DOCSLIB.ORG

SNP Communication Genetic Variations of the ABC Transporter Gene ABCC3 in a Japanese Population

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SNP Communication Genetic Variations of the ABC Transporter Gene ABCC3 in a Japanese Population Drug Metab. Pharmacokinet. 22 (2): SNP22 (129)SNP28 (135) (2007). SNP Communication Genetic Variations of the ABC Transporter Gene ABCC3 in a Japanese Population Hiromi FUKUSHIMA­UESAKA1, Yoshiro SAITO1,2,*,KeikoMAEKAWA1,2, Ryuichi HASEGAWA3, Kazuko SUZUKI4,TatsuoYANAGAWA4, Hiroshi KAJIO5, Nobuaki KUZUYA5, Mitsuhiko NODA5, Kazuki YASUDA6, Masahiro TOHKIN1,3 and Jun­ichi SAWADA1,2 1Project Team for Pharmacogenetics, 2Division of Biochemistry and Immunochemistry, 3Division of Medicinal Safety Science, National Institute of Health Sciences, Tokyo, Japan 4Nerima General Hospital, Tokyo, Japan, 5Division of Endocrine and Metabolic Diseases, the Hospital, 6Department of Metabolic Disorder, Research Institute, International Medical Center of Japan, Tokyo, Japan Full text of this paper is available at http://www.jstage.jst.go.jp/browse/dmpk Summary: An ATP­binding cassette transporter, multidrug resistance­related protein 3 (MRP3), is encoded by the ABCC3 gene. The MRP3 protein is expressed in several tissues, and functions as an eux transporter for conjugated as well as unconjugated substrates. In this study, the 31 ABCC3 exons and their anking introns were comprehensively screened for genetic variations in 89 Japanese subjects. Forty­six genetic variations, including 21 novel ones, were found: 8 were located in the 5?­anking region, 14 in the coding exons (8 synonymous and 6 nonsynonymous variations), and 24 in the introns. Of these 46 variations, ve novel nonsynonymous variations, 2221CÀT (Gln741Stop), 2395GÀA (Val799Met), 2798ä2799delAG (Gln933ArgfsX64), 3657CÀA (Ser1219Arg), and 4217CÀT (Thr1406Met), were found as heterozygous variations. The allele frequencies were 0.011 for Ser1219Arg and 0.006 for the other four variations. Gln741Stop induces a stop codon at codon 741. Gln933ArgfsX64 causes a frame­shift at codon 933, resulting in early termination at codon 997. Both variations result in loss of 6 transmembrane helices (from the 12th to 17th helices) in the C­terminus and all regions of nucleotide binding domain 2. Thus, both variant proteins are assumed to be inactive. These data provide fundamental and useful information for pharmacogenetic studies on MRP3­transported drugs in Japanese. Key words: ABCC3; direct sequencing; novel genetic variation; amino acid change encoded by the ATP­binding cassette transporter C3 Introduction gene (ABCC3 ), and the most homologous to MRP1 The multidrug resistance­related protein 3 (MRP3) is among MRP family members.1) The ABCC3 gene consists of 31 exons spanning approximately 57 kb at chromosome 17q22, encodes 1527 amino acids, and the As of October 22, 2006, the novel variations reported here are not found in the database of Japanese Single Nucleotide Polymorphisms resulting membrane proteins (190 and 170 kDa) have 15) (http:WWsnp.ims.u­tokyo.ac.jpW), dbSNP in the National Center for dierent glycosylation patterns. MRP3 mRNA and Biotechnology Information (http:WWwww.ncbi.nlm.nih.govWSNPW), protein are expressed in several tissues including adrenal or PharmGKB Database (http:WWwww.pharmgkb.orgW). gland, liver, small intestine, colon, kidney, and pan­ This study was supported in part by the Program for the Promotion of creas.17) MRP3 protein is localized to the basolateral Fundamental Studies in Health Sciences and the Health and Labor Sciences Research Grants (Research on Advanced Medical Technolo­ membranes of the cells in epithelia and thought to play a gy) from the Ministry of Health, Labor and Welfare. role in the eux of organic anions including drugs.1,5,7) Received; October 23, 2006, Accepted; November 16, 2006 *To whom correspondence should be addressed: Yoshiro SAITO,Ph.D.,Division of Biochemistry and