DOCSLIB.ORG

Expression Analysis and Significance of PD-1, LAG-3, and TIM-3 in Human Non−Small Cell Lung Cancer Using Spatially Resolved and Multiparametric Single-Cell Analysis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression Analysis and Significance of PD-1, LAG-3, and TIM-3 in Human Non−Small Cell Lung Cancer Using Spatially Resolved and Multiparametric Single-Cell Analysis Published OnlineFirst May 3, 2019; DOI: 10.1158/1078-0432.CCR-18-4142 Precision Medicine and Imaging Clinical Cancer Research Expression Analysis and Significance of PD-1, LAG-3, and TIM-3 in Human Non–Small Cell Lung Cancer Using Spatially Resolved and Multiparametric Single-Cell Analysis Ila Datar1,2, Miguel F. Sanmamed3,4,5, Jun Wang3, Brian S. Henick1,2, Jungmin Choi6, Ti Badri3, Weilai Dong6, Nikita Mani1, Maria Toki1, Luis D. Mejías4, Maria D. Lozano4, Jose Luis Perez-Gracia4,Vamsidhar Velcheti7, Matthew D. Hellmann8,9,10, Justin F. Gainor11, Kristen McEachern12, David Jenkins12, Konstantinos Syrigos13, Katerina Politi1,2, Scott Gettinger2, David L. Rimm1,2, Roy S. Herbst2, Ignacio Melero4,5, Lieping Chen3, and Kurt A. Schalper1,2 Abstract Purpose: To determine the tumor tissue/cell distribution, ing immunotherapy. Expression of the markers was lower in functional associations, and clinical significance of PD-1, LAG- EGFR-mutated adenocarcinomas and displayed limited asso- 3, and TIM-3 protein expression in human non–small cell lung ciation with tumor mutational burden. In single-cell CyTOF cancer (NSCLC). analysis, PD-1 and LAG-3 were predominantly localized on Experimental Design: Using multiplexed quantitative T-cell subsets/NKT cells, whereas TIM-3 expression was higher immunofluorescence, we performed localized measure- in NK cells and macrophages. Coexpression of PD-1, LAG-3, ments of CD3, PD-1, LAG-3, and TIM-3 protein in >800 and TIM-3 was associated with prominent T-cell activation clinically annotated NSCLCs from three independent (CD69/CD137), effector function (Granzyme-B), and prolif- cohorts represented in tissue microarrays. Associations eration (Ki-67), but also with elevated levels of proapoptotic between the marker's expression and major genomic altera- markers (FAS/BIM). LAG-3 and TIM-3 were present in TIL tions were studied in The Cancer Genome Atlas NSCLC subsets lacking PD-1 expression and showed a distinct func- dataset. Using mass cytometry (CyTOF) analysis of leuko- tional profile. In baseline samples from 90 patients with cytes collected from 20 resected NSCLCs, we determined the advanced NSCLC treated with PD-1 axis blockers, elevated levels, coexpression, and functional profile of PD-1, LAG-3, LAG-3 was significantly associated with shorter progression- and TIM-3 expressing immune cells. Finally, we measured free survival. the markers in baseline samples from 90 patients with Conclusions: PD-1, LAG-3, and TIM-3 have distinct tissue/ advanced NSCLC treated with PD-1 axis blockers and cell distribution, functional implications, and genomic corre- known response to treatment. lates in human NSCLC. Expression of these immune inhibi- Results: PD-1, LAG-3, and TIM-3 were detected in tumor- tory receptors in TILs is associated with prominent activation, infiltrating lymphocytes (TIL) from 55%, 41.5%, and 25.3% of but also with a proapoptotic T-cell phenotype. Elevated LAG-3 NSCLC cases, respectively. These markers showed a prominent expression is associated with insensitivity to PD-1 axis block- association with each other and limited association with major ade, suggesting independence of these immune evasion clinicopathologic variables and survival in patients not receiv- pathways. 1Department of Pathology, Yale University School of Medicine, New Haven, Note: Supplementary data for this article are available at Clinical Cancer Connecticut. 2Department of Medical Oncology, Yale University, Yale Cancer Research Online (http://clincancerres.aacrjournals.org/). Center, New Haven, Connecticut. 