DOCSLIB.ORG

OPCD03879) Data Sheet

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
OPCD03879) Data Sheet Produktinformation Diagnostik & molekulare Diagnostik Laborgeräte & Service Zellkultur & Verbrauchsmaterial Forschungsprodukte & Biochemikalien Weitere Information auf den folgenden Seiten! See the following pages for more information! Lieferung & Zahlungsart Lieferung: frei Haus Bestellung auf Rechnung SZABO-SCANDIC Lieferung: € 10,- HandelsgmbH & Co KG Erstbestellung Vorauskassa Quellenstraße 110, A-1100 Wien T. +43(0)1 489 3961-0 Zuschläge F. +43(0)1 489 3961-7 [email protected] • Mindermengenzuschlag www.szabo-scandic.com • Trockeneiszuschlag • Gefahrgutzuschlag linkedin.com/company/szaboscandic • Expressversand facebook.com/szaboscandic HIPK2 Recombinant Protein (OPCD03879) Data Sheet Product Number OPCD03879 Product Page http://www.avivasysbio.com/hipk2-recombinant-protein-opcd03879.html Product Name HIPK2 Recombinant Protein (OPCD03879) Size 10 ug Gene Symbol HIPK2 Alias Symbols DKFZp686K02111, FLJ23711, hHIPk2, Homeodomain-interacting protein kinase 2, PRO0593 Molecular Weight 27 kDa Product Format Lyophilized Tag N-terminal His Tag Conjugation Unconjugated NCBI Gene Id 28996 Host E.coli Purity > 95% Source Prokaryotic Expressed Recombinant Official Gene Full Name homeodomain interacting protein kinase 2 Description of Target Serine/threonine-protein kinase involved in transcription regulation, p53/TP53-mediated cellular apoptosis and regulation of the cell cycle. Acts as a corepressor of several transcription factors, including SMAD1 and POU4F1/Brn3a and probably NK homeodomain transcription factors. Phosphoryla tes PDX1, ATF1, PML, p53/TP53, CREB1, CTBP1, CBX4, RUNX1, EP300, CTNNB1, HMGA1 and ZBTB4. Inhibits cell growth and promotes apopto sis through the activation of p53/TP53 both at the transcription level and at the protein level (by phosphorylation and indirect acetylation). The phosp horylation of p53/TP53 may be mediated by a p53/TP53-HIPK2-AXIN1 complex. Involved in the response to hypoxia by acting as a transcriptional co -suppressor of HIF1A. Mediates transcriptional activation of TP73. In response to TGFB, cooperates with DAXX to activate JNK. Negative regulator t hrough phosphorylation and subsequent proteasomal degradation of CTNNB1 and the antiapoptotic factor CTBP1. In the Wnt/beta-catenin signaling pathway acts as an intermediate kinase between MAP3K7/TAK1 and NLK to promote the proteasomal degradation of MYB. Phosphorylates CBX4 upon DNA damage and promotes its E3 SUMO-protein ligase activity. Activates CREB1 and ATF1 transcription factors by phosphorylation in respo nse to genotoxic stress. In response to DNA damage, stabilizes PML by phosphorylation. PML, HIPK2 and FBXO3 may act synergically to activate p53/TP53-dependent transactivation. Promotes angiogenesis, and is involved in erythroid differentiation, especially during fetal liver erythropoiesis. P hosphorylation of RUNX1 and EP300 stimulates EP300 transcription regulation activity. Triggers ZBTB4 protein degradation in response to DNA da mage. Modulates HMGA1 DNA-binding affinity. In response to high glucose, triggers phosphorylation-mediated subnuclear localization shifting of P DX1. Involved in the regulation of eye size, lens formation and retinal lamination during late embryogenesis.1 Reconstitution and Storage Reconstitute in PBS or others. Store at 2-8C for one month. Aliquot and store at -80C for 12 months. Avoid repeated freeze/thaw cycles. Additional Information Endotoxin Level: < 1.0 EU per 1 ug (determined by the LAL method) Additional Information Residues: Ser977 - Ile1198 Lead Time Domestic: within 1-2 weeks delivery International: 1-3 weeks Formulation Lyophilized in PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Tissue Tool Find tissues and cell lines supported by DNA array analysis to express HIPK2. Swissprot Id Q9H2X6 Protein Name Homeodomain-interacting protein kinase 2 Protein Accession # NP_001106710.1 RNA Seq Find tissues and cell lines supported by RNA-seq analysis to express HIPK2. Nucleotide Accession # NM_001113239.2 Species Reactivity Human Application SDS-PAGE, WB, ELISA, IP Image 1 SDS-PAGE HIPK2 Recombinant Protein (OPCD03879) using SDS-PAGE AVIVA SYSTEMS BIOLOGY manufactures and sells quality antibody products covering genome wide proteins. This product is for Research Use Only. Not for diagnostic, human, or veterinary use. Optimal conditions of its use should be determined by end users. AVIVA SYSTEMS BIOLOGY 5754 Pacific Center Blvd., Suite 201 San Diego, CA 92121 USA | Tel: (858)552-6979 | [email protected].
