DOCSLIB.ORG

Primary and Acquired Resistance to Immune Checkpoint Inhibitors in Metastatic Melanoma Tuba N

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Primary and Acquired Resistance to Immune Checkpoint Inhibitors in Metastatic Melanoma Tuba N Published OnlineFirst November 10, 2017; DOI: 10.1158/1078-0432.CCR-17-2267 Review Clinical Cancer Research Primary and Acquired Resistance to Immune Checkpoint Inhibitors in Metastatic Melanoma Tuba N. Gide1,2, James S. Wilmott1,2, Richard A. Scolyer1,2,3, and Georgina V. Long1,2,4,5 Abstract Immune checkpoint inhibitors have revolutionized the treat- involves various components of the cancer immune cycle, ment of patients with advanced-stage metastatic melanoma, as and interactions between multiple signaling molecules and well as patients with many other solid cancers, yielding long- pathways. Due to this complexity, current knowledge on resis- lasting responses and improved survival. However, a subset of tance mechanisms is still incomplete. Overcoming therapy patientswhoinitiallyrespondtoimmunotherapy,laterrelapse resistance requires a thorough understanding of the mechan- and develop therapy resistance (termed "acquired resistance"), isms underlying immune evasion by tumors. In this review, we whereas others do not respond at all (termed "primary resis- explore the mechanisms of primary and acquired resistance to tance"). Primary and acquired resistance are key clinical barriers immunotherapy in melanoma and detail potential therapeutic to further improving outcomes of patients with metastatic strategies to prevent and overcome them. Clin Cancer Res; 24(6); melanoma, and the known mechanisms underlying each 1260–70. Ó2017 AACR. Introduction Drugs targeting the programmed cell death receptor 1 (PD-1, PDCD1) showed a further increase in response rates, PFS (2), and Immune checkpoint inhibitors have revolutionized the treat- OS (14–16) compared with anti–CTLA-4 blockade. PD-1 is also ment of advanced melanoma (1–5) and have significant clinical expressed on the surface of activated T cells and binds to the activity across an increasing range of many other solid malignan- programmed cell death ligand 1 (PD-L1, CD274) to negatively cies, including non–small cell lung cancer (6, 7), renal cell regulate T-cell activation and differentiation. PD-L1 is constitu- carcinoma (8), head and neck cancer (9), Merkel cell carcinoma tively expressed by T cells, macrophages, and dendritic cells (DC), (10), and bladder cancer (11, 12). Understanding the biology as well as by some tumor cells including melanoma (17). Follow- behind response and resistance to immune checkpoint blockade up data from phase I clinical trials of the fully human IgG4 is critical to further improving outcomes of patients with meta- monoclonal antibody, nivolumab, showed a median OS of static melanoma. 17.3 months, with a 5 year OS rate of 34% (18). In a phase III The first immune checkpoint to be clinically targeted, the study of nivolumab versus dacarbazine in patients with BRAF cytotoxic T-lymphocyte antigen 4 (CTLA-4), is expressed on the wild-type metastatic melanoma, the median OS was not reached surface of activated T cells and binds to its ligands, B7-1 and B7-2, for nivolumab at the most recent analysis, versus 11.2 months for on antigen-presenting cells (APC), resulting in the transmission of dacarbazine [hazard ratio (HR), 0.43, P < 0.001], and the 1- and inhibitory signals to T cells. In patients with metastatic melano- 2-year OS rates were 73% and 58%, respectively, for nivolumab ma, phase III clinical trials of ipilimumab, a fully human IgG1 (1, 14). Pembrolizumab, a humanized IgG4 monoclonal anti- monoclonal antibody inhibiting CTLA-4, demonstrated a signif- body against PD-1, also showed 1-, 2-, and 3-year OS rates icant improvement in progression-free survival (PFS) and overall of 67%, 50%, and 40%, respectively, in