3Department of Immunobiology, Yale Univer- sity School of Medicine, New Haven, Connecticut. 4Clinic University of Navarra, I. Datar and M.F. Sanmamed contributed equally in this article. Pamplona, Spain. 5CIBERONC, Madrid, Spain. 6Department of Genetics, Yale Corresponding Author: Kurt A. Schalper, Yale School of Medicine, PO Box University School of Medicine, New Haven, Connecticut. 7Department of Tho- 208023, 310 Cedar Street, New Haven, CT 06520-8023. Phone: 203-988-5773; racic Oncology, New York University, Langone Medical Center, New York, New Fax: 203-737-5089; E-mail: [email protected] York. 8Memorial Sloan Kettering Cancer Center, New York, New York. 9Weill 10 Cornell Medical College, New York, New York. Parker Institute for Cancer Clin Cancer Res 2019;XX:XX–XX Immunotherapy, San Francisco, California. 11Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts. 12Tesaro Inc., Boston, doi: 10.1158/1078-0432.CCR-18-4142 Massachusetts. 13Oncology Unit GPP, Athens School of Medicine, Athens, Greece. Ó2019 American Association for Cancer Research. www.aacrjournals.org OF1 Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2019 American Association for Cancer Research. Published OnlineFirst May 3, 2019; DOI: 10.1158/1078-0432.CCR-18-4142 Datar et al. variable N-terminal Ig domain and a mucin stalk domain (24). Translational Relevance An immunosuppressive effect of TIM-3 signaling on T cells was Our results reveal that PD-1, LAG-3, and TIM-3 show reported to be related with the binding of Galectin-9 and CEA- differential tissue/cell distribution, functional impact, and CAM1 (25, 26). Additional candidate ligands have also been clinical significance in NSCLCs. In addition, single-cell studies shown to be able to modulate TIM-3 functions including phos- show that simultaneous coexpression of these immune-inhib- phatidyl serine (PtdSer) and high-mobility group protein B1 itory receptors is associated with prominent tumor-infiltrating (HMGB1; ref. 14).Clinical studies assessing the safety and anti- lymphocyte activation, but also with acquisition of a proa- tumor effect of TIM-3 blockers alone or in combination with other poptotic phenotype. Finally, we determine the prognostic therapies are currently ongoing: NCT02817633, NCT03099109, value of the markers and identify a negative association NCT03066648. The expression, tissue distribution, and associa- between elevated baseline LAG-3 and sensitivity to PD-1 axis tion of TIM-3 with other immune-inhibitory receptors in human blockade. Taken together, our results support independence of lung cancer are not well understood. these immune-inhibitory pathways and expand the current Here, we used multiplexed tissue imaging of large tumor understanding of their interplay in cancer. This information collections and single-cell phenotypic analysis of primary cancers could be used to guide and interpret results from ongoing and to evaluate the distribution and significance of PD-1, LAG-3, and future clinical trials. TIM-3 expression in NSCLC. Our results reveal complex func- tional associations and support independent functions of these receptors to suppress T-cell function. Introduction Materials and Methods Immunostimulatory therapies blocking the PD-1 axis pathway Patients, cohorts, and tissue microarrays have become major antitumor treatment options in diverse Formalin-fixed, paraffin-embedded (FFPE) samples from pre- malignancies including non–small cell lung cancer (NSCLC; viously reported retrospective collections of NSCLC not treated refs. 1–5). To date, single-agent treatment using mAbs targeting with immune checkpoint blockers and represented in tissue PD-1 receptor or its ligand PD-L1 induce lasting clinical responses microarrays (TMA) were analyzed (27, 28). The first collection in approximately 18% of patients with advanced NSCLC. How- includes samples from 426 patients with NSCLC seen at Yale