DOCSLIB.ORG

The Emergence of New DNA Repeats and the Divergence of Primates (Genetic Noveltles/Pseudogenes/Irreversible Events/Evolutionary Rates/Phylogenies) PHILLIP P

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Emergence of New DNA Repeats and the Divergence of Primates (Genetic Noveltles/Pseudogenes/Irreversible Events/Evolutionary Rates/Phylogenies) PHILLIP P Proc. Natl. Acad. Sci. USA Vol. 90, pp. 1872-1876, March 1993 Evolution The emergence of new DNA repeats and the divergence of primates (genetic noveltles/pseudogenes/irreversible events/evolutionary rates/phylogenies) PHILLIP P. MINGHETTI*t AND ACHILLES DUGAICZYK*t *Department of Biochemistry, University of California, Riverside, CA 92521; and tDepartment of Physiology-Human Genome Mapping Center, University of California School of Medicine, San Francisco, CA 94143 Communicated by Frank W. Putnam, November 30, 1992 (receivedfor review September 29, 1992) ABSTRACT We have identified four genetic novelties that genome (5-7). They have been known for some time, but they are fixed in specific primate lineages and hence can serve as remain somewhat enigmatic, and their usefulness as evolu- phylogenetic time markers. One Alu DNA repeat is present in tionary markers has not been fully appreciated. Although the human lineage but is absent from the great apes. Another early studies on the a- and f-globin gene regions revealed no Alu DNA repeat is present in the gorilla lineage but is absent differences in the location of 14 specific Alu elements be- from the human, chimpanzee, and orangutan. A progenitor tween human, chimpanzee, and gorilla (8, 9), later studies did Xbal element is present in the human, chimpanzee, gorilla, and reveal differences in the location of specific DNA repeats orangutan, but only in the human lineage did it give rise to a between various primate lineages. For instance, in the work transposed progeny, Xba2. The saltatory appearance of Xba2 by Fitch et al. (10), involving sequence determination in the is an example of a one-time event in the evolutionary history of ,B-globin gene region, a truncated Li sequence and two Alu a species. The enolase pseudogene, known to be present as a elements were found to specifically distinguish the spider single copy in the human, was found to be present in four other monkey from the human and the apes. Dugaiczyk and primates, including the baboon, an Old World monkey. Using coworkers (11, 12) found an Xba and an Alu DNA repeat in the accepted value of 5 x 10-9 nucleotide substitutions per site the human a-fetoprotein (AFP) gene that were absent from per year as the evolutionary rate for pseudogenes, we calcu- the gorilla AFP gene. Additional human-specific Alu se- lated that the enolase pseudogene arose 14 million years ago. quences have also been found, and their species-specific The calculated age for this pseudogene and its presence in the presence or absence was demonstrated by DNA hybridiza- baboon are incongruent with each other, since Old World tion and PCR (13). In addition, a gorilla-specific Alu element monkeys are considered to have in the 3,S-globin region was absent from the human, chim- diverged from the hominid panzee, and macaque (14). Ilneage some 30 milion years ago. Thus the rate ofevolution in The process of new DNA repeats arising in the genomes the enolase pseudogene is only about 2.5 x 10-9 substitutions continues today, as has been demonstrated by a contempo- per site per year, or half the rate in other pseudogenes. It is rary de novo insertion of an Alu repeat into the neurofibro- concluded that rates of substitution vary between species, even matosis gene (15) and a de novo insertion of an Li sequence for similar DNA elements such as pseudogenes. We submit that into the factor VIII gene (16) in man. We have extended the new DNA repeats arise in the genomes ofspecies in irreversible work on the human-specific AFP Alu repeat to include and punctuated events and hence can be used as molecular time additional species-specific DNA elements and to screen small markers to decipher phylogenies. populations of higher primates for these DNA sequences. The study was undertaken in an effort to establish a corre- If it is true that evolution is punctuated with rapid changes lation between the emergence of new DNA repeats and the and new species arise in saltatory events rather than by divergence of primate species. gradual accumulation ofpoint mutations (1), then it should be possible to identify at the molecular