a phase I trial of survival (OS) when compared with a gp100 vaccine (13) or ipilimumab-treated and ipilimumab-na€ve patients with dacarbazine chemotherapy (4). advanced melanoma (3). Furthermore, in a phase III trial of pembrolizumab versus ipilimumab, the 2-year OS rates were 55% versus 43%, respectively (5, 15). More recently, combined anti–CTLA-4 and anti–PD-1 immu- 1Melanoma Institute Australia, The University of Sydney, Sydney, NSW, Australia. notherapies have shown improved response rates and clinical 2Sydney Medical School, The University of Sydney, Sydney, NSW, Australia. outcomes in comparison to ipilimumab monotherapy (the study 3 4 Royal Prince Alfred Hospital, Sydney, NSW, Australia. Royal North Shore was not powered to compare the two nivolumab treating arms: 5 Hospital, Sydney, NSW, Australia. Mater Hospital, North Sydney, NSW, nivolumab plus ipilimumab and nivolumab alone). A phase III Australia. study showed an increase in the median PFS of patients treated Note: Supplementary data for this article are available at Clinical Cancer with nivolumab and ipilimumab (11.5 months; HR, 0.42, P < Research Online (http://clincancerres.aacrjournals.org/). 0.001) and nivolumab alone (6.9 months; HR, 0.57, P < 0.001) Corresponding Author: Georgina V. Long, Melanoma Institute Australia, The compared with ipilimumab alone (2.9 months; ref. 2). At a Poche Centre, 40 Rocklands Road, North Sydney, NSW, 2060, Australia. Phone: minimum follow-up of 28 months, the median OS had not been 612-9911-7336; Fax: 612-9954-9290; E-mail: [email protected] reached in the combination or nivolumab-alone groups and doi: 10.1158/1078-0432.CCR-17-2267 was 20 months for ipilimumab alone [HR: combination vs. Ó2017 American Association for Cancer Research. ipilimumab, 0.55 (P < 0.0001); nivolumab vs. ipilimumab, 1260 Clin Cancer Res; 24(6) March 15, 2018 Downloaded from clincancerres.aacrjournals.org on September 29, 2021. © 2018 American Association for Cancer Research. Published OnlineFirst November 10, 2017; DOI: 10.1158/1078-0432.CCR-17-2267 Resistance to Immunotherapy in Melanoma Primary resistance Primary resistance • Poor immunogenicity • Downregulation of • Impaired DC chemokines maturation • Upregulation of Figure 1. Acquired resistance Antigen T-cell endothelin B receptor The cancer immune cycle. The • Loss of B2M presentation trafficking • Overexpression of VEGF induction of an effective antitumor and T-cell and tumor immune response requires activation infiltration successful (i) antigen presentation Therapeutic strategies Therapeutic strategies and T-cell activation, (ii) T-cell • Radiotherapy • Oncolytic viruses trafficking and tumor infiltration, • Oncolytic viruses • HDAC inhibitors and (iii) T-cell killing activity within • CTLA-4 inhibitors the tumor microenvironment. • HDAC inhibitors T-cell killing activity Various immune escape within the tumor mechanisms present at each of microenvironment these stages can result in primary or acquired resistance to immunotherapy. Potential therapeutic strategies can be used at each stage to overcome Primary resistance immunotherapy resistance. • Upregulation of PD-L1 A2AR, A2A receptor; B2M, • Induction of IDO beta-2-microglobulin; HDAC, • Upregulation of Tregs histone deacetylase; JAK1/JAK2, • Upregulation of Therapeutic strategies janus kinases 1 and 2; IDO, CD73/adenosine • PD-1/PD-L1 inhibitors indoleamine 2,3-dioxygenase; • Expression of IPRES • IDO inhibitors – IPRES, innate anti PD-1 resistance • Loss-of-function mutations • LAG-3 inhibitors signature; LAG-3, lymphocyte • TIM-3 inhibitors activation gene 3; TIM-3, T-cell Acquired resistance • CD73/A2AR inhibitors immunoglobulin and mucin domain • Mutations in JAK1/JAK2 3; Tregs, regulatory T cells; VEGF, • Upregulation of PD-L1 vascular endothelial growth factor. • Upregulation of immune checkpoint markers © 2017 American Association for Cancer