ever, primary resistance occurs in the majority of patients and Pathology between 1988 and 2012 (cohort #1). The second acquired adaptation of tumors to immune pressure in patients cohort includes samples from 304 patients with NSCLC initially responding to therapy has also become a clinical chal- collected at Sotiria General Hospital and Patras University lenge (6–9). Therefore, identification of biomarkers for patient General Hospital (Greece) between 1991 and 2001 (cohort selection and characterization of additional nonredundant #2). All cases in the cohorts were reviewed by a local pathologist actionable immunostimulatory targets are needed. using hematoxylin and eosin–stained preparations and tumor Various immune and tumor genomic metrics are associated histology variant was confirmed by morphology analysis. Tumor with sensitivity to PD-1 axis blockers including tumor PD-L1 cores for TMA construction were obtained from case areas expression, measurement of tumor-infiltrating lymphocytes (TIL) selected by a pathologist to represent the disease. Tumor core or inflammation-related mRNA expression profiles, tumor muta- selection was not based on specific tumor segments or location. tional burden, and microsatellite instability (3, 4, 10–13). To Clinicopathologic information from patients in both cohorts date, however, only detection of PD-L1 protein using IHC and was collected from clinical records and pathology reports. mismatch repair deficiency are approved by the FDA as compan- Analysis of mRNA expression and nonsynonymous mutations ion biomarkers for PD-1–blocking antibodies. was performed using the lung cancer dataset from TCGA (cohort Additional immune coinhibitory receptors beyond PD-1, such #3, n ¼ 370). Another TMA-based cohort from Yale (cohort #4) as LAG-3 and TIM-3, are induced after T-cell receptor (TCR) including retrospective samples from 108 lung adenocarcinomas stimulation and mediate T-cell suppression/dysfunction (14–17). clinically tested for EGFR and KRAS mutations was also The potential role of these receptors in
Load more

Recommended publications
  • Single-Cell RNA Sequencing Demonstrates the Molecular and Cellular Reprogramming of Metastatic Lung Adenocarcinoma
    ARTICLE https://doi.org/10.1038/s41467-020-16164-1 OPEN Single-cell RNA sequencing demonstrates the molecular and cellular reprogramming of metastatic lung adenocarcinoma Nayoung Kim 1,2,3,13, Hong Kwan Kim4,13, Kyungjong Lee 5,13, Yourae Hong 1,6, Jong Ho Cho4, Jung Won Choi7, Jung-Il Lee7, Yeon-Lim Suh8,BoMiKu9, Hye Hyeon Eum 1,2,3, Soyean Choi 1, Yoon-La Choi6,10,11, Je-Gun Joung1, Woong-Yang Park 1,2,6, Hyun Ae Jung12, Jong-Mu Sun12, Se-Hoon Lee12, ✉ ✉ Jin Seok Ahn12, Keunchil Park12, Myung-Ju Ahn 12 & Hae-Ock Lee 1,2,3,6 1234567890():,; Advanced metastatic cancer poses utmost clinical challenges and may present molecular and cellular features distinct from an early-stage cancer. Herein, we present single-cell tran- scriptome profiling of metastatic lung adenocarcinoma, the most prevalent histological lung cancer type diagnosed at stage IV in over 40% of all cases. From 208,506 cells populating the normal tissues or early to metastatic stage cancer in 44 patients, we identify a cancer cell subtype deviating from the normal differentiation trajectory and dominating the metastatic stage. In all stages, the stromal and immune cell dynamics reveal ontological and functional changes that create a pro-tumoral and immunosuppressive microenvironment. Normal resident myeloid cell populations are gradually replaced with monocyte-derived macrophages and dendritic cells, along with T-cell exhaustion. This extensive single-cell analysis enhances our understanding of molecular and cellular dynamics in metastatic lung cancer and reveals potential diagnostic and therapeutic targets in cancer-microenvironment interactions. 1 Samsung Genome Institute, Samsung Medical Center, Seoul 06351, Korea.
