Fast Detection of Vibrio species potentially pathogenic for mollusc Estela Pérez Lago, Teresa Pérez Nieto, Rosa Farto Seguín
To cite this version:
Estela Pérez Lago, Teresa Pérez Nieto, Rosa Farto Seguín. Fast Detection of Vibrio species potentially pathogenic for mollusc. Veterinary Microbiology, Elsevier, 2009, 139 (3-4), pp.339. 10.1016/j.vetmic.2009.06.035. hal-00526942
HAL Id: hal-00526942 https://hal.archives-ouvertes.fr/hal-00526942 Submitted on 17 Oct 2010
HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Accepted Manuscript
Title: Fast Detection of Vibrio species potentially pathogenic for mollusc
Authors: Estela Perez´ Lago, Teresa Perez´ Nieto, Rosa Farto Segu´ın
PII: S0378-1135(09)00319-8 DOI: doi:10.1016/j.vetmic.2009.06.035 Reference: VETMIC 4489
To appear in: VETMIC
Received date: 26-2-2009 Revised date: 17-6-2009 Accepted date: 22-6-2009
Please cite this article as: Lago, E.P., Nieto, T.P., Segu´ın, R.F., Fast Detection of Vibrio species potentially pathogenic for mollusc, Veterinary Microbiology (2008), doi:10.1016/j.vetmic.2009.06.035
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. * Manuscript
1 Fast Detection of Vibrio species potentially pathogenic for mollusc
2
3
4 Estela Pérez Lagoa, Teresa Pérez Nietoa, Rosa Farto Seguína*
5
6
7
8 a* Área de Microbiología, Departamento de Biología Funcional y Ciencias de la Salud, Facultad de
9 Biología, Universidad de Vigo. Lagoas Marcosende s/n, 36310. Vigo, Spain.
10 Phone: 34 986 812 398; Fax: 34 986 812 556. E- mail: [email protected]
11
Accepted Manuscript
1 Page 1 of 23 12 Abstract
13 Vibrio tasmaniensis V. splendidus and V. neptunius species were worldwide distributed and associated
14 with aquaculture and been reported as the cause of diseases in aquatic organisms. Polyphasic analyses for
15 bacterial identification are not feasible for routine diagnostic because of the time involved. The aim of
16 this study is to design three PCR primer sets that can assist with a fast detection of these species. They
17 were designed from the 16S ribosomal RNA gene, and PCR conditions were found. Each PCR test
18 successfully identified all the tested strains of each target species. The combined specificity of V.
19 tasmaniensis and V. splendidus primer sets offered the best coverage (86%) in terms of separating target
20 organisms from other related species. The primer set of V. tasmaniensis showed a lower sensitivity limit
21 (500 fg of DNA) than the V. splendidus set (1pg) and both sets gave positive amplification using
22 homogenized tissues from inoculated clams, with 102 and 104 cfu/g of clam, respectively. The primer set
23 of V. neptunius was highly specific, showing only cross-reaction with V. parahaemolyticus species from
24 44 tested species. Its sensitivity limit was 100 pg of DNA. A small number of biochemical tests were
25 proposed concurrently with the PCR to differentiate the cross-reacting bacteria. The time of detection of
26 the three tested species was reduced and the further affected animals can be diagnosed in a rapid fraction
27 of time. The detection of virulent strains of V. tasmaniensis pointed to the risk of mollusc culture
28 outbreaks.
29
30 Keywords: V. tasmaniensis, V. splendidus, V. neptunius, clam, fast detection, pathogenic potential.
31 Accepted Manuscript
2 Page 2 of 23 32 Introduction
33 34 V. tasmaniensis, V. splendidus and V. neptunius were the predominant species found by us associated
35 with the culture of oysters and clams (Guisande et al., 2008). These species have been distributed world-
36 wide and were associated with diseases in aquatic organisms in different countries. So, over the last few
37 years, V. splendidus has been mainly associated with disease in fish (both larvae and juvenile specimens)
38 (Angulo et al., 1994 a, b; Santos et al., 1997; Gatesoupe et al., 1999; Thomson et al., 2005; Sitjà-
39 Bobadilla et al., 2007; Reid et al., 2009), molluscs (Sugumar et al., 1998; Le Roux et al., 2002; Gay et al.,
40 2004; Gómez-León et al., 2005; Garnier et al. 2007; Guisande et al., 2008) and gorgonians (Hall-Spencer
41 et al., 2007). V. neptunius and V. tasmaniensis, that were species commonly considered to be non-
42 pathogenic (Thompson et al., 2003a, 2003b) have been associated with disease in fish and molluscs and
43 sea cucumbers and gorgonian, respectively (Austin et al., 2005; Prado et al., 2005; Hall-Spencer et al.,
44 2007; Guisande et al., 2008; Deng et al., 2009). The main reason for increasing these infections lies in
45 intensive cultures, since it contributes to concentrating the pathogenic and opportunistic species.
46 V. tasmaniensis and V. splendidus are two closely related species included in the V. splendidus-related
47 group. This group shares a high level of homogeneity (Macián et al., 2001; Montes et al., 2003, 2006; Le
48 Roux et al., 2004; Thompson et al., 2005) and several molecular methods have been previously proposed
49 to differentiate between them. Guisande et al. (2008) used a combination of ribotyping and sequencing of
50 16S rRNA gene, while Thompson et al. (2005) suggested the analysis of the three loci recA, rpoA, pyrH
51 and Le Roux et al. (2004) the gyrB gene. The combination of genotypic and phenotypic analyses was also
52 previously reported for the identification of the V. neptunius species (Thompson et al., 2003a; Guisande et 53 al., 2008). Neither of theseAccepted techniques is feasible for routine Manuscript diagnostic laboratories. 54 The design of molecular methods for fast detection of pathogenic Vibrio species would be essential for
55 improving industrial culture production. Specific PCR primers that amplify gene coding for bacterial 16S
56 rRNA have been widely used as a target showing useful results (Saulnier et al., 2000; Oakey et al., 2003;
57 Avendaño-Herrera et al., 2004).
58 The aim of this study is to evaluate the specificity and sensitivity of three PCR primer sets designed from
59 the 16S rDNA sequence to assist with a fast detection of V. tasmaniensis, V. splendidus and V. neptunius
3 Page 3 of 23 60 species by using colonies obtained from a laboratory collection. The usefulness of the PCR tests was
61 evaluated on homogenized tissues from experimentally inoculated clams. In addition, the risk of
62 outbreaks and virulence of V. tasmaniensis on Venerupis rhomboides was estimated.