Research 0.63 (P < 0.0001); ref. 16]. The two-year OS rates were 64%, 59%, tumors evade the immune system, and strategies to overcome or and 45% in the combination, nivolumab, and ipilimumab prevent resistance in the future. groups, respectively (16). The results of these clinical trials highlight the significant impact immunotherapies have had on the clinical management Primary Resistance of patients with advanced-stage metastatic melanoma. However, Primary resistance to immune checkpoint blockade occurs although approximately 35% to 60% of patients have a RECIST in approximately 40% to 65% of patients with melanoma treated response (10%–12% a complete response) to anti–PD-1-based with anti–PD-1 based therapy (Fig. 2), depending on whether immunotherapy (2, 14, 15), 40% to 65% have shown minimal or anti–PD-1 is given upfront or after progression on other therapies no RECIST response at the outset, and 43% of responders develop (2, 14, 15), and >70% of those treated with anti–CTLA-4 therapy acquired resistance by 3 years (3). The underlying mechanisms (4, 13). This key unsolved clinical problem occurs when there is driving these variations in response are not yet well understood. failure to induce an effective antitumor immune response at any For an immunotherapy to elicit an efficient antitumor immune of the three stages of the cancer immune cycle (Fig. 1). To date, the response, the cancer immune cycle must be initiated and the clinicopathologic factors that have been associated with primary subsequent steps successfully completed. This involves efficient resistance are elevated levels of baseline serum LDH (23), (i) antigen presentation and T-cell activation, (ii) T-cell trafficking increased baseline tumor burden (24), lack of PD-L1 expression and tumor infiltration, and (iii) T-cell killing activity within the in baseline melanoma tissue samples (Fig. 3; ref. 25), lack of T-cell tumor microenvironment (Fig. 1). Studies examining possible infiltration (Fig. 3; ref. 21), the absence of PD-1 T cells
Load more

Recommended publications
  • Single-Cell RNA Sequencing Demonstrates the Molecular and Cellular Reprogramming of Metastatic Lung Adenocarcinoma
    ARTICLE https://doi.org/10.1038/s41467-020-16164-1 OPEN Single-cell RNA sequencing demonstrates the molecular and cellular reprogramming of metastatic lung adenocarcinoma Nayoung Kim 1,2,3,13, Hong Kwan Kim4,13, Kyungjong Lee 5,13, Yourae Hong 1,6, Jong Ho Cho4, Jung Won Choi7, Jung-Il Lee7, Yeon-Lim Suh8,BoMiKu9, Hye Hyeon Eum 1,2,3, Soyean Choi 1, Yoon-La Choi6,10,11, Je-Gun Joung1, Woong-Yang Park 1,2,6, Hyun Ae Jung12, Jong-Mu Sun12, Se-Hoon Lee12, ✉ ✉ Jin Seok Ahn12, Keunchil Park12, Myung-Ju Ahn 12 & Hae-Ock Lee 1,2,3,6 1234567890():,; Advanced metastatic cancer poses utmost clinical challenges and may present molecular and cellular features distinct from an early-stage cancer. Herein, we present single-cell tran- scriptome profiling of metastatic lung adenocarcinoma, the most prevalent histological lung cancer type diagnosed at stage IV in over 40% of all cases. From 208,506 cells populating the normal tissues or early to metastatic stage cancer in 44 patients, we identify a cancer cell subtype deviating from the normal differentiation trajectory and dominating the metastatic stage. In all stages, the stromal and immune cell dynamics reveal ontological and functional changes that create a pro-tumoral and immunosuppressive microenvironment. Normal resident myeloid cell populations are gradually replaced with monocyte-derived macrophages and dendritic cells, along with T-cell exhaustion. This extensive single-cell analysis enhances our understanding of molecular and cellular dynamics in metastatic lung cancer and reveals potential diagnostic and therapeutic targets in cancer-microenvironment interactions. 1 Samsung Genome Institute, Samsung Medical Center, Seoul 06351, Korea.