    [Show full text]
  • Opposing Regulatory Functions of the TIM3 (HAVCR2)
    Opposing regulatory functions of the TIM3 (HAVCR2) signalosome in primary effector T cells as revealed by quantitative interactomics Yunhao Zhai, Javier Celis-Gutierrez, Guillaume Voisinne, Daiki Mori, Laura Girard, Odile Burlet-Schiltz, Anne Gonzalez de Peredo, Romain Roncagalli, Bernard Malissen To cite this version: Yunhao Zhai, Javier Celis-Gutierrez, Guillaume Voisinne, Daiki Mori, Laura Girard, et al.. Opposing regulatory functions of the TIM3 (HAVCR2) signalosome in primary effector T cells as revealed by quantitative interactomics. Cellular and molecular immunology, Nature Publishing Group/Chinese Society of Immunology, In press, 10.1038/s41423-020-00575-7. hal-03086942 HAL Id: hal-03086942 https://hal-amu.archives-ouvertes.fr/hal-03086942 Submitted on 23 Dec 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License Cellular & Molecular Immunology www.nature.com/cmi CORRESPONDENCE OPEN Opposing regulatory functions of the TIM3 (HAVCR2) signalosome in primary effector T
    [Show full text]
  • Melanoma Single-Cell Biology in Experimental and Clinical Settings
    Journal of Clinical Medicine Review Melanoma Single-Cell Biology in Experimental and Clinical Settings Hans Binder 1 , Maria Schmidt 1 , Henry Loeffler-Wirth 1, Lena Suenke Mortensen 1 and Manfred Kunz 2,* 1 Interdisciplinary Center for Bioinformatics, University of Leipzig, 04107 Leipzig, Germany; [email protected] (H.B.); [email protected] (M.S.); [email protected] (H.L.-W.); [email protected] (L.S.M.) 2 Department of Dermatology, Venereology and Allergology, University of Leipzig Medical Center, Philipp-Rosenthal-Str. 23-25, 04103 Leipzig, Germany * Correspondence: [email protected]; Tel.: +49-341-97-18610; Fax: +49-341-97-18609 Abstract: Cellular heterogeneity is regarded as a major factor for treatment response and resistance in a variety of malignant tumors, including malignant melanoma. More recent developments of single-cell sequencing technology provided deeper insights into this phenomenon. Single-cell data were used to identify prognostic subtypes of melanoma tumors, with a special emphasis on immune cells and fibroblasts in the tumor microenvironment. Moreover, treatment resistance to checkpoint inhibitor therapy has been shown to be associated with a set of differentially expressed immune cell signatures unraveling new targetable intracellular signaling pathways. Characterization of T cell states under checkpoint inhibitor treatment showed that exhausted CD8+ T cell types in melanoma lesions still have a high proliferative index. Other studies identified treatment resistance mechanisms to targeted treatment against the mutated BRAF serine/threonine protein kinase including repression of the melanoma differentiation gene microphthalmia-associated transcription factor (MITF) and induction of AXL receptor tyrosine kinase.
    [Show full text]
  • Havcr2 (NM 001100762) Rat Untagged Clone – RN206032 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RN206032 Havcr2 (NM_001100762) Rat Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Havcr2 (NM_001100762) Rat Untagged Clone Tag: Tag Free Symbol: Havcr2 Synonyms: tim3 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >RN206032 representing NM_001100762 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTTTCATGGCTTCCCTTCAGCTGTGCCCTGCTGCTGCTGCAACCACTACCTGCAAGGTCCTTGGAAA ATGCTTACACAGCTGAGGTCGGGAAGAATGCCTATCTGCCCTGCAGCTACACTGTACCTGCCCCTGGGAC GCTCGTGCCTATCTGCTGGGGCAAGGGATCCTGTCCTTTGTTACAGTGTGCCAGTGTGGTGCTCAGAACG GATGAAACGAATGTGACATATCGGAAATCCAGAAGATACCAGCTAAAGGGGAATTTCTACAAAGGAGACA TGTCGCTGACCATAAAGAATGTGACTCTAGCTGACTCTGGGACCTACTGCTGCAGGATACAATTCCCTGG CCCAATGAATGATGAAAAATTAGAGCTGAAATTAAGCATCACTGAACCAGCCAAAGTCATCCCAGCTGGG ACTGCTCATGGGGATTCTACAACAGCTTCTCCCAGAACCCTAACCACTGAGGGAAGTGGCTCAGAGACAC AGACCCTGGTGACCCTCCATGATAACAATGGAACAAAAATTTCCACATGGGCCGATGAAATTAAGGACTC TGGAGAAACTATCAGAACTGCTGTCCACATTGGAGTAGGCGTCTCTGCTGGGCTGGCCCTGGCACTTATT CTTGGTGTTTTAATCCTTAAATGGTATTCCTCTAAGAAAAAGAAGTTGCAGGATTTGAGTCTTATTACAC TGGCCAACTCCCCACCAGGAGGGTTGGTGAATGCAGGAGCAGGCAGGATTCGGTCTGAGGAAAACATCTA CACTATAGAGGAGAACATATATGAAATGGAGAATTCAAATGAGTACTACTGCTATGTCAGCAGCCAGCAG CCATCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
    [Show full text]
  • Recruitment and Expansion of Tregs Cells in the Tumor Environment—How to Target Them?