level the genetic events MATERIALS AND METHODS that underlie these evolutionary punctuations. For example, DNA. Human DNA samples from 16 individuals were genomic rearrangements could change the timing of gene provided by Richard Gatti (Department of Pathology, Uni- expression and thus profoundly affect development of the versity of California Medical School, Los Angeles). DNA host; the new phenotype could sufficiently differ to start a samples from individual primate animals were provided by new speciation process. Similarly, DNA rearrangements Oliver Ryder (Research Department, San Diego Zoo) and by even in nonfunctional regions could disrupt meiotic chromo- Jerry Slightom (Division of Molecular Biology, Upjohn, some pairing, leading to reproductive isolation of a previ- Kalamazoo, MI). ously interbreeding population. The specific genetic changes PCR. Cycling conditions used in PCR experiments are that punctuate the evolutionary process have yet to be described in figure legends. identified, but perhaps the closest examples of such saltatory Cloning of PCR Products. DNA amplified by PCR was events in our genomes is the spreading of repetitive DNA cloned into the Hph I site of the cloning vector pCR1000 elements. It therefore seems worthwhile to analyze these (Invitrogen) according to the manufacturer's protocol. Re- events in some detail, because they can provide us with combinant clones were selected on kanamycin/5-bromo-4- genetic markers timing the evolutionary process. chloro-3-indolyl f-D-galactopyranoside plates and grown in The most prominent among the various repetitive DNA liquid culture, and plasmid DNA was isolated. elements are members ofthe Alu family. They are considered Sequencing of Recombinant Plasmid DNA. The Hph I to be pseudogenes that are ancestrally related to 7SL RNA (2, cloning site in pCR1000 is flanked by EcoRI and HindIII 3) or 4.5S RNA (4), and it appears they arose from an as yet restriction sites. These two sites were therefore used to label unidentified founder gene. They are specific to primate the DNA with 32p, and the labeled fragments were sequenced species, where they are found at an estimated 106 copies per by the chemical degradation method (17). The publication costs ofthis article were defrayed in part by page charge Abbreviations: AFP, a-fetoprotein; Myr, million years. payment. This article must therefore be hereby marked "advertisement" tPresent address: Department of Medicine, University of Alabama, in accordance with 18 U.S.C. §1734 solely to indicate this fact. Birmingham, AL 35294. 1872 Downloaded by guest on October 3, 2021 Evolution: Minghetti and Dugaiczyk Proc. Natl. Acad. Sci. USA 90 (1993) 1873 Direct Sequencing of PCR-Amplified DNA. DNA amplified A in the was labeled with 32P as op PCR concomitantly follows. 567 One of the primers was first end-labeled by using T4 poly- 540 504 nucleotide kinase and ['t-32P]ATP prior to addition to the PCR 456 mixture. The end-labeled PCR product was purified from 434 unincorporated primers by polyacrylamide gel electrophore- sis, eluted from the gel, and sequenced (17). RESULTS 267 Human-SpecificAlu Repeat in the AFP Gene. A specific Alu 234 21 3 repeat is present in the human AFP gene but absent from the 192 same (orthologous) position in the gorilla (11, 12). To extend 1684 these studies to include other primates, and to see whether the presence of this Alu repeat is fixed or polymorphic in the B - Alti Boundaries; 304 hbp-- -- human population, genomic DNA from human, chimpanzee, Term Repeat Terrim Repeat gorilla, and orangutan was amplified by PCR. The primers GGATGTTGTGGGGCCGGGCGCGGT ......lAltil..... .. AAAAAAAAAAAAAGGATGTTGTGG (D-534 and D-533; see legend to Fig. 1) for this reaction were from intron 4 of the human AFP gene sequence (11). This set of primers should amplify a 530-bp Eagment if the Alu Human: \' sequence is present, or 215 bp in the absence of this Alu AGATACACAGACATGGCAAAGGTTTACTGAACACTTA AAACATGTCTGCTTGCACAGAGGATCAGATTAACACT Human DNA an repeat. indeed yielded amplification product Chi mpanzee: Target Site of the expected size. On the other hand, amplified DNA -- GGATGTTGIGG --- products derived from genomic DNA from the chimpanzee, Goril la: gorilla, and orangutan were small (215 bp), indicative of the ------------------------------------- GGATGTTGTGG------------------------------------ absence of this Alu character in these primates (Fig. 1A). Orangutan: To verify that the amplified DNA products originateC from --------------------------- GGATGTTGTGG - orthologous sites in the four species, the DNA bands were excised from the gel and their sequences were determined. FIG. 1. PCR and sequence analysis of orthologous AFP loci in The sequences surrounding the Alu insertion site are shown primates. (A) Electrophoretic separation of PCR products. Ingredi- in Fig. 1B. Within the stretch of 85 nucleotides shown, the ents forthe PCR included (in 100 id) 20 mM Tris-HCI (pH 8.3), 50 mM are the for one mutation in the KCI, 2.5 mM MgCl2, 250 ,uM each dNTP, 0.2 ,LM each primer (D-534 sequences same, except and D-533), and 1 ug of genomic DNA. Amplification of DNA was orangutan. The 11-bp unoccupied target site is identical in performed in an Ericomp thermal cycler under the following condi- three primates, but in the human this target site was dupli- tions: 98°C for 2 min, pause at 80°C (2.5 units of Taq polymerase was cated and gave rise to the terminal repeats, conceivably added at this point), followed by 30 cycles of denaturation (96°C for during the event ofthe Alu transposition. The results indicate 30 sec), annealing (55°C for 30 sec), and elongation (62°C for 30 sec). that the primers specifically amplify orthologous sites in The last cycle was followed by afmal elongation step (65C for5 min), genomic DNA from the four primates.
Load more

Recommended publications
  • An Alu Element-Based Model of Human Genome Instability George Wyndham Cook, Jr
    Louisiana State University LSU Digital Commons LSU Doctoral Dissertations Graduate School 2013 An Alu element-based model of human genome instability George Wyndham Cook, Jr. Louisiana State University and Agricultural and Mechanical College, [email protected] Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations Recommended Citation Cook, Jr., George Wyndham, "An Alu element-based model of human genome instability" (2013). LSU Doctoral Dissertations. 2090. https://digitalcommons.lsu.edu/gradschool_dissertations/2090 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected]. AN ALU ELEMENT-BASED MODEL OF HUMAN GENOME INSTABILITY A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in The Department of Biological Sciences by George Wyndham Cook, Jr. B.S., University of Arkansas, 1975 May 2013 TABLE OF CONTENTS LIST OF TABLES ...................................................................................................... iii LIST OF FIGURES .................................................................................................... iv LIST OF ABBREVIATIONS ......................................................................................
    [Show full text]
  • DNA Sequence Insertion and Evolutionary Variation in Gene Regulation (Mobile Elements/Long Terminal Repeats/Alu Sequences/Factor-Binding Sites) Roy J
    Proc. Natl. Acad. Sci. USA Vol. 93, pp. 9374-9377, September 1996 Colloquium Paper This paper was presented at a colloquium entitled "Biology of Developmental Transcription Control, " organized by Eric H. Davidson, Roy J. Britten, and Gary Felsenfeld, held October 26-28, 1995, at the National Academy of Sciences in Irvine, CA. DNA sequence insertion and evolutionary variation in gene regulation (mobile elements/long terminal repeats/Alu sequences/factor-binding sites) RoY J. BRITrEN Division of Biology, California Institute of Technology, 101 Dahlia Avenue, Corona del Mar, CA 92625 ABSTRACT Current evidence on the long-term evolution- 3 and 4). Sequence change, obscuring the original structure, ary effect of insertion of sequence elements into gene regions has occurred in the long history, and the underlying rate of is reviewed, restricted to cases where a sequence derived from base substitution that is responsible is known (5). a past insertion participates in the regulation of expression of The requirements for a convincing example are: (i) that a useful gene. Ten such examples in eukaryotes demonstrate there be a trace of a known class of elements present in gene that segments of repetitive DNA or mobile elements have been region; (ii) that there is evidence that it has been there long inserted in the past in gene regions, have been preserved, enough to not just be a transient mutation; (iii) that some sometimes modified by selection, and now affect control of sequence residue of the mobile element or repeat participates transcription ofthe adjacent gene. Included are only examples in regulation of expression of the gene; (iv) that the gene have in which transcription control was modified by the insert.