Load more

Recommended publications
  • SPEN Induces Mir-4652-3P to Target HIPK2 in Nasopharyngeal Carcinoma
    Li et al. Cell Death and Disease (2020) 11:509 https://doi.org/10.1038/s41419-020-2699-2 Cell Death & Disease ARTICLE Open Access SPEN induces miR-4652-3p to target HIPK2 in nasopharyngeal carcinoma Yang Li1,YuminLv1, Chao Cheng2,YanHuang3,LiuYang1, Jingjing He1,XingyuTao1, Yingying Hu1,YutingMa1, Yun Su1,LiyangWu1,GuifangYu4, Qingping Jiang5,ShuLiu6,XiongLiu7 and Zhen Liu1 Abstract SPEN family transcriptional repressor (SPEN), also known as the SMART/HDAC1-associated repressor protein (SHARP), has been reported to modulate the malignant phenotypes of breast cancer, colon cancer, and ovarian cancer. However, its role and the detail molecular basis in nasopharyngeal carcinoma (NPC) remain elusive. In this study, the SPEN mRNA and protein expression was found to be increased in NPC cells and tissues compared with nonmalignant nasopharyngeal epithelial cells and tissues. Elevated SPEN protein expression was found to promote the pathogenesis of NPC and lead to poor prognosis. Knockdown of SPEN expression resulted in inactivation ofPI3K/AKT and c-JUN signaling, thereby suppressing NPC migration and invasion. In addition, miR-4652-3p was found to be a downstream inducer of SPEN by targeting the homeodomain interacting protein kinase 2 (HIPK2) gene, a potential tumor suppressor that reduces the activation of epithelial–mesenchymal transition (EMT) signaling, thereby reducing its expression and leading to increased NPC migration, invasion, and metastasis. In addition, SPEN was found to induce miR-4652-3p expression by activating PI3K/AKT/c-JUN signaling to target HIPK2. Our data provided a new molecular mechanism for SPEN as a metastasis promoter through activation of PI3K/AKT signaling, thereby stimulating the c-JUN/miR-4652-3p axis to target HIPK2 in NPC.
    [Show full text]
  • HIPK2–P53ser46 Damage Response Pathway Is Involved in Temozolomide-Induced Glioblastoma Cell Death Yang He, Wynand P
    Published OnlineFirst February 22, 2019; DOI: 10.1158/1541-7786.MCR-18-1306 Cell Fate Decisions Molecular Cancer Research The SIAH1–HIPK2–p53ser46 Damage Response Pathway is Involved in Temozolomide-Induced Glioblastoma Cell Death Yang He, Wynand P. Roos, Qianchao Wu, Thomas G. Hofmann, and Bernd Kaina Abstract Patients suffering from glioblastoma have a dismal prog- in chromatin-immunoprecipitation experiments, in which nosis, indicating the need for new therapeutic targets. Here p-p53ser46 binding to the Fas promotor was regulated by we provide evidence that the DNA damage kinase HIPK2 HIPK2. Other pro-apoptotic proteins such as PUMA, and its negative regulatory E3-ubiquitin ligase SIAH1 are NOXA, BAX, and PTEN were not affected in HIPK2kd, and critical factors controlling temozolomide-induced cell also double-strand breaks following temozolomide remain- death. We show that HIPK2 downregulation (HIPK2kd) ed unaffected. We further show that downregulation of significantly reduces the level of apoptosis. This was not the HIPK2 inactivator SIAH1 significantly ameliorates the case in glioblastoma cells expressing the repair protein temozolomide-induced apoptosis, suggesting that the MGMT, suggesting that the primary DNA lesion responsible ATM/ATR target SIAH1 together with HIPK2 plays a pro- 6 for triggering HIPK2-mediated apoptosis is O -methylguanine. apoptotic role in glioma cells exhibiting p53wt status. A Upon temozolomide treatment, p53 becomes phosphory- database analysis revealed that SIAH1, but not SIAH2, is lated whereby HIPK2kd had impact exclusively on ser46, significantly overexpressed in glioblastomas. but not ser15. Searching for the transcriptional target of p-p53ser46, we identified the death receptor FAS (CD95, Implications: The identification of a novel apoptotic APO-1) being involved.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Updates on HIPK2: a Resourceful Oncosuppressor for Clearing Cancer Gabriella D’Orazi1,2*, Cinzia Rinaldo2,3 and Silvia Soddu2*