63 Material and Methods
64 Bacterial strains
65 The Vibrio strains used in this study are shown in Table 2. Several strains were previously associated
66 with Galician aquaculture, were isolated from mollusc and turbot and were identified by phenotypic
67 ribotyping and 16S rRNA sequence analysis (Farto et al., 2003, 2006; Montes et al., 2006; Guisande et
68 al., 2008). Other type and reference strains were obtained from various culture collections and maintained
69 in the laboratory.
70 The original Vibrio strains were grown in tryptic soy broth (Cultimed, Barcelona, Spain)
71 supplemented with 2% (w/v) NaCl (Panreac) (TSB-2) and 15% (v/v) of glycerol (Panreac, Madrid, Spain)
72 at 22 ºC for 48 h and stored at –80 ºC. Freeze-dried pure cultures of Vibrio strains (Table 2) were
73 routinely cultivated on tryptic soy agar (Cultimed) supplemented with 2% (w/v) NaCl (Panreac,
74 Barcelona, Spain) (TSA-2) at 22 ºC for 48 h. Aeromonas, Pseudomonas and Tenacibaculum strains were
75 cultivated and conserved as was reported for the Spanish collection of type culture (CECT).
76 Selection of target priming sequences
77 A pair of oligonucleotide probes for each species, V. tasmaniensis (VTS and VT), V. splendidus
78 (VTS and VS) and V. neptunius (VN1 and VN2) were selected by us and synthesized by Invitrogen (UK).
79 The sequence, position and size are shown in Table 1.
80 The sequences of variable regions of the 16S rRNA genes of Vibrio strains in this study were
81 determined, aligned andAccepted compared with all available bacterial Manuscript 16S rRNA sequences in order to search for
82 specific target sites. Previously reported 16S sequences from V. tasmaniensis, V. splendidus, V. neptunius
83 and other Vibrionaceae species were extracted from GenBank.
84 PCR optimization and primers specificity
85 The DNA was amplified from colonies of each strain with the pair of primers of each species: VTS/VT;
86 VTS/VS; VN1/VN2, firstly using 30 cycles and an annealing temperature of 55 ºC. The 100 µL PCR-
4 Page 4 of 23 87 reaction mixture contained sterile distilled water, dNTP mix (25 mM each; Invitrogen), 200 ng of each
88 primer set (Invitrogen) and 5 u/µL of Taq DNA polymerase (Bioline, UK). Amplification was performed
89 in a Techgene Thermal cycle (Techne, UK). The protocol was 94 ºC for 4 min, followed by 30 cycles of
90 94ºC for 30 sec, 55 ºC for 1 min, 72 ºC for 2 min, with a final extension of 72 ºC for 7 min. PCR
91 amplified fragments were purified on Microspin columns (Amersham Pharmacia Biotech, UK) and
92 visualized in 1% agarose gel and staining with ethidium bromide; a molecular mass marker (digoxigenin-
93 labelled λ phage digested with HindIII; Invitrogen) was also added.
94 A temperature gradient assay (Eppendorf mastercycler gradient) was conducted for optimization and
95 specificity, for each primer set. The annealing temperature interval assayed for V. tasmaniensis and V.
96 splendidus was 65-75 ºC, and 48-62 ºC for V. neptunius. Amplification was conducted by using the
97 standard conditions described above, except that 40 cycles for V. neptunius were used.
98 The most favoured conditions and the maximum specific temperature were considered to be those which,
99 in combination, showed high reproducibility over a number of replicate tests and showed an amplified
100 product from each species tested and as few (if any) of the other species tested. These PCR assays were
101 repeated three times with several strains to ensure reproducibility.
102 The specificity of these probes was evaluated by using 12, 8 and 7 strains of V. tasmaniensis, V.
103 splendidus and V. neptunius respectively and between 56 to 85 strains belonging to 42 other species
104 (Table 2). In addition, colonies re-isolated from inoculated clams (Ven. rhomboides) for strains of V.
105 tasmanienisis (see experimental infections section) were tested for specificity. The re-isolated colonies
106 from clams of V. splendidus and V. neptunius species were obtained by us in a previous work (Guisande
107 et al., 2008).
108 Sensitivity assays Accepted Manuscript
109 The sensitivity of primers VTS/VT (V. tasmaniensis), VTS/VS (V. splendidus) and VN1 and VN2 (V.
110 neptunius) was determined with DNA from different strains (Tables 3, 4). The genomic DNA was firstly
111 amplified from colonies with the eubacterial universal primers to 16S rRNA gene (9-25 forward and
112 1493-1513 reverse), reported by Paster et al. (1988), by using the conditions described in the previous
113 section. The purified PCR products (0.75 µL) were used as a template in amplification with each tested
5 Page 5 of 23 114 primer set and the conditions were the most specific for each one (see results). The purified PCR
115 amplified fragments were adjusted to 1 nanogram and the DNA was serially diluted in 10mM Tris-1Mm
116 EDTA buffer (TE) buffer up to 1 femtogram. Each dilution was tested for the PCR amplification and the
117 lowest amount of DNA with a positive amplification in most tested strains for each species was chosen as
118 the sensitivity limit.
119 The usefulness of the PCR tests was also assayed using homogenized tissue from experimentally
120 inoculated clams with the type strains of V. tasmaniensis (LMG 20012) or V. splendidus (ATCC 33125).