    [Show full text]
  • Transcriptome-Wide Effects of Inverted Sines on Gene Expression And
    Tajaddod et al. Genome Biology (2016) 17:220 DOI 10.1186/s13059-016-1083-0 RESEARCH Open Access Transcriptome-wide effects of inverted SINEs on gene expression and their impact on RNA polymerase II activity Mansoureh Tajaddod1†, Andrea Tanzer3†, Konstantin Licht2†, Michael T. Wolfinger2,3, Stefan Badelt3, Florian Huber1,4, Oliver Pusch2, Sandy Schopoff1, Michael Janisiw2, Ivo Hofacker3 and Michael F. Jantsch2,5* Abstract Background: Short interspersed elements (SINEs) represent the most abundant group of non-long-terminal repeat transposable elements in mammalian genomes. In primates, Alu elements are the most prominent and homogenous representatives of SINEs. Due to their frequent insertion within or close to coding regions, SINEs have been suggested to play a crucial role during genome evolution. Moreover, Alu elements within mRNAs have also been reported to control gene expression at different levels. Results: Here, we undertake a genome-wide analysis of insertion patterns of human Alus within transcribed portions of the genome. Multiple, nearby insertions of SINEs within one transcript are more abundant in tandem orientation than in inverted orientation. Indeed, analysis of transcriptome-wide expression levels of 15 ENCODE cell lines suggests a cis-repressive effect of inverted Alu elements on gene expression. Using reporter assays, we show that the negative effect of inverted SINEs on gene expression is independent of known sensors of double-stranded RNAs. Instead, transcriptional elongation seems impaired, leading to reduced mRNA levels. Conclusions: Our study suggests that there is a bias against multiple SINE insertions that can promote intramolecular base pairing within a transcript. Moreover, at a genome-wide level, mRNAs harboring inverted SINEs are less expressed than mRNAs harboring single or tandemly arranged SINEs.
    [Show full text]
  • Sequences Enriched in Alu Repeats Drive Nuclear Localization of Long Rnas in Human Cells
    bioRxiv preprint doi: https://doi.org/10.1101/189746; this version posted September 16, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Sequences enriched in Alu repeats drive nuclear localization of long RNAs in human cells Yoav Lubelsky and Igor Ulitsky* Department of Biological Regulation, The Weizmann Institute of Science, Rehovot, Israel * - Corresponding author, [email protected] +972-8-9346421 Abstract Long noncoding RNAs (lncRNAs) are emerging as key players in multiple cellular pathways, but their modes of action, and how those are dictated by sequence remain elusive. While lncRNAs share most molecular properties with mRNAs, they are more likely to be enriched in the nucleus, a feature that is likely to be crucial for function of many lncRNAs, but whose molecular underpinnings remain largely unclear. In order identify elements that can force nuclear localization we screened libraries of short fragments tiled across nuclear RNAs, which were cloned into the untranslated regions of an efficiently exported mRNA. The screen identified a short sequence derived from Alu elements and found in many mRNAs and lncRNAs that increases nuclear accumulation and reduces overall expression levels. Measurements of the contribution of individual bases and short motifs to the element functionality identified a combination of RCCTCCC motifs that are bound by the abundant nuclear protein HNRNPK. Increased HNRNPK binding and C-rich motifs are predictive of substantial nuclear enrichment in both lncRNAs and mRNAs, and this mechanism is conserved across species. Our results thus detail a novel pathway for regulation of RNA accumulation and subcellular localization that has been co-opted to regulate the fate of transcripts that integrated Alu elements.