    cancers Review Recruitment and Expansion of Tregs Cells in the Tumor Environment—How to Target Them? Justine Cinier 1,†, Margaux Hubert 1,†, Laurie Besson 1, Anthony Di Roio 1 ,Céline Rodriguez 1, Vincent Lombardi 2, Christophe Caux 1,‡ and Christine Ménétrier-Caux 1,*,‡ 1 University of Lyon, Claude Bernard Lyon 1 University, INSERM U-1052, CNRS 5286 Centre Léon Bérard, Cancer Research Center of Lyon (CRCL), 69008 Lyon, France; [email protected] (J.C.); [email protected] (M.H.); [email protected] (L.B.); [email protected] (A.D.R.); [email protected] (C.R.); [email protected] (C.C.) 2 Institut de Recherche Servier, 125 Chemin de Ronde, 78290 Croissy-sur-Seine, France; [email protected] * Correspondence: [email protected] † Co-first authorship. ‡ Co-last authorship. Simple Summary: The immune response against cancer is generated by effector T cells, among them cytotoxic CD8+ T cells that destroy cancer cells and helper CD4+ T cells that mediate and support the immune response. This antitumor function of T cells is tightly regulated by a particular subset of CD4+ T cells, named regulatory T cells (Tregs), through different mechanisms. Even if the complete inhibition of Tregs would be extremely harmful due to their tolerogenic role in impeding autoimmune diseases in the periphery, the targeted blockade of their accumulation at tumor sites or their targeted Citation: Cinier, J.; Hubert, M.; depletion represent a major therapeutic challenge. This review focuses on the mechanisms favoring Besson, L.; Di Roio, A.; Rodriguez, C.; Treg recruitment, expansion and stabilization in the tumor microenvironment and the therapeutic Lombardi, V.; Caux, C.; strategies developed to block these mechanisms.
    [Show full text]
  • TIM-3 Expression Is Downregulated on Human NK Cells in Response to Cancer Targets in Synergy with Activation
    cancers Article TIM-3 Expression Is Downregulated on Human NK Cells in Response to Cancer Targets in Synergy with Activation Tram N. Dao 1, Sagar Utturkar 2 , Nadia Atallah Lanman 2,3 and Sandro Matosevic 1,2,* 1 Department of Industrial and Physical Pharmacy, Purdue University, West Lafayette, IN 47907, USA; [email protected] 2 Center for Cancer Research, Purdue University, West Lafayette, IN 47907, USA; [email protected] (S.U.); [email protected] (N.A.L.) 3 Department of Comparative Pathobiology, Purdue University, West Lafayette, IN 47907, USA * Correspondence: [email protected] Received: 23 June 2020; Accepted: 24 August 2020; Published: 26 August 2020 Abstract: Among natural killer (NK) cell receptors, the T-cell immunoglobulin and mucin-containing domain (TIM-3) has been associated with both inhibitory and activating functions, depending on context and activation pathway. Ex vivo and in vitro, expression of TIM-3 is inducible and depends on activation stimulus. Here, we report that TIM-3 expression can be downregulated on NK cells under specific conditions. When NK cells are exposed to cancer targets, they synergize with stimulation conditions to induce a substantial decrease in TIM-3 expression on their surface. We found that such downregulation occurs following prior NK activation. Downregulated TIM-3 expression correlated to lower cytotoxicity and lower interferon gamma (IFN-γ) expression, fueling the notion that TIM-3 might function as a benchmark for human NK cell dysfunction. Keywords: TIM-3; NK cell receptor; immunotherapy; solid tumor; NK cell activation 1. Introduction It is increasingly evident that modulation of immune-regulatory receptors in the tumor microenvironment in favor of restored anti-tumor immunity is becoming one of the pivotal strategies in the adaptation of cell-based immunotherapies to target various cancers [1].