121 The experiment was performed with healthy clams of Ven. rhomboides. Before starting the experiment,
122 the clams were kept as described below (experimental infections). Cells from each strain were inoculated
123 into 15 mL of TSB-2 for 24h at 22 ºC, with shaking at 100 rpm. The growth was adjusted by absorbance
124 determination at 590 nm and the number of cells was estimated by plating each dilution onto TSA-2 and
125 counting the colony forming units (cfu). The concentration was serially diluted in sterilized seawater and
126 bacteria at levels ranging from 108 to 101 cfu/mL were inoculated in clams. Ten mL of each bacterial
127 dilution was added to each tank containing 100 mL (final volume) of sterile sea water and 5 clams, and
128 was kept 1 h at 18 ºC, with shaking at 100 rpm. Clams were subsequently weighed and homogenized in
129 10 mL of sterile sea water with a stomacher (Laboratory blender stomacher 80, Seward). The genomic
130 DNA was extracted from 1.5 mL of homogenized clams by using TRIzol Reagent protocol (Invitrogen)
131 and 0.75 µL was used as a template for PCR reaction, using the primers of V. tasmaniensis (VTS/VT) and
132 V. splendidus (VTS/VS). Conditions for PCR amplification were the most specific for each primer set
133 (see results).
134 The lowest number of cells inoculated that gave a positive amplification using DNA of homogenized
135 tissues was chosen as theAccepted level of detection in vivo, which Manuscriptwas expressed as number of cfu/g of clams.
136 The colonies re-isolated from homogenized tissues of inoculated clams were used as positive control and
137 their identification was carried out by PCR (using directly the primer sets VTS/VT, VTS/VS) and
138 biochemical tests (Guisande et al. 2008). Bath challenged clams with 100 mL of sterile seawater were
139 processed as above, and were used as a negative control.
140
6 Page 6 of 23 141 Experimental infections
142 Bacterial cultures from 5 sequenced strains of V. tasmaniensis associated with the mollusc culture were
143 selected from our previous work (Guisande et al. 2008) for experimental infections in healthy clams (Ven.
144 rhomboides). The clams were kept for 5 days in tanks, with aerated filtered (0.2 m) seawater at 18 ºC,
145 and a salinity level of 33‰ before experiments were completed. The infections were performed as
146 described previously (Guisande et al. 2008). Briefly, a group of 20 clams per assay was used for each
147 strain and control and kept in different tanks. The cfu of each bacterial suspension (incubated for 24 h at
148 22 ºC on TSB-2) were estimated by plating onto TSA-2 and were added to each tank (containing 540 mL
149 of sterile sea water) the final dose used being between 106 - 107 cfu/mL per bath. Each group of 20 clams
150 was bath challenged for 3 h in non-circulating seawater conditions, transferred to empty tanks for 1 h and,
151 finally, to the tanks containing aerated filtered seawater at 18 ºC. All the clams were monitored for
152 mortality over a 14 day period. Bath challenged clams with 600 mL of sterile seawater were used as a
153 negative control. Samples from clam tissues were taken from all dead clams and, after the 14-day period,
154 from all live clams and spread on TSA-2 (at 22 ºC for 48 h). Identification of suspicious re-isolated
155 colonies was carried out by PCR using directly the primer set VTS/VT, and biochemical tests (Guisande
156 et al. 2008). The re-isolation rate was expressed as percentage of dead clams from which the major type
157 of colony re-isolated from tissues was the inoculated strain.
158 All the animal experiments were performed according to the law approved by the Spanish Ethical
159 Committee (Royal Decree 1201/2005, 10th October, on the protection of animals for experimentation and
160 other scientific purposes; Boletín Oficial del Estado (Official State Gazette of Spain), BOE 21 October
161 2005; pp. 34.367-34.391).
162 Results Accepted Manuscript
163 Selection of target priming sequences
164 The variable regions of 16S sequences were selected for primer design comparing all the sequences 16S
165 from several strains of V. tasmaniensis, V. splendidus, V. neptunius and the other Vibrionaceae species,
166 tested in this study, from the GenBank. Two variable regions were observed at regions corresponding to
167 the Escherichia coli 16S sequence bases 99-113 and 443-460 for V. neptunius. A unique variable region
7 Page 7 of 23 168 with identity in 9 bases for V. tasmaniensis (position 475-496) and V. splendidus (position 482-503) was
169 found (Table 1). A common region for V. tasmaniensis and V. splendidus in positions 76-95 was also
170 selected since it was the most specific for these species and also the region that most differs from other
171 Vibrio species.
172 Amplification of colonies with the primers of V. tasmaniensis (VTS/VT), V. splendidus (VTS/VS) and V.
173 neptunius (VN1/VN2), produced amplicons of 420 bp, 427 bp and 361 bp, respectively (Fig. 1).
174 PCR optimization and primer specificity
175 An annealing temperature of 55 ºC was firstly selected by using the nearest-neighbour model (Tinoco et
176 al., 1971) for the three primer sets tested. Under these conditions, positive amplicons from several tested
177 species with the pair of primers of primers VTS/VT (52 positive strains from 62 strains) and VTS/VS (48
178 positive strains from 62 strains) were obtained. The primers of V. neptunius were also non-specific since a
179 positive amplification was found with 32 strains from 114 tested strains.
180 The temperature gradient assay showed that 72 ºC was the annealing temperature necessary to obtain the
181 maximum specificity with the pair of primers VTS/VT of V. tasmaniensis and the pair of primers
182 VTS/VS of V. splendidus. This temperature also gave high reproducible results for V. tasmaniensis
183 (reproducibility rate 93%; the repeated results were obtained in 15 strains form 16 tested strains) and V.
184 splendidus primers (100%; 16/16 tested strains). The pair of primers VTS/VT of V. tasmaniensis gave a
185 positive result with all the tested strains (12) of V. tasmaniensis and also with several (14) strains of the V.
186 splendidus-related species (V. cyclitrophicus, V. kanaloae, V. lentus, V. pomeroyi and V. splendidus) and
187 also with V. aestuarianus species. Amplification products were not obtained from the other 54 strains,
188 most of which are included in other species (Table 2). The pair of primers VTS/VS showed a positive
189 amplification with allAccepted tested strains (8) of V. splendidus, Manuscript and also with several (11) strains of the V.