    [Show full text]
  • Isolation, Characterization, and Mapping of Four Novel Polymorphic Markers and an H3.3B Pseudogene to Chromosome 9P21-22
    348J Hum Genet (1999) 44:348–349 © Jpn Soc Hum Genet and Springer-Verlag 1999 BRIEF REPORT — CASE REPORT Elias Aliprandis · Juliette Harris · Barney Yoo Bruce D. Gelb · John A. Martignetti Isolation, characterization, and mapping of four novel polymorphic markers and an H3.3B pseudogene to chromosome 9p21-22 Received: April 16, 1999 / Accepted: May 20, 1999 Abstract Alterations in chromosomal region 9p21-22 are (Cannon-Albright et al. 1994), and multiple familial trich- among the most frequently encountered cytogenetic changes oepithelioma (Harada et al. 1996). We describe the isola- present in a number of human malignancies. In addition, the tion, characterization, fine mapping, and ordering of four causative genes of a number of hereditary cancers have been novel polymorphic markers, the previously identified genetically mapped to this region. We describe the isolation marker D9S1846, and a processed replacement histone and precise localization of four novel polymorphic markers H3.3B pseudogene and its flanking L1 and Alu elements. and a previously identified marker, D9S1846, from this re- gion. Moreover, we have identified a retroposon-rich area within this oncogenic region containing a processed H3.3B pseudogene flanked by an L1 sequence and an Alu element. Source and isolation of polymorphic DNA markers and Together, these finely mapped and ordered reagents should an H3.3B pseudogene prove useful for genetic mapping, sequencing, and loss of heterozygosity studies of the 9p21-22 region. Two P1 clones and one PAC clone (731, 232, and 160 8P, respectively; Research Genetics, Huntsville, AL, USA) from Key words Chromosome 9p21-22 · Polymorphic markers · the region were restriction enzyme digested and the resulting Histone H3.3B Pseudogene · Loss of heterozygosity · fragments were separated electrophoretically and transferred to Retroposon a nylon membrane (NEN, Boston, MA, USA) using standard methods (Maniatis et al.
    [Show full text]
  • Generation of Deletion Derivatives by Targeted Transformation of Human
    Proc. Natl. Acad. Sci. USA Vol. 87, pp. 1300-1304, February 1990 Genetics Generation of deletion derivatives by targeted transformation of human-derived yeast artificial chromosomes (yeast artificial chromosome fragmentation/homologous recombination/repetitive DNA/macrorestriction map) WILLIAM J. PAVAN*, PHILIP HIETERt, AND ROGER H. REEVES*t Departments of *Physiology and tMolecular Biology and Genetics, The Johns Hopkins University School of Medicine, Baltimore, MD 21205 Communicated by John W. Littlefield, November 27, 1989 ABSTRACT Mammalian DNA 'segments cloned as yeast homologous recombination (HR)-based methods have in- artificial chromosomes (YACs) can be manipulated by DNA- volved DNA segments of about several hundred base pairs mediated transformation when placed in an appropriate yeast (bp) or more in length that are completely homologous to the genetic background. A "fragmenting vector" has been devel- genomic target sequence. The length of homologous se- oped that can introduce a yeast telomere and selectable marker quence required to target recombination, the degree of mis- into human-derived YACs at specific sites by means of homol- match tolerated, and the effects of these variables on the ogous recombination, deleting all sequences distal to the re- frequency of HR are not known. combination site. A powerful application of the method uses a Repetitive sequences are distributed throughout the ge- human Alu family repeat sequence to target recombination to nomes of mammals. The human genome contains -500,000 multiple independent sites on a human-derived YAC. Sets of copies of Alu family repetitive elements (8). Individual Alu deletion derivatives generated by this procedure greatly facil- elements are tandem direct repeats totaling "300 bp in itate restriction mapping oflarge genomic segments.