Immunochemistry, National Institute of Health Sciences, 1­18­1 Kamiyoga, Setagaya­ku, Tokyo 158­8501, Japan. Tel. {81­3­5717­3831, Fax. {81­3­5717­3832, E­mail: yoshiro nihs.go.jp SNP22 (129) SNP23 (130) Hiromi FUKUSHIMA­UESAKA, et al. Similar to MRP1 protein, MRP3 is predicted to have 17 Materials and Methods transmembrane helices (TM) in three membrane span­ ning domains (consisting of TM1 to TM5, TM6 to Human genomic DNA samples: Eighty­nine TM11, and TM12 to TM17) and two large cytoplasmic Japanese diabetic subjects administered glimepiride domains between TM11 and TM12, and downstream of participated in this study with written informed consent. TM17.1,3) These two cytoplasmic domains contain Genomic DNA was extracted from blood leukocytes. nucleotide binding domains (NBD1 and NBD2), where The ethical review boards of the International Medical binding and hydrolysis of ATP occur to facilitate sub­ Center of Japan, Nerima General Hospital, and the strate transport. Three sequence motifs in each NBD are National Institute of HealthSciences approved this also conserved in the MRP3 protein, called Walker A, study. Walker B and ABC signature sequence.1,3) PCR conditions for DNA sequencing and linkage Human MRP3 can transport glucuronide­, sulfate­ disequilibrium (LD)analysis: Genomic and mRNA and glutathione­conjugates such as the estradiol 17b­D­ sequences of ABCC3 obtained from GenBank glucuronide, dinitrophenyl S­glutathione and leu­ (NTä010783.14 and NMä003786.2, respectively) were kotriene C4, and also some bile acids including used for primer design and as reference sequences. First, glycocholate.1,8,9) In vitro studies have also indicated multiplex long­range PCR was performed to amplify all that overexpression of MRP3 confers resistance to 31 exons of ABCC3 from 100 ng of genomic DNA using anticancer drugs etoposide and teniposide.8,10) In 0.025 unitsWmL of Z­Taq (Takara Bio Inc., Shiga, contrast to MRP1 and MRP2, depletion of cellular Japan) withfour sets of primers (1 mM) designed in the glutathione did not inuence the resistance to etoposide intronic regions as listed in Table 1 (``1st PCR''). The and teniposide, and MRP3 could not eux glutathione rst PCR conditions were 30 cycles of 989C for 5 sec, itself.8,10) Thefolateanaloguesmethotrexateand559C for 5 sec, and 729C for 190 sec. Next, eachexon, leucovorin are also substrates of MRP3.11) In addition, a except for exon 1, was amplied separately in the 2nd recent report showed that an anti­diabetic drug, glybu­ PCR using the 1st PCR product as a template by Ex­ ride, was transported by MRP3.12) In mice, knock­out Taq (0.02 unitsWmL, Takara Bio Inc.) withprimers (0.2 of the ABCC3 gene altered pharmacokinetics of mM) listed in ``2nd PCR'' in Table 1.Becauseofahigh morphine­3­glucuronide, and decreased anti­nocicep­ GC content, exon 1 was amplied using 0.05 unitsWmL tive eects of interperitoneally injected morphine­ of LA­Taq (Takara Bio Inc.) in GC buer I with0.5 mM 6­glucuronide.13) Thus, MRP3 is thought to be involved of the primers listed in Table 1. The second PCR in tissue distribution of anionic compounds, which conditions were 949C for 5 min, followed by 30 cycles includes drugs. of 949C for 30 sec, 609Cfor1min,and729Cfor2min, MRP3 mRNA and protein expression levels were and then a nal extension at 729Cfor7min.ThePCR reported to vary 86­ and 84­fold, respectively, in products were then treated with a PCR Product Pre­ Caucasian livers.14) Thesevariationsmaybecausedin Sequencing Kit (USB Co., Cleveland, OH, USA) and part by transcriptional regulation. Expression of MRP3 directly sequenced on bothstrands using an ABI BigDye mRNA was enhanced by pregnane X receptor agonists Terminator Cycle Sequencing Kit version 3.1 (Applied suchas rifampicin, 15) andalsobyomeprazoleand Biosystems, Foster City, CA, USA) and the sequencing b­naphtoavone, possibly through aryl hydrocarbon primers listed in Table 1 (Sequencing). Excess dye was receptor pathway.16) MRP3 expression