Identification of Genes Showing Differential Expression Profile

c Indian Academy of Sciences

RESEARCH ARTICLE

Identiﬁcation of genes showing differential expression proﬁle associated with growth rate in skeletal muscle tissue of Landrace weanling pig

YUUTA KOMATSU1, SHIN SUKEGAWA2,MAIYAMASHITA1, NAOKI KATSUDA1, BIN TONG1, TAKESHI OHTA1, HIROYUKI KOSE3 and TAKAHISA YAMADA1∗

1Faculty of Agriculture, Department of Agrobiology, Niigata University, Nishi-ku, Niigata 950-2181, Japan 2Research and Development Center, NH Foods Ltd., Tsukuba, Ibaraki 300-2646, Japan 3Department of Natural Sciences, International Christian University, Mitaka, Tokyo 181-8585, Japan

Abstract Suppression subtractive hybridization was used to identify genes showing differential expression profile associated with growth rate in skeletal muscle tissue of Landrace weanling pig. Two subtracted cDNA populations were generated from musculus longissimus muscle tissues of selected pigs with extreme expected breeding values at the age of 100 kg. Three upregulated genes (EEF1A2, TSG101 and TTN) and six downregulated genes (ATP5B, ATP5C1, COQ3, HADHA, MYH1 and MYH7) in pig with genetic propensity for higher growth rate were identified by sequence analysis of 12 differentially expressed clones selected by differential screening following the generation of the subtracted cDNA population. Real-time PCR analysis confirmed difference in expression profiles of the identified genes in musculus longissimus muscle tissues between the two Lan- drace weanling pig groups with divergent genetic propensity for growth rate. Further, differential expression of the identified genes except for the TTN was validated by Western blot analysis. Additionally, the eight genes other than the ATP5C1 co- localized with the same chromosomal positions as QTLs that have been previously identified for growth rate traits. Finally, the changes of expression predicted from gene function suggested association of upregulation of expression of the EEF1A2, TSG101 and TTN genes and downregulation of the ATP5B, ATP5C1, COQ3, HADHA, MYH1 and MYH7 gene expression with increased growth rate. The identified genes will provide an important insight in understanding the molecular mechanism underlying growth rate in Landrace pig breed.

[Komatsu Y., Sukegawa Y., Yamashita M., Katsuda N., Tong B., Ohta T., Kose H. and Yamada T. 2016 Identiﬁcation of genes showing differential expression proﬁle associated with growth rate in skeletal muscle tissue of Landrace weanling pig. J. Genet. 95, xx–xx]

Introduction Comparative analyses of expression proﬁles are useful in identifying the molecular differences between divergent Pig breeding programmes have focussed on growth rate and muscle phenotypes (Wimmers et al. 2004). Transcriptome leanness as major objectives in selection (Hammond and analysis of skeletal muscle tissue may be particularly valu- Leitch 1998). Selection for increased growth rate in pig has able for such studies. In recent years, the transcriptome stud- been used to develop lines with increased body and mus- ies performed in pig skeletal muscle tissue were based on the cle weight in commercial breeds (e.g. Landrace and Large analysis of difference in gene expression patterns between White) (Fredeen and Mikami 1986). Because of the impor- samples from different breeds with divergent growth tance of the growth rate on the line development of commercial rate proﬁles (e.g. commercial breed with higher growth breeds, there is great interest in gaining a better understand- rate versus indigenous breed with lower growth rate) (Lin ing of the networks of expressed genes and the biological and Hsu 2005; Cagnazzo et al. 2006;Murániet al. 2007; pathways controlling the growth rate in skeletal muscle tis- Tang et al. 2007;Xuet al. 2009;Kimet al. 2010; Davoli sue, which exhibits physiological changes in pig selected for et al. 2011). This experimental design is suited to under- increased growth rate (Casas-Carrillo et al. 1997). stand the between-breed component of the skeletal muscle transcriptome associated with the growth rate. However, ∗ the molecular network might differ among different genetic For correspondence. E-mail: [email protected]. Yuuta Komatsu, Shin Sukegawa and Mai Yamashita contributed equally to backgrounds (Cánovas et al. 2012). Therefore, the informa- this work. tion on this between-breed component seems not to result

Keywords. expression proﬁle; growth rate; Landrace pig; skeletal muscle; suppression subtractive hybridization.