    D’Orazi et al. Journal of Experimental & Clinical Cancer Research 2012, 31:63 http://www.jeccr.com/content/31/1/63 REVIEW Open Access Updates on HIPK2: a resourceful oncosuppressor for clearing cancer Gabriella D’Orazi1,2*, Cinzia Rinaldo2,3 and Silvia Soddu2* Abstract Homeodomain-interacting protein kinase 2 (HIPK2) is a multitalented protein that exploits its kinase activity to modulate key molecular pathways in cancer to restrain tumor growth and induce response to therapies. HIPK2 phosphorylates oncosuppressor p53 for apoptotic activation. In addition, also p53-independent apoptotic pathways are regulated by HIPK2 and can be exploited for anticancer purpose too. Therefore, HIPK2 activity is considered a central switch in targeting tumor cells toward apoptosis upon genotoxic damage and the preservation and/or restoration of HIPK2 function is crucial for an efficient tumor response to therapies. As a proof of principle, HIPK2 knockdown impairs p53 function, induces chemoresistance, angiogenesis, and tumor growth in vivo,onthe contrary, HIPK2 overexpression activates apoptotic pathways, counteracts hypoxia, inhibits angiogenesis, and induces chemosensitivity both in p53-dependent and -independent ways. The role of HIPK2 in restraining tumor development was also confirmed by studies with HIPK2 knockout mice. Recent findings demonstrated that HIPK2 inhibitions do exist in tumors and depend by several mechanisms including HIPK2 cytoplasmic localization, protein degradation, and loss of heterozygosity (LOH), recapitulating the biological outcome obtained by RNA interference studies in tumor cells, such as p53 inactivation, resistance to therapies, apoptosis inhibition, and tumor progression. These findings may lead to new diagnostic and therapeutic approaches for treating cancer patients. This review will focus on the last updates about HIPK2 contribution in tumorigenesis and cancer treatment.
    [Show full text]
  • Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells
    Cancer Therapeutics, Targets, and Chemical Biology Research Mithramycin Represses Basal and Cigarette Smoke–Induced Expression of ABCG2 and Inhibits Stem Cell Signaling in Lung and Esophageal Cancer Cells Mary Zhang1, Aarti Mathur1, Yuwei Zhang1, Sichuan Xi1, Scott Atay1, Julie A. Hong1, Nicole Datrice1, Trevor Upham1, Clinton D. Kemp1, R. Taylor Ripley1, Gordon Wiegand2, Itzak Avital2, Patricia Fetsch3, Haresh Mani6, Daniel Zlott4, Robert Robey5, Susan E. Bates5, Xinmin Li7, Mahadev Rao1, and David S. Schrump1 Abstract Cigarette smoking at diagnosis or during therapy correlates with poor outcome in patients with lung and esophageal cancers, yet the underlying mechanisms remain unknown. In this study, we observed that exposure of esophageal cancer cells to cigarette smoke condensate (CSC) led to upregulation of the xenobiotic pump ABCG2, which is expressed in cancer stem cells and confers treatment resistance in lung and esophageal carcinomas. Furthermore, CSC increased the side population of lung cancer cells containing cancer stem cells. Upregulation of ABCG2 coincided with increased occupancy of aryl hydrocarbon receptor, Sp1, and Nrf2 within the ABCG2 promoter, and deletion of xenobiotic response elements and/or Sp1 sites markedly attenuated ABCG2 induction. Under conditions potentially achievable in clinical settings, mithramycin diminished basal as well as CSC- mediated increases in AhR, Sp1, and Nrf2 levels within the ABCG2 promoter, markedly downregulated ABCG2, and inhibited proliferation and tumorigenicity of lung and esophageal cancer cells. Microarray analyses revealed that mithramycin targeted multiple stem cell–related pathways in vitro and in vivo. Collectively, our findings provide a potential mechanistic link between smoking status and outcome of patients with lung and esophageal cancers, and support clinical use of mithramycin for repressing ABCG2 and inhibiting stem cell signaling in thoracic malignancies.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Proquest Dissertations
    RICE UNIVERSITY Molecular Basis of Gene Dosage Sensitivity by Jianping Chen A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE Doctor of Philosophy APPROVED, THESIS COMMITTEE: Ariel Fernandez, Chair Karl F. Hasselmann Professor Department of Bioengineering Rice University rn'idtfP h.tQsJUW*- Michael W. Deem, John W. Cox Professor Department of Bioengineering Department of Physics and Astronomy Rice Universit ^engineering at Rice University Jiochemistry at Baylor College of Medicine Axxttig- «J^gb/uv Laura Segaton, T.N. Law Assistant Professor Chemical and Biomolecular Engineering Rice University HOUSTON, TEXAS JANUARY 2009 UMI Number: 3362141 INFORMATION TO USERS The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleed-through, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. UMI® UMI Microform 3362141 Copyright 2009 by ProQuest LLC All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 ABSTRACT Molecular Basis of Gene Dosage Sensitivity by JianpingChen Deviation of gene expression from normal levels has been associated with diseases. Both under- and overexpression of genes could lead to deleterious biological consequences. Dosage balance has been proposed to be a key issue of determining gene expression pheno- type.