is also induced removed by a DyeEx96 kit (Qiagen, Hilden, Germany) by bile salts such as chenodeoxycholic acid through andtheeluateswereappliedtoanABIPrism3730DNA induction of a­1 fetoprotein transcription factor, which Analyzer (Applied Biosystems). All rare novel varia­ binds to the two elements located 224 to 195 bases tions were conrmed by repeated sequencing analyses of upstream of the translational start site.17) PCR products generated by new genomic DNA In addition, genetic polymorphisms are known in the amplications. Under the conditions used, up to 2.1 kb ABCC3 gene. Fifty­one polymorphisms, including 6 upstream of the translational start site, all exons and nonsynonymous ones, were reported in Caucasians.14) their anking introns were successfully sequenced for all One polymorphism, |211CÀT, had a signicant corre­ subjects. The nucleotide positions based on the cDNA lation withreduced mRNA expression levels in theliver. sequence were numbered from the adenine of the Saito et al. found 35 genetic polymorphisms, including 3 translational initiation site or the nearest exons. synonymous ones, in 48 Japanese subjects.18) However, Hardy­Weinberg equilibrium and linkage dise­ no nonsynonymous polymorphism was reported for quilibrium (LD) analyses were performed withSNPA­ Asian populations, which included the Japanese. lyze version 3.1 (Dynacom Co., Yokohama, Japan), In this study, we searched for genetic variations in and pairwise LDs between variations were obtained for ABCC3 by resequencing all 31 exons and their sur­ rho square (r 2)and`D?` values. rounding introns from 89 Japanese subjects. Genetic Variations of ABCC3 in Japanese SNP24 (131) Table 1. ABCC3 sequencing primers Amplied or ? ? ? ? Amplied sequenced region Forward primer (5 to 3 ) Reverse primer (5 to 3 ) length (bp) 1st PCR |2k to Exon 1 AGCCTTGGGAAAGCAATAGCGATAG TCTGTGAGAAGGGAGTTGGACTACA
Load more

Recommended publications
  • Developmental Differences in the Expression of ABC Transporters at Rat Brain Barrier Interfaces Following Chronic Exposure to Di
    www.nature.com/scientificreports OPEN Developmental diferences in the expression of ABC transporters at rat brain barrier interfaces Received: 28 November 2018 Accepted: 28 March 2019 following chronic exposure to Published: xx xx xxxx diallyl sulfde Liam M. Koehn1, Katarzyna M. Dziegielewska1, Kjeld Møllgård 2, Elodie Saudrais3, Nathalie Strazielle3,4, Jean-Francois Ghersi-Egea3, Norman R. Saunders 1 & Mark D. Habgood1 Many pregnant women and prematurely born infants require medication for clinical conditions including cancer, cardiac defects and psychiatric disorders. In adults drug transfer from blood into brain is mostly restricted by efux mechanisms (ATP-binding cassette, ABC transporters). These mechanisms have been little studied during brain development. Here expression of eight ABC transporters (abcb1a, abcb1b, abcg2, abcc1, abcc2, abcc3, abcc4, abcc5) and activity of conjugating enzyme glutathione-s- transferase (GST) were measured in livers, brain cortices (blood-brain-barrier) and choroid plexuses (blood-cerebrospinal fuid, CSF, barrier) during postnatal rat development. Controls were compared to animals chronically injected (4 days, 200 mg/kg/day) with known abcb1a inducer diallyl sulfde (DAS). Results reveal both tissue- and age-dependent regulation. In liver abcb1a and abcc3 were up- regulated at all ages. In cortex abcb1a/b, abcg2 and abcc4/abcc5 were up-regulated in adults only, while in choroid plexus abcb1a and abcc2 were up-regulated only at P14. DAS treatment increased GST activity in livers, but not in cortex or choroid plexuses. Immunocytochemistry of ABC transporters at the CSF-brain interface showed that PGP and BCRP predominated in neuroepithelium while MRP2/4/5 were prominent in adult ependyma. These results indicate an age-related capacity of brain barriers to dynamically regulate their defence mechanisms when chronically challenged by xenobiotic compounds.