    [Show full text]
  • Active Alu Element “A-Tails”: Size Does Matter
    Letter Active Alu Element “A-Tails”: Size Does Matter Astrid M. Roy-Engel,1 Abdel-Halim Salem,2,3 Oluwatosin O. Oyeniran,1 Lisa Deininger,1 Dale J. Hedges,2 Gail E. Kilroy,2 Mark A. Batzer,2 and Prescott L. Deininger1,4,5 1Tulane Cancer Center, SL-66, Department of Environmental Health Sciences, Tulane University–Health Sciences Center, NewOrleans, Louisiana 70112, USA; 2Department of Biological Sciences, Biological Computation and Visualization Center, Louisiana State University, Baton Rouge, Louisiana 70803, USA; 3Department of Anatomy, Faculty of Medicine, Suez Canal University, Ismailia, Egypt; 4Laboratory of Molecular Genetics, Alton Ochsner Medical Foundation, New Orleans, Louisiana 70121, USA. Long and short interspersed elements (LINEs and SINEs) are retroelements that make up almost half of the human genome. L1 and Alu represent the most prolific human LINE and SINE families, respectively. Only a few Alu elements are able to retropose, and the factors determining their retroposition capacity are poorly understood. The data presented in this paper indicate that the length of Alu “A-tails” is one of the principal factors in determining the retropositional capability of an Alu element. The A stretches of the Alu subfamilies analyzed, both old (Alu S and J) and young (Ya5), had a Poisson distribution of A-tail lengths with a mean size of 21 and 26, respectively. In contrast, the A-tails of very recent Alu insertions (disease causing) were all between 40 and 97 bp in length. The L1 elements analyzed displayed a similar tendency, in which the “disease”-associated elements have much longer A-tails (mean of 77) than do the elements even from the young Ta subfamily (mean of 41).
    [Show full text]
  • Tracking the Evolution of Mammalian Wide Interspersed Repeats Across the Mammalian Tree of Life
    Master's thesis Tracking the evolution of mammalian wide interspersed repeats across the mammalian tree of life. Author Jakob Friedrich Strauß First marker Prof. Dr. Joachim Kurtz Second marker Prof. Dr. Wojciech Maka lowski November 2, 2010 Tracking the evolution of mammalian wide interspersed repeats across the mammalian tree of life. Jakob Friedrich Strauß Institute of Bioinformatics WWU M¨unster Master's thesis November 2, 2010 Abstract This work focuses on the detection of mammalian wide interspersed repeats (MIRs) within the mammalian tree of life. MIRs are retroposons that belong to the class of SINEs (short interspersed repeats). The amplification of the ancient MIR is estimated 130 ma years ago, just before the mammalian radiation and has soon become inactive. The main idea of this project is to cross detect MIR elements in orthologous loci between fully sequenced mammalian genomes. While a MIR sequence in an extant species may still have a strong resemblance to the ancient MIR element, orthologous sequences in other mammalian species may have diverged beyond recognition, e.g. in mammals with a high substitution rate as rodents. But even those strongly diverged MIR elements may be detectable when the orthologous loci of a closely related species contains a less diverged element. We analyze in which gene-families MIR elements have spread and distinguish between MIR occurrence within UTRs, introns and exons. Thus we hope to illuminate the contri- bution of MIR elements to mammalian evolution. Contents 1 Background1 1.1 Transposable Elements.............................1 1.2 Genomic impact of transposable elements...................3 1.2.1 Long interspersed nuclear elements (LINEs).............4 1.2.2 Short interspersed nuclear elements (SINEs).............4 1.3 Mammalian wide interspersed repeats (MIRs)................5 1.3.1 MIR elements and the tree of life...................7 1.4 Detection of transposable elements.......................8 1.5 Goals of this study..............................
