatellite marker using genome assembly fot Ganoderma boninense, causal agent of oil pal, basal stem rot disease. Mycol Progress 14 : 103.

Merciere M, Boulord R, Carasco-Lacombe C, Klopp C, Lee YP, Tan JS, Alwee SSRS, Zaremski A, De Franqueville H, Camus-Kulandaivelu L. 2017. About Ganoderma boninense in oil palm plantations of Sumatra and peninsular Malaysia: Ancient population expansion, extensive gene flow and large scale dispersion ability. Fungal Biol 121 (6-7): 529-540.

Matsuoka, S. E. Mitchell, S. Kresovich, M. Goodman, and J. Doebley. 2002. ―Microsatellites in Zea—variability, patterns of mutations, and use for evolutionary studies,‖ Theoretical and Applied Genetics, vol. 104, no. 2-3, pp. 436–450, 2002. View at Publisher · View at Google Scholar · View at Scopus.

Litt and J.A. Luty. 1989. ―A hypervariable microsatellite revealed by in vitro amplification of a dinucleotide repeat within the cardiac muscle actin gene,‖ The American Journal of Human Genetics, vol.44,no.3,pp,397-401,1989.

Midot, F., Lau, S.Y.L., Wong, C.W., Tung, H.J., Yap, M.L., Lo, M.L., Jee, M.S., Dom, S.P., Melling, L. 2019. Genetic Divesity and Demogrpahic History of Genoderma boninense in Oil Plam Plantation of Sarawak Malaysia Inferred from ITS Region. Microorganisms,7,464.doi:10.3390/microorganisms 7100464.

Miller, R.N.G., Holderness, M., Bridge, P.D., Chung, G.F., Zakaria, M.H. 1999. Genetic Diversity of Ganoderma in oil palm plantings. Plant Pathol 48(5):595-603.

Moncalvo, J.M. 2000. Systematic of Ganoderma. In: Ganoderma Diseases of Perennial Crops.

Nadiah, A. 2013. Jamur Ganoderma sp.: Peran ganda yang bertentangan. BBPPTP Surabaya:2013.

Nagylaki T. 1998. Fixation indices in subdivided populations. Genetics 148: 1325–1332.

Nei, M. 1987. Molecular evalutionary genetics. Columbia university press. New york.

Nusaibah SA, Latiffah Z, Hassaan AR. 2011. ITS-PCR-RFLP analysis of Ganoderma sp. Infecting industrial crops. Pertanika J Trop Agric Sci 34 (1): 83-91.

Ogbebor N, Adekunle A, Eghafona N, Ogboghodo A. 2010. Ganoderma psuedoferreum: biological control possibilities with microorganisms isolated from soils of rubber plantations in Nigeria. Afr J Agric Res 6: 301-305.

Perreira and Jacquemoud-Collet. 2014. Software DARwin. (Dissimilarity Analysis Representation for Windows). Diakses dari: http://darwin.cirad.fr. Last up date 2016/11/10.

Pearson, W.R. 2013. An Introduction to Sequence Similarity ―Homology‖ Searching. Curr Protoc Bioinformatics Chapter 3: Unit3.1. doi: 10.1002/0471250953.bi0301s42.

Pilotti, C. 2006. A Field Guide for the Identification of Ganoderma on Oil Palm & Coconut. The OPRAtive Word. Technical Note 8 February 2006.

Pilotti, C.A. 2005. Stem rots of oil palm caused by Ganoderma boninense; pathogen biology and epidemiology. Mycopathologia 159(1):129-37.

Pilotti, C.A. Sanderson, F.R., Aitken, E.A.B. 2003. Genetic structure of a population of Ganoderma boninense on oil palm. Plant Pathol 52(4):455- 463.

Presti, F.T., Wasko, A.P. 2014. A Review of Microsatellite Markers and their Application on Genetic Diversity Studies in Parrots. Open Journal of Genetics 2014.

Purnamasar,i M.I., Prihatna, C., Gunawan, A.W., Suwanto, A. 2012, Isolasi dan identifikasi secara molekuler Ganoderma spp. Yang berasosiasi dengan penyakit busuk pangkal batang di kelapa sawit. J Fitopatol Indones. 8(1):9- 15. DOI:10.14692/jfi.8.1.9.

Purwiastuti, R., Indrioko, S., Faridah, E. 2016. Keragaman Genetik Cendana Pada Tegakan Penghasil Benih dan Tegakan Rehabilitasi Berdasarkan Penanda Isozim. Jurnal Pemuliaan Tanaman Hutan. Vol.10 No.1, p.23-30.

Ratnaningtyas, N. I dan Samiyarsih, S. 2012. Karakterisasi Ganoderma spp. di Kabupaten Banyumas dan Uji Peran Basidiospora dalam Siklus Penyakit Busuk Batang. Biosfera 29 (1) Januari 2012.

Rees, R.W., Flood, J., Hasan, Y., Cooper, R.M. 2007. Effects of inoculums potential, shading and soil temperature on root infection of oil palm seedlings by the basal stem rot pathogen Ganoderma boninense. Plant Pathol 56(5):862-870.

Sambrook, J. and Russell, D.W. 2001. Molecular Cloning: A Laboratory Manual. Eds. 3. Cold Spring Harbor Laboratory Press. New York.

Schoebel, C.N., Brodbeck, S., Buehler, D., Cornejo, C., Gajurel, J., Hartikainen, H, Keller, D., Leys M, Ricanova S, Segelbacher G, Werth S, Csenesics D. 2013. Lessons learned from microsatellite development for nonmodel organisms using 454 pyrosequencing. J Evol Biol 26(3):600-11.

Semangun, H. 2006. Pengantar Ilmu Penyakit Tumbuhan. Gadjah Mada University Press. Yogyakarta.

Seo, G.S. dan Kirk, P.M. 2000. Ganodermataceae, Nomenclature and Classification dalam Ganoderma Disease of Perennial Crops (eds. J. Flood, RD Bridge & M. Holderness) CAB International 2000.

Susanto, A., Eko Prasetyo, A., Priwiratama, H., Wening, S., Surianto. 2013. Ganoderma boninense Penyebab Penyakit Busuk Batang Atas Kelapa Sawit.J urnal Fitopatologi Indonesia. Volume 9, Nomor 4, Agustus 2013. Halaman 123-126.

Travadon, R., Smith, M.E., Fujiyoshi, P., Douhan, G.W., Rizzo, D.M., Baumgartner, K. 2012b. Inferring dispersal patterns of the generalist root fungus Armillaria mellea. New Phytol 193(4):959-969.

Turner, P.D. 1981. Oil Palm Disease and Disorders. Oxford, United Kingdom. Oxford University Press.

Vidhyasekara, P. 2004. Concise Encyclopedia of Plant Pathology. Food Products Press and The Haworth Reference Press, imprints of The Haworth Reference Press Inc., 10 Alice Street, Binghamton, NY 13904-1580.

Wright S. 1978. The genetical structure of populations. Annals of Eugenics Journal 15: 323-54.

Yanti, F., dan A. Susanto. 2004. Cara praktis isolasi tubuh buah G. boninensei pada medium potato dextrose agar (PDA). Jurnal PPKS 12(2-3):1-11.

Zhao, J.D, Zhang, X.Q. 2000. Flora fungorum sinicorum vol. 18, Ganodermataceae. Beijing: Science Press; 2 000. Pp.1-17

BIODIVERSITAS ISSN: 1412-033X Volume 21, Number 2, February 2020 E-ISSN: 2085-4722 Pages: 451-456 DOI: 10.13057/biodiv/d210204

Genetic diversity and structure of Ganoderma boninense isolates from oil palm and other plantation crops

1 1 2 3 4 AGUSTIAMAN PURBA , RAHMAH HAYATI , LOLLIE A.P. PUTRI , DIANA CHALIL , DADANG AFANDI , 4 5♥ INDRA SYAHPUTRA , MOHAMMAD BASYUNI 1 Graduate School of Agrotechnology, Faculty of Agriculture, Universitas Sumatera Utara. Jl. Dr. A Sofyan No. 3, Medan 20155, North Sumatra, Indonesia 2 Department of Agrotechnology, Faculty of Agriculture, Universitas Sumatera Utara. Jl. Dr. A Sofyan No. 3, Medan 20155, North Sumatra, Indonesia 3 Department of Agribusiness, Faculty of Agriculture, Universitas Sumatera Utara. Jl. Dr. A Sofyan No. 3, Medan 20155, North Sumatra, Indonesia 4 Laboratory of Biomolecular, PT Socfin Indonesia, Martebing, Dolok Masihul, Serdang Bedagai 20991, North Sumatra, Indonesia 5 Department of Forestry, Faculty of Forestry, Universitas Sumatera Utara. Jl. Tri Dharma Ujung No. 1, Medan 20155, North Sumatra, Indonesia. ♥ Tel./fax.: +62-61-8201920, email: [email protected]

Manuscript received: 13 December 2019. Revision accepted: 6 January 2020.

Abstract. Purba A, Hayati R, Putri LAP, Chalil D, Afandi D, Syahputra I, Basyuni M. 2020. Genetic diversity and structure of Ganoderma boninense isolates from oil palm and other plantation crops. Biodiversitas 21: 451-456. Oil palm is an economically important plant, which one of the most important sources of vegetable oil in the world. However, oil palm plantation and other crops face the treat basal stem rot (BSR) disease by Ganoderma boninense. A study on genetic diversity and structure of G. boninense is therefore needed in order to formulate improved control strategies for this disease. This work aimed to analyze the genetic diversity and structure of the G. boninense isolates derived from different hosts, 131 oil palm (Elaeis guineensis), six rubber (Hevea brasiliensis), three coconuts (Cocos nucifera), and three lontar palm (Borassus flabellifer). Genetic diversity and population structure of G. boninense isolates were investigated using six SSR markers with GenAlex 6.502 software. Results showed that several microsatellite loci indicated specific primary success rates, such as KT124402, KT124399, and KT124394, depicting high polymorphism content (>75%). This result suggested that these markers were equally effective in determining the polymorphisms of G. boninense isolates. A hierarchical analysis of molecular variance (AMOVA) revealed that genetic diversity mostly found among individuals within a population (88%), then among populations (8%), and within individuals (4%).. Phylogeny analysis showed two clusters of Ganoderma isolates. which was considered variation as dissimilar across with origin. The present study indicated that G. boninense from oil palm was predominantly comprised of a genetically distinct individual.