    [Show full text]
  • 1 a Genome-Wide RNA Interference Screen Identifies New Regulators Of
    Downloaded from genome.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press A genome-wide RNA interference screen identifies new regulators of androgen receptor function in prostate cancer cells Keren Imberg-Kazdan1 Susan Ha1,2 Alex Greenfield3 Christopher S. Poultney3^ Richard Bonneau3 Susan K. Logan1,2,4 Michael J. Garabedian2, 3,4 Departments of Biochemistry and Molecular Pharmacology1, Urology2, Microbiology4, and NYU Cancer Institute5, New York University School of Medicine, 550 First Avenue, New York, NY 10016; 3Center for Genomics and Systems Biology, New York University, New York, New York 10003 ^ present address: Seaver Autism Center for Research and Treatment, Department of Psychiatry, Mount Sinai Medical Center, New York, New York 10029 Corresponding Author: Michael J. Garabedian Department of Microbiology NYU School of Medicine 550 First Avenue, New York, NY 10016 Phone 212 263-7662 Fax 212 263-8276 Email: [email protected] Running Title: Genome-wide RNAi screen for AR regulators Keywords: Androgen receptor, RNAi screen, transcriptional regulation, HIPK2, MED19, Mediator complex, prostate cancer 1 Downloaded from genome.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract The androgen receptor (AR) is a mediator of both androgen-dependent and castration- resistant prostate cancers. Identification of cellular factors affecting AR transcriptional activity could in principle yield new targets that reduce AR activity and combat prostate cancer, yet a comprehensive analysis of the genes required for AR-dependent transcriptional activity has not been determined. Using an unbiased genetic approach that takes advantage of the evolutionary conservation of AR signaling, we have conducted a genome-wide RNAi screen in Drosophila cells for genes required for AR transcriptional activity and applied the results to human prostate cancer cells.
    [Show full text]
  • A Three-Dimensional Organoid Model Recapitulates Tumorigenic Aspects
    www.nature.com/scientificreports OPEN A three-dimensional organoid model recapitulates tumorigenic aspects and drug responses of Received: 22 June 2018 Accepted: 10 October 2018 advanced human retinoblastoma Published: xx xx xxxx Duangporn Saengwimol1, Duangnate Rojanaporn2, Vijender Chaitankar3, Pamorn Chittavanich4, Rangsima Aroonroch5, Tatpong Boontawon4, Weerin Thammachote4, Natini Jinawath4, Suradej Hongeng6 & Rossukon Kaewkhaw4 Persistent or recurrent retinoblastoma (RB) is associated with the presence of vitreous or/and subretinal seeds in advanced RB and represents a major cause of therapeutic failure. This necessitates the development of novel therapies and thus requires a model of advanced RB for testing candidate therapeutics. To this aim, we established and characterized a three-dimensional, self-organizing organoid model derived from chemotherapy-naïve tumors. The responses of organoids to drugs were determined and compared to relate organoid model to advanced RB, in terms of drug sensitivities. We found that organoids had histological features resembling retinal tumors and seeds and retained DNA copy-number alterations as well as gene and protein expression of the parental tissue. Cone signal circuitry (M/L+ cells) and glial tumor microenvironment (GFAP+ cells) were primarily present in organoids. Topotecan alone or the combined drug regimen of topotecan and melphalan efectively targeted proliferative tumor cones (RXRγ+ Ki67+) in organoids after 24-h drug exposure, blocking mitotic entry. In contrast, methotrexate showed the least efcacy against tumor cells. The drug responses of organoids were consistent with those of tumor cells in advanced disease. Patient-derived organoids enable the creation of a faithful model to use in examining novel therapeutics for RB. Retinoblastoma (RB) is a serious childhood retinal tumor that, if lef untreated, can cause death within 1–2 years.