    [Show full text]
  • RNA-Guided Retargeting of Sleeping Beauty Transposition in Human Cells
    1 RNA-guided Retargeting of Sleeping Beauty Transposition in 2 Human Cells 3 4 Adrian Kovač1, Csaba Miskey1, Michael Menzel2, Esther Grueso1, Andreas Gogol- 5 Döring2 and Zoltán Ivics1,* 6 7 8 1 Transposition and Genome Engineering, Division of Medical Biotechnology, Paul Ehrlich Institute, 63225 9 Langen, Germany 10 2 University of Applied Sciences, 35390 Giessen, Germany 11 12 13 *For correspondence: 14 Zoltán Ivics 15 Paul Ehrlich Institute 16 Paul Ehrlich Str. 51-59 17 D-63225 Langen 18 Germany 19 Phone: +49 6103 77 6000 20 Fax: +49 6103 77 1280 21 Email: [email protected] 22 23 Keywords: genetic engineering, CRISPR/Cas, gene targeting, DNA-binding, gene insertion 24 1 25 ABSTRACT 26 An ideal tool for gene therapy would enable efficient gene integration at predetermined sites in 27 the human genome. Here we demonstrate biased genome-wide integration of the Sleeping 28 Beauty (SB) transposon by combining it with components of the CRISPR/Cas9 system. We 29 provide proof-of-concept that it is possible to influence the target site selection of SB by fusing it 30 to a catalytically inactive Cas9 (dCas9) and by providing a single guide RNA (sgRNA) against 31 the human Alu retrotransposon. Enrichment of transposon integrations was dependent on the 32 sgRNA, and occurred in an asymmetric pattern with a bias towards sites in a relatively narrow, 33 300-bp window downstream of the sgRNA targets. Our data indicate that the targeting 34 mechanism specified by CRISPR/Cas9 forces integration into genomic regions that are 35 otherwise poor targets for SB transposition.
    [Show full text]
  • Age-Associated ALU Element Instability in White Blood Cells Is Linked to Lower Survival in Elderly Adults: a Preliminary Cohort Study
    RESEARCH ARTICLE Age-Associated ALU Element Instability in White Blood Cells Is Linked to Lower Survival in Elderly Adults: A Preliminary Cohort Study R. Garrett Morgan1,2, Massimo Venturelli1,3,4, Cole Gross1, Cantor Tarperi3, Federico Schena3, Carlo Reggiani5, Fabio Naro6, Anna Pedrinolla7, Lucia Monaco8, Russell S. Richardson1,2,9, Anthony J. Donato1,2,9* 1 Department of Internal Medicine, Division of Geriatrics, University of Utah School of Medicine, University of Utah, Salt Lake City, Utah, United States of America, 2 Geriatric Research, Education, and Clinical Center, a1111111111 George E. Wahlen Department of Veterans Affairs Medical Center, Salt Lake City, Utah, United States of a1111111111 America, 3 Department of Neurological and Movement Sciences, University of Verona, Verona, Italy, a1111111111 4 Department of Biomedical Sciences for Health, University of Milan, Milan, Italy, 5 Department of a1111111111 Biomedical Sciences, University of Padova, Padova, Italy, 6 DAHFMO-Unit of Histology and Medical a1111111111 Embryology, Sapienza University, Rome, Italy, 7 Department of Medicine, University of Verona, Verona, Italy, 8 Department of Physiology and Pharmacology, Sapienza University of Rome, Italy, 9 Department of Health, Kinesiology, and Recreation, University of Utah, Salt Lake City, Utah, United States of America * [email protected] OPEN ACCESS Citation: Morgan RG, Venturelli M, Gross C, Abstract Tarperi C, Schena F, Reggiani C, et al. (2017) Age- Associated ALU Element Instability in White Blood Cells Is Linked to Lower Survival in Elderly Adults: Background A Preliminary Cohort Study. PLoS ONE 12(1): ALU element instability could contribute to gene function variance in aging, and may partly e0169628. doi:10.1371/journal.pone.0169628 explain variation in human lifespan.