    [Show full text]
  • Bile Acid Transporters and Regulatory Nuclear Receptors in the Liver and Beyond
    Review Bile acid transporters and regulatory nuclear receptors in the liver and beyond ⇑ Emina Halilbasic, Thierry Claudel, Michael Trauner Hans Popper Laboratory of Molecular Hepatology, Division of Gastroenterology and Hepatology, Department of Internal Medicine III, Medical University of Vienna, Austria Summary logical functions including stimulation of bile flow, intestinal absorption of lipophilic nutrients, solubilization and excretion of Bile acid (BA) transporters are critical for maintenance of the enter- cholesterol, as well as antimicrobial and metabolic effects. Tight ohepatic BA circulation where BAs exert their multiple physio- regulation of BA transporters via nuclear receptors is necessary to maintain proper BA homeostasis. Hereditary and acquired defects of BA transporters are involved in the pathogenesis of sev- Keywords: Bile acids, Cholestasis; Fatty liver disease; Gallstones; Liver regener- eral hepatobiliary disorders including cholestasis, gallstones, fatty ation; Liver cancer. liver disease and liver cancer, but also play a role in intestinal and Received 12 January 2012; received in revised form 1 August 2012; accepted 3 August metabolic disorders beyond the liver. Thus, pharmacological mod- 2012 ification of BA transporters and their regulatory nuclear receptors ⇑ Corresponding author. Address: Hans Popper Laboratory of Molecular Hepa- tology, Division of Gastroenterology and Hepatology, Department of Internal opens novel treatment strategies for a wide range of disorders. Medicine III, Medical University of Vienna, Waehringer Waehringer Guertel 18- Ó 2012 European Association for the Study of the Liver. Published 20, A-1090 Vienna, Austria. Tel.: +43 01 40400 4741; fax: +43 01 40400 4735. by Elsevier B.V. All rights reserved. E-mail address: [email protected] (M. Trauner).
    [Show full text]
  • Computational Modeling to Predict the Functions and Impact of Drug Transporters Pär Matsson1,2* and Christel a S Bergström1,2*
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Springer - Publisher Connector Matsson and Bergström In Silico Pharmacology (2015) 3:8 DOI 10.1186/s40203-015-0012-3 REVIEW Open Access Computational modeling to predict the functions and impact of drug transporters Pär Matsson1,2* and Christel A S Bergström1,2* Abstract Transport proteins are important mediators of cellular drug influx and efflux and play crucial roles in drug distribution, disposition and clearance. Drug-drug interactions have increasingly been found to occur at the transporter level and, hence, computational tools for studying drug-transporter interactions have gained in interest. In this short review, we present the most important transport proteins for drug influx and efflux. Computational tools for predicting and understanding the substrate and inhibitor interactions with these membrane-bound proteins are discussed. We have primarily focused on ligand-based and structure-based modeling, for which the state-of-the-art and future challenges are also discussed. Keywords: Drug transport; Membrane transporter; Carrier-mediated transport; Structure-activity relationship; Ligand-based modeling; Structure-based modeling Introduction Export Pump (BSEP; ABCB11), and the members of the Transport proteins, which are expressed in all tissues of multidrug resistance-associated protein family (MRP; the body, facilitate the transmembrane transport of essen- ABCC) (Giacomini et al. 2010, Hillgren et al. 2013). tial solutes such as nutrients and signal substances. They About 40 human ABC transporters are known to also play an important role in the removal of metabolites date, while more than 350 SLC transporters have been and toxicants from cells and tissues.
    [Show full text]
  • Interindividual Differences in the Expression of ATP-Binding
    Supplemental material to this article can be found at: http://dmd.aspetjournals.org/content/suppl/2018/02/02/dmd.117.079061.DC1 1521-009X/46/5/628–635$35.00 https://doi.org/10.1124/dmd.117.079061 DRUG METABOLISM AND DISPOSITION Drug Metab Dispos 46:628–635, May 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Special Section on Transporters in Drug Disposition and Pharmacokinetic Prediction Interindividual Differences in the Expression of ATP-Binding Cassette and Solute Carrier Family Transporters in Human Skin: DNA Methylation Regulates Transcriptional Activity of the Human ABCC3 Gene s Tomoki Takechi, Takeshi Hirota, Tatsuya Sakai, Natsumi Maeda, Daisuke Kobayashi, and Ichiro Ieiri Downloaded from Department of Clinical Pharmacokinetics, Graduate School of Pharmaceutical Sciences, Kyushu University, Fukuoka, Japan (T.T., T.H., T.S., N.M., I.I.); Drug Development Research Laboratories, Kyoto R&D Center, Maruho Co., Ltd., Kyoto, Japan (T.T.); and Department of Clinical Pharmacy and Pharmaceutical Care, Graduate School of Pharmaceutical Sciences, Kyushu University, Fukuoka, Japan (D.K.) Received October 19, 2017; accepted January 30, 2018 dmd.aspetjournals.org ABSTRACT The identification of drug transporters expressed in human skin and levels. ABCC3 expression levels negatively correlated with the methylation interindividual differences in gene expression is important for understanding status of the CpG island (CGI) located approximately 10 kilobase pairs the role of drug transporters in human skin. In the present study, we upstream of ABCC3 (Rs: 20.323, P < 0.05). The reporter gene assay revealed evaluated the expression of ATP-binding cassette (ABC) and solute carrier a significant increase in transcriptional activity in the presence of CGI.