190 splendidus-related species (V. crassostreae, V. kanaloae, V. lentus, V. pomeroyi and V.tasmaniensis).
191 Amplification products were not obtained from the other 61 strains, most of which are included in other
192 species (Table 2).
193 An annealing temperature of 60 ºC and 40 cycles were necessary to obtain the maximum specificity with
194 the pair of primers VN1/VN2 of V. neptunius. A reproducibility rate of 100 % (15/15) was obtained. The
8 Page 8 of 23 195 7 tested strains of V. neptunius gave a positive amplification and a cross-reacting with V.
196 parahaemolyticus strains (5) was found. The other strains (100) included in different species showed a
197 negative amplification (Table 2).
198 Each pair of primers gave a positive amplification with strains of V. tasmaniensis, V. splendidus and V.
199 neptunius species re-isolated from inoculated clams, used for specificity assays, respectively.
200 All PCRs carried out have shown definitive positive or negative results with all tested species (45) of this
201 study. A high number of strains from different origins were analyzed showing a high reproducibility.
202 Identical results of amplification were shown with the three pairs of primers when the two different
203 thermal cycles were used (Eppendorf mastercycler gradient and Techgene Thermal cycle) using the same
204 Taq polymerase and reactives. Thus a reproducible PCR was confirmed.
205 Sensitivity assays
206 The sensitivity of three primer sets is shown in Tables 3 and 4. These results indicated that the sensitivity
207 limit of the pair VTS/VT was 500 fg of DNA for V. tasmaniensis strains and 1pg for V. splendidus. An
208 identical level of sensitivity as V. tasmaniensis was shown by the tested strains of V. lentus, V. pomeroyi
209 and V. kanaloae.
210 The level of sensitivity showed by the pair of primers VTS/VS was 1 pg of DNA for V. splendidus and 10
211 pg for V. tasmaniensis. Other tested strains of those species and Vibrio splendidus-related species were
212 unable to be separated at 500 fg of DNA.
213 Positive reactions with the pair of primers VN1/VN2 were found at 1 pg, 10 pg and 100 pg of DNA with
214 both V. neptunius and V. parahaemolyticus species.
215 DNA from inoculated strains LMG 20012 and ATCC 33125 were detected by PCR with both primer sets
216 (V. tasmaniensis and V.Accepted splendidus) applied on homogenized Manuscript clam tissues. A different detection capacity
217 was found. The lowest number of cells inoculated necessary for detection of LMG 20012 DNA using V.
218 tasmaniensis primers, was 2.4x102 (cfu/g of clam). A higher dose was necessary for detection of this
219 DNA with the primers of V. splendidus (2.1x103 cfu/g of clam). The DNA from strain of V. splendidus
220 (ATCC 33125) was detected with a similar number of cells with both pair of primers (3.4x104 cfu/g of
221 clam and 2.8x104 cfu/g of clam for VTS/VT and VTS/VS primers, respectively).
9 Page 9 of 23 222 A positive amplification from colonies re-isolated from homogenized tissues of clams used as positive
223 control was found by using the primer sets VTS/VT and VTS/VS, respectively.
224 Experimental infections
225 The inoculated strains caused mortalities between 20 and 95% in clams and their re-isolation from dead
226 clams as a pure component was between 13 and 72%. In the rest of the dead clams, the inoculated strains
227 were re-isolated as mixed cultures. The highest mortality (90%) and re-isolation rate (72%) was shown by
228 1, from 5 strains tested of V. tasmaniensis that was inoculated with 1.6 x 107 cfu/mL. A clear association
229 between the mortality and the re-isolation rate was not found in the others. A low or absent re-isolation of
230 inoculated strains was obtained from the survivor clams. Clinical signs were not recorded. Neither
231 mortality nor re-isolation from clam tissues was recorded in the negative control group. All the inoculated
232 strains were successfully amplified by using the primer set VTS/VT.
233 Discussion
234 V. tasmaniensis was related to disease in cold-water coral and sea cucumbers (Hall-Spencer et al., 2007;
235 Deng et al., 2009) but not associated with mollusc culture. The five experimentally inoculated strains of
236 V. tasmaniensis assayed in this study caused mortality and were able to colonize the tissues of Ven.
237 rhomboides, their pathogenic potential being confirmed. Since our strains were isolated from healthy
238 reproductive oysters, this is the first report associating this species with induced disease in clams. These
239 results point to the risk of mollusc culture outbreaks in this species, as was previously reported for V.
240 splendidus and V. neptunius species as detailed in the Introduction. These species were also frequently
241 associated with diseases in other aquatic organisms in different countries and were the predominant
242 species found by us associated with the mollusc culture (see introduction). A rapid diagnostic for a
243 prophylactic approachAccepted is particularly important since aquacultureManuscript is highly vulnerable to the impact of
244 infectious diseases. The development of genomic methods appeared to be an important alternative for a
245 rapid detection of bacteria because of the time involved by using a polyphasic analysis when the isolates
246 are closely related taxonomically (Le Roux et al., 2004; Thompson et al., 2005; Guisande et al., 2008). In
247 our study, three PCR primer sets and the PCR optimization assays were designed in order to assist with a
10 Page 10 of 23 248 fast detection of V. tasmaniensis, V. splendidus and V. neptunius species as an indication of good culture
249 conditions.
250 We found that the VTS/VT and VTS/VS primers detected V. tasmaniensis and V. splendidus strains on
251 tissues from experimentally inoculated clams. The usefulness of the technique was shown with the
252 sensitivity limit, using DNA, necessary to obtain positive results for each species (500 fg to 1 pg). This
253 low amount of DNA is found in natural tissues corresponding, at least, with 2.4x102 and 2.8x104 (cfu/g of
254 clam) of V. tasmaniensis and V. splendidus, respectively, since they were the number of inoculated cells
255 required to be detected in vivo.