Journal of Genetics Yuuta Komatsu et al. in an accurate knowledge of the within-breed component of Differential screening the skeletal muscle transcriptome in a commercial pig, which To check unique expression of the subtracted cDNA may be useful for the line development in commercial breeds due to selection. sequences, all transcript clones were subjected to differential The molecular events resulting in increased growth rate screening. Subtracted cDNA inserts were amplified by PCR are likely to occur in part around the weanling age when fat- using plasmid DNA as a template and nested PCR primer tening is started (Gross 1986). Thus, in this study, we have 1 and nested PCR primer 2 as primer, with Advantage 2 investigated difference in skeletal muscle gene expression polymerase mix (Clontech). PCR products were denatured profiles between two groups of Landrace weanling pigs with in 0.5 mol/L NaOH, transferred onto two identical Hybond divergent genetic propensity for growth rate. N membranes (GE Healthcare, Little Chalfont, UK) and UV cross-linked. Macroarrays were subsequently hybridized with the different probes (cDNA obtained from high-growth group and low-growth group). Probe labelling was per- Materials and methods formed using DIG high prime DNA labelling and detection Samples starter kit (Roche, Mannheim, Germany) as described by the manufacturer. The screening was performed visually. In this study, we used six weanling males of Landrace (three animals with genetic propensity for extremely high growth rate and three animals with extremely low growth rate, Analysis of differentially expressed clones named as high-growth group and low-growth group, respectively). These animals were selected from the extreme tails of The insert DNA containing checked differentially expressed the distribution, based on the expected breeding value for the cDNA sequence was sequenced using the 3730xl DNA ana- age at 100 kg calculated as (sire’s predicted breeding value + lyzer following standard Big Dye protocols (Applied Biosys- − − − dam’s predicted breeding value)/2 ( 5.03, 5.50 and 6.50 tems, Foster City, USA). The basic local alignment search for the high-growth group and 4.10, 4.71 and 5.91 for the tool (BLAST) (Altschul et al. 1990) was used to identify low-growth group), in a conventional commercial Landrace = sequence homology of each differentially expressed cDNA population (n 140). This population has been maintained sequence with publicly available pig genome data in dif- by mating between Landrace pig breed, consisting of a diver- ferent partially overlapping databases: GenBank Nucleotide sity of lines. There was no bias for a specific line in these nr/nt, GenBank Genome Pig (Sscrofa10.2 release, Septem- animals. Animals had been reared in the same conditions, ber 2011), and Ensembl Pig Genome (Sscrofa10.2). The and musculus longissimus muscle tissues were taken from these animals at the age of 23 days. This study conformed sequence homology was considered ‘true’ only if: (i) e-value − to the guidelines for animal experimentation of the Gradu- was higher than 20, (ii) more than 80% of the sequence ate School of Science and Technology, Niigata University length was homologous to the target and (iii) the homo- (Niigata, Japan). logy percentage was higher than 90% for pig sequences and higher than 75% for nonpig sequences. To identify the chromosomal position of each differentially expressed Generation of subtracted cDNA population cDNA sequence in this study, the GenBank pig genome database (Sscrofa10.2) was searched to detect the match We extracted mRNA from the muscle tissue sample using Poly(A) Purist kit (Ambion, Austin, USA). Both quality and with sequences already integrated in the genome assembly. quantity were evaluated using the 2100 BioAnalyzer (Agi- The map information of the matched sequences obtained lent, Santa Clara, USA). Two mRNA pools, each was created was integrated into QTL map available at Pig QTL database from three animals of the high-growth group or low-growth (Hu and Reecy 2007) in NAGRP Pig Genome Coordination group. Suppression subtractive hybridization (Diatchenko Program (http://www.animalgenome.org/pig/). et al. 1996) was performed using a PCR Select cDNA Subtraction kit (Clontech, Mountain View, USA) and Advan- tage 2 Polymerase Mix (Clontech) as described by the man- Real-time PCR analysis ufacturer. Forward and reverse subtractions were carried out Total RNA was extracted from the muscle tissue using using 2 μg of the pooled mRNA samples. A control exper- RNeasy fibrous tissue kit (Qiagen) according to the man- iment was included following the manufacturer’s instruc- ufacturer’s instructions. Total RNA (2 μg) was reverse- tions. The two subtracted cDNA populations were cloned into the pCR2.1-TOPO vector of the TOPO TA Cloning Kit transcribed into cDNA using iScript advanced cDNA syn- (Invitrogen, Carlsbad, USA) and transformed into E. coli thesis kit for RT-qPCR (Bio-Rad, Hercules, USA) accord- TOP10 (Invitrogen). Following overnight growth on selec- ing to the manufacturer’s instructions. Real-time PCR was tive media, colonies were picked and incubated at 37◦Cin performed using SsoAdvanced SYBR Green Supermix (Bio- 5 mL LB medium. Ninety-six plasmids for each subtracted rad). The eukaryotic translation elongation factor 1 alpha 2 cDNA population were randomly selected and plasmid DNA (EEF1A2), tumour susceptibility 101 (TSG101), titin (TTN), + was extracted using QIAprep Spin Miniprep kit (Qiagen, ATP synthase, H transporting, mitochondrial F1 complex, Hilden, Germany). beta polypeptide (ATP5B), ATP synthase, H+ transporting,