    [Show full text]
  • The Food Contaminants Pyrrolizidine Alkaloids Disturb Bile Acid Homeostasis Structure-Dependently in the Human Hepatoma Cell Line Heparg
    foods Article The Food Contaminants Pyrrolizidine Alkaloids Disturb Bile Acid Homeostasis Structure-Dependently in the Human Hepatoma Cell Line HepaRG Josephin Glück 1, Marcus Henricsson 2, Albert Braeuning 1 and Stefanie Hessel-Pras 1,* 1 Department of Food Safety, German Federal Institute for Risk Assessment, Max-Dohrn-Straße 8-10, 10589 Berlin, Germany; [email protected] (J.G.); [email protected] (A.B.) 2 Wallenberg Laboratory, Department of Molecular and Clinical Medicine, Institute of Medicine, University of Gothenburg, 413 45 Gothenburg, Sweden; [email protected] * Correspondence: [email protected]; Tel.: +49-30-18412-25203 Abstract: Pyrrolizidine alkaloids (PAs) are a group of secondary plant metabolites being contained in various plant species. The consumption of contaminated food can lead to acute intoxications in humans and exert severe hepatotoxicity. The development of jaundice and elevated bile acid concentrations in blood have been reported in acute human PA intoxication, indicating a connection between PA exposure and the induction of cholestasis. Additionally, it is considered that differences in toxicity of individual PAs is based on their individual chemical structures. Therefore, we aimed to elucidate the structure-dependent disturbance of bile acid homeostasis by PAs in the human hepatoma cell line HepaRG. A set of 14 different PAs, including representatives of all major structural characteristics, namely, the four different necine bases retronecine, heliotridine, otonecine and platynecine and different grades of esterification, was analyzed in regard to the expression of genes Citation: Glück, J.; Henricsson, M.; Braeuning, A.; Hessel-Pras, S. The involved in bile acid synthesis, metabolism and transport.
    [Show full text]
  • Pleiotropic Roles of ABC Transporters in Breast Cancer
    International Journal of Molecular Sciences Review Pleiotropic Roles of ABC Transporters in Breast Cancer Ji He 1 , Erika Fortunati 1, Dong-Xu Liu 2 and Yan Li 1,2,3,* 1 School of Science, Auckland University of Technology, Auckland 1010, New Zealand; [email protected] (J.H.); [email protected] (E.F.) 2 The Centre for Biomedical and Chemical Sciences, School of Science, Faculty of Health and Environmental Sciences, Auckland University of Technology, Auckland 1010, New Zealand; [email protected] 3 School of Public Health and Interprofessional Studies, Auckland University of Technology, Auckland 0627, New Zealand * Correspondence: [email protected]; Tel.: +64-9921-9999 (ext. 7109) Abstract: Chemotherapeutics are the mainstay treatment for metastatic breast cancers. However, the chemotherapeutic failure caused by multidrug resistance (MDR) remains a pivotal obstacle to effective chemotherapies of breast cancer. Although in vitro evidence suggests that the overexpression of ATP-Binding Cassette (ABC) transporters confers resistance to cytotoxic and molecularly targeted chemotherapies by reducing the intracellular accumulation of active moieties, the clinical trials that target ABCB1 to reverse drug resistance have been disappointing. Nevertheless, studies indicate that ABC transporters may contribute to breast cancer development and metastasis independent of their efflux function. A broader and more clarified understanding of the functions and roles of ABC transporters in breast cancer biology will potentially contribute to stratifying patients for precision regimens and promote the development of novel therapies. Herein, we summarise the current knowledge relating to the mechanisms, functions and regulations of ABC transporters, with a focus on the roles of ABC transporters in breast cancer chemoresistance, progression and metastasis.