256 These results showed also the usefulness of applying the primers directly to the total DNA extracted from
257 the homogenized tissues from natural populations. Similar values were previously reported for other
258 bacteria (González et al., 2003) and the sensitivity limit achieved is sufficient to detect these two species,
259 on natural mixed populations, in cultured clams. This means that the detection of these bacteria can be
260 made in a short fraction of time and without the requirement of a previous culture. Although the
261 sensitivity limit of VTS/VT primers was higher than that of VTS/VS primers if the cfu/g of clam
262 achieved is 104, the isolation of the bacteria is needed for a closer identification of species.
263 A positive cross-reactivity between several strains of V. tasmaniensis and V. splendidus and others such
264 as V. splendidus-related or V. aestuarianus species was also found using the VTS/VT and the VTS/VS
265 primers in the specificity experiments. So, these PCR primer sets were partially specific for the tested
266 species, as could be expected when analysing the designed primers. Comparing all the sequences 16S
267 extracted from the GenBank, a high similarity around positions previously reported as useful to design
268 priming sites for diagnostic PCRs for bacteria (Dorsch et al., 1992; Kita-Tsukamoto et al., 1993) was
269 found. Even then, theyAccepted were the more acceptable regions Manuscript for selecting the forward (VTS) and reverse
270 primers (VT, VS). These results confirmed the high level of homogeneity among these species.
271 In this study, combining the results of both pair of primers V. tasmaniensis (VTS/VT) and V. splendidus
272 (VTS/VS) by using an annealing temperature of 72 ºC, it was possible to discriminate several V.
273 splendidus-related species as V. crassostreae and V. cyclitrophicus and also other species such as V.
274 aestuarianus. It was also possible to distinguish 4 strains of 5 tested from V. lentus, 6 of 7 tested from V.
11 Page 11 of 23 275 pomeroyi, 1 of 3 tested from V. kanaloae, 3 of 8 tested from V. splendidus and 10 of 12 tested from V.
276 tasmaniensis. The V. splendidus-related species were previously grouped in an identical cluster with at
277 least 90% DNA-DNA hybridization, recA, rpoA, pyrH and gyrB genes sequence similarity (Macián et al.,
278 2001; Le Roux et al., 2004; Thompson et al., 2005). Although V. splendidus-related species have also
279 shown little variation in 16S rRNA sequences (Le Roux et al., 2002; Thompson et al., 2003c; Montes et
280 al., 2003, 2006), combining the results of both pairs of primers, the separation of all tested strains was
281 86%, a higher percentage than those achieved by using each pair of primers by separated (VTS/VT: 68%;
282 VTS/VS: 77%). These results show the usefulness of this criterion for detecting these highly related
283 species.
284 Using conventional phenotypical tests obtained by us for the strains tested in this study (Farto et al., 2003;
285 Montes et al., 2003; Guisande et al., 2004) V. tasmaniensis can be differentiated from V. kanaloae, V.
286 lentus and V. splendidus, using the acetate as sole carbon source since it was positive for V. tasmaniensis
287 and negative for the others. The production of acid from cellobiose and use as sole carbon source of
288 tartrate and tryptophan can be used for the separation of V. kanaloae, V. lentus and V. splendidus
289 (cellobiose negative only for V. kanaloae; tartrate positive only for V. splendidus; tryptophan positive
290 only for V. kanaloae). However, although we can use degradation of esculin, crystal violet, use as sole
291 carbon source of citrate and -hemolysis for separation of V. pomeroyi from all other V. kanaloae, V.
292 lentus and V. splendidus, we can not discriminate this species from V. tasmaniensis, comparing the 92
293 phenotypical tests previously reported by us (Guisande et al., 2004). Further studies are needed for
294 selecting other new phenotypical tests in order to distinguish between these two species. These results
295 also support the little variation found by using molecular analyses (Macián et al., 2001; Montes et al.,
296 2003, 2006; Le RouxAccepted et al., 2004; Thompson et al., 2005).Manuscript Therefore, the combination of PCR and
297 biochemical tests allowed for the separation of 97% of tested V. splendidus-related strains. All these
298 results showed that PCR assists in reducing the number of biochemical tests and time, required for
299 separate V. splendidus-related species.
300 The two variable regions observed in positions 99-113 and 443-460 of sequence 16S from V. neptunius
301 made it possible to select a pair of highly specific primers, since 95,5% of tested species was
12 Page 12 of 23 302 distinguished by using an annealing temperature of 60 ºC. The only species with positive cross-reaction
303 was V. parahaemolyticus, which is surprising since it is not phylogenetic closely related to V. neptunius
304 (Thompson et al., 2005). Comparisons of the region including the two priming sites of V. neptunius and
305 V. parahaemolyticus, showed a high level of similarity between them.
306 Four biochemical tests can discriminate between these two species: arginine dihydrolase (ADH) and -
307 hemolysis that were positive for V. neptunius and negative for V. parahaemolyticus and ornithine
308 decarboxylase (LDC) and production of acid from galactose that were negative por V. neptunius and
309 positive for V. parahaemolyticus (Montes et al., 1999; Guisande et al., 2004). Although we did not
310 identify V. parahaemolyticus associated with molluscan culture in Galicia (Guisande et al., 2008), we
311 previously reported their association with turbot culture (Montes et al., 2006). The number of biochemical
312 tests required to separate these two species is low and the identification time could be reduced further if
313 suspect colonies were tested using biochemical tests concurrently with the PCR.
314 The primer sets and PCR assays designed improve the fast detection of V. tasmaniensis, V. splendidus
315 and V. neptunius species. The combined sensitivity of PCR and biochemical tests offered the best
316 coverage in terms of separating V. tasmaniensis and V. splendidus from V. splendidus-related species and
317 V. neptunius from V. parahamolyticus. V. tasmaniensis is a potential risk of molluscan culture outbreaks
318 and the time of detection of this species was reduced. All these results make it possible to diagnose
319 affected animals in a short fraction of time.