Journal of Genetics Pig growth-associated expression profile mitochondrial F1 complex, gamma polypeptide 1 (ATP5C1), COQ3, HADHA, MYH1 and MYH7 relative to GAPDH coenzyme Q3 methyltransferase (COQ3), hydroxyacyl-CoA were calculated as the expression levels of each protein. dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydra- tase (trifunctional protein), alpha subunit (HADHA), myosin, heavy chain 1, skeletal muscle, adult (MYH1) and myosin, Results heavy chain 7, cardiac muscle, beta (MYH7) mRNA expression levels in the individual muscle tissue samples were Suppression subtractive hybridization was used to charac- determined by the MiniOpticon real-time PCR detection sys- terize differential gene expression in skeletal muscle tis- tem (Biorad), using the mRNA-specific primers. A complete sue between high-growth and low-growth groups. Following list of primer sequences is shown in table 1. GAPDH trans- the suppression subtractive hybridization, the forward and cripts were amplified for normalization within each sample. reverse subtracted cDNA populations were cloned to obtain The reaction was performed in 20 μL, containing 10 μL upregulated and downregulated genes in high-growth group, SsoAdvanced SYBR Green Supermix (Biorad), 1 μL of each respectively. primer (10 μmol/L), 2 μL cDNA (2.5 ng/μL) and 6 μL A total of 192 clones (96 for each subtracted cDNA population) were randomly picked. To eliminate false pos- RNase/DNase-free H2O. The thermal cycling parameters were as follows: 95◦C for 30 s, followed by 40 cycles at itive clones, differential screening was used. The clones 95◦C for 3 s and 60◦C for 30 s. The relative fold change was were spotted on two sets of macroarrays and differential calculated using the 2−Ct (Schmittgen and Livak 2008). screening was performed using cDNA from high-growth and low-growth groups as probes. We identified four and eight clones as upregulated and downregulated clones in Western blot analysis high-growth group, respectively (table 2). These 12 selected + The lysates were prepared from the muscle tissue sam- clones (4 8) were sequenced and compared against public ple as described by Ngoka (2008). Protein concentration sequence databases. The 12 cDNA sequences ranged from was determined with BCA Protein Assay kit (Pierce, Rock- 147 to 798 bp in length and were submitted to the Gen- ford, USA). Two lysate pools, each was created from the Bank database, whose accession numbers are provided in three animals of the high-growth group or low-growth table 3.Thee-values for homology of these cDNA sequences − group. The pooled lysates (20 μg protein) were subjected with matched sequences were higher than 66, more than to SDS/10% polyacrylamide gel electrophoresis followed by 91% of the sequence length in these cDNA sequences were electrical transfer to polyvinylidene difluoride membranes homologous to matched sequences and the homology per- (Biorad). The membranes were incubated with rabbit poly- centages of these cDNA sequences were higher than 94% clonal anti-EEF1A2, -TSG101, -ATP5B, -HADHA, or - MYH1, or mouse anti-ATP5C1, -COQ3, or -MYH7 anti- Table 2. Summary of the results of differential screening and bodies (Abcam, Cambridge, UK) and bound antibodies were sequence analysis in subtracted cDNA populations. detected using horseradish peroxidase-labelled goat anti- Forwarda Reverseb Total rabbit IgG (Abcam) for rabbit antibodies or goat antimouse IgG for mouse antibodies (Abcam) with Amersham ECL Number of clones 96 96 192 Plus Western Blotting Detection reagents (GE Healthcare). Number of clones after screening 4 8 12 The membrane was also probed with GAPDH as an internal Number of different clones 4 7 11 standard and photographed. Digital images of photographs Number of different genes 3 6 9 were imported into NIH ImageJ software. Densitometric aForward subtracted cDNA population contains upregulated genes analysis was performed on bands using NIH ImageJ software in high-growth group. and the band signal intensities were measured. The band bReverse subtracted cDNA population contains downregulated signal intensities of EEF1A2, TSG101, ATP5B, ATP5C1, genes in high-growth group.