Keywords: AMOVA, Ganoderma disease, microsatellite, polymorphism

Abbreviations: FBSR-CN: fruiting body basal stem rot-Cocos nucifera, FBSR-BF: fruiting body basal stem rot-Borassus flabellifer, FBSR-EG: fruiting body basal stem rot-Elaeis guineensis, FUSR-EG: fruiting body upper stem rot-E. guineensis, FBSR-HB: fruiting basal stem rot-Hevea Brasiliensis, FRWB-HB: fruiting body rubberwood block-H. brasiliensis, TUSR-EG: tissue upper stem rot-E. guineensis, TBSR-EG: tissue basal stem rot-E. guineensis, SBSR-EG: spore basal stem rot-E. guineensis, FB-EG: fruiting body-E. guineensis, T-EG: tissue-E. guineensis, FBD-EG: fruiting body died-E. guineensis, RFBS-EG: re-isolation fruit body seedling-E. guineensis, PDA: potato dextrose agar, WA: water agar.

INTRODUCTION BSR can cause significant damage (Ishaq et al. 2014). Areas that constitute the BSR zone were North Sumatra Oil palm (Elaeis guineensis) is an economically and along the west coast of Peninsular Malaysia. Many important plant, which one of the most important sources of infections occur with the appearance of the fruit body at the vegetable oil in the world and a good fuel of biodiesel base of the plant. The spear leaves do not open, and canopy (Pleanjai and Shabbir 2009). A number of studies have turns yellow (Breton et al. 2008). Oil palm, rubber, and been reported that Ganoderma boninense was a major tropical plantations crop suffer losses due to rootstock rot, pathogen causing diseases to attack oil palm (Paterson caused by G. boninense (Caro et al. 2014), which is a 2007), even to a lethal level (Hushiarian et al. 2013), fungus that causes death to plants. Many oil palm coconut tree (Kandan et al. 2008), rubber tree (Sariah et al. plantations experience considerable losses caused by the 1994), lontar palm (Sankaran et al. 2005). Stem basal rot impact of disease of Ganoderma, used of planting materials (SBR) has been reported to appear in various regions in that are resistant is needed (Purba et al. 2019). Total Africa, includes Angola, Cameroon, Ghana, Nigeria, resistance to fungi has rarely been reported, but many Zambia, Sao Tome, Tanzania, Zimbabwe and the Republic examples have been observed, including in oil palm of the Congo; in America occurred in Honduras, and in (Durand-Gasselin et al. 2014), rubber (Lim 1997), coconut Oceania found in Papua New Guinea, and South East Asia (Zakaria 2005) and lontar palm (Rajendran et al. 2014). countries (Wang et al. 2009). 452 BIODIVERSITAS 21 (2): 451-456, February 2020

Furthermore, this disease was difficult to diagnose, and were conserved, stored in an incubator at 20°C. Preparation pathogens can be presented without the appearance of of isolates was carried out in laminar airflow under sterile symptoms but have naturally infected plants (Corley and conditions. Mycelium was taken from pieces of PDA Tinker 2003). On the other hand, G. boninense has a slow (potato dextrose agar) from a Wheaton tube using a needle, growth development (Ho and Nawawi 1986) but has a then subcultured into water agar (WA) media long-lasting ability because of the resting spore and (+chloramphenicol, streptomycin) in three petri dishes, pseudosclerotium (Blanchette 1984). Darmono (1998) has which was prepared for five days before the subculture reported that G. boninense found in Indonesia to have a performed. Mycelium, which grows on WA media, was molecular difference. In this circumstance, the phenotypic subcultured into the PDA (+chloramphenicol) medium of variation of G. boninense from several regions in Indonesia five petri dishes, which have been prepared five days does not have very close relations (Purba et al. 2019). before subculture was carried out (Naher et al. 2012). Then, However, genetic diversity on G. boninense is not fully the G. boninense isolates incubated in dark conditions at understood. Recently molecular performances showing the 28°C for ten days, as shown in Figure 1. grouping of plant resistance to G. boninense occurred in healthy leaves of mature oil palm (Afandi et al. 2018). The DNA extraction Furthermore, polyisoprenoid carbon chain-length has been Ganoderma boninense mycelium, which has been shown to be a chemotaxonomic marker for the screening of grown on the PDA media, were used for DNA extraction. oil palm resistance to G. boninense (Afandi et al. 2019. Total DNA was extracted from B. boninense using the Therefore, a study on genetic diversity and structure of G. CTAB method, as previously described with minor boninense is needed in order to formulate improved control modification (Basyuni et al. 2017). The DNA quality was strategies for this disease. The present work aimed to tested based on UV-illuminator and documented using the investigate the genetic diversity and structure of the G. Gel doc. DNA was quantified using the nanophotometer boninense isolates from mostly E. guineensis and other method, using wavelengths (λ) 260 and 280 nm. plantation crops.

PCR Amplification In this study, the SSR (Simple Sequence Repeat) MATERIALS AND METHODS primers for the Polymerase Chain Reaction (PCR) used 6 primers pairs (Table 1) as previously reported (Merciere et Ganoderma boninense isolates al. 2015). Amplification reaction for PCR was done in 10 The materials used in this work were 147 Ganoderma μl of the total volume containing 3 μL of DNA templates boninense isolates, which were from different hosts, 131 oil mixed with 2.5 μL Gotaq master, 0.5 μL forward primer palm (Elaeis guineensis), six rubber (Hevea brasiliensis), and 0.5 μL reverse, primer and 3.5 μL ddH2O. three coconuts (Cocos nucifera), and three lontar palm PCR amplification was performed on Eppendorf (Borassus flabellifer). These isolates were derived from the Mastercycler ep 384 (Eppendorf, Westbury, New York, Pathology Laboratory of PT Socfin Indonesia collections. USA). The amplification program consisted 35 cycles at The isolates were initially from North Sumatra (Serdang 95°C for 4 min, followed by 10 sec at 94°C, annealing at Bedagai, Asahan, Simalungun, Tebing Tinggi, Central 52°C for 75 sec, and elongation were processed at 72 °C Tapanuli, Batubara, Labuhan Batu Utara, and Medan), for 90 sec and a final extension at 72°C for 8 min. PCR West Sumatra, South Sumatra, and Sulawesi, Indonesia. product was performed by electrophoresis and documented Source of isolates were grouped as 13 populations that with UV-transilluminator (UV-Doc) and Gel-Doc (U Doc) previously described (Purba et al. 2019) as follows. FBSR- as previously described (Afandi et al. 2018). CN (fruiting body basal stem rot-Cocos nucifera), FBSR- BF (fruiting body basal stem rot-Borassus flabellifer), FBSR-EG (fruiting body basal stem rot-Elaeis guineensis),

FUSR-EG (fruiting body upper stem rot-E. guineensis), FBSR-HB (fruiting basal stem rot-Hevea Brasiliensis), FRWB-HB (fruiting body rubberwood block-H. brasiliensis), TUSR-EG (tissue upper stem rot-E. guineensis), TBSR-EG (tissue basal stem rot-E. guineensis), SBSR-EG (spore basal stem rot-E. guineensis), FB-EG (fruiting body-E. guineensis), T-EG (tissue-E. guineensis), FBD-EG (fruiting body died-E. guineensis), RFBS-EG (re-isolation fruit body seedling-E. guineensis). The majority of isolates were sourced from oil palm (Elaeis guineensis Jacq., Arecaceae).

Growth of Ganoderma boninense isolates on potato

dextrose agar (PDA) The growth of G. boninense isolates was carried out as previously reported (Purba et al. 2019). Briefly, the isolates Figure 1. The mycelium Ganoderma boninense have been grown on PDA PURBA et al. – Genetic diversity and structure of Ganoderma boninense 453

Table 1. Description of primer sequences used to this study Arithmetic Mean (UPGMA) by MVSP ver. 3.22 software (Basyuni et al. 2018). Amplicon Primer Primer sequences (5’-3’) (bp) KT124397 F: CGCCATGCCCACCACCAGAG 283-325 RESULTS AND DISCUSSION R: GACCCGGCTGCCCGAATGAG KT124402 F:ACAAGGCTCAAGGCAGCGCA 212-224 R: GCACACCCCAGCAACAGGAGG Selection of polymorphism marker KT124403 F: GGCGACGAGGGCACGAGAGA 273-297 We identified of G. boninense isolates in six loci R:CCGCACTTTCGCCAACCACC (KT124397, KT124402, KT124403, KT124400, KT124400 F:AGCTCCCCTCCCAGCTCCAAC 171-186 KT124399 and KT124394) and 13 populations. R:GAATGCGGCGGGGAAACGGA Interpretation of genetic variation and interaction of locus KT 124399 F:GCACAGGCACAAGCGCAAGG 204-267 frequencies between alleles was a collaboration between R:CGACGACCGCCCCAAAGGAT individual alleles and indicated Fis (0.84), as displayed in KT 124394 F:CGGGAAGTGGTGAACGGTGGT 234-243 Table 2. The average frequency of the different isolate R:GGGTGGCTTGACAGCGGCAT populations in the alleles identified was 0.90 (Fit). Wherein the second factor was obtained by Fst (0.37), while the maximum Fis (1.00) and Fit (1.00), the minimum Fis Tabel 2. F-Statistics, total migrant and polymorphic information (0.71), and Fit (0.83). Total migration (Nm) by the mean overall population number of alleles was 0.43 within populations; PIC 0.65

mean observed (Table 2). The PIC value of each SSR Loci Fis Fit Fst Nm PIC primers was determined by the number of alleles and the