320
Accepted Manuscript
13 Page 13 of 23 321 Acknowledgments
322 This work was supported by grants PGIDIT00MAR2002PR and PGIDIT02RMA30102PR from the
323 Xunta de Galicia (Regional Government of Galicia). The authors wish to thank J. Montes for kindly
324 providing bacterial isolates and F. Mallo for providing the thermal cycle for temperature gradient assays.
325
Accepted Manuscript
14 Page 14 of 23 326 References
327 Angulo, L., López, J.E., Vicente, J.A., 1994a. Epizootic outbreaks by a protozoan and bacterium in reared
328 turbot, Scophthalmus maximus (L.). Bull. Eur. Ass. Fish Pathol. 14, 39-40.
329 Angulo, L., López, J.E., Vicente, J.A., Saborido, A.M. 1994b. Haemorrahagic areas in the mouth of
330 farmed turbot, Scophthalmus maximus (L.). J. Fish Dis. 17, 163-169.
331 Avendaño-Herrera, R., Magariños, B., Toranzo, A.E., Beaz, R., Romalde, J.L., 2004. Species-specific
332 polymerase chain reaction primer set for the diagnosis of Tenacibaculum maritimum infection. Dis.
333 Aquat. Org. 62, 75-83.
334 Austin, B., Austin, D., Sutherland, R., Thompson, F., Swings J., 2005. Pathogenicity of vibrios to
335 rainbow trout (Oncorhynchus mykiss, Walbaum) and Artemia nauplii. Environ Microbiol. 7, 1488-1495.
336 Deng, H., He Ch., Zhou, Z, Liu, Ch., Tan, K., Wang, N., Jiang, B., Gao, X., Liu, W., 2009. Isolation and
337 pathogenicity of pathogens from skin ulceration disease and viscera ejection syndrome of the sea
338 cucumber Apostichopus japonicus. Aquaculture 287, 18–27.
339 Dorsch, M., Lane, D., Stackebrandt, E., 1992. Towards a phylogeny of the genus Vibrio based on 16S
340 rRNA sequences. Int. J. System. Bacteriol. 42, 58-63.
341 Farto, R., Armada, S.P., Montes, M., Guisande, J.A., Pérez, M.J., Nieto, T.P. , 2003. Vibrio lentus
342 associated with diseased wild octopus (Octopus vulgaris). J. Invertebr. Pathol. 83, 149-156.
343 Farto, R., Armada, S.P., Montes, M., Pérez, M.J., Nieto, T.P., 2006. Presence of a letal protease in the
344 extracellular products of Vibrio splendidus-V.lentus related extrains. J. Fish Dis. 29, 1-7. 345 Garnier, M., Labreuche,Accepted Y., Garcia, C., Robert, M., Nicolas, Manuscript J.L., 2007. Evidence for the involvement of 346 pathogenic bacteria in summer mortalities of the pacific oyster Crassostrea gigas. Microbial Ecology 53,
347 187-196.
348 Gatesoupe, F.J., Lambert, C., Nicolas, J.L., 1999. Pathogenicity of Vibrio splendidus strains associated
349 with turbot larvae, Scophthalmus maximus. J. Appl. Microbiol. 87, 757-763.
15 Page 15 of 23 350 Gay, M., Berthe, F.C.J., Le Roux, F., 2004. Screening of Vibrio isolates to develop and experimental
351 infection model in the Pacific oyster Crassostrea gigas. Dis. Aquat. Org. 59, 49-56.
352 Gómez-León, J., Villamil, L., Lemos,M.L., Novoa, B., Figueras, A., 2005. Isolation of Vibrio
353 alginolyticus and Vibrio splendidus from aquacultured carpet shell clam (Ruditapes decussates) larvae
354 associated with mass mortalities. Appl. Environ. Microbiol. 71, 98-104.
355 González, S.F., Osorio, C.R., Santos, Y., 2003. Development of a PCR- based meted for the detection of
356 Listonella anguillarum in fish tissues and blood samples. Dis. Aquat. Org. 55, 109-115.
357 Guisande, J.A., Montes, M., Farto, R., Armada, S.P., Pérez, M.J., Nieto, T.P., 2004. A set of tests for the
358 phenotypic identification of culturable bacteria associated with Galician bivalve mollusc production. J.
359 Shellfish Res. 23, 599-609.
360 Guisande, J.A., Lago, E.P., Prado, S., Nieto, T.P., Farto, R., 2008. Genotypic diversity of culturable
361 Vibrio species associated with the culture of oysters and clams in Galicia and screening of their
362 pathogenic potential. J. Shellfish Res. 27, 801-809.
363 Hall-Spencer, J.M., Pike, J., Munn, C.B., 2007. Diseases affect cold-water corals too: Eunicella
364 verrucosa (Cnidaria: Gorgonacea) necrosis in SW England. Dis. Aquat. Org. 76, 87-97.
365 Kita-Tsukamoto, K., Oyaizu, H., Nanba, K., Simidu, U., 1993. Phylogenetic relationships of marine
366 bacteria, mainly members of the family Vibrionaceae, determined on the basis of 16S rRNA sequences.
367 Int. J. System. Bacteriol., 43, 8-19.
368 Le Roux, F., Gay, M., Lambert, C., Waechter, M., Poubalanne, S., Chollet, B., Nicolas, J.L., Berthe, F., 369 2002. Comparative analysisAccepted of Vibrio splendidus-related Manuscript strains isolated during Crassostrea gigas 370 mortality events. Aquat. Living Resour. 14, 251-258.
371 Le Roux, F., Gay, M., Lambert, C., Nicolas, J.L., Gouy, M., Berthe, F., 2004. Phylogenetic study and
372 identification of Vibrio splendidus-related strains based on gyrB gene sequences. Dis. Aquat. Org. 58,
373 143-150.
16 Page 16 of 23 374 Macián, M.C., Ludwig, W., Aznar, R., Grimont, P.A.D., Schleifer, K.H., Garay, G., Pujalte, M.J., 2001.
375 Vibrio lentus sp. nov., isolated from Mediterranean oysters. Int. J. System. Evol. Microbiol. 51, 1449–
376 1456.