    [Show full text]
  • Mrp3), and Abcg2 (Bcrp1) Are the Main Determinants for Rapid Elimination of Methotrexate and Its Toxic Metabolite 7-Hydroxymethotrexate in Vivo
    Published OnlineFirst December 8, 2009; DOI: 10.1158/1535-7163.MCT-09-0668 3350 Abcc2 (Mrp2), Abcc3 (Mrp3), and Abcg2 (Bcrp1) are the main determinants for rapid elimination of methotrexate and its toxic metabolite 7-hydroxymethotrexate in vivo Maria L. H. Vlaming,1 Anita van Esch,1 Zeliha Pala,3 and Abcg2 together mediate the rapid elimination of Els Wagenaar,1 Koen van de Wetering,1 MTX and 7OH-MTX after i.v. administration and can Olaf van Tellingen,2 and Alfred H. Schinkel1 to a large extent compensate for each other's absence. This may explain why it is still comparatively safe to Divisions of 1Molecular Biology and 2Clinical Chemistry, The use a toxic drug such as MTX in the clinic, as the risk Netherlands Cancer Institute, Amsterdam, the Netherlands; of highly increased toxicity due to dysfunctioning of and 3Department of Pharmacology, Faculty of Pharmacy, Istanbul University, Istanbul, Turkey ABCC2, ABCC3, or ABCG2 alone is limited. Neverthe- less, cotreatment with possible inhibitors of ABCC2, ABCC3, and ABCG2 should be done with utmost cau- Abstract tion when treating patients with methotrexate. [Mol The multidrug transporters ABCC2, ABCC3, and ABCG2 Cancer Ther 2009;8(12):3350–9] can eliminate potentially toxic compounds from the body and have overlapping substrate specificities. To in- Introduction vestigate the overlapping functions of Abcc2, Abcc3, and Abcg2 in vivo, we generated and characterized The ATP-binding cassette (ABC) transporters ABCC2, Abcc3;Abcg2−/− and Abcc2;Abcc3;Abcg2−/− mice. We ABCC3, and ABCG2 are transmembrane proteins that are subsequently analyzed the relative impact of these involved in the export of potentially toxic endogenous transport proteins on the pharmacokinetics of the anti- and exogenous compounds from the cell.
    [Show full text]
  • Role of Genetic Variation in ABC Transporters in Breast Cancer Prognosis and Therapy Response
    International Journal of Molecular Sciences Article Role of Genetic Variation in ABC Transporters in Breast Cancer Prognosis and Therapy Response Viktor Hlaváˇc 1,2 , Radka Václavíková 1,2, Veronika Brynychová 1,2, Renata Koževnikovová 3, Katerina Kopeˇcková 4, David Vrána 5 , Jiˇrí Gatˇek 6 and Pavel Souˇcek 1,2,* 1 Toxicogenomics Unit, National Institute of Public Health, 100 42 Prague, Czech Republic; [email protected] (V.H.); [email protected] (R.V.); [email protected] (V.B.) 2 Biomedical Center, Faculty of Medicine in Pilsen, Charles University, 323 00 Pilsen, Czech Republic 3 Department of Oncosurgery, Medicon Services, 140 00 Prague, Czech Republic; [email protected] 4 Department of Oncology, Second Faculty of Medicine, Charles University and Motol University Hospital, 150 06 Prague, Czech Republic; [email protected] 5 Department of Oncology, Medical School and Teaching Hospital, Palacky University, 779 00 Olomouc, Czech Republic; [email protected] 6 Department of Surgery, EUC Hospital and University of Tomas Bata in Zlin, 760 01 Zlin, Czech Republic; [email protected] * Correspondence: [email protected]; Tel.: +420-267-082-711 Received: 19 November 2020; Accepted: 11 December 2020; Published: 15 December 2020 Abstract: Breast cancer is the most common cancer in women in the world. The role of germline genetic variability in ATP-binding cassette (ABC) transporters in cancer chemoresistance and prognosis still needs to be elucidated. We used next-generation sequencing to assess associations of germline variants in coding and regulatory sequences of all human ABC genes with response of the patients to the neoadjuvant cytotoxic chemotherapy and disease-free survival (n = 105).