KT124397 0.80 0.86 0.31 0.57 0.56 frequency of distribution within a population, wherein high KT124402 1.00 1.00 0.44 0.32 0.92 PIC was > 0.5, moderate 0.5 > PIC > 0.25, and low PIC was KT124403 0.78 0.85 0.31 0.56 0.53 < 0.25 (Bhattacharya et al. 2010). The polymorphic of this KT124400 1.00 1.00 0.42 0.34 0.15 study ranged from 0.15 to 1.0 within thirteen populations. KT124399 0.76 0.85 0.38 0.41 1.00 KT124394 0.71 0.83 0.40 0.38 0.76 This genetic variation indicated that the genetic diversity Mean 0.84 0.90 0.37 0.43 0.65 within the population was very low in KT124400 loci SE 0.05 0.03 0.02 0.04 0.12 (0.15) but higher in KT124399 loci (1.00). Among three Note: Allele frequency correlations between individuals in the loci, as reported by Merciere et al. (2015) showed the same subpopulation (Fis), allele frequency in the population caused by mean PIC was KT124397 (0.56), KT124403 (0.53), and Fis and Fst (Fit), allele frequency correlations between KT124394 (0.76) respectively. subpopulation (Fst), the total of migrants (Nm), polymorphic This study suggested that some microsatellite loci data information content (PIC). indicated specific primary success rates, this result showed only for locus KT124402, KT124399, and KT124394. There are not effective polymorphism locus within KT124400. The high level for a polymorphic Microsatellite data analysis recommendation (PIC > 0.5) of SSR markers and suggested Genetic differentiation for each population and locus that these markers were effective in determining the were assessed by calculating using GenAlEx ver 6.502 polymorphisms of Ganoderma isolates. The present study (Peakal and Smouse 2012) as frequency by alleles supported the previous reports (Afandi et al. 2018) that correlations between individuals in subpopulations (Fis), molecular markers to be considered as promising markers correlation of frequency between subpopulations (Fst), for G. boninense resistance screening oil palm. In addition frequency by alleles in population caused by both factors to the polyisoprenoid pattern in E. guineensis as a potential (Fit), total migrants (Nm), number of different alleles (N), biochemical marker in response to G. boninense infection number of different allele frequencies >0.5% (Na), Number (Afandi et al. 2019). of active alleles (Ne) and Shannon of Information index (I). The polymorphisms for each population and locus were assessed by calculating the observed average Microsatellite analysis for each population

heterozygosity (Ho), expected heterozygosity (He), and Table 3 shows the microsatellite for the population of

G. boninense isolates. The average number of alleles (N) fixation index (F) (Nei 1978). Polymorphic Information for each population from 2.50 to 21.00, was observed. The Content (PIC) was determined by Avval (2017). The highest value found in RFBS-EG was 21.00. The mean genetic structure analyzed was calculated using the number of different alleles frequency >0.5% found (8.10); GenAlEx analysis of molecular variance (AMOVA) ver this value was similar to those previously reported for 6.502 package (Peakal and Smouse 2012). Ganoderma boninense (8.00) (Merciere et al. 2015). Estimated Ne values averaged 6.64 varying from 1.00 to Phylogenetic analysis 21.57 (Table 3), indicating that most individuals were Phylogenetic analysis was done based on the accession necessary for one population or another one. However, I and grouping analysis of the phylogenetic tree of value ranging from 0.00 to 3.24, with an average was 1.45. Ganoderma boninense isolates. Forward, they were analyzed using the Unweighted Pair Group Method with 454 BIODIVERSITAS 21 (2): 451-456, February 2020

Table 3. The profile of microsatellite loci for all population of Ganoderma boninense isolates

Population N Na Ne I Ho He uHe F

FBSR-CN 2.50 3.17 2.93 1.11 0.31 0.66 0.83 0.52 FBSR-BF 2.83 3.00 2.84 1.05 0.14 0.63 0.77 0.79 FBSR-EG 51.33 30.83 21.57 3.24 0.03 0.95 0.96 0.97 FUSR-EG 20.00 16.33 12.82 2.66 0.03 0.92 0.94 0.97 FBSR-HB 3.00 2.33 2.23 0.69 0.28 0.42 0.50 0.39 FRWB-HB 3.00 3.50 3.07 1.06 0.50 0.57 0.68 0.19 TUSR-EG 17.00 12.33 10.18 2.37 0.00 0.89 0.91 1.00 TBSR-EG 11.00 9.00 8.20 2.13 0.00 0.87 0.91 1.00 SBSR-EG 3.00 1.67 1.53 0.42 0.00 0.30 0.36 1.00 FB-EG 5.00 4.00 3.62 1.29 0.00 0.69 0.77 1.00 T-EG 3.00 1.00 1.00 0.00 0.00 0.00 0.00 1.03 FBD-EG 3.00 1.00 1.00 0.00 0.00 0.00 0.00 0.50 RFBS-EG 21.00 17.17 15.26 2.78 0.00 0.93 0.96 0.89 Mean 11.21 8.10 6.64 1.45 0.10 0.60 0.66 0.82 SE 1.53 0.99 0.76 0.12 0.03 0.04 0.04 0.04 Note: A number of different alleles (N), number of different alleles frequency> 0.5% (Na), number of effective alleles (Ne), and Shannon of information index (I), observed heterozygosity (Ho), expected heterozygosity (He), unbiased expected heterozygosity (uHe), fixation index (F). FBSR-CN (fruiting body basal stem rot-Cocos nucifera), FBSR-BF (fruiting body basal stem rot-Borassus flabellifer), FBSR-EG (fruiting body basal stem rot-Elaeis guineensis), FUSR-EG (fruiting body upper stem rot-E. guineensis), FBSR- HB (fruiting basal stem rot-Hevea Brasiliensis), FRWB-HB (fruiting body rubberwood block-H. brasiliensis), TUSR-EG (tissue upper stem rot-E. guineensis), TBSR-EG (tissue basal stem rot-E. guineensis), SBSR-EG (spore basal stem rot-E. guineensis), FB-EG (fruiting body-E. guineensis), T-EG (tissue-E. guineensis), FBD-EG (fruiting body died-E. guineensis), RFBS-EG (re-isolation fruit body seedling-E. guineensis)

Table 4. Summary analysis of molecular variance (AMOVA) of Ganoderma boninense isolates population

Source df SS MS Est. Var. % var

Among populations 12 122.51 10.21 0.24 8 Among individuals 134 724.88 5.41 2.65 88 Within individuals 147 16.50 0.12 0.11 4 Total 293 863.89 3.00 100 Note: df: Degree of Freedom, SS: Source of Variation, MS: Mean Squares, Est.Var: Estimation of Variant, Var: Variant

Allelic diversity by samples was estimated using that the average He was 0.59 for G. boninense isolates, was heterozygosity (Ho and He). It is interesting to note that similar to this study. seven populations had Ho (0.00); these values could not be detected in samples TUSR-EG, TBSR-EG, SBSR-EG, FB- Genetic structure of Ganoderma boninense EG, T-EG, FBD-EG, and RFBS-EG. Furthermore, the The genetic structure of G. boninense was carried out others were successfully detected, the range value Ho from by hierarchical analysis of molecular variance (AMOVA) 0.03 to 0.31. A more appropriate measure of genetic using on the infinite alleles model (F-statistics). Table 4 variation in population was genes diversity (mean expected shows locus by AMOVA analysis, which was done to heterozygosity). He, in this population, was average (0.60), undertake the populations as sources of variation. In this which was in the range (0.30 to 0.95) to be useful for case, results derived from GeneAlex programs provide measuring genetic variation with population T-EG and strong support of a G. boninense isolates origin C. nucifera, FBD-EG were not detected (He= 0.00). One of the factors B. flabellifer, E. guineensis, and H. brasiliensis. This SSR that affects the dendrogram is the level of heterozygosity, marker seems to be worthy, mainly genetic diversity. The in some organisms with average heterozygosity higher than high average percentage of the source of variation (724.88) 0.1 to construct a reliable dendrogram (Nei 1978). Genetic among individual, pointed out the genetic differences diversity was assessed by calculating unbiased expected among individuals within populations. heterozygosity (Raymond and Rousset 1995). uHe among In addition, AMOVA indicated the degree of freedom population T-EG and FBD-EG are not detected (0.00), and that 134 of the total genetic variation. While the mean using an average, the fixation index (F) of the population square was 5.41 corresponded to the distinction among was 0.82. On the other hand, the Ganoderma isolates from individuals. Percentages among individuals within the Belitung Island have been reported with He of 0.77 (Jiat et population were 88% variant, among populations was low al. 2019). Moreover, Merciere et al. (2015) have reported (8%), and within an individual (4%) were estimated. This PURBA et al. – Genetic diversity and structure of Ganoderma boninense 455 genetic structure of G. boninense varied among the guineensis). It showed in Figure. 2. The dendrogram individuals was supported by the previous report that (UPGMA) showed two large groups in the population. The population structure could be the result of an arrangement first group consisting of population was RFBS-EG, FB-EG, of long‐surviving isolates, possibly from adjacent areas FBD-EG, T-EG, SBSR-EG, TBSR-EG, TUSR-EG, FUSR- planted with coconut and oil palm (Pilotti et al. 2003). EG and FBSR-EG. The second group consisted mainly of Recently, Merciere et al. (2017) have reported on the only four populations from FBSR-HB, FRWB-HB, FBSR- AMOVA results that G. boninense had a very low variation BF, FBSR-CN. Dendrogram was concluded that the clades between regions (1.59 %) and between plantations (0.97), represented separated populations of origin. G. boninense but a very high variation within samples (97.44 %,), totally distinct most closely related to isolates from E. guineensis agreed with the present study. (cluster I) dissimilar with isolates from H.Brasiliensis (cluster II), B. flabellifer (cluster III) and C.nucifera Phylogenetic analysis of G. boninense (cluster IV). This study supported likewise Ganoderma We identified the genetic variation from thirteen boninense is the major disease factor to E. guineensis populations of FBSR-CN (fruiting body basal stem rot- plantations in the world (Gorea et al. 2019). On the other Cocos nucifera), FBSR-BF (fruiting body basal stem rot- hand, Ganoderma sp. have been reported from the tea and Borassus flabellifer), FBSR-EG (fruiting body basal stem rubber plantation were more closely related compared to oil rot-Elaeis guineensis), FUSR-EG (fruiting body upper stem palm and the forest trees, furthermore, the species were rot-E. guineensis), FBSR-HB (fruiting basal stem rot- identified especially to G. boninense from E. guineensis Hevea Brasiliensis), FRWB-HB (fruiting body rubberwood and C.nucifera, whereas G. philippii from H. brasiliensis block-H. brasiliensis), TUSR-EG (tissue upper stem rot-E. (Nusaibah et al. 2011). Ganoderma disease caused by G. guineensis), TBSR-EG (tissue basal stem rot-E. psuedoferreum has been reported caused fruiting bodies guineensis), SBSR-EG (spore basal stem rot-E. guineensis), were seen in the H. brasiliensis stumps in the plantation FB-EG (fruiting body-E. guineensis), T-EG (tissue-E. (Ogbebor et al. 2010). guineensis), FBD-EG (fruiting body died-E. guineensis), RFBS-EG (re-isolation fruit body seedling-E.

