Development 128, 2153-2161 (2001) 2153 Printed in Great Britain © The Company of Biologists Limited 2001 DEV4528 Hoxa11 and Hoxd11 regulate branching morphogenesis of the ureteric bud in the developing kidney Larry T. Patterson, Martina Pembaur and S. Steven Potter* Division of Nephrology and Hypertension and Division of Developmental Biology, The Children’s Hospital Research Foundation, Cincinnati, OH 45229, USA *Author for correspondence (e-mail: [email protected]) Accepted 23 March 2001 SUMMARY Hoxa11 and Hoxd11 are functionally redundant during marker of the metanephric kidney, show that the kidney development. Mice with homozygous null mutation branching defect was not simply the result of homeotic of either gene have normal kidneys, but double mutants transformation of metanephros to mesonephros. Absent have rudimentary, or in extreme cases, absent kidneys. We Bf2 and Gdnf expression in the midventral mesenchyme, have examined the mechanism for renal growth failure in findings that could by themselves account for branching this mouse model and find defects in ureteric bud defects, shows that Hoxa11 and Hoxd11 are necessary for branching morphogenesis. The ureteric buds are either normal gene expression in the ventral mesenchyme. unbranched or have an atypical pattern characterized by Attenuation of normal gene expression along with the lack of terminal branches in the midventral renal cortex. absence of a detectable proliferative or apoptotic change in The mutant embryos show that Hoxa11 and Hoxd11 the mutants show that one function of Hoxa11 and Hoxd11 control development of a dorsoventral renal axis. By in the developing renal mesenchyme is to regulate immunohistochemical analysis, Hoxa11 expression is differentiation necessary for mesenchymal-epithelial restricted to the early metanephric mesenchyme, which reciprocal inductive interactions. induces ureteric bud formation and branching. It is not found in the ureteric bud. This suggests that the branching defect had been caused by failure of mesenchyme to Key words: Organogenesis, Kidney, Renal, Branching, Development, epithelium signaling. In situ hybridizations with Wnt7b, a Hox, Metanephros, Mouse INTRODUCTION absence of mesenchyme (Qiao et al., 1999). The mechanism does require the presence of more than one mesenchymal cell Renal organogenesis has served as a model system for the type. With loss of the winged helix Bf2 transcription factor study of multiple developmental mechanisms such as (Foxd1 – Mouse Genome Informatics) from the stromal branching morphogenesis and mesenchyme-to-epithelial mesenchyme progenitors, normal ureteric bud growth and conversion. These processes depend upon the successful branching is impaired (Hatini et al., 1996). The loss of α8 integration of inductive interactions between tissues. Inductive integrin from the mesenchyme immediately adjacent to the bud events in the kidney are functionally well described (Saxen, also impairs ureteric bud branching morphogenesis (Muller et 1987) and remain of great interest at the molecular level. al., 1997). One distinguishing feature in renal development is Ureteric bud induction from the Wolffian duct and its the complex process of mesenchymal morphogenesis. After subsequent growth and branching to form the collecting system induction of the bud by the mesenchyme, the bud provides occurs in response to signaling from nephrogenic and stromal signals that promote mesenchyme survival and induce progenitor mesenchyme. The mesenchyme secreted factors, nephronogenesis. The induced mesenchyme condenses, GDNF (Pichel et al., 1996) and amphiregulin (Lee et al., 1999) becomes polarized epithelium and forms vesicles. The vesicles are two of probably several soluble morphogens that regulate then elongate and differentiate to form the mature glomeruli ureteric bud development. In addition, mutation of an enzyme and tubules of the metanephric kidney. In the absence of involved in proteoglycan synthesis (Bullock et al., 1998) and ureteric bud derived signals, the mesenchyme becomes inhibition of extracellular matrix sulfation (Davies et al., 1995) apoptotic. The processes of branching morphogenesis and within the nephrogenic mesenchyme demonstrate that normal nephronogenesis must conform to a set pattern of development. ureteric bud branching morphogenesis requires extracellular Hox genes are a well described family of clustered genes matrix as well. The signaling mechanism for ureteric bud that encode homeodomain-containing transcription factors. growth and branching does not require mesenchymal-epithelial Relatively little is known about the role of Hox genes during cell contact, as demonstrated by ureteric bud growth in the organogenesis. We have described morphological changes 2154 L. T. Patterson, M. Pembaur