    [Show full text]
  • Opposing Regulatory Functions of the TIM3 (HAVCR2)
    Opposing regulatory functions of the TIM3 (HAVCR2) signalosome in primary effector T cells as revealed by quantitative interactomics Yunhao Zhai, Javier Celis-Gutierrez, Guillaume Voisinne, Daiki Mori, Laura Girard, Odile Burlet-Schiltz, Anne Gonzalez de Peredo, Romain Roncagalli, Bernard Malissen To cite this version: Yunhao Zhai, Javier Celis-Gutierrez, Guillaume Voisinne, Daiki Mori, Laura Girard, et al.. Opposing regulatory functions of the TIM3 (HAVCR2) signalosome in primary effector T cells as revealed by quantitative interactomics. Cellular and molecular immunology, Nature Publishing Group/Chinese Society of Immunology, In press, 10.1038/s41423-020-00575-7. hal-03086942 HAL Id: hal-03086942 https://hal-amu.archives-ouvertes.fr/hal-03086942 Submitted on 23 Dec 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License Cellular & Molecular Immunology www.nature.com/cmi CORRESPONDENCE OPEN Opposing regulatory functions of the TIM3 (HAVCR2) signalosome in primary effector T
    [Show full text]
  • Primary and Acquired Resistance to Immune Checkpoint Inhibitors in Metastatic Melanoma Tuba N
    Published OnlineFirst November 10, 2017; DOI: 10.1158/1078-0432.CCR-17-2267 Review Clinical Cancer Research Primary and Acquired Resistance to Immune Checkpoint Inhibitors in Metastatic Melanoma Tuba N. Gide1,2, James S. Wilmott1,2, Richard A. Scolyer1,2,3, and Georgina V. Long1,2,4,5 Abstract Immune checkpoint inhibitors have revolutionized the treat- involves various components of the cancer immune cycle, and ment of patients with advanced-stage metastatic melanoma, as interactions between multiple signaling molecules and path- well as patients with many other solid cancers, yielding long- ways. Due to this complexity, current knowledge on resistance lasting responses and improved survival. However, a subset of mechanisms is still incomplete. Overcoming therapy resistance patientswhoinitiallyrespondtoimmunotherapy,laterrelapse requires a thorough understanding of the mechanisms under- and develop therapy resistance (termed "acquired resistance"), lying immune evasion by tumors. In this review, we explore the whereas others do not respond at all (termed "primary resis- mechanisms of primary and acquired resistance to immuno- tance"). Primary and acquired resistance are key clinical barriers therapy in melanoma and detail potential therapeutic strategies to further improving outcomes of patients with metastatic to prevent and overcome them. Clin Cancer Res; 24(6); 1–11. Ó2017 melanoma, and the known mechanisms underlying each AACR. Introduction Drugs targeting the programmed cell death receptor 1 (PD-1, PDCD1) showed a further increase in response rates, PFS (2), and Immune checkpoint inhibitors have revolutionized the treat- OS (14–16) compared with anti–CTLA-4 blockade. PD-1 is also ment of advanced melanoma (1–5) and have significant clinical expressed on the surface of activated T cells and binds to the activity across an increasing range of many other solid malignan- programmed cell death ligand 1 (PD-L1, CD274) to negatively cies, including non–small cell lung cancer (6, 7), renal cell regulate T-cell activation and differentiation.