377 Montes, M., Pérez M.J., Nieto, T.P., 1999. Numerical taxonomy of Gram negative, facultative anaerobic
378 bacteria isolated from skin of turbot (Scophthalmus maximus) and surrounding water. Syst. Appl.
379 Microbiol. 22, 604–618.
380 Montes, M., Farto, R., Pérez, M.J., Nieto, T.P., Larsen, J.L., Christensen, H., 2003. Characterization of
381 Vibrio strains isolated from turbot (Scophthalmus maximus) culture by phenotypic analysis, ribotyping
382 and 16S rRNA gene sequence comparison. J. Appl. Microbiol. 95, 693-703.
383 Montes M., Farto, R., Pérez, M.J., Armada S.P., Nieto, T.P., 2006. Genotypic diversity of Vibrio isolates
384 associated with turbot (Scophthalmus maximus) culture. Res. Microbiol., 157, 487-495.
385 Oakey, H.J., Levy, N., Bourne, D.G., Cullen, B., Thomas, A., 2003. The use of PCR to aid in the rapid
386 identification of Vibrio harveyi isolates. J. Appl. Microbiol. 95, 1293-1303.
387 Paster, B.J., Dewhirst, F.E., 1988. Phylogeny of Campylobacter, Wolinellas, Bacteroides gracilis, and
388 Bacteroides ureolyticus by 16S ribosomal ribonucleic acid sequencing. Int. J. System. Bacteriol. 38, 56-
389 62.
390 Prado, S., Romalde, J.L., Montes, J, Barja, J.L., 2005. Pathogenic bacteria isolated from disease outbreaks
391 in shellfish hatcheries. First description of Vibrio neptunius as an oyster pathogen. Dis. Aquat. Org. 67,
392 209-215. 393 Reid, H.I., Treasurer, AcceptedJ.W., Adam, B., Birkbeck, T.H., 2009.Manuscript Analysis of bacterial populations in the gut 394 of developing cod larvae and identification of Vibrio logei, Vibrio anguillarum and Vibrio splendidus as
395 pathogens of cod larvae. Aquaculture 288, 36–43.
396 Santos, Y., Pazos, F., Núñez, S., Toranzo, A.E., 1997. Antigenic characterization of Vibrio anguillarum-
397 related organisms isolated from turbot and cod. Dis. Aquat. Org. 28, 45-50.
17 Page 17 of 23 398 Saulnier, D., Avarre, J.C., Le Moullac, G., Ansquer, D., Levy, P., Vonau, V., 2000. Rapid and sensitive
399 PCR detection of Vibrio penaeicida, the putative etiological agent of Syndrome 93 in New Caledonia.
400 Dis. Aquat. Org. 40, 109-115.
401 Sitjà-Bobadilla, A., Pujalte, M.J., Bermejo, A., Garay, E., Álvarez-Pellitero, P., Pérez-Sánchez, J., 2007.
402 Bacteria associated with winter mortalities in laboratory-reared common dentex (Dentex dentex L.).
403 Aquac. Res., 38, 733-739.
404 Sugumar, G., Nakai, T., Hirata, Y., Matsubara, D., Muroga, K., 1998. Vibrio splendidus biovar II as the
405 causative agent of bacillary necrosis of Japanese oyster Crassostrea gigas larvae. Dis. Aquat. Org. 33,
406 111-118.
407 Thompson, F.L., Li, Y., Gómez-Gil, B., Thompson, C.C., Hoste, B., Vandemeulebroecke, K., Rupp, G.S.,
408 Pereira, A., De Bem, M.M., Sorgeloos, P., Swings, J., 2003a. Vibrio neptunius sp. nov., Vibrio
409 brasiliensis sp. nov. and Vibrio xuii sp. nov., isolated from the marine aquaculture environment (bivalves,
410 fish, rotifers and shrimps). Int. J. System. Evol. Microbiol. 53, 245-252.
411 Thompson, F.L., Thompson, C.C., Swings, J., 2003b. Vibrio tasmaniensis sp. nov., isolated from Atlantic
412 salmon (Salmo salar L.). System. Appl. Microbiol. 26, 65-69.
413 Thompson, F.L., Thompson, C.C., Li, Y., Gómez-Gil, B., Vandengberghe, J., Hoste, B., Swings, J.,
414 2003c. Vibrio kanaloae sp. nov., Vibrio pomeroyi sp. nov., and Vibrio chagasii sp. nov., from sea water
415 and marine animals. Int. J. System. Evol. Microbiol. 3, 753-759.
416 Thomson, R., Macpherson, H.L., Riaza, A., Birkbeck, T.H., 2005. Vibrio splendidus biotype 1 as a cause 417 of mortalities in hatchery-rearedAccepted larval turbot, Scophthalmus Manuscript maximus (L.). J. Appl. Microbiol. 49, 243- 418 250.
419 Tinoco, Jr.I., Uhlenbech O.C., Levine, M.D., 1971. Estimation of secondary structure in ribonucleic
420 acids. Nature 230, 263-367.