Table 1. Primer sequences used in real-time PCR.

Gene symbol Forward primer Reverse primer

EEF1A2 TGGGCGTGAAGCAGCTGATCGT TTGGTGCTGGGCTCCAGCATGT TSG101 CTGTGGCTGCTGGACACATACC ACGTGTTTCCACTCATGTAGATAAGGAAGA TTN GACAGCACCACCCAACTTCGT ATGCTTCCGCAATCAGTAAGCTGT ATP5B GTGCCAGCTGATGACTTGAC CTGTAGGATCTTTTGCACTCCA ATP5C1 TCGGACCAATTTCTAGTGACATTCAAGGAAGTG GCACTTGCAACGGTATCAAGGGAGAAG COQ3 GGCACTGGAGTGAAAACACCAGCCTT ACATGAGACTTTCAAGCCGTTTTACTACAGTCCTT HADHA CTGCTGATTGACCATGCCAGCAGCCCAAA CTGGTCATGGCCGAAGGCACTTTAATCGCA MYH1 CCAAGGCCACAGACACCTCCTTCAAGAACAAGCTC TGGTACAGCCCGACCACCGTCTCATTCAGG MYH7 GATGCGGAGATGGCCGCATT GACTTTGCCACCCTCTCGAGACA

Journal of Genetics Yuuta Komatsu et al.

Table 3. List of differentially expressed clones selected by differential screening.

Our sequences Matched sequences Coverage Identity Chromosomal Clone Insert size (bp) Accession no. Gene name Accession no. Species e-value (%) (%) positiona

Upregulated clones in high-growth group LS1-13 322 AB899003 EEF1A2 NM_001037464 Bovine 3e−135 100 94 28754692 of chr. 9 LS1-25 499 AB899004 TTN XM_002685260 Bovine 0 97 92 93766120 of chr. 15 LS1-33 247 AB899005 EEF1A2 FM992107 Pig 3e−110 91 99 28754692 of chr. 9 LS1-52 202 AB899006 TSG101 JN882576 Pig 3e−98 99 99 43816933 of chr. 2 Downregulated clones in high-growth group SL1-6 379 AB899007 ATP5C1 XM_005214123 Bovine e−139 99 91 – SL1-8 147 AB899008 HADHA NM_213962 Pig e−66 97 99 119782134 of chr. 3 SL1-9 340 AB899009 COQ3 XM_005674068 Pig 6e−148 100 94 74964869 of chr. 1 SL1-25 379 AB899010 ATP5C1 XM_005214123 Bovine e−140 99 91 – SL2-1 441 AB899011 MYH7 NM_213855 Pig 0 100 100 81080991 of chr. 7 SL2-5 164 AB899012 ATP5B XM_001929410 Pig 4e−77 99 99 23664576 of chr. 5 SL2-12 797 AB899013 MYH1 NM_001104951 Pig 0 100 99 57980496 of chr. 12 SL2-31 798 AB899014 HADHA NM_213962 Pig 0 100 99 119773334 of chr. 3 aChromosomal position represent genomic position of 5-nucleotide in exon sequence of the corresponding gene matched with GenBank pig genome assembly. chr., chromosome; –, no match against GenBank pig genome assembly. for pig matched sequences and higher than 91% for bovine muscle tissues between high-growth and low-growth groups. matched sequences (table 3). Four different sequences of The mRNA expression level was quantified based on the which two (LS1-13 and LS1-33) corresponded to almost the individual skeletal muscle tissues of the three animals of same region of the EEF1A2 gene were identified among the the high-growth group or low-growth group. The expres- four upregulated clones (tables 2 and 3). The LS1-13 clone sion levels of the upregulated genes were significantly higher had 75-bp extended 5-sequences as compared to the LS1-33 (10.24-fold, 6.84-fold and 14.53-fold for EEF1A2, TSG101 clone. Further, among the eight downregulated clones, two and TTN, respectively) in the high-growth group than in the (SL1-6 and SL1-25) were replicate and two (SL1-8 and SL2- low-growth group, by student’s t-test (figure 1;table4). In 31) had the sequences corresponding to different regions of contrast, the expression levels of downregulated genes were the HADHA gene (tables 2 and 3). Thus, we identified three significantly higher (5.26-fold, 14.69-fold, 3.80-fold, 12.32- upregulated (EEF1A2, TSG101 and TTN) and six downregu- fold, 8.89-fold and 12.91-fold for ATP5B, ATP5C1, COQ3, lated genes (ATP5B, ATP5C1, COQ3, HADHA, MYH1 and HADHA, MYH1 and MYH7, respectively) in the low-growth MYH7) in high-growth group (tables 2 and 3). group than in the high-growth group (figure 1;table4). Thus, We performed real-time PCR analysis to confirm differ- difference in expression profiles was confirmed for all the ence in expression profiles of the identified genes in skeletal genes identified in this study, consistent with the results of the