    [Show full text]
  • Single Cell Derived Clonal Analysis of Human Glioblastoma Links
    SUPPLEMENTARY INFORMATION: Single cell derived clonal analysis of human glioblastoma links functional and genomic heterogeneity ! Mona Meyer*, Jüri Reimand*, Xiaoyang Lan, Renee Head, Xueming Zhu, Michelle Kushida, Jane Bayani, Jessica C. Pressey, Anath Lionel, Ian D. Clarke, Michael Cusimano, Jeremy Squire, Stephen Scherer, Mark Bernstein, Melanie A. Woodin, Gary D. Bader**, and Peter B. Dirks**! ! * These authors contributed equally to this work.! ** Correspondence: [email protected] or [email protected]! ! Supplementary information - Meyer, Reimand et al. Supplementary methods" 4" Patient samples and fluorescence activated cell sorting (FACS)! 4! Differentiation! 4! Immunocytochemistry and EdU Imaging! 4! Proliferation! 5! Western blotting ! 5! Temozolomide treatment! 5! NCI drug library screen! 6! Orthotopic injections! 6! Immunohistochemistry on tumor sections! 6! Promoter methylation of MGMT! 6! Fluorescence in situ Hybridization (FISH)! 7! SNP6 microarray analysis and genome segmentation! 7! Calling copy number alterations! 8! Mapping altered genome segments to genes! 8! Recurrently altered genes with clonal variability! 9! Global analyses of copy number alterations! 9! Phylogenetic analysis of copy number alterations! 10! Microarray analysis! 10! Gene expression differences of TMZ resistant and sensitive clones of GBM-482! 10! Reverse transcription-PCR analyses! 11! Tumor subtype analysis of TMZ-sensitive and resistant clones! 11! Pathway analysis of gene expression in the TMZ-sensitive clone of GBM-482! 11! Supplementary figures and tables" 13" "2 Supplementary information - Meyer, Reimand et al. Table S1: Individual clones from all patient tumors are tumorigenic. ! 14! Fig. S1: clonal tumorigenicity.! 15! Fig. S2: clonal heterogeneity of EGFR and PTEN expression.! 20! Fig. S3: clonal heterogeneity of proliferation.! 21! Fig.
    [Show full text]
  • Pou4f1 and Pou4f2 Are Dispensable for the Long-Term Survival of Adult Retinal Ganglion Cells in Mice
    Pou4f1 and Pou4f2 Are Dispensable for the Long-Term Survival of Adult Retinal Ganglion Cells in Mice Liang Huang1,2, Fang Hu1,2, Xiaoling Xie1, Jeffery Harder1, Kimberly Fernandes1, Xiang-yun Zeng2, Richard Libby1, Lin Gan1,3* 1 Flaum Eye Institute and Department of Ophthalmology, University of Rochester School of Medicine and Dentistry, Rochester, New York, United States of America, 2 Department of Ophthalmology, First Affiliated Hospital of Gannan Medical University, Ganzhou, Jiangxi, China, 3 College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou, Zhejiang, China Abstract Purpose: To investigate the role of Pou4f1 and Pou4f2 in the survival of adult retinal ganglion cells (RGCs). Methods: Conditional alleles of Pou4f1 and Pou4f2 were generated (Pou4f1loxP and Pou4f2loxP respectively) for the removal of Pou4f1 and Pou4f2 in adult retinas. A tamoxifen-inducible Cre was used to delete Pou4f1 and Pou4f2 in adult mice and retinal sections and flat mounts were subjected to immunohistochemistry to confirm the deletion of both alleles and to quantify the changes in the number of RGCs and other retinal neurons. To determine the effect of loss of Pou4f1 and Pou4f2 on RGC survival after axonal injury, controlled optic nerve crush (CONC) was performed and RGC death was assessed. Results: Pou4f1 and Pou4f2 were ablated two weeks after tamoxifen treatment. Retinal interneurons and Mu¨ller glial cells are not affected by the ablation of Pou4f1 or Pou4f2 or both. Although the deletion of both Pou4f1 and Pou4f2 slightly delays the death of RGCs at 3 days post-CONC in adult mice, it does not affect the cell death progress afterwards.
    [Show full text]