UPGMA

RFBS-EG FB-EG

FBD-EG T-EG SBSR-EG I TBSR-EG

TUSR-EG FUSR-EG

FBSR-EG FBSR-HB II FRWB-HB FBSR-BF III FBSR-CN IV

0.6 0.5 0.4 0.3 0.2 0.1 0

Euclidean - Data log (10) transformed

Figure 2. Cluster analysis of Ganoderma boninense isolates from 13 populations. FBSR-CN (fruiting body basal stem rot-Cocos nucifera), FBSR-BF (fruiting body basal stem rot-Borassus flabellifer), FBSR-EG (fruiting body basal stem rot-Elaeis guineensis), FUSR-EG (fruiting body upper stem rot-E. guineensis), FBSR-HB (fruiting basal stem rot-Hevea Brasiliensis), FRWB-HB (fruiting body rubberwood block-H. brasiliensis), TUSR-EG (tissue upper stem rot-E. guineensis), TBSR-EG (tissue basal stem rot-E. guineensis), SBSR-EG (spore basal stem rot-E. guineensis), FB-EG (fruiting body-E. guineensis), T-EG (tissue-E. guineensis), FBD-EG (fruiting body died-E. guineensis), RFBS-EG (re-isolation fruit body seedling-E. guineensis). 456 BIODIVERSITAS 21 (2): 451-456, February 2020

In conclusion, this work confirmed that G. boninense Ho YW, Nawawi A. 1986. Isolation, growth and sporophore development had high genetic diversity among the individual within of Ganoderma boninense from oil palm in Malaysia. Pertanika 9: 69- 73. populations. Management factors such as the origin Hushiarian, Roozbeh, Nor AY, Sabo WD. 2013. Detection and control of between isolates could be the significant cause G. Ganoderma boninense: strategies and perspectives. Springer Plus 2 boninense population isolates. Several SSR markers were (1): 555. promisingly effective in determining the polymorphisms of Ishaq I, Alias MS, Kadir J, Kasawani I. 2014. Detection of basal stem rot disease at oil palm plantations using sonic tomography. J Sustain Sci G. boninense isolates. This study clarified that G. Manag 9: 52-57. boninense from oil palm was predominantly comprised of a Jiat TH, Astari S, Keng G, Joo G, Chee WW. 2019. cDNA-SSR markers genetically distinct individual. for molecular epidemiology of Ganoderma boninense. J Oil Palm Res 31 (2): 220-237. Kandan AR, Bhaskaran R, Samiyappan R. 2010. Ganoderma-a basal stem rot disease of coconut palm in south Asia and Asia Pacific regions. ACKNOWLEDGEMENTS Arch Phytol Plant Prot 43: 1445-1449 Lim TM. 1977. Production, germination and dispersal of basidiospores of Ganoderma pseudoferreum on Hevea. J Rubber Res Inst Malaya 25 This study was supported by an Applied Grant (2): 93-99. (No.28/UN5.2.3.1/PPM/KP-DPRM/2019) from Directorate Merciere M, Boulord R, Carasco-Lacombe C, Klopp C, Lee YP, Tan JS, for Research and Community Service, Ministry of Alwee SSRS, Zaremski A, De Franqueville H, Camus-Kulandaivelu Research, Technology and Higher Education, Republic of L. 2017. About Ganoderma boninense in oil palm plantations of Sumatra and peninsular Malaysia: Ancient population expansion, Indonesia. extensive gene flow and large scale dispersion ability. Fungal Biol

121 (6-7): 529-540. Mercière M, Laybats A, Lacombe CC, Tan JS, Klopp C, Gasselin TD, Alwee SSRS, Kulandaivelu LC, Breton F. 2015. Identification and REFERENCES development of new polymorphic microsatellite markers using genome assembly for Ganoderma boninense, causal agent of oil palm Afandi D, Basyuni M, Putri LA, Chalil D, Wati R, Siregar EB, Syahputra basal stem rot disease. Mycol Prog 14: 103. I. 2018. Molecular performances of oil palm (Elaeis guineensis) Naher L, Yusuf UK, Siddiquee S, Ferdous J, Rahman MA. 2012. Effect of tolerance to Ganoderma sp. IOP Conf. Ser: J Phys: Conf. Ser 1116: media on growth and antagonistic activity of selected Trichoderma 052001. DOI:10.1088/1742-6596/1116/5/052001. strains against Ganoderma. Afr J Microbiol Res 6 (48): 7449-7453. Afandi D, Basyuni M, Putri LAP, Chalil D, Syahputra I. 2019. Expression Nei M. 1978. Estimation of average heterozygosity and genetic distance of oil palm (Elaeis guineensis) polyisoprenoids in response to from a small number of individuals. J Genet 89: 583-590 Ganoderma boninense infection. Biodiversitas 20: 68-76. Nusaibah SA, Latiffah Z, Hassaan AR. 2011. ITS-PCR-RFLP analysis of Avval SE. 2017. Assessing polymorphism information content (PIC) Ganoderma sp. Infecting industrial crops. Pertanika J Trop Agric Sci using SSR molecular markers on local species of Citrullus 34 (1): 83-91. colocynthis. Case study: Iran, Sistan-Balouchestan province. J Mol Ogbebor N, Adekunle A, Eghafona N, Ogboghodo A. 2010. Ganoderma Biol Res 7: 42-49. psuedoferreum: biological control possibilities with microorganisms isolated from soils of rubber plantations in Nigeria. Afr J Agric Res 6: Basyuni M, Baba S, Oku H. 2017. Microsatellite analysis on genetic 301-305. variation in two populations of red mangrove Rhizophora mangle L. Paterson RRM. 2007. Ganoderma disease of oil palm—A white rot (Rhizophoraceae) and its implication to conservation. IOP Conf Ser: perspective necessary for integrated control. Crop Prot 26.9: 1369- Mater Sci Eng 180: 012243. 1376. Basyuni M, Wati R, Deni I, Tia AR, Siregar ES, Syahputra I. 2018. Cluster analysis of polyisoprenoid in oil palm (Elaeis guineensis) Peakall R, Smouse PE. 2012. GenAlEx 6.5: genetic analysis in Excel. leaves in different land-uses to find the possible cause of yield gap Population genetic software for teaching and research-an update. from planting materials. Biodiversitas 19: 1492-1501. Bioinformatics 28: 2537-2539. Bhattacharya S, Bandopadhyay TK, Ghosh EPD. 2010. Efficiency of Pilotti, CA. Sanderson FR, Aitken EAB. 2003. Genetic structure of a RAPD and ISSR markers in assessment of molecular diversity in elite population of Ganoderma boninense on oil palm. Plant Pathol 52: germplasms of Cymbopogon winterianus across West Bengal, India. J 455-463. Food Agric 22: 13-24. Pleanjai S, Shabbir HG. 2009. Full chain energy analysis of biodiesel Blanchette RA. 1984. Selective delignification of eastern hemlock by production from palm oil in Thailand. Appl Energy 86: S209-S214. Ganoderma tsugae. Phytopathology 74 (2): 153-160. Purba A, Basyuni M, Putri LA, Chalil D, Hayati R, Arifiyanto D, Breton F, Miranti R, Lubis Z, Hayun Z, Setiawati U, Flori A, Nelson S, Syahputra I. 2019. Sequence analysis of Ganoderma boninense Durand GT, Jacquemard JC, Hubert DF. 2009. Implementation of an isolates from oil palm. IOP Conf Ser: Earth Environ Sci 260: 012172. early artificial inoculation test to screen oil palm progenies for their Rajendran L, Akila R, Karthikeyan G, Raguchander T, Saravanakumar D, level of resistance and hypothesis on natural infection. The 5th Samiyappan R. 2014. Nucleic acid-based detection technique for Quadrennial International Oil Palm Conference, Bali Nusa Dua Ganoderma lucidum in coconut. Archiv Phytopathol Plant Prot 47 Convention Center, Indonesia, 17-19 June 2014. (6): 690-702. Caro ML, Rimbawanto A, Page DE. 2014. Management of basidiomycete Raymond M., Rousset F. 1995. Genepop (version 1.2): population root and stem rot diseases in oil palm, rubber, and tropical hardwood genetics software for exact tests and ecumenicism. J Hered 86: 248- plantation crops. For Pathol 44: 428-446. 249. Corley RHV, Tinker PB. 2003. The Oil Palm. 4th ed. Blackwell Publishing, London. Sankaran KV, Bridge PD, Gokulapalan C. 2005. Ganoderma diseases of Darmono TW. 1998. Variation among isolates of Ganoderma sp. from oil perennial crops in India-an overview. Mycopathologia 159: 143-152. palm in Indonesia. Second International Workshop on Ganoderma Sariah M, Hussin MZ, Miller RNG, Holderness M. 1994. Pathogenicity of Disease, Malaysia. Ganoderma boninense tested by inoculation of oil palm seedlings. Durand-Gasselin T, Noiret JM, Kouamé KR, Cochard B, Adon B. 1999. Plant Pathol 43 (3): 507-510. Availability of quality pollen for improved oil palm (Elaeis Wang, Dong M, Sheng HW, Ching HS, Jin TP, Ya HS, Lung CC. 2009. guineensis Jacq.) seed production. Plantations, Recherche, Ganoderma multipileum, the correct name for ‘G. lucidum' in tropical Développement 6: 264-276. Asia. Bot Stud 50: 451-458. Gorea EA, Godwin ID, Mudge AM. 2019. Ganoderma infection of oil Zakaria L, Kulaveraasingham K, Tan SG, Abdullah F, Ho YW. 2005. palm-a persistent problem in Papua New Guinea and Solomon Random amplified polymorphic DNA (RAPD) and random amplified Islands. Australasian Plant Pathol. DOI: 10.1007/s13313-019-00673-9 microsatellite (RAMS) of Ganoderma from Infected oil palm and coconut stumps in Malaysia. Asia Pac J Mol Biol Biotechnol 13 (1): 23-34. AEFS 2018 IOP Publishing IOP Conf. Series: Earth and Environmental Science 260 (2019) 012172 doi:10.1088/1755-1315/260/1/012172

Sequence analysis of Ganoderma boninense isolates from oil palm

A Purba1, M Basyuni2*, L A P Putri3, D Chalil4, R Hayati1, D Arifiyanto5 and I Syahputra5

1Graduate School of Agrotechnology, Faculty of Agriculture, Universitas Sumatera Utara, Medan, Sumatera Utara, Indonesia. 2Department of Forestry, Faculty of Forestry, Universitas Sumatera Utara, Medan, Sumatera Utara, Indonesia. 3Department of Agrotechnology, Faculty of Agriculture, Universitas Sumatera Utara, Medan, Sumatera Utara, Indonesia. 4Department of Agribusiness, Faculty of Agriculture, Universitas Sumatera Utara, Medan, Sumatera Utara, Indonesia. 5Laboratory of Biomolecular of PT Socfin Indonesia, Martebing, Dolok Masihul, Tebing Tinggi, Sumatera Utara, Indonesia.