    [Show full text]
  • Inhibitory Receptor Agonists: the Future of Autoimmune Disease Therapeutics?
    Available online at www.sciencedirect.com ScienceDirect Inhibitory receptor agonists: the future of autoimmune disease therapeutics? 1,2 1 Stephanie Grebinoski and Dario AA Vignali + Central and peripheral tolerance both contribute to protection Tregs, implying that >30% of CD4 effectors could be against autoimmunity. The pathogenesis of autoimmunity, autoreactive [2 ]. Critical deficits or limitations in toler- however, can result from critical deficits or limitations in ance mechanisms, rather than complete failure, can con- peripheral and/or central tolerance mechanisms, presenting an tribute to autoimmunity (Figure 1). Evidence suggests opportunity for therapeutic intervention. Recent advances that the majority of these deficits affect peripheral toler- highlight the substantial impact of inhibitory receptors (IRs), ance, presenting an opportunity for therapeutic interven- which mediate peripheral tolerance, in autoimmunity. Deletion tion [1]. and blockade studies in mice, IR disruption in humans, and correlation with positive disease outcomes all highlight Recent advances in cancer immunotherapy indicate that IR potential clinical benefits of enhancing IR signaling modulation affects T cell function and disease outcome, (agonism) — specifically CTLA4, PD1, LAG3, TIM3 and which merited the 2018 Nobel Prize in Medicine [3]. IRs TIGIT — to treat autoimmune disease. Although critical mediateperipheral tolerance byantagonizing T cell receptor questions remain, IR agonists represent an unappreciated and (TCR) signaling and/or signal propagation in autoreactive T untapped opportunity for the treatment of autoimmune and cells, resulting in a dysfunctional state [4]. Evolutionarily, inflammatory diseases. IRs are upregulated in response TCR signaling to dampen the immune response post infection or upon recognition of Addresses self-antigen(Figure1). Under chronic conditions, IR expres- 1 Department of Immunology, University of Pittsburgh School of sion is heightened and T cell effector function is inhibited Medicine, 200 Lothrop Street, Pittsburgh, PA 15261, USA 2 [5].
    [Show full text]
  • An Integrative Analysis Reveals the Underlying Association Between CTNNB1 Mutation and Immunotherapy in Hepatocellular Carcinoma
    ORIGINAL RESEARCH published: 12 June 2020 doi: 10.3389/fonc.2020.00853 An Integrative Analysis Reveals the Underlying Association Between CTNNB1 Mutation and Immunotherapy in Hepatocellular Carcinoma Edited by: † † Said Dermime, Zhuomao Mo , Yongdan Wang , Zhirui Cao, Pan Li and Shijun Zhang* National Center for Cancer Care and Department of Traditional Chinese Medicine, The First Affiliated Hospital, Sun Yat-sen University, Guangzhou, China Research, Qatar Reviewed by: Abdelali Agouni, Background: Tumor mutational burden (TMB) was verified to be closely associated with Qatar University, Qatar immune checkpoint inhibitors, but it is unclear whether gene mutation has an effect on Mona Omar Mohsen, University of Oxford, United Kingdom immunotherapy of hepatocellular carcinoma (HCC). This research aimed to investigate *Correspondence: the underlying correlation between gene mutation and immunotherapy in HCC. Shijun Zhang [email protected] Methods: The somatic gene mutation data and gene expression data were retrieved from International Cancer Genome Consortium database and The Cancer Genome †These authors have contributed equally to this work Atlas (TCGA) database. The mutational genes were selected by the intersection of three cohorts and further identified using survival analysis and TMB correlation analysis. After Specialty section: the identification of key mutational gene, we explored the correlation between gene This article was submitted to mutation and both the immune cell infiltration and immune inhibitors. The signaling Cancer Immunity and Immunotherapy, a section of the journal pathways associated with gene mutation were confirmed through gene set enrichment Frontiers in Oncology analysis. Furthermore, the survival analysis and mutational analysis based on TCGA Received: 08 April 2020 cohort were performed for the validation of included gene.