    [Show full text]
  • ABCC3 As a Marker for Multidrug Resistance in Non-Small Cell Lung
    OPEN ABCC3 as a marker for multidrug SUBJECT AREAS: resistance in non-small cell lung cancer TUMOUR BIOMARKERS Yanbin Zhao1*, Hailing Lu1*, An Yan1, Yanmei Yang2, Qingwei Meng1, Lichun Sun1, Hui Pang1, NON-SMALL-CELL LUNG CANCER Chunhong Li1, Xiaoqun Dong3 & Li Cai1 Received 1Department of Internal Medical Oncology, the Affiliated Tumor Hospital of Harbin Medical University, Harbin, Heilongjiang 20 August 2013 Province, China, 2Cancer Research Institute, Harbin Medical University, Harbin, Heilongjiang Province, China, 3Department of Biomedical and Pharmaceutical Sciences, College of Pharmacy, The University of Rhode Island, Pharmacy Building, 7 Greenhouse Accepted Road, Kingston, RI 02881, USA. 18 October 2013 Published Multidrug resistance (MDR) contributes to the failure of chemotherapy and high mortality in non-small cell 1 November 2013 lung cancer (NSCLC). We aim to identify MDR genes that predict tumor response to chemotherapy. 199 NSCLC fresh tissue samples were tested for chemosensitivity by MTT assay. cDNA microarray was done with 5 samples with highest resistance and 6 samples with highest sensitivity. Expression of ABCC3 mRNA Correspondence and and protein was detected by real-time PCR and immunohistochemisty, respectively. The association between gene expression and overall survival (OS) was examined using Cox proportional hazard regression. requests for materials 44 genes were upregulated and 168 downregulated in the chemotherapy-resistant group. ABCC3 was one of should be addressed to the most up-regulated genes in the resistant group. ABCC3-positive expression correlated with lymph node X.Q.D. involvement, advanced TNM stage, more malignant histological type, multiple-resistance to anti-cancer (xiaoqun_dong@uri. drugs, and reduced OS. ABCC3 expression may serve as a marker for MDR and predictor for poor clinical edu) or L.C.
    [Show full text]
  • Global Identification of MLL2-Targeted Loci Reveals Mll2ts Role in Diverse Signaling Pathways
    Global identification of MLL2-targeted loci reveals MLL2’s role in diverse signaling pathways Changcun Guoa,b,c,1, Chun-Chi Changa,b,c,1, Matthew Worthama,b,c, Lee H. Chena,b,c, Dawn N. Kernagisc, Xiaoxia Qind, Young-Wook Choe,2, Jen-Tsan Chid, Gerald A. Granta,b,f, Roger E. McLendona,b,c, Hai Yana,b,c, Kai Gee, Nickolas Papadopoulosg, Darell D. Bignera,b,c, and Yiping Hea,b,c,3 aThe Preston Robert Tisch Brain Tumor Center at Duke, bPediatric Brain Tumor Foundation Institute, cDepartment of Pathology, dInstitute for Genome Sciences and Policy, and fDepartment of Surgery, Duke University, Durham, NC 27710; eLaboratory of Endocrinology and Receptor Biology, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892; and gLudwig Center for Cancer Genetics and Therapeutics, Sidney Kimmel Comprehensive Cancer Center, Baltimore, MD 21231 Edited* by Bert Vogelstein, Johns Hopkins University, Baltimore, MD, and approved September 14, 2012 (received for review June 1, 2012) Myeloid/lymphoid or mixed-lineage leukemia (MLL)-family genes SWI/SNF, the MLL2 or MLL3 (hereafter referred to as MLL2/ encode histone lysine methyltransferases that play important 3) complex has been found to play essential roles as a coactivator roles in epigenetic regulation of gene transcription. MLL genes for transcriptional activation by nuclear hormone receptors (11). are frequently mutated in human cancers. Unlike MLL1, MLL2 (also Consistent with this notion, previous studies have shown that known as ALR/MLL4) and its homolog MLL3 are not well-under- MLL2/3 complexes regulate Hox gene transcription in an es- stood.