E-mail: *[email protected]

Abstract. Basal Stem Rot (BSR) is a prevalent oil palm disease caused by Ganoderma fungus. Many oil palm plantations suffered losses due to BSR disease, which caused deaths of oil palm crops. Ganoderma has host plants from the Palmae family such as oil palm, coconut, Nipah, aren, areca nut, papyrus, and also can be found in Industrial Plantation Forest (HTI) like Acacia, even in the forest wood can also be encountered Ganoderma. Ganoderma has high genetic diversity. Fruiting bodies which isolated from oil palm tree located in different locations is one of the factors causing genetic diversity. The Ganoderma isolates analysed in this study were isolates derived from different oil palm plantation. Ganoderma isolates collection of PT Socfindo is used in a screening test to obtain oil palm material which has resistance to Ganoderma attack. The present study confirmed through DNA sequences that Ganoderma derived from oil palm has been defined as a Ganoderma boninense, that is very virulent for the appearance of BSR disease.

1. Introduction Ganoderma boninense species cause basal Stem Rot (BSR) disease in oil palm. However, this disease is known to be caused by different Ganoderma pathogens in each country, in Malaysia, the causes of BPB are identified as G. boninense, G. zonatum, G. miniatocintum and G. tornatum [1]. However, in the 1900s, using artificial inoculation techniques through root and rubber woods was able to prove that G. boninense is a dominant pathogenic Ganoderma species to oil palm based on the Koch Postulat concept [2]. The causes of palm oil BPB disease in some countries are reported to vary, for example, some species of saprophytic Ganoderma from the Basidiomycota group. In West Africa, the causes of

Content from this work may be used under the terms of the Creative Commons Attribution 3.0 licence. Any further distribution of this work must maintain attribution to the author(s) and the title of the work, journal citation and DOI. Published under licence by IOP Publishing Ltd 1 AEFS 2018 IOP Publishing IOP Conf. Series: Earth and Environmental Science 260 (2019) 012172 doi:10.1088/1755-1315/260/1/012172

BSR are identified as G. lucidum, in Nigeria identified as G. zonatum, G. encidum, G. colossus, and G. applanatum [3]. G. boninense found in Indonesia has a molecular difference. G. boninense from some regions of Indonesia does not have a very close relationship [5]. The phenotypic diversity of Ganoderma is also found in the PT Socfin Indonesia plantation of oil palm plantations afflicted with BSR disease. There are differences in color, surface shape, sticking pattern on the palm oil rod and basidiocarp edge pattern. But its genetic diversity is not well understood. Therefore, this study was conducted to determine sequence analysis of selected isolates of G. boninense causes BSR existing in PT Socfin Indonesia and outside PT Socfin Indonesia.

2. Materials and Method The materials used in this study were 138 isolates of Ganoderma (13 isolates has been selected for the DNA sequencing), distilled water, peeled potato, agar powder, dextrose/sucrose, chloramphenicol C0378 Sigma-Aldrich, streptomycin S6501 Sigma-Aldrich, PDA (Potato Dextrose Agar) media, WA media(Water Agar), Ganoderma DNA extract, 70% ethanol, 0.1 g nitrogen liquid, polyvinylpyrrolidone (PVPP), CTAB buffer, TAE buffer, TE buffer, NaCl, isopropanol, chloroform, specific primers, H2O, agarose gel, GelRed, ladder DNA, loading lye. The tools used in this research are tissue, aluminium foil, paper label, permanent marker, pen, scalpel blade, scalpel handle, beaker glass volume 500 cc, magnetic bar, rubber gloves, hair cap, mask, Wheaton tube, incubator Liebhr, micro pipette size 1-50 μl, 100-500 μl, pipet tips (white, yellow and blue), peeler, pot, gas stove, gas cylinder, Cimarex hot plate, Mednif horizontal autoclave, tape for sterilization indicator, sterile plastic petrix with 9 cm diameter, glass plate with 9 cm diameter, needle for spinal anaesthesia Spinocan size 0,53 x 88 mm, parafilm, laminar airflow Esco, bunsen lamp, refrigerator, particle counter Handilaz, mortar, tweezers, Memmert oven, freezer , Eppendorf tube, micro tube 2.0 ml and 1.5 ml, PCR device, spectrometer, electrophoresis device, electrophoresis (Power PAC 3000, Bio-Rad), PCR (Thermal cycler) applied biosystem, Gel Doc, analytical scales Sartorius TE313S, Erlenmeyer, spatula, centrifuge (Eppendorf 5415), spectrophotometer, fume hood, microwave, pincers, camera, notebooks, computers.

2.1. Sample collection Identification of sample location was chosen by the highest rate of Ganoderma infection in the estate. The samples as minimum 3 unit of each block were collected, from live palm with high infection symptom (score 3–4). The fresh fruiting body and not too old with symptom on the upper part still smooth and lower portion with white colour, the thickness of mycelium at the centre part more than 5 mm. Survey and select a fruiting body on an infected oil palm tree were done.

The sample location (estate, block, row number, tree number) and notes into Ganoderma sampling form were recorded. The picture of the sample tree and sample of the fruiting body were taken. Fruiting body from palm trunk and cut at the middle of the fruiting body to identify that size of mycelium is enough for the sample, then cover with aluminium foil. Plastic clip was used to identity of an example (sample code) and put into the plastic box then include it and bring to Pathology Laboratory. Total DNA was extracted from Ganoderma isolate using cetyl trimethyl ammonium bromide (CTAB) method with minor modification to increase yields as earlier reported [6]. The total DNA was used for sequence analysis.

2.2. Source of sequenced isolates The origin of isolates was taken for sequencing are from different places. They are from North Sumatera Province (Asahan, Simalungun, Serdang Bedagai, Batu Bara, Tebing Tinggi, Labuhanbatu Utara), South

2 AEFS 2018 IOP Publishing IOP Conf. Series: Earth and Environmental Science 260 (2019) 012172 doi:10.1088/1755-1315/260/1/012172

Sumatera Province from Sumatera Candi Kencana plantation and West Sumatera Province from Pangian Barat plantation as depicted in Table 1. Meanwhile, the isolates were same isolated from oil palm tree and seedlings.

Table 1. Source of sequenced isolates.

No Isolates Country Region Plantation Source of Isolate

1. 006PTN3 Indonesia Asahan Sei Dadap Fruiting Body Basal Stem Rot (BSR) 2 I5 Indonesia Simalungun Bah Lias Tissue Upper Stem Rot (USR) 3. J Indonesia Serdang Bangun Fruiting Body Basal Stem Rot (BSR) Bedagai Bandar 4. CS7 Indonesia South SCK Fruiting Body Basal Stem Rot (BSR) Sumatera 5. I202 Indonesia Asahan Aek Loba Fruiting Body Basal Stem Rot (BSR) 6. Paya Indonesia Tebing Paya Pinang Fruiting Body Basal Stem Rot (BSR) Pinang Tinggi 7. Isolate 192 Indonesia Serdang Matapao Fruiting Body Basal Stem Rot (BSR) Bedagai 8. NJ72 Indonesia Batu Bara Tanah Fruiting Body (nursery) Gambus 9. CS1 Indonesia West Pangian Fruiting Body Basal Stem Rot (BSR) Sumatera Barat 10. Isolate 191 Indonesia Serdang Bangun Fruiting Body BSR (fallen dead trunk) Bedagai Bandar 11. NJ3 Indonesia Batu Bara Tanah Fruiting Body (nursery) Gambus 12. 001MJIR Indonesia Labuhanbat MJIR Fruiting Body Basal Stem Rot (BSR) u Utara 13. NJ54 Indonesia Batu Bara Tanah Fruiting Body (nursery) Gambus

2.3. Sequence and data analysis Thirteen nucleotide partials named as isolates: 006PTN3, 25, 3J, CS7, 202, Payah Pinang, 192, NJ72, CS1, 191, NJ3, 001MJR, and NJ54. The functional assignment of DNA sequences of 13 isolates was performed based on a similarity search of the sequences against the Genbank non-redundant (nr) peptide database of NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi) using BLASTX [7].

200 bp 100 bp

Figure 1. DNA polymorphism of Ganoderma isolates using selected SSR primer KT124394

3 AEFS 2018 IOP Publishing IOP Conf. Series: Earth and Environmental Science 260 (2019) 012172 doi:10.1088/1755-1315/260/1/012172

2.4. Phylogenetic analysis of predicted Ganoderma The DNA sequences were aligned, and similarity scores were obtained using the FASTA version 3.4t26 [8] of the DNA Data Bank of Japan (Mishima, Shizuoka, Japan). The best score of results is shown in Table 3. Phylogenetic analysis of 13 isolates DNA sequences was conducted with CLUSTAL W version 1.83 [9] of the DNA Data Bank of Japan followed by drawing with TreeView, ver. 1.6.6 [10] based on a neighbor-joining method. Bootstrap analysis with 1000 replications was used to assess the strength of the nodes in the tree [11].