Figure 1. mRNA expression levels of EEF1A2, TSG101, TTN, ATP5B, ATP5C1, COQ3, HADHA, MYH1 and MYH7 genes in skeletal muscle tissues of high-growth (high) and low-growth groups (low). Expression levels in the individual skeletal muscle tissues were determined by real-time PCR and normalized with GAPDH. Expression levels of low-growth group for EEF1A2, TSG101 and TTN and of high- growth group for ATP5B, ATP5C1, COQ3, HADHA, MYH1 and MYH7 were normalized to 1.0. Values are mean ± SD (n = 3). Signiﬁcant difference: *P< 0.05, **P < 0.01, ***P < 0.001.

Journal of Genetics Pig growth-associated expression proﬁle

Table 4. Validation of differential gene expression by real-time PCR analysis and Western blot analysis.

Differential Real-time Western blot Gene name screening PCR analysis analysis

EEF1A2 High > lowa High > low High > low TTN High > low High > low TSG101 High > low High > low High > low ATP5C1 Low > highb Low > high Low > high HADHA Low > high Low > high Low > high COQ3 Low > high Low > high Low > high MYH7 Low > high Low > high Low > high ATP5B Low > high Low > high Low > high MYH1 Low > high Low > high Low > high aHigh > low corresponds to the gene showing higher expression level in high-growth group. bLow > high corresponds to the gene showing higher expression level in low-growth group. mRNA levels obtained by differential screening described above (table 4). Western blot analysis was performed to validate differential expression of the identified genes except for TTN,which could not be subjected to the analysis because of giant protein (Itoh-Satoh et al. 2002). The expression level was quantified based on the two lysates each pooled from skeletal muscle tissues of the three animals of the high-growth group or low-growth group. The expression levels of EEF1A2 and TSG101, respectively, were 2.75-fold and 4.52-fold higher Figure 2. Western blot analysis of EEF1A2, TSG101, ATP5B, in the high-growth group than in the low-growth group (fig- ATP5C1, COQ3, HADHA, MYH1 and MYH7 expression levels ure 2;table4). Conversely, the expression levels of ATP5B, in skeletal muscle tissues of high-growth (high) and low-growth ATP5C1, COQ3, HADHA, MYH1 and MYH7, respectively, groups (low). The pooled lysates (each 20 μg protein) from skele- were 4.63-fold, 3.62-fold, 2.95-fold, 3.49-fold, 6.88-fold and tal muscle tissues of the three animals of the high-growth group 18.90-fold higher in the low-growth group as compared to or low-growth group were electrophoresed in SDS-polyacrylamide (10%) gel. After being transferred to the polyvinylidene difluoride the high-growth group (figure 2;table4). Therefore, these membrane, the blot was incubated with anti-EEF1A2, -TSG101, results supported differential expression for all the analysed -ATP5B, -ATP5C1, -COQ3, -HADHA, -MYH1 or -MYH7 antibod- genes (table 4). ies. Immune complexes were detected with second antibodies and The nine differentially expressed genes were mapped to Amersham ECL Plus Western Blotting Detection reagents. Quan- chromosomes using alignment of sequences of the 12 selec- tification of the expression levels was performed using GAPDH as an internal standard. Values in graphs are the band signal intensities ted clones by differential screening with GenBank pig geno- of EEF1A2, TSG101, ATP5B, ATP5C1, COQ3, HADHA, MYH1 me assembly. Using this approach, eight genes other than and MYH7 relative to GAPDH. ATP5C1 could be localized on the pig genome (table 3). Screening PigQTL database with the matched sequences showed that EEF1A2, TSG101, TTN, ATP5B, COQ3, HADHA, MYH1 and MYH7, respectively, were located within myofibrillogenesis and maintenance of structural integrity of previously identified QTL regions affecting growth rate traits the sarcomere (Itoh-Satoh et al. 2002), respectively. Consid- on pig chromosomes 9, 2, 15, 5, 1, 3,12 and 7 (table 3). ering functions together with the changes of expression in these genes, we suggested that upregulation of their expression might be associated with increased growth rate. Fur- Discussion ther, it has been reported that the EEF1A2 (Serão et al. 2011) and TTN (Davoli et al. 2011) exhibited higher expression The EEF1A2, TSG101 and TTN identified as upregulated levels in skeletal muscle of pig breed with higher growth genes in high-growth group have been reported to be rate than in one with lower growth rate, consistent with our involved in myotube survival and protection from apop- within-breed study using Landrace pig. Besides, our pre- tosis (Ruest et al. 2002), cell growth and maintenance of vious study showed that a polymorphism in the TTN was genomic stability (Krempler et al. 2002;Liuet al. 2010), and associated with growth-related trait in bovine association