    [Show full text]
  • Clusters of Intragenic Alu Repeats Predispose the Human C1 Inhibitor
    Proc. Natl. Acad. Sci. USA Vol. 87, pp. 1551-1555, February 1990 Genetics Clusters of intragenic Alu repeats predispose the human C1 inhibitor locus to deleterious rearrangements (genetic disease/hereditary angioedema/serine protease inhibitor/complement) DOMINIQUE STOPPA-LYONNET*, PHILIP E. CARTERt, TOMMASO MEO*, AND MARIO TOSI*t *Unitd d'Immunogdndtique and Institut National de la Santd et de la Recherche Mddicale, U. 276, Institut Pasteur, Paris, France; and tDepartment of Biochemistry, University of Aberdeen, Aberdeen, United Kingdom Communicated by Donald C. Shreffler, October 30, 1989 (receivedfor review June 20, 1989) ABSTRACT Frequent alterations in the structure of the 5' half of the gene§ in a significant proportion of type I complement component C1 inhibitor gene have been found in families (9). Here we describe a "hot spot" of genetic patients affected by the common variant of hereditary angio- alterations, related to unusual Alu repeat clusters, which edema, characterized by low plasma levels ofC1 inhibitor. This accounts for the occurrence of the disease in a significant control protein limits the enzymic activity of the first compo- fraction of families. nent of complement and of other plasma serine proteases. Sequence comparisons of a 4.6-kilobase-long segment of the normal gene and the corresponding gene segments isolated EXPERIMENTAL PROCEDURES from two patients carrying family-specific DNA deletions point We examined gene alterations characteristic offour unrelated to unusually long clusters oftandem repeats oftheAlu sequence kindreds affected by type I HAE (families F1, F3, F4, and family as a source of genetic instability in this locus. Unequal F5). The disease-related restriction fragments found in fam- crossovers, in a variety ofregisters, amongAlu sequences ofthe ilies F1, F3, and F4 have been described (9).
    [Show full text]
  • The Partial Tandem Duplication of ALL1 (MLL) Is Consistently Generated by Alu-Mediated Homologous Recombination in Acute Myeloid Leukemia
    Proc. Natl. Acad. Sci. USA Vol. 95, pp. 2390–2395, March 1998 Genetics The partial tandem duplication of ALL1 (MLL) is consistently generated by Alu-mediated homologous recombination in acute myeloid leukemia MATTHEW P. STROUT*, GUIDO MARCUCCI*, CLARA D. BLOOMFIELD*†, AND MICHAEL A. CALIGIURI*†‡ *The Division of Hematology-Oncology, Department of Internal Medicine, and Division of Human Cancer Genetics, Department of Medical Microbiology and Immunology, Comprehensive Cancer Center at The Ohio State University, 320 West 10th Avenue, Columbus, OH 43210; and †Cancer and Leukemia Group B, 208 South LaSalle Avenue, Chicago, IL, 60604 Communicated by Albert de la Chapelle, The Ohio State University, Columbus, OH, December 22, 1997 (received for review December 6, 1997) ABSTRACT Chromosome abnormalities resulting in presence of heptamer-nonamer recombination signals adja- gene fusions are commonly associated with acute myeloid cent to the genomic breakpoints on both chromosomes has leukemia (AML), however, the molecular mechanism(s) re- suggested that V(D)J recombinase activity is involved in sponsible for these defects are not well understood. The partial illegitimate recombination events leading to these transloca- tandem duplication of the ALL1 (MLL) gene is found in tions (14). A similar mechanism has not been identified in the patients with AML and trisomy 11 as a sole cytogenetic majority of molecular defects found in AML (13). Chromo- abnormality and in 11% of patients with AML and normal some translocations involving ALL1 often are present in cytogenetics. This defect results from the genomic fusion of patients who develop secondary leukemia following treatment ALL1 intron6orintron8toALL1 intron 1. Here, we examined of a primary malignancy with drugs that inhibit topoisomerase the DNA sequence at the genomic fusion in nine cases of AML II (15, 16).
    [Show full text]