    [Show full text]
  • Molecular Mechanisms of Resistance to Immune Checkpoint Inhibitors in Melanoma Treatment: an Update
    biomedicines Review Molecular Mechanisms of Resistance to Immune Checkpoint Inhibitors in Melanoma Treatment: An Update Sonja Vukadin 1,2, Farah Khaznadar 1, Tomislav Kizivat 3,4, Aleksandar Vcev 5,6,7 and Martina Smolic 1,2,* 1 Department of Pharmacology and Biochemistry, Faculty of Dental Medicine and Health Osijek, Josip Juraj Strossmayer University of Osijek, 31000 Osijek, Croatia; [email protected] (S.V.); [email protected] (F.K.) 2 Department of Pharmacology, Faculty of Medicine, Josip Juraj Strossmayer University of Osijek, 31000 Osijek, Croatia 3 Clinical Institute of Nuclear Medicine and Radiation Protection, University Hospital Osijek, 31000 Osijek, Croatia; [email protected] 4 Department of Nuclear Medicine and Oncology, Faculty of Medicine Osijek, Josip Juraj Strossmayer University of Osijek, 31000 Osijek, Croatia 5 Department of Pathophysiology, Physiology and Immunology, Faculty of Dental Medicine and Health Osijek, Josip Juraj Strossmayer University of Osijek, 31000 Osijek, Croatia; [email protected] 6 Department of Pathophysiology, Faculty of Medicine Osijek, Josip Juraj Strossmayer University of Osijek, 31000 Osijek, Croatia 7 Department of Internal Medicine, University Hospital Osijek, 31000 Osijek, Croatia * Correspondence: [email protected] Abstract: Over the past decade, immune checkpoint inhibitors (ICI) have revolutionized the treatment of advanced melanoma and ensured significant improvement in overall survival versus chemother- apy. ICI or targeted therapy are now the first line treatment in advanced melanoma, depending on the tumor v-raf murine sarcoma viral oncogene homolog B1 (BRAF) mutational status. While these Citation: Vukadin, S.; Khaznadar, F.; new approaches have changed the outcomes for many patients, a significant proportion of them still Kizivat, T.; Vcev, A.; Smolic, M.
    [Show full text]
  • Resistance to PD1/PD-L1 Blockade
    Acta Scientific Cancer Biology Volume 2 Issue 6 August 2018 Mini Review Resistance to PD1/PD-L1 Blockade Bakulesh Khamar* R&D Department, Cadila Pharmaceuticals Limited, Ahmedabad, India *Corresponding Author: Bakulesh Khamar, R&D Department, Cadila Pharmaceuticals Limited, Ahmedabad, India. Received: June 18, 2018; Published: July 11, 2018 Abstract Monoclonal antibodies targeting PD-1/PD-L1 as a monotherapy are useful in varieties of tumors to provide durable response not - seen with other therapies. However large majority patients do not respond. The major reason for lack of response is lack of inflamma immune cycle are also seen at the time of relapse in those who responded to therapy initially. In this article current information about tion. Even in tumors with inflammation other defects in cancer immune cycle are responsible for lack of response. Changes in cancer resistance mechanisms to anti PD-1/PD-L2 therapy are reviewed. Keywords: PD-1; PD-L1; Primary Resistance; Acquired Resistance; Resistance Mechanism CD8 Cells; T Cells; Cancer Immune Phe- notype; Check Point Inhibitors Introduction in varieties of advanced Cancer. However response rate following their administration in management of solid tumours is not very Cancer development and progression involve increasingly ac- high. They are approved for management of metastatic melanoma, cumulating mutations. These mutations leads to expression of a renal-cell carcinoma (RCC), advanced non-small-cell lung cancer diverse set of proteins (foreign antigens/neo antigens). Immune (NSCLC), classic Hodgkin’s lymphoma (HL), bladder carcinoma, system uses them to recognise cancer cells as ‘foreign’ and destroys Merkel cell carcinoma, head and neck squamous cell cancer, solid them (immune surveillance).
    [Show full text]
  • Melanoma Single-Cell Biology in Experimental and Clinical Settings
    Journal of Clinical Medicine Review Melanoma Single-Cell Biology in Experimental and Clinical Settings Hans Binder 1 , Maria Schmidt 1 , Henry Loeffler-Wirth 1, Lena Suenke Mortensen 1 and Manfred Kunz 2,* 1 Interdisciplinary Center for Bioinformatics, University of Leipzig, 04107 Leipzig, Germany; [email protected] (H.B.); [email protected] (M.S.); [email protected] (H.L.-W.); [email protected] (L.S.M.) 2 Department of Dermatology, Venereology and Allergology, University of Leipzig Medical Center, Philipp-Rosenthal-Str. 23-25, 04103 Leipzig, Germany * Correspondence: [email protected]; Tel.: +49-341-97-18610; Fax: +49-341-97-18609 Abstract: Cellular heterogeneity is regarded as a major factor for treatment response and resistance in a variety of malignant tumors, including malignant melanoma. More recent developments of single-cell sequencing technology provided deeper insights into this phenomenon. Single-cell data were used to identify prognostic subtypes of melanoma tumors, with a special emphasis on immune cells and fibroblasts in the tumor microenvironment. Moreover, treatment resistance to checkpoint inhibitor therapy has been shown to be associated with a set of differentially expressed immune cell signatures unraveling new targetable intracellular signaling pathways. Characterization of T cell states under checkpoint inhibitor treatment showed that exhausted CD8+ T cell types in melanoma lesions still have a high proliferative index. Other studies identified treatment resistance mechanisms to targeted treatment against the mutated BRAF serine/threonine protein kinase including repression of the melanoma differentiation gene microphthalmia-associated transcription factor (MITF) and induction of AXL receptor tyrosine kinase.