    [Show full text]
  • Functional Diversity of Non-Histone Chromosomal Protein Hmgb1
    International Journal of Molecular Sciences Review Functional Diversity of Non-Histone Chromosomal Protein HmgB1 , Elena Chikhirzhina * y, Tatyana Starkova y , Anton Beljajev, Alexander Polyanichko * and Alexey Tomilin Laboratory of Molecular Biology of Stem Cells, Institute of Cytology of the Russian Academy of Sciences, Tikhoretsky Av. 4, 194064 St. Petersburg, Russia; [email protected] (T.S.); [email protected] (A.B.); [email protected] (A.T.) * Correspondence: [email protected] (E.C.); [email protected] (A.P.) These authors contributed equally to this work. y Received: 1 October 2020; Accepted: 23 October 2020; Published: 26 October 2020 Abstract: The functioning of DNA in the cell nucleus is ensured by a multitude of proteins, whose interactions with DNA as well as with other proteins lead to the formation of a complicated, organized, and quite dynamic system known as chromatin. This review is devoted to the description of properties and structure of the progenitors of the most abundant non-histone protein of the HMGB family—the HmgB1 protein. The proteins of the HMGB family are also known as “architectural factors” of chromatin, which play an important role in gene expression, transcription, DNA replication, and repair. However, as soon as HmgB1 goes outside the nucleus, it acquires completely different functions, post-translational modifications, and change of its redox state. Despite a lot of evidence of the functional activity of HmgB1, there are still many issues to be solved related to the mechanisms of the influence of HmgB1 on the development and treatment of different diseases—from oncological and cardiovascular diseases to pathologies during pregnancy and childbirth.
    [Show full text]
  • 1 Type I Interferon Transcriptional Network Regulates Expression Of
    bioRxiv preprint doi: https://doi.org/10.1101/2020.10.30.362947; this version posted October 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Type I Interferon Transcriptional Network Regulates Expression of Coinhibitory Receptors in Human T cells Tomokazu S. Sumida*1, Shai Dulberg2*, Jonas Schupp3*, Helen A. Stillwell1, Pierre-Paul Axisa1, Michela Comi1, Matthew Lincoln1, Avraham Unterman3, Naftali Kaminski3, Asaf Madi2,4, Vijay K. Kuchroo4,5,†, David A. Hafler1,5,† 1Departments of Neurology and Immunobiology, Yale School of Medicine, New Haven, CT, USA. 2 Department of Pathology, Sackler School of Medicine, Tel Aviv University, Tel Aviv, Israel. 3Section of Pulmonary, Critical Care and Sleep Medicine Section, Department of Internal Medicine, Yale School of Medicine, New Haven, CT, USA. 4 Evergrande Center for Immunologic Diseases and Ann Romney Center for Neurologic Diseases, Harvard Medical School and Brigham and Women's Hospital, Boston, MA, USA. 5Broad Institute of MIT and Harvard, Cambridge, MA, USA. *Equal Contributions † Correspondence to Drs. Vijay Kuchroo ([email protected]) or David Hafler ([email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.30.362947; this version posted October 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
    [Show full text]
  • SUV39H1-DNMT3A-Mediated Epigenetic Regulation of Tim-3 and Galectin-9 in the Cervical Cancer