3. Results and Discussion Diseases of BSR have been reported to appear in some areas where oil palm crops are located, covering from Africa such as Congo, Cameroon, Ghana, Nigeria, America such as Honduras, Oceania such as Papua New Guinea and regions in Southeast Asia such as Indonesia and Malaysia [1-5]. Many infections occur with the appearance of the fruiting body at the base of the stem of the oil palm tree, the base of the stem is hollow, the spear leaves do not open, yellowing canopy. BSR can result in huge losses [1-2]. The DNA sequence between 13 isolates of Ganoderma from Elaeis guineensis shared 89-99% among themselves (Table 1), showing Ganoderma boninense strain NJ3 microsatellite 17b sequence/KT124394.1. The total score varied among the isolates from 228 to 333 (Table 2). Similarly E-value show diversity among the isolates investigated.

Table 2. Description isolates of G. boninense using Blastx [8]

Identity Total Isolates Description/Accession E-value (%) Score

Ganoderma boninense strain NJ3 1. 006PTN3 95 287 5e-75 microsatellite 17b sequence/KT124394.1 Ganoderma boninense strain NJ3 2. I5 89 228 3e-57 microsatellite 17b sequence/KT124394.1 Ganoderma boninense strain NJ3 3. J 99 327 3e-87 microsatellite 17b sequence/KT124394.1 Ganoderma boninense strain NJ3 4. CS7 99 326 1e-86 microsatellite 17b sequence/KT124394.1 Ganoderma boninense strain NJ3 5. I202 98 326 1e-86 microsatellite 17b sequence/KT124394.1 Ganoderma boninense strain NJ3 6. Paya Pinang 99 333 7e-89 microsatellite 17b sequence/KT124394.1 Ganoderma boninense strain NJ3 7. Isolate 192 99 327 3e-87 microsatellite 17b sequence/KT124394.1 Ganoderma boninense strain NJ3 8. NJ72 99 333 7e-89 microsatellite 17b sequence/KT124394.1 Ganoderma boninense strain NJ3 9. CS1 96 300 7e-79 microsatellite 17b sequence/KT124394.1 Ganoderma boninense strain NJ3 10. I191 98 316 7e-84 microsatellite 17b sequence/KT124394.1 Ganoderma boninense strain NJ3 11. NJ3 94 285 2e-74 microsatellite 17b sequence/KT124394.1 Ganoderma boninense strain NJ3 12. 001MJIR 98 327 3e-87 microsatellite 17b sequence/KT124394.1 Ganoderma boninense strain NJ3 13. NJ54 microsatellite 17b sequence/KT124394.1 99 327 3e-87

The genotypic diversity of Ganoderma spp. on palm oil is quite high. This may be explained by the nature of the fruit body which is the result of different heterokaryon marriages between hyphae. To produce the fruit body, Ganoderma spp. must perform sexual reproduction with different hyphae. Thus,

4 AEFS 2018 IOP Publishing IOP Conf. Series: Earth and Environmental Science 260 (2019) 012172 doi:10.1088/1755-1315/260/1/012172

DNA recombination that occurs during sexual reproduction contributes to high genetic diversity [12]. Two types of Ganoderma grow on oil palm (dead and alive palm oil) and dead coconut.

Isolates 001MJIR

759

Isolates 3J

244

Isolates NJ54

335

Isolates NJ72 111

Isolates 192

259 Isolates 191 165 342

Isolates CS1

Isolates CS7

361

Isolates 006PTPN3

Isolates NJ3

620

Isolates 5

Isolates 202

478

Isolates Payah Pinang

Figure 2. The dendrogram is depicting the genetic relationship of Isolates Ganoderma using selected SSR primer KT124394. The indicated scale corresponds to 0.1 DNA sequence substitutions per site. Numbers indicate bootstrap value from 1000 replicates.

Type Palmae, Ganoderma boninense, is the primary pathogen in oil palm and is usually found in large quantities in dead coconut trunk. The 'forest' type, Ganoderma tornatum, usually grows as a saprophyte on the trunk of oil palm and coconut and stump. Also, it is widespread to grow on hardwood [13-14].

5 AEFS 2018 IOP Publishing IOP Conf. Series: Earth and Environmental Science 260 (2019) 012172 doi:10.1088/1755-1315/260/1/012172

To control BSR, knowledge of the characteristics, properties, and behaviour of Ganoderma spp. is indispensable. One of the early stages of characterization is molecular identification. Conventional classification methods have limitations in discrimination because of the morphological characteristics of Ganoderma spp. may change depending on environmental conditions. This has in some aspects confused the identity of Ganoderma species that attack oil palm in Malaysia [4-5]. To confirm the relationship among the isolates, a clustering was carried out as previously described [15]. Figure 2 shows that there are three branches of a phylogenetic tree, namely main branch consisted of 9 isolates: 001MJIR, 3J, NJ54, NJ72, 192, 191, CS1, CS57, and 006PTPN3. The second branch comprised only two isolates: NJ3 and 5. The last branch had only two isolates: 202 and payah pinang. To confirm the homology among the isolates, the DNA sequence was performed. The isolates show high similarity among the strains (more than 90% similarity each other) as displayed in Table 3. It is noteworthy that the utilization of primer KT124394 was powerful to detect the possibility the existence of G. boninense in the oil palm plantation.

Table 3. DNA sequence similarity between isolates

Isolates 1 2 3 4 5 6 7 8 9 10 11 12 13

1. 006PTN3 100 2. I5 90 100 3. J 93 90 100 4. CS7 93 92 94 100 5. I202 90 90 96 94 100 6. Paya Pinang 93 92 96 96 95 100 7. Isolate 192 93 92 97 97 95 97 100 8. NJ72 91 89 96 97 95 98 95 100 9. CS1 93 92 94 94 93 95 96 94 100 10. Isolat 191 90 92 95 96 94 96 98 95 96 100 11. NJ3 90 90 95 93 93 94 94 93 93 93 100 12. 001MJIR 92 90 98 96 94 96 98 98 96 98 94 100 13. NJ54 92 91 96 97 94 96 95 97 95 97 93 98 100

The selected SSR primer KT124394 for sequencing gives the best result, the base pair of all isolates locates on the band 200 bp. To compare with the referenced paper [16] show size (bp) of primer KT124394 is 234-243. Therefore, to ensure the biomolecular Ganoderma species present in the collection, this study was conducted using Simple Sequence Repeats (SSR) method for the next study.

4. Conclusions All the isolates which taken from a different location on this research are Ganoderma boninense, usually found as a main virulent pathogen on oil palm tree is known as a causal agent for BSR disease. The present study clarified through DNA sequences that Ganoderma from oil palm has been defined as a G. boninense, which is identical virulent for the appearance of BSR disease.

References [1] Ariffin D, Idris A S and Singh G 2000 Status of Ganoderma in Oil Palm Ganoderma Diseases of Perennial Crops (United Kingdom: CABI Publishing Wallingford) pp 46-68 [2] Sariah M M Z, Hussin R N G, Miller and Holderness 1994 Pathogenicity of Ganoderma boninense tested by inoculation of oil palm seedlings J Plant Pathol 43 pp 507-10

6 AEFS 2018 IOP Publishing IOP Conf. Series: Earth and Environmental Science 260 (2019) 012172 doi:10.1088/1755-1315/260/1/012172

[3] Breton F, Hasan Y, Hariadi, Lubis Z and de Franqueville H 2006 Characterization of the parameter the development of an early screening test for basal stem rot tolerance in oil palm progenies J Oil Palm Res pp 24-36 [4] Darmono T W 1998 Variation among isolates of Ganoderma sp. from oil palm in Indonesia Second International Workshop 2nd on Ganoderma Disease Malaysia [5] Ho Y W and Nawawi A 1985 Ganoderma boninense Pat. From basal stem rot of oil palm (Elaeis guineensis) in Peninsular Malaysia J Pertanika 8 pp 425-28 [6] Basyuni M, Baba S and Oku H 2017 Microsatellite analysis on genetic variation in two populations of red mangrove Rhizophora Mangle L (Rhizophoraceae) and its implication to conservation IOP Conf Ser Mater Sci Eng 180 012243 [7] Basyuni M and Wati R 2017 Bioinformatics analysis of the oxidosqualene gene and the amino acid sequence in mangrove plants J Phys Conf Ser 801 012011 [8] Pearson W R and Lipman D J 1988 Improved tools for biological sequence comparison Proc Natl Acad Sci USA 85 pp 2444–48 [9] Thompson J D, Higgins D G and Gibson T J 1994 Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties, and weight matrix choice Nucleic Acid Res 22 pp 4673–80 [10] Page R D 1996 Tree View : an application to display phylogenetic trees on personal computers Comput Appl Biosci 12 pp 357–58 [11] Felsenstein J 1985 Confidence limits on phylogenies: an approach using the bootstrap Evolution 39 pp 783–91 [12] Latiffah Z, Abdullah F, Harikhrisna K, Tan S G and Ho Y W 2002 Morphological and growth characteristic and somatic incompatibility of Ganoderma from infected oil palm and coconut stumps J Malaysian Appl Biol 31 pp 37-48 [13] Purnamasari M I, Prihatna C, Gunawan A W and Suwanto A 2012 Isolasi dan identifikasi secara molekuler Ganoderma spp. yang berasosiasi dengan penyakit busuk pangkal batang di kelapa sawit J Fitopatol Indones 8 1 pp 9-15 [14] Pilotti C 2006 A Field Guide for the identification of Ganoderma on oil palm and coconut J The operative Word [15] Basyuni M, Wati R, Sagami H, Sumardi, Baba S and Oku H 2018 Diversity and abundance of polyisoprenoid composition in coastal plant species from North Sumatra Indonesia Biodiversitas 19 pp 1–11 [16] Merciere M, Laybats A, Carasco-Lacombe C, Tan J S, Klopp C, Durand-Gasselin T, Alwee SSRS, Camus-Kulandaivelu L and Breton F 2015 Identification and development of new polymorphic microsatellite markers using genome assembly for Ganoderma boninense causal agent of oil palm basal stem rot disease J Mycol Progress 14 p 103

Acknowledgment This work was supported in part by a Penelitian Strategis Nasional Institusi (PSN Institusi 2018 to MB) from the Directorate for Research and Community Service, Ministry of Research, Technology and Higher Education, Republic of Indonesia. The authors are very grateful to PT Socfin Indonesia for full support on this study and also the Universitas Sumatera Utara.