and S. S. Potter within the reproductive tract that suggest the Hox genes Douglass, 1992 (Dressler and Douglass, 1992). The antibody to regulate positional information during organogenesis (Hsieh- Hoxa11 has previously been described (Gendron et al., 1997). Li et al., 1995; Gendron et al., 1997). During neurogenesis, Polyclonal rabbit antibody from immune and preimmune serum was Hox genes have been shown to control both dorsoventral and purified from a protein A column. Sections (6 µm) were fixed for 5 anteroposterior patterning of the hindbrain (Davenne et al., minutes with 3% paraformaldehyde in PBS. The sections were then 1999). In the developing gut, it has been demonstrated that permeabilized with 0.1% Triton X-100 in phosphate-buffered saline (PBS) for 10 minutes and washed in PBS 0.05% Tween (PBST). The Hoxd13 regulates regionally restricted inductive signaling primary antibodies were diluted 1:100 to 1:200 in 2% goat serum (Roberts et al., 1998). Over 15 Hox genes are expressed in the PBST and incubated with the sections for 1 hour. The slides were developing kidney (Davies and Brandli, 1997 – The Kidney washed in PBST and incubated with rhodamine- or fluorescein- Development Database http//mbisg2.sbc.man.ac.uk/kidbase/ conjugated secondary antibody diluted in goat serum PBST. kidhome.html and http://golgi.ana.ed.ac.uk/kidhome.html.). Dissected embryonic urogenital blocks from double heterozygous These genes may control cell proliferation, inductive signaling Hoxa11/Hoxd11 matings were processed for whole-mount antibody pathways and/or anteroposterior-dorsoventral patterning of the detection of cytokeratin. The tissue was fixed in methanol and incubated kidney or its multiple components. We have shown that two 4-5 hours in 2% goat serum PBST with 1:100 dilution of anti-pan members of the family, Hoxa11 and Hoxd11, exhibit functional cytokeratin (Sigma C2562). After washing, the tissue was incubated redundancy in formation of the kidney, as well as the forelimb with FITC-conjugated anti-mouse IgG secondary antibody (Sigma F2012) in PBST (2% goat serum). Photographic slides were taken with and vertebra (Davis et al., 1995). Homozygous mutant mice for an Olympus BHS model microscope with a reflected light fluorescence either Hoxa11 or Hoxd11 have normal kidneys; however, the attachment. The slides were scanned into Adobe Photoshop. kidneys of the double homozygous mutants are absent or rudimentary. Lectin staining To better understand the function of Hoxa11 and Hoxd11 in Mutant and normal urogenital blocks from E13.5 embryos were kidney development, we defined their expression domains stained with fluorescein-conjugated Dolichos biflorus agglutinin and examined early renal developmental anomalies of (DBA, Vector). The tissue was dissected and fixed for 10 minutes in Hoxa11/Hoxd11 double mutant mice. Although Hoxa11 and 2% paraformaldehyde in PBS, treated with 3% bovine serum albumin o Hoxd11 expression was limited to the mesenchyme in the early (BSA) in PBS 0.05% Triton X-100 for 1 hour at 37 C, and incubated developing kidney, the most striking mutant defect was in with DBA 1:40 in PBS Triton for 1 hour. After washing, the tissue was transferred to a slide for photography. So as not to distort the the pattern of ureteric bud branching morphogenesis. This structures, care was taken not to compress the tissue with a coverslip. establishes a role for Hoxa11/Hoxd11 in mesenchyme for patterning ureteric bud branching morphogenesis. Expression Whole-mount in situ hybridization analysis of the mutant renal mesenchyme demonstrated an Mutant and normal urogenital blocks were dissected and hybridized altered mesenchymal character. There was loss of expression with riboprobes as described previously (Wilkinson, 1992; Hogan, of genes that are crucial for ureteric bud morphogenesis, as 1994). Wnt11 probe was obtained from a 782 bp PvuII fragment of well as diminished expression of genes that are normally EST 349486 (Research Genetics). The pCMV Pax2 construct, kindly induced in the mesenchyme by the ureteric bud. These findings provided by Gregory Dressler, was used to obtained a 575 bp support the hypothesis that Hox genes control pattern XbaI/BamHI Pax2 riboprobe (Dressler et al., 1993). A 399 bp cDNA formation in kidney development by promoting mesenchyme- fragment was amplified using tgtccagtgtggagaactttactg and ctctacacctcaaaaagggcttag primers, cloned and used for a Bf2 epithelial reciprocal inductive signaling. riboprobe. The Wnt7b EST clone 334147 contained a 530 bp fragment that was used as a riboprobe. The Wt1 and Gdnf riboprobes were kind gifts from Andreas Schedl (from Buckler et. al., 1991) and Frank MATERIALS AND METHODS Costantini (Srinivas et. al., 1999), respectively. A 504 bp EcoRI/SmaI fragment