    SUV39H1-DNMT3A-mediated epigenetic regulation of Tim-3 and galectin-9 in the cervical cancer Li Zhang Xi'an Jiaotong University Sijuan Tian Xi'an Jiaotong University Minyi Zhao Xi'an Jiaotong University Ting Yang Xi'an Jiaotong University Shimin Quan Xi'an Jiaotong University Qing Yang Xi'an Jiaotong University Lihua Song Shanghai Jiao Tong University Xiaofeng Yang ( [email protected] ) https://orcid.org/0000-0002-0675-305X Primary research Keywords: Cervical cancer, SUV39H1, H3K9me3, DNMT3A, Tim-3, galectin-9 Posted Date: June 18th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-24078/v3 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published on July 20th, 2020. See the published version at https://doi.org/10.1186/s12935-020-01380-y. Page 1/23 Abstract Background: Methylation of histone 3 at lysine 9 (H3K9) and DNA methylation are epigenetic marks correlated with genes silencing. The tumor microenvironment signicantly inuences therapeutic responses and clinical outcomes. The epigenetic-regulation mechanism of the costimulatory factors Tim- 3 and galectin-9 in cervical cancer remains unknown. Methods: The methylation status of HAVCR2 and LGALS9 were detected by MS-PCR in cervical cancer tissues and cell lines. The underlying molecular mechanism of SUV39H1-DNMT3A-Tim-3/galectin-9 regulation was elucidated using cervical cancer cell lines containing siRNA or/and over-expression system. Conrmation of the regulation of DNMT3A by SUV39H1 used ChIP-qPCR. Results: SUV39H1 up-regulates H3K9me3 expression at the DNMT3A promoter region, which in turn induced expression of DNMT3A in cervical cancer.
    [Show full text]
  • Anti-TIM3 / HAVCR2 / CD366 (Effector T-Cell Marker) Monoclonal Antibody(Clone: TIM3/3113)
    9853 Pacific Heights Blvd. Suite D. San Diego, CA 92121, USA Tel: 858-263-4982 Email: [email protected] 36-3422: Anti-TIM3 / HAVCR2 / CD366 (Effector T-Cell Marker) Monoclonal Antibody(Clone: TIM3/3113) Clonality : Monoclonal Clone Name : TIM3/3113 Application : ELISA, IHC Reactivity : Human Gene : HAVCR2 Gene ID : 84868 Uniprot ID : Q8TDQ0 CD366; HAVR2; Hepatitis A virus cellular receptor 2 (HAVCR2); Kidney injury molecule 3 (KIM3); Alternative Name : T-cell immunoglobulin and mucin domain-containing protein 3; T-cell immunoglobulin mucin receptor 3; T-cell membrane protein 3; TIM3; TIMD3 Isotype : Mouse IgG2a, kappa Immunogen Information : Recombinant fragment of human TIM3 protein (around aa 22-202) (exact sequence is proprietary) Description TIMs are type I transmembrane glycoproteins with one Ig-like V-type domain and a Ser/Thr-rich mucin stalk. TIM-3 is expressed on the surface of effector T cells (CD4+Th1 and CD8+Tc1) but not on helper T cells (CD4+Th2 and CD8+Tc2). In chronic inflammation, autoimmune disorders, and some cancers, TIM-3 is upregulated on several other hematopoietic cell types. The Ig domain of TIM-3 interacts with a ligand on resting but not activated Th1 and Th2 cells. The glycosylated Ig domain of TIM-3 binds cell-associated galectin-9. This induces TIM-3 Tyr phosphorylation and pro-apoptotic signaling. TIM-3 functions as a negative regulator of Th1 cell activity. Its blockade results in increased IFN-gamma production, Th1 cell proliferation and cytotoxicity, regulatory T cell development, and increases in macrophage and neutrophil infiltration into sites of inflammation. Product Info Amount : 20 µg / 100 µg 200 µg/ml of Ab Purified from Bioreactor Concentrate by Protein A/G.
    [Show full text]