    [Show full text]
  • Development and Characterization of Immunogenic Genetically Engineered Mouse Models of Pancreatic Cancer
    Development and characterization of immunogenic genetically engineered mouse models of pancreatic cancer By Laurens J. Lambert MSc, Medical Biology Radboud University, 2014 Submitted to the Department of Biology in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy at the MASSACHUSETTS INSTITUTE OF TECHNOLOGY September 2020 © 2020 Massachusetts Institute of Technology. All rights reserved. Signature of Author………………………………………………………………………………. Laurens J. Lambert Department of Biology June 16, 2020 Certified by………..………………………………………………………………………………. Tyler Jacks David H. Koch Professor of Biology Investigator, Howard Hughes Medical Institute Thesis Supervisor Accepted by………………………………………………………………………………………. Stephen Bell Uncas and Helen Whitaker Professor of Biology Investigator, Howard Hughes Medical Institute Co-Director, Biology Graduate Committee 2 Development and characterization of immunogenic genetically engineered mouse models of pancreatic cancer By Laurens J. Lambert Submitted to the Department of Biology on June 16, 2020 in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Biology Abstract Insights into mechanisms of immune escape have fueled the clinical success of immunotherapy in many cancers. However, pancreatic cancer has remained largely refractory to checkpoint immunotherapy. To uncover mechanisms of immune escape, we have characterized two preclinical models of immunogenic pancreatic ductal adenocarcinoma (PDAC). In order to dissect the endogenous antigen-specific T cell response in PDAC, lentivirus encoding the Cre recombinase and a tumor specific antigen LSL-G12D/+; flox/flox (SIINFEKL, OVA257-264) was delivered to Kras Trp53 (KP) mice. We demonstrate that KP tumors show distinct antigenic outcomes: a subset of PDAC tumors undergoes clearance or editing by a robust antigen-specific CD8+ T cell response, while a fraction undergo immune escape.
    [Show full text]
  • ASX ANNOUNCEMENT November 2Nd, 2011 ______
    ASX ANNOUNCEMENT November 2nd, 2011 ___________________________________________________________________________________ ImmunAid Press Release Genetic Technologies Limited (ASX: GTG; NASDAQ: GENE) is pleased to attach a Press Release by its subsidiary ImmunAid Pty. Ltd. which was recently released at the BIO-Europe Conference in Düsseldorf, Germany. The name and number of the European patent mentioned in first paragraph of the attached Release is Method of Therapy, number EP1692516. Genetic Technologies Limited holds a 71.7% direct equity interest in ImmunAid Pty. Ltd. FOR FURTHER INFORMATION PLEASE CONTACT Dr. Paul D.R. MacLeman Chief Executive Officer Genetic Technologies Limited Phone: +61 3 8412 7000 Genetic Technologies Limited • Website: www.gtglabs.com • Email: [email protected] ABN 17 009 212 328 Registered Office • 60-66 Hanover Street, Fitzroy, Victoria 3065 Australia • Postal Address P.O. Box 115, Fitzroy, Victoria 3065 Australia Phone +61 3 8412 7000 • Fax +61 3 8412 7040 FOR IMMEDIATE RELEASE Break-Through Invention for Treating Cancer – Australian Biotech Company Awarded European Patent DÜSSELDORF, GERMANY (October 31st, 2011): ImmunAid Pty. Ltd. has been awarded a European patent for its pioneering work in the treatment of cancer, based on monitoring the immune cycle of each individual patient and then determining the optimal time to deliver treatment to that patient. Dr. Svetomir Markovic, chair of the Melanoma Group at Mayo Clinic, Rochester, MN, says, “The discovery of the regulated immune response cycle in cancer patients is potentially of immense clinical significance with profound public health implications.” Approximately $32 billion is spent globally each year on cancer drugs, yet the cancer mortality rate in the United States is more than 11,000 per week.