7 The 3rd International Conference on Computing and Applied Informatics 2018 IOP Publishing IOP Conf. Series: Journal of Physics: Conf. Series 1235 (2019) 012071 doi:10.1088/1742- 6596/1235/1/012071

Bioinformatics analysis of predicted Ganoderma boninense from oil palm (Elaeis guineensis)

M Basyuni1, A Purba2, L A P Putri3, R Hayati2, D Chalil4, I Syahputra5

1Department of Forestry, Faculty of Forestry, Universitas Sumatera Utara, Jl. Tri Dharma Ujung No. 1 Medan, North Sumatera 20155, Indonesia 2Graduate School of Agricultural Sciences, Faculty of Agriculture, Universitas Sumatera Utara, Medan, North Sumatera 20155, Indonesia 3Department of Agrotechnology, Faculty of Agriculture, Universitas Sumatera Utara, Medan, North Sumatera 20155, Indonesia 4Department of Agribusiness, Faculty of Agriculture, Universitas Sumatera Utara, Medan, North Sumatera 20155, Indonesia 5Laboratory of Biomolecular of PT Socfin Indonesia, Martebing, Dolok Masihul, Tebing Tinggi 20991, North Sumatra, Indonesia

*Email: [email protected]

Abstract. The current report examines the bioinformatics approaches to analyse 13 predicted

Ganodermaboninense genes from Elaeis guineensisJacq. along with predicted the assembly, pattern, potential transit peptide, and subcellular localisation. The length of the genes was varied with the genes examined, from 209 to 222 bp. It is noteworthy the physicochemical heterogeneity properties consistingcomparative molecular weight, theoretical isoelectric point value, the total atomic number, extinction coefficient, instability coefficient, aliphatic index, and general average hydropathicity along with the analysed genes. Based on stability coefficients, 13 G. boninense genes were unstable proteins, mostly stored in the cytoplasm, microbody (peroxisome), and endoplasmic reticulum (membrane). In contrast to this osbervation, a few genes were existed to the plasma membrane. BLAST search showed that 13 sequences of G. boninenses isolates show high similarity (89-99%) to the G. boninense strain NJ3 in the database of NCBI.These findingspointed the significantknowledge on the diversity and role of physical and chemical characteristics of the distinguishable amino acids in G. boninenseisolates.

1. Introduction Indonesia is currently the world's first palm oil producer with 36.5 million metric tons of palm oil production or nearly 70% of world palm oil production [1]. Inappropriately, oil palm plantations (Elaeis guineensisJacq.) in Asia, particularly in Indonesia and Malaysia face the threat of basal stem root (BSR) diseases caused by Ganoderma boninense pathogens[2].G. boninense caused loss of yield and finally killed the palm trees. The G. boninense control is widely studied and developed nowadays by using tolerant plants; however, so far no particular method availably to handle the enduring widespread of the BSR disease [2-3]. Molecular cellular responses of oil palm to these pathogens are not well understood although several lines of genes have been proposed and identified to tolerance or resistance to G. boninense [3- 5]. These genes are vital to strategise active portions to exterminate BSR. Recently a genome sequence

Content from this work may be used under the terms of the Creative Commons Attribution 3.0 licence. Any further distribution of this work must maintain attribution to the author(s) and the title of the work, journal citation and DOI. Published under licence by IOP Publishing Ltd 1 The 3rd International Conference on Computing and Applied Informatics 2018 IOP Publishing IOP Conf. Series: Journal of Physics: Conf. Series 1235 (2019) 012071 doi:10.1088/1742- 6596/1235/1/012071

of the phytopathogenic fungus G. boninense from Indonesian strain G3 has been reported [6], showing a severe symptom of BSR disease in North Sumatra, an endemic BSR. However, the bioinformatics analysis of G. boninensetolerance from E. guinensis has not previously been available. The present report thus purposed to examine 13 sequences of G. boninenses isolates from oil palm using the established bioinformatics method [7-8].

2. Materials and method

2.1. Materials

Selected thirteen isolates of Ganoderma boninense from oil palm (Elaeis guineensisJacq, Arecaceae) belong to PT Socfindo were collected. The isolates namely 006PTN3, 25, 3J, CS7, 202, Payah Pinang, 192, NJ72, CS1, 191, NJ3, 001MJR, and NJ54 was sequenced as shown in Figure 1. The PCR primers were designed based on a previous study [9], primer 7, F:5’- TCGGGTAGGCTCGCAGGTGG-3’, R: 5’-GGGCCGCACAGGTCGAGAAA-3’. PCR with Primers 7F and 7R was performed by MyTaq Red Mix (Bioline)in line with the manufacturer’s protocol. PCR amplification outlinewas for 2 min at 94 ºC, followed by 35 cycles of 30 sec at 94 ºC, 30 sec at 60 ºC and 3 min 72 ºC, with the final extension of 10 min at 72 ºC.PCR products were purified with Zymoclean Gel DNA Recovery Kit (Zymo Research) prior sequenced.

2.2. Physicochemical properties of the G. boninense gene

The composition, physical and chemical properties of G. boninense isolate sequence was performed using Protparam online(web.expasy.org/protparam/). The calculated factors define the molecular weight, theoretical isoelectric point values, atomic composition, extinction coefficient, half-life estimation, instability index, aliphatic index, and grand typical hydropathicity as earlier shown[10].

2.3. Potential transit of peptide and subcellular localisation

To measure the transit peptide, the targetP1.1 server online (www.cbs.dtu.dk/services/targetp/) was employed. The site is built on the expected incidence of any of the N-terminal pre-sequences chloroplast transit peptide (cTP), mitochondrial targeting peptide (mTP), and secretory pathway signal peptide (SP). Likewise, PSORT Prediction online (psort.hgc.jp/form.html) was applied to control the subcellular localisation of 13 sequences of G. boninense as previously described [10].

Figure 1. 1 μL PCR Products were assessed byelectrophoresis with 1%TBE agarose. Sample numbers 1-13 denoted as isolates:006PTN3, 25, 3J, CS7, 202, Payah Pinang, 192, NJ72, CS1, 191, NJ3, 001MJR, and NJ54.

3. Results and Discussions

3.1. Physicochemical features

Table 1 depicts some linefactors of physicochemical of G. boninense isolates extracted from oil palm plantation. The G. boninense sequence consists of thirteen clones. The length of the genes was varied

2 The 3rd International Conference on Computing and Applied Informatics 2018 IOP Publishing IOP Conf. Series: Journal of Physics: Conf. Series 1235 (2019) 012071 doi:10.1088/1742- 6596/1235/1/012071

with the genes examined, from 209 to 222 bp. It is notable the heterogeneity of comparative molecular weight, theoretical isoelectric point value, the total number of atoms, extinction coefficient, instability coefficient, aliphatic index, and general average hydropathicity along with the analysed genes (Table 1). BLAST search shows that the 13 13 sequences of G. boninenses isolates from oil palm shows high similarity (89-99%) to the G. boninense strain NJ3 in the database of NCBI. It is important to note that the approximate half-life period was diverse among the genes (1.2-7.2 h). Oxidosqualenecyclase (OSC) genes had the same half-time from Rhizophoraceae tribe (4.4 h) [7], mangrove actin genes have been shown to have a variety half-time (1.3-30 h) [11], Kandeliaobovata polyprenolreductase gene and 14 expressed sequence tags from Rhizophorastylosa possessed 1.2-30 h of half-time [12, 13]. However, the predictable half-life of polyprenolreductase of plant species was surprisingly to have similar half-time (30 h) [8]. It is noteworthy that these clones had 5.10-5.29 theoretical isoelectric point values (Table 1) and 2188-2347 total numbers of atoms.

Table 1.Physical and chemical characteristics of G. boninenseisolates G. boninense clone Clone 202 Clone CS1 Clone 06PTPN3 Clone 5 Length of genes/bp 213 213 209 222 Molecular weight 17787.43 17915.67 17531.17 18805.61 Theoretical isoelectric point values 5.29 5.27 5.10 5.10 Total number of atoms 2213 2217 2179 2347 Extinction coefficient 4000 4250 4000 4250 Half-life period 4.4h 1.2h 7.2h 7.2h Instability coefficient 60.45 57.50 56.43 58.63 Aliphatic index 25.82 23.94 25.36 25.23 Grand average of hydropathicity 0.994 1.007 1.000 0.976

Table Continue Clone G. boninense clone 001MJIR Clone CS57 Clone 191 Length of genes/bp 214 213 212 Molecular weight 17832.49 17829.45 17658.27 Theoretical isoelectric point values 5.10 5.11 5.28 Total number of atoms 2214 2223 2193 Extinction coefficient 4125 4000 4000 Half-life period 7.2h 7.2h 1.2h Instability coefficient 52.16 52.55 52.96 Aliphatic index 25.23 25.82 25.00 Grand average of hydropathicity 0.992 0.997 0.981

Table Continue G. boninense clone Clone 192 Clone J Clone NJ3 Length of genes/bp 212 212 217 Molecular weight 17672.30 17612.25 18370.16 Theoretical isoelectric point values 5.29 5.29 5.29 Total number of atoms 2196 2188 2293 Extinction coefficient 4000 4000 4125 Half-life period 4.4h 4.4h 4.4h Instability coefficient 53.07 55.43 55.41 Aliphatic index 25.47 26.42 26.73 Grand average of hydropathicity 0.992 1.015 1.018

Table Continue Clone Paya G. boninense clone Clone NJ54 Clone NJ72 Pinang Length of genes/bp 213 210 212 Molecular weight 17867.61 17644.27 17790.43

3 The 3rd International Conference on Computing and Applied Informatics 2018 IOP Publishing IOP Conf. Series: Journal of Physics: Conf. Series 1235 (2019) 012071 doi:10.1088/1742- 6596/1235/1/012071

Theoretical isoelectric point values 5.27 5.11 5.10 Total number of atoms 2215 2199 2214 Extinction coefficient 4250 4000 4000 Half-life period 1.2h 7.2h 7.2h Instability coefficient 53.53 48.92 52.35 Aliphatic index 25.35 25.71 25.00 Grand average of hydropathicity 1.026 0.987 0.997

Based on stability coefficients, 13 G. boninense genes were non-stable proteins. A few genes have been shown asstable genes from plant polyprenol reductase genes, for example, Glycine max, G. arboretum, and G. raimondii[8].OSC genes also have been described in Bruguiera gymnorrhiza b- amyrin synthase (BgbAS)and Rhizophora stylosa cycloartenol synthase(RcCAS) also had stable proteins [7], stable proteins were derived from mangrove actin genes: B. gymnorrhiza BgAct1, KcAct1 from K. candel, and RsAct1 from R. stylosa [11]. Very recently, Rs1 from R. stylosa EST had the stable gene (31.52) [14]. These findings demonstrated the significant agreement for the variation and role of physical and chemical characteristics of the distinguishable amino acids in G. boninenseisolates [8].