Journal of Genetics Yuuta Komatsu et al. study using Japanese Black beef cattle population (Yamada Acknowledgement et al. 2011). Based on these results, we suggested that the upregulated EEF1A2, TSG101 and TTN genes corresponded This work was supported by a grant-in-aid for Scientific Research (C) (no. 24580406) from Ministry of Education, Science, Sports, to the intriguing genes showing differential expression pro- and Culture of Japan. files associated with growth rate in skeletal muscle tissue of Landrace weanling pig. Among the downregulated genes in high-growth group, References the ATP5B (Zhang et al. 2012), ATP5C1 (Itoh et al. 2004), COQ3 (Jonassen and Clarke 2000)andHADHA Altschul S. F., Gish W., Miller W., Myers E. W. and Lipman D. J. 1990 Basic local alignment search tool. J. Mol. Biol. 215, 403– (IJlst et al. 1996) encode mitochondrial proteins that play 410. important roles in mitochondrial activity and function, and Bernard C., Cassar-Malek I., Renand G. and Hocquette J.F. 2009 are involved in oxidative metabolism, activation of which is Changes in muscle gene expression related to metabolism likely to be associated with increase of intramuscular fat con- according to growth potential in young bulls. Meat Sci. 82, 205– tent and decrease of growth rate (Sudre et al. 2005). The 212. Cagnazzo M., te Pas M. F., Priem J, de Wit A. A., Pool M. MYH1 and MYH7, encoding heavy chain subunit of myosin H., Davoli R. et al. 2006 Comparison of prenatal muscle tis- (Schiaffino and Reggiani 1994), respectively, are expressed sue expression profiles of two pig breeds differing in muscle in intermediate and slow type muscle fibres observed to characteristics. J. Anim. Sci. 84, 1–10. some extent and abundantly in pigs with lower growth rate Cánovas A., Pena R. N., Gallardo D., Ramírez O., Amills M. and (Hocquette et al. 1998; Lefaucheur et al. 2004; Wimmers Quintanilla R. 2012 Segregation of regulatory polymorphisms with effects on the gluteus medius transcriptome in a purebred et al. 2008). The changes of expression predicted from pig population. PLoS One 7, e35583. gene function may suggest association of downregulation Casas-Carrillo E., Prill-Adams A., Price S. G., Clutter A. C. and of expression of these genes with increased growth rate. In Kirkpatrick B. W. 1997 Relationship of growth hormone and addition, the genes encoding mitochondrial oxidative meta- insulin-like growth factor-1 genotypes with growth and carcass bolic proteins such as ATP5B, ATP5C1, COQ3 and HADHA traits in swine. Anim. Genet. 28, 88–93. Davoli R., Braglia S., Russo V., Varona L. and te Pas M. F. 2011 (Xu et al. 2009;Kimet al. 2010;Liet al. 2013;Xuet al. Expression profiling of functional genes in prenatal skeletal mus- 2013), and the MYH1 and MYH7 genes (Lefaucheur et al. cle tissue in Duroc and Pietrain pigs. J. Anim. Breed Genet. 