    [Show full text]
  • Havcr2 (NM 001100762) Rat Untagged Clone – RN206032 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RN206032 Havcr2 (NM_001100762) Rat Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Havcr2 (NM_001100762) Rat Untagged Clone Tag: Tag Free Symbol: Havcr2 Synonyms: tim3 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >RN206032 representing NM_001100762 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTTTCATGGCTTCCCTTCAGCTGTGCCCTGCTGCTGCTGCAACCACTACCTGCAAGGTCCTTGGAAA ATGCTTACACAGCTGAGGTCGGGAAGAATGCCTATCTGCCCTGCAGCTACACTGTACCTGCCCCTGGGAC GCTCGTGCCTATCTGCTGGGGCAAGGGATCCTGTCCTTTGTTACAGTGTGCCAGTGTGGTGCTCAGAACG GATGAAACGAATGTGACATATCGGAAATCCAGAAGATACCAGCTAAAGGGGAATTTCTACAAAGGAGACA TGTCGCTGACCATAAAGAATGTGACTCTAGCTGACTCTGGGACCTACTGCTGCAGGATACAATTCCCTGG CCCAATGAATGATGAAAAATTAGAGCTGAAATTAAGCATCACTGAACCAGCCAAAGTCATCCCAGCTGGG ACTGCTCATGGGGATTCTACAACAGCTTCTCCCAGAACCCTAACCACTGAGGGAAGTGGCTCAGAGACAC AGACCCTGGTGACCCTCCATGATAACAATGGAACAAAAATTTCCACATGGGCCGATGAAATTAAGGACTC TGGAGAAACTATCAGAACTGCTGTCCACATTGGAGTAGGCGTCTCTGCTGGGCTGGCCCTGGCACTTATT CTTGGTGTTTTAATCCTTAAATGGTATTCCTCTAAGAAAAAGAAGTTGCAGGATTTGAGTCTTATTACAC TGGCCAACTCCCCACCAGGAGGGTTGGTGAATGCAGGAGCAGGCAGGATTCGGTCTGAGGAAAACATCTA CACTATAGAGGAGAACATATATGAAATGGAGAATTCAAATGAGTACTACTGCTATGTCAGCAGCCAGCAG CCATCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
    [Show full text]
  • BIRC5 Is a Prognostic Biomarker Associated with Tumor Immune Cell Infltration Linlong Xu1,5, Wenpeng Yu2,5, Han Xiao3* & Kang Lin4*
    www.nature.com/scientificreports OPEN BIRC5 is a prognostic biomarker associated with tumor immune cell infltration Linlong Xu1,5, Wenpeng Yu2,5, Han Xiao3* & Kang Lin4* BIRC5 is an immune-related gene that inhibits apoptosis and promotes cell proliferation. It is highly expressed in most tumors and leads to poor prognosis in cancer patients. This study aimed to analyze the relationship between the expression level of BIRC5 in diferent tumors and patient prognosis, clinical parameters, and its role in tumor immunity. Genes co-expressed with BIRC5 were analyzed, and functional enrichment analysis was performed. The relationship between BIRC5 expression and the immune and stromal scores of tumors in pan-cancer patients and the infltration level of 22 tumor- infltrating lymphocytes (TILs) was analyzed. The correlation of BIRC5 with immune checkpoints was conducted. Functional enrichment analysis showed that genes co-expressed with BIRC5 were signifcantly associated with the mitotic cell cycle, APC/C-mediated degradation of cell cycle proteins, mitotic metaphase, and anaphase pathways. Besides, the high expression of BIRC5 was signifcantly correlated with the expression levels of various DNA methyltransferases, indicating that BIRC5 regulates DNA methylation. We also found that BIRC5 was signifcantly correlated with multiple immune cells infltrates in a variety of tumors. This study lays the foundation for future research on how BIRC5 modulates tumor immune cells, which may lead to the development of more efective targeted tumor immunotherapies. Cancer poses a severe threat to human health and has a high mortality rate. Te three most common cancers among men are prostate, colon and rectum, and skin melanoma.