3.2. Prospective transit of peptide and subcellular localisation

Table 2 describes the prospect of the impending transit peptide in 13 clones from G. boninense. There are three options: chloroplast transit peptide, mitochondrial target peptide and signal peptide of secretory pathway together with the estimate possibility. The target chloroplast diversedfrom 0.090 to 0.274, with the uppermost values of chloroplast be appropriate to clone C5 (0.274), designated that chloroplast transit peptide existing in the nominee genes of Ganoderma tolerance. It is remarkablethat the target peptide assessment of mitochondria was a reduced amount ofassociated with chloroplast transit or mitochondrial peptide. The maximum indicator peptide of the secretory pathway was CS1. Reliability prediction value of 3 (77%) dominated in the G. boninense the genes. Table 3 illustrates the subcellular localisation of partial fragment genes in G. boninense. The subcellular localisation of these genes was generally resided in the cytoplasm, microbody (peroxisome), and endoplasmic reticulum (membrane). In contrast, a few genes kept in the plasma membrane, such as C001MJIR, CS57, CJ, and CNJ54 (Table 3). Recently, it has been reported that the expression of triterpenoid synthase genes was increased the triterpenoid concentration of entire cell body and plasma membrane portions [7]. Table 3 shows thatC001MJIR, CS57, CJ, and CNJ54, which show the uppermost value of cytoplasm were employed on the plasma membrane, supported previous papers on their subcellular localisation of triterpene genes sited in the plasma membrane [7, 13]. The reliability and practically ofthe plasma membrane are therefore a key element for salt tolerance mechanism in G. boninense[14]. G. boninense become an obstacle of the importance of oil palm as essential commodities in Indonesia to produce crude palm oil from the fruit mesocarp and palm kernel oil from the palm seed or kernel [15-16]. Recently the profile of polyprenols and dolichols in the leaves of oil palm plantations under different land-uses in North Sumatra, Indonesia has been described [17-18]. The finding of pattern polyisoprenoids in oil palm supported that replanting effort and the resolve of widespread of G. boninense in the oil palm plantation areas both small holders and companies.

4 The 3rd International Conference on Computing and Applied Informatics 2018 IOP Publishing IOP Conf. Series: Journal of Physics: Conf. Series 1235 (2019) 012071 doi:10.1088/1742-6596/1235/1/012071

Table 2. The possibility of the potential transit peptide in Ganoderma boninensepolyprenolreductase G. boninense clone Reliability Chloroplast Mitochondrial Signal peptide of Reliability transit peptide target peptide secretory pathway prediction

C202 0.116 0.184 0.019 3 CS1 0.110 0.148 0.026 3 C06PTPN3 0.123 0.196 0.027 3 C5 0.274 0.105 0.021 4 C001MJIR 0.090 0.174 0.015 2 CS57 0.127 0.155 0.019 3 C191 0.131 0.187 0.014 2 C192 0.123 0.191 0.012 3 CJ 0.152 0.153 0.014 3 CNJ3 0.196 0.153 0.013 3 CNJ54 0.115 0.155 0.019 3 CNJ72 0.145 0.154 0.016 3 Cpaya Pinang 0.166 0.134 0.016 3

Table 3. Subcellular localisation of predicted G. boninense G. boninense endoplasmic microbody mitochondrial Plasma clone Cytoplasm reticulum (peroxisome) matrix space membrane (membrane) C202 0.450 0.252 0.100 0.000 nd CS1 0.650 nd 0.100 0.000 nd C06PTPN3 0.650 nd 0.100 0.000 nd C5 0.650 nd 0.100 0.000 nd C001MJIR 0.650 nd 0.100 0.000 0.100 CS57 0.650 nd 0.100 0.000 0.100 C191 0.450 0.207 0.100 0.000 nd C192 0.450 0.305 0.100 0.000 nd CJ 0.650 nd 0.100 0.000 0.100 CNJ3 nd nd 0.528 nd nd CNJ54 0.650 nd 0.100 0.000 0.100 CNJ72 0.450 0.279 0.100 0.000 nd Cpaya Pinang 0.450 0.491 0.100 0.000 nd nd= not detected

4. Conclusions There are four clones:C001MJIR, CS57, CJ, and CNJ54, showing the utmost value on the plasma membrane, reinforced priorstudies on the subcellular localisation of triterpenoid genes detected in the plasma membrane. The current report indicated the significant role of features of the partial clones of probably G. boninense tolerance genes in E. guinenesis genomic library.

Acknowledgement This work was partly supported by a Penelitian Strategis Nasional Institusi (PSN Institusi 2018 to MB) from the Directorate for Research and Community Service, Ministry of Research, Technology and

5 The 3rd International Conference on Computing and Applied Informatics 2018 IOP Publishing IOP Conf. Series: Journal of Physics: Conf. Series 1235 (2019) 012071 doi:10.1088/1742- 6596/1235/1/012071

Higher Education, Republic of Indonesia. The authors are grateful to PT. Socfin Indonesia for laboratory facility and the Universitas Sumatera Utara.

References [1] USDA 2017 Indonesia and product annual report 2017USDA Foreign Agricultural Service. [2] Hushiarian R, Yusof NA, Dutse SW 2013 Detection and control of Ganoderma boninense: strategies and perspectivesSpringerPlus2555. [3] Tan YC, Yeoh KA, Wong MY, Ho CL 2013 Expression profiles of putative defence-related proteins in oil palm (Elaeis guineensis) colonised by Ganoderma boninense J. Plant Physiol.170 1455– 1460 [4] Tee SS, Tan YC, Faridah A, Meilina OA, Ho CL 2013 Transcriptome of oil palm (Elaeis guineensis Jacq.) roots treated with Ganoderma boninense Tree Genet. Genomes9 377–386 [5] Foan CC, Lee YW, Tan JS, Alwee SSRS 2012 Amplification and sequencing of partial-length disease resistance gene homologues coding for NBS-LRR proteins in oil palm (Elaeis guineensis) As Pac J. Mol. Biol. Biotechnol.20 25-31 [6] Utomo C, Tanjung ZA, Aditama R, Buana RF, Pratomo AD, Tryono R, Liwang T 2018 Draft genome sequence of the phytopathogenic fungus Ganoderma boninense, the causal agent of basal stem rot disease on oil palmGenome Announc. 6e00122-18. [7] Basyuni M, R Wati 2017 Bioinformatics analysis of the oxidosqualene gene and the amino acid sequence in mangrove plants J. Phys. : Conf. Ser. 801 012011. [8] Basyuni M, Wati R 2018 Bioinformatics analysis of the predicted polyprenol reductase genes in higher plants J. Phys. : Conf. Ser. 978012050. [9] Mercière M, Laybats A, Carasco-Lacombe C, Tan JS, Klopp C, Durand-Gasselin T, Alwee SS, Camus-Kulandaivelu L, Breton F 2015 Identification and development of new polymorphic microsatellite markers using genome assembly for Ganoderma boninense, the causal agent of oil palm basal stem rot diseaseMycol. Prog. 14103. [10] Basyuni M, Sumardi 2017 Bioinformatics approach of salt tolerance gene in mangrove plant Rhizophora stylosa J. Phys.: Confer. Ser. 801 012012. [11] Basyuni M, Wasilah M 2018 Bioinformatics study of the mangrove actin genesJ.Phys.: Conf. Ser. 801 012013. [12] Basyuni M, Wati R, Sagami H, Oku H, Baba S 2018 Bioinformatics approach of three partial polyprenol reductase genes in Kandelia obovataJ. Phys.: Conf. Ser. 978012044. [13] Basyuni M, Sagami H, Baba S, Oku H 2018 Genome sequence analysis of predicted polyprenol reductase gene from mangrove plant Kandelia obovataIOP Conf. Ser. : Earth Environ. Sci. 130 012039. [14] Wati R, Basyuni M, Baba S, Oku H 2018 Bioinformatics analysis of the expressed sequence tags from Rhizophora stylosa Griff. genomic library AIP Conf. Proceed.2002020051. [15] Basyuni M, Amri N, Putri LA, Syahputra I, Arifiyanto D 2017 Characteristics of fresh fruit bunch yield and the physicochemical qualities of palm oil during storage in North Sumatra, Indonesia Indones. J. Chem. 17 182–190. [16] Arifiyanto D, Basyuni M, Sumardi, Putri LAP, Siregar ES, Risnasari I, Syahputra I 2017 Occurrence and cluster analysis of palm oil (Elaeis guineensis) fruit type using two- dimensional thin layer chromatography Biodiversitas 18 1487–1492. [17] Basyuni M, Wati R, Deni I, Tia AR, Slamet B, Siregar ES, Syahputra I 2018 Cluster analysis of polyisoprenoid in oil palm (Elaeis guineensis) leaves in different land-uses to find the possible cause of yield gap from planting materialsBiodiversitas 19 1492–1501. [18] Basyuni M, Wati R, Sagami H, Sumardi, Baba S, Oku H 2018 Diversity and abundance of polyisoprenoid composition in coastal plant species from North Sumatra, Indonesia Biodiversitas 19 1–11.