128, 2004; Wimmers et al. 2008;Xuet al. 2009;Liet al. 2013) 15–27. have been reported to exhibit higher expression levels in Diatchenko L., Lau Y. F., Campbell A. P., Chenchik A., Moqadam skeletal muscle of pig breed with lower growth rate as com- F., Huang B. et al. 1996 Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific pared to one with higher growth rate. The results of between- cDNA probes and libraries. Proc. Natl. Acad. Sci. USA 93, 6025– breed studies were in agreement with our result from 6030. within-breed study using Landrace pig. Taken together, these Fredeen H. T. and Mikami H. 1986 Mass selection in a pig popula- results suggested that the downregulated ATP5B, ATP5C1, tion: correlated changes in carcass merit. J. Anim. Sci. 62, 1546– COQ3, HADHA, MYH1 and MYH7 genes were regarded as 1554. Gross R. 1986 Modes of growth and regeneration. In Human the intriguing genes showing growth rate associated expres- growth: a comprehensive treatise (ed. F. Falkner and J. Tanner sion changes in skeletal muscle tissue of Landrace wean- J.), vol. 1, pp. 3–26, Plenum Press, New York, USA. ling pig. The information on the nine genes identified in this Hammond K. and Leitch H. W. 1998 Genetic resources and the study will provide an important insight into understanding of global programme for their management. In The genetics of the the molecular mechanism underlying growth rate in skeletal pig (ed. M. F. Rothschild and A. Ruvinsky), pp. 430. CAB International, New York, USA. muscle tissue, which may be useful for the line development Hocquette J. F., Ortigues-Marty I., Pethick D., Herpin P. and in Landrace pig breed. Fernandez X. 1998 Nutritional and hormonal regulation of In this study, only three sample sizes were used. Thus, energy metabolism in skeletal muscles of meat-producing ani- further study using additional samples might be needed to mals. Livest. Prod. Sci. 56, 115–143. Hu Z. L. and Reecy J. M. 2007 Animal QTLdb: beyond a reposi- confirm growth rate associated expression changes of the tory. A public platform for QTL comparisons and integration with nine genes in skeletal muscle tissue of Landrace weanling diverse types of structural genomic information. Mamm. Genome pig. In addition, Bernard et al. (2009) showed that differen- 18, 1–4. tial expression of some genes is probably involved in mus- IJlst L., Ruiter J. P., Hoovers J. M., Jakobs M. E. and Wanders cle mass development independently of fat deposition and R. J. 1996 Common missense mutation G1528C in long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency. Characterization meat quality, suggesting that selection in favour of muscle and expression of the mutant protein, mutation analysis on growth would not modify meat quality to great extent. We genomic DNA and chromosomal localization of the mitochon- did not obtain data for muscle mass, fat deposition and meat drial trifunctional protein alpha subunit gene. J. Clin. Invest. 98, quality in animals used in this study. Therefore, we should 1028–1033. note that it is interesting to examine association of differen- Itoh H., Takahashi A., Adachi K., Noji H., Yasuda R., Yoshida M. et al. 2004 Mechanically driven ATP synthesis by F1-ATPase. tial expression profiles of the identified genes in this study Nature 427, 465–468. with muscle mass, fat deposition and meat quality in future Itoh-Satoh M., Hayashi T., Nishi H., Koga Y., Arimura T., study. Koyanagi T. et al. 2002 Titin mutations as the molecular basis for