    [Show full text]
  • Recruitment and Expansion of Tregs Cells in the Tumor Environment—How to Target Them?
    cancers Review Recruitment and Expansion of Tregs Cells in the Tumor Environment—How to Target Them? Justine Cinier 1,†, Margaux Hubert 1,†, Laurie Besson 1, Anthony Di Roio 1 ,Céline Rodriguez 1, Vincent Lombardi 2, Christophe Caux 1,‡ and Christine Ménétrier-Caux 1,*,‡ 1 University of Lyon, Claude Bernard Lyon 1 University, INSERM U-1052, CNRS 5286 Centre Léon Bérard, Cancer Research Center of Lyon (CRCL), 69008 Lyon, France; [email protected] (J.C.); [email protected] (M.H.); [email protected] (L.B.); [email protected] (A.D.R.); [email protected] (C.R.); [email protected] (C.C.) 2 Institut de Recherche Servier, 125 Chemin de Ronde, 78290 Croissy-sur-Seine, France; [email protected] * Correspondence: [email protected] † Co-first authorship. ‡ Co-last authorship. Simple Summary: The immune response against cancer is generated by effector T cells, among them cytotoxic CD8+ T cells that destroy cancer cells and helper CD4+ T cells that mediate and support the immune response. This antitumor function of T cells is tightly regulated by a particular subset of CD4+ T cells, named regulatory T cells (Tregs), through different mechanisms. Even if the complete inhibition of Tregs would be extremely harmful due to their tolerogenic role in impeding autoimmune diseases in the periphery, the targeted blockade of their accumulation at tumor sites or their targeted Citation: Cinier, J.; Hubert, M.; depletion represent a major therapeutic challenge. This review focuses on the mechanisms favoring Besson, L.; Di Roio, A.; Rodriguez, C.; Treg recruitment, expansion and stabilization in the tumor microenvironment and the therapeutic Lombardi, V.; Caux, C.; strategies developed to block these mechanisms.
    [Show full text]
  • Immune System and Melanoma Biology: a Balance Between Immunosurveillance and Immune Escape
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 62), pp: 106132-106142 Review Immune system and melanoma biology: a balance between immunosurveillance and immune escape Anna Passarelli1, Francesco Mannavola1, Luigia Stefania Stucci1, Marco Tucci1 and Francesco Silvestris1 1Department of Biomedical Sciences and Human Oncology, University of Bari ‘Aldo Moro’, Bari, Italy Correspondence to: Anna Passarelli, email: [email protected] Keywords: melanoma; immune system; immunogenicity; immunoediting; immune escape Received: May 26, 2017 Accepted: September 21, 2017 Published: October 31, 2017 Copyright: Passarelli et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Melanoma is one of the most immunogenic tumors and its relationship with host immune system is currently under investigation. Many immunomodulatory mechanisms, favoring melanomagenesis and progression, have been described to interfere with the disablement of melanoma recognition and attack by immune cells resulting in immune resistance and immunosuppression. This knowledge produced therapeutic advantages, such as immunotherapy, aiming to overcome the immune evasion. Here, we review the current advances in cancer immunoediting and focus on melanoma immunology, which involves a dynamic interplay between melanoma and immune system, as well as on effects of “targeted therapies” on tumor microenvironment for combination strategies. INTRODUCTION editing that includes inter-connected phases as elimination of tumor cells based on immunosurveillance, equilibrium Cutaneous melanoma (CM) is the most common between tumor and immune cells and escape or immune skin cancer with an incidence that is rapidly increased in evasion.
    [Show full text]