    [Show full text]
  • Pharmacogenetic Analysis of High-Dose Methotrexate Treatment in Children with Osteosarcoma
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 6), pp: 9388-9398 Research Paper Pharmacogenetic analysis of high-dose methotrexate treatment in children with osteosarcoma Marta Hegyi1, Adam Arany2,3, Agnes F. Semsei4, Katalin Csordas1, Oliver Eipel1, Andras Gezsi2,4, Nora Kutszegi1,4, Monika Csoka1, Judit Muller1, Daniel J. Erdelyi1, Peter Antal2, Csaba Szalai4, Gabor T. Kovacs1 1Second Department of Pediatrics, Semmelweis University, H-1094 Budapest, Tűzoltó utca 7-9, Hungary 2Department of Measurement and Information Systems, University of Technology and Economics, H-1111 Budapest, Műegyetem rkp. 3, Hungary 3Department of Organic Chemistry, Semmelweis University, H-1092 Budapest, Hőgyes Endre u. 7, Hungary 4Department of Genetics, Cell and Immunobiology, Semmelweis University, H-1089 Budapest, Nagyvárad tér 4, Hungary Correspondence to: Gabor T. Kovacs, email: [email protected] Keywords: osteosarcoma, methotrexate, toxicity, SNP, Bayesian network-based Bayesian multilevel analysis of relevance (BN-BMLA) Received: February 18, 2016 Accepted: August 09, 2016 Published: August 23, 2016 ABSTRACT Inter-individual differences in toxic symptoms and pharmacokinetics of high- dose methotrexate (MTX) treatment may be caused by genetic variants in the MTX pathway. Correlations between polymorphisms and pharmacokinetic parameters and the occurrence of hepato- and myelotoxicity were studied. Single nucleotide polymorphisms (SNPs) of the ABCB1, ABCC1, ABCC2, ABCC3, ABCC10, ABCG2, GGH, SLC19A1 and NR1I2 genes were analyzed in 59 patients with osteosarcoma. Univariate association analysis and Bayesian network-based Bayesian univariate and multilevel analysis of relevance (BN-BMLA) were applied. Rare alleles of 10 SNPs of ABCB1, ABCC2, ABCC3, ABCG2 and NR1I2 genes showed a correlation with the pharmacokinetic values and univariate association analysis.
    [Show full text]
  • Repositioning of Tyrosine Kinase Inhibitors As Antagonists of ATP-Binding Cassette Transporters in Anticancer Drug Resistance
    Cancers 2014, 6, 1925-1952; doi:10.3390/cancers6041925 OPEN ACCESS cancers ISSN 2072-6694 www.mdpi.com/journal/cancers Review Repositioning of Tyrosine Kinase Inhibitors as Antagonists of ATP-Binding Cassette Transporters in Anticancer Drug Resistance Yi-Jun Wang, Yun-Kai Zhang, Rishil J. Kathawala and Zhe-Sheng Chen * Department of Pharmaceutical Sciences, College of Pharmacy and Health Sciences, St. John’s University, Queens, NY 11439, USA; E-Mails: [email protected] (Y.-J.W.); [email protected] (Y.-K.Z.); [email protected] (R.J.K.) * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-718-990-1432; Fax: +1-718-990-1877. Received: 31 July 2014; in revised form: 4 September 2014 / Accepted: 11 September 2014 / Published: 29 September 2014 Abstract: The phenomenon of multidrug resistance (MDR) has attenuated the efficacy of anticancer drugs and the possibility of successful cancer chemotherapy. ATP-binding cassette (ABC) transporters play an essential role in mediating MDR in cancer cells by increasing efflux of drugs from cancer cells, hence reducing the intracellular accumulation of chemotherapeutic drugs. Interestingly, small-molecule tyrosine kinase inhibitors (TKIs), such as AST1306, lapatinib, linsitinib, masitinib, motesanib, nilotinib, telatinib and WHI-P154, have been found to have the capability to overcome anticancer drug resistance by inhibiting ABC transporters in recent years. This review will focus on some of the latest and clinical developments with ABC transporters, TKIs and anticancer drug resistance. Keywords: multidrug resistance; ABC transporters; tyrosine kinase inhibitor; clinical relevance; pharmacogenomics 1. Introduction Cancer, also known as malignant neoplasm or tumor, is the second most leading cause of death after cardiovascular diseases in United States and developing countries.
    [Show full text]