Journal of Genetics Pig growth-associated expression proﬁle

dilated cardiomyopathy. Biochem. Biophys. Res. Commun. 291, Schiaffino S. and Reggiani C. 1994 Myosin isoforms in mammalian 385–393. skeletal muscle. J Appl. Physiol. 77, 493–501. Jonassen T. and Clarke C. F. 2000 Isolation and functional expres- Schmittgen T. D. and Livak K. J. 2008 Analyzing real-time PCR sion of human COQ3, a gene encoding a methyltransferase data by the comparative C(T) method. Nat. Protoc. 3, 1101–1108. required for ubiquinone biosynthesis. J. Biol. Chem. 275, 12381– Serão N. V., Veroneze R., Ribeiro A. M., Verardo L. L., Braccini 12387. Neto J., Gasparino E. et al. 2011 Candidate gene expression and Kim N. K., Park H. R., Lee H. C., Yoon D., Son E. S., Kim Y. S. intramuscular fat content in pigs. J. Anim. Breed Genet. 128, 28– et al. 2010 Comparative studies of skeletal muscle proteome and 34. transcriptome profilings between pig breeds. Mamm. Genome 21, Sudre K., Cassar-Malek I., Listrat A., Ueda Y., Leroux C., Jurie 307–319. C. et al. 2005 Biochemical and transcriptomic analyses of two Krempler, Henry M. D., Triplett A. A. and Wagner K. U. 2002 Tar- bovine skeletal muscles in Charolais bulls divergently selected geted deletion of the Tsg101 gene results in cell cycle arrest at for muscle growth. Meat Sci. 70, 267–277. G1/S and p53-independent cell death. J. Biol. Chem. 277, 43216– Tang Z., Li Y., Wan P., Li X., Zhao S., Liu B. et al. 2007 LongSAGE 43223. analysis of skeletal muscle at three prenatal stages in Tongcheng Lefaucheur L., Milan D., Ecolan P. and Le Callennec C. 2004 and Landrace pigs. Genome Biol. 8, R115. Myosin heavy chain composition of different skeletal muscles in Wimmers K., Ponsuksili S. and Schellander K. 2004 The muscle Large White and Meishan pigs. J. Anim. Sci. 82, 1931–1941. transcriptome. In Muscle development of livestock animals: phys- LiA.,MoD.,ZhaoX.,JiangW.,CongP.,HeZ.et al. 2013 Com- iology, genetics, and meat quality (ed. M. F. W. te Pas, H. P. parison of the longissimus muscle proteome between obese and Haagsman and M. E. Everts), pp. 225–245. CAB International, lean pigs at 180 days. Mamm. Genome 24, 72–79. Oxfordshire, UK. Lin C. S. and Hsu C. W. 2005 Differentially transcribed genes in Wimmers K., Ngu N. T., Jennen D. G., Tesfaye D., Murani E., skeletal muscle of Duroc and Taoyuan pigs. J. Anim. Sci. 83, Schellander K. et al. 2008 Relationship between myosin heavy 2075–2086. chain isoform expression and muscling in several diverse pig Liu F., Yu Y., Jin Y. and Fu S. 2010 TSG101, identified by screen- breeds. J. Anim. Sci. 86, 795–803. ing a cancer cDNA library and soft agar assay, promotes cell Xu Y. J., Jin M. L., Wang L. J., Zhang A. D., Zuo B., Xu D. Q. et al. proliferation in human lung cancer. Mol. Biol Rep. 37, 2829– 2009 Differential proteome analysis of porcine skeletal muscles 2838. between Meishan and Large White. J. Anim. Sci. 87, 2519–2527. Muráni E., Murániová M., Ponsuksili S., Schellander K. and Xu H., Xu Y., Liang X., Wang Y., Jin F., Liu D. et al. 2013 Porcine Wimmers K. 2007 Identification of genes differentially expressed skeletal muscle differentially expressed gene ATP5B: molecu- during prenatal development of skeletal muscle in two pig breeds lar characterization, expression patterns, and association analysis differing in muscularity. BMC Dev. Biol. 7, 109. with meat quality traits. Mamm. Genome 24, 142–150. Ngoka L. C. 2008 Sample prep for proteomics of breast cancer: pro- Yamada T., Sasaki S., Sukegawa S., Takahagi Y., Morita M., teomics and gene ontology reveal dramatic differences in protein Murakami H. et al. 2011 Possible association of single nucleotide solubilization preferences of radioimmunoprecipitation assay and polymorphism in titin gene with growth-related trait in Japanese urea lysis buffers. Proteome Sci. 6, 30. Black beef cattle. J. Anim. Vet. Adv. 10, 2603–2606. Ruest L. B., Marcotte R. and Wang E. 2002 Peptide elongation fac- ZhangQ.,XiaoX.,LiM.,LiW.,YuM.,ZhangH.et al. 2012 tor eEF1A-2/S1 expression in cultured differentiated myotubes Telmisartan improves kidney function through inhibition of the and its protective effect against caspase-3-mediated apoptosis. oxidative phosphorylation pathway in diabetic rats. J. Mol. J. Biol. Chem. 277, 5418–5425. Endocrinol. 49, 35–46.

Received 9 July 2015, in ﬁnal revised form 16 October 2015; accepted 20 October 2015 Unedited version published online: 19 November 2015 Final version published online: 5 May 2016

Journal of Genetics