18 Page 18 of 23 Figure
bp
23.130
2322 2027
564
125
λ A B C
Fig.1 λ – the fragment sizes of the digoxigenin-labelled marker digested
with Hin dIII shown in bp; A- V. tasmaniensis LMG 20012 at 72 °C of
annealing temperature (417 bp); B- V. splendidus ATCC 33125 at 72 °C
(427 bp); C- V. neptunius LMG 20536 at 60 °C (361 bp)
Accepted Manuscript
1 Page 19 of 23 Table
1 Table 1. Primers used in PCR
2 Primer Sequence Common primer of V. tasmaniensis and V. splendidus 76-95f (VTS) 5’ GAGCGGAAACGACACTAACA 3’ (20 bp)a Primer of V. tasmaniensis 475-496r (VT) 5’ GCAGCTATTAACTACACACCCT 3’ (22 bp) Primer of V. splendidus 482-503r (VS) 5’ AAGAGATAGCGCTATTAACGCT 3’ (22 bp) Primer of V. neptunius 99-113f (VN-1) 5’ AAAGCCTTCGGGTGG 3’ (15 bp) 443-460r (VN-2) 5’ ACACCACCTTCCTCACTG 3’ (18 bp) 3 a, primer size; in black shared region by both primers; f, forward,; r, reverse 4
Accepted Manuscript
1 Page 20 of 23 5 Table 2. Results of amplifications from colonies of tested species by using the primers of V. 6 tasmaniensis, V. splendidus and V. neptunius Amplificationb Tested speciesa VTS/VT VTS/VS VN1/VN2 72 ºC 72 ºC 60 ºC Aeromonas salmonicida subsp. salmonicida (CECT 894T; 1 LCS) NT NT 0/2 Photobacterium damselae subsp. damselae (ATCC 33539 T) 0/1 0/1 0/1 Photobacterium damselae subsp. piscicida (ATCC 17911) NT NT 0/1 Pseudomonas anguilliseptica (CECT 899T) NT NT 0/1 Tenacibaculum maritumum (CECT 4276) NT NT 0/1 Vibrio aestuarianus (ATCC 35048T; 1 LCS) 1/2 0/2 0/2 V. albensis (LMG 4406T) 0/1 0/1 0/1 V. alginolyticus (CECT 521T; CECT 586; CAIM 342) 0/1 0/1 0/3 V. anguillarum (NCIMB 571; ATCC 43307; CECT 522) 0/2 0/2 0/3 V. campbellii (CECT 523) 0/1 0/1 0/1 V. chagassii (LMG 21353T) 0/1 0/1 0/1 V. cincinnatiensis (LMG 7891T) 0/1 0/1 0/1 V. coralliilyticus (LMG 20984T) NT NT 0/1 V. costicola (LMG 6460) 0/1 0/1 0/1 V. crassostreae (LMG 22240T) 0/1 1/1 0/1 V. cyclitrophicus (LMG 21359T; CAIM 547) 1/1 0/1 0/2 V. diazotrophicus (LMG 7893T) 0/1 0/1 0/1 V. fischeri (LMG 4414T; 3 LCS) 0/2 0/2 0/4 V. fluvialis (LMG 7894T) 0/1 0/1 0/1 V. furnissii (LMG 7910T) 0/1 0/1 0/1 V. halioticoli (3 LCS) NT NT 0/3 V. ichthyoenteri (CAIM 597T; 3 LCS) 0/3 0/3 0/4 V. kanaloae (LMG 20539T; CAIM 546; 1 LCS) 2/3 2/3 0/3 V. lentus (CECT 5293; 4 LCS) 4/5 1/5 0/5 V. mediterranei (LMG 11258T; 2 LCS) 0/2 0/2 0/3 V. metschnikovii (ATCC 7708) 0/1 0/1 0/1 V .mytili (CECT 632) 0/1 0/1 0/1 V. neptunius (LMG 20536T; 6 LCS ) 0/4 0/4 7/7 V. nereis (LMG 3895T) 0/1 0/1 0/1 V. ordalii (CECT 582) 0/1 0/1 0/1 V. orientalis (CECT 629) 0/1 0/1 0/1 V. pacinii (LMG 19999T) 0/1 0/1 0/1 V. parahaemolyticus (CECT 588; CECT 5306; CAIM 58; 2 LCS) 0/1 0/1 5/5 V. pelagius (LMG 3897T) 0/1 0/1 0/1 V. pomeroyi (LMG 20537T; CAIM 739; 5 LCS) 1/7 5/7 0/7 V. proteolyticus (LMG 3772T) 0/1 0/1 0/1 V. salmonicida (CECT 4195) 0/1 0/1 0/1 V. scophthalmi (10 LCS) 0/3 0/3 0/10 T Accepted Manuscript V. shilonii (LMG 19703 ) NT NT 0/1 V. splendidus (ATCC 33125T; LMG 16751; 7 LCS) 5/8 9/8 0/8 V. superstes (CAIM 904T; 1 LCS) 0/1 0/1 0/1 V. tapetis (CECT 4600T) 0/1 0/1 0/1 V. tasmaniensis (LMG 20012T; CAIM 759; 10 LCS) 12/12 2/12 0/12 V. tubiashii (LMG 10936T) 0/1 0/1 0/1 V. vulnificus (CECT 897; CAIM 611) 0/2 0/2 0/2 7 a,The LCS, laboratory collection strains from T.P. Nieto´s private collection and recorded in Farto et al. (2003; 2006), Montes et al. (2006), 8 and Guisande et al. (2008); ATCC, American Type Culture Collection, University Boulevard, Manassas, Virginnia (U.S.A.); CAIM, 9 Collection of Aquatic Important Microorganisms, Mazatlán Unit for Aquaculture and Environmental Management, Mazatlán (Sinaloa 10 México); CECT, Colección Española de Cultivos Tipo, Valencia (Spain); LMG, Laboratorium voor Microbiologie, Universiteit, Gent, 11 Belgium (EU); NCIMB, National Collection of Industrial and Marine Bacteria, Aberdeen (UK); b, primer tested at annealing temperature of 12 72 ºC and 60 ºC; Number of positive strains/number of total tested strains; NT: not tested 13 2 Page 21 of 23 14 Table 3. Sensitivity of V. tasmaniensis and V. splendidus primers by using the DNA from colonies 15 Amplification by PCR VTS/VTa VTS/VSb Strains 10pgc 1pg 500fg 1fgd 10pg 1pg 500fg V. tasmaniensis LMG 20012 CAIM 759 5 LCS + (7/7) + (7/7) + (7/7) + (0/7) + (6/7) + (2/7) + (1/7) V. splendidus ATCC 33125 LMG 16751 3 LCS + (5/5) + (3/5) + (0/5) NT + (4/5) + (4/5) + (2/5) V.lentus P58 CECT 5293 + (2/2) + (2/2) + (1/2) NT + (1/2) + (1/2) + (1/2) V.pomeroyi LMG 20537 1 LCS + (2/2) + (2/2) + (2/2) NT + (2/2) + (2/2) + (2/2) V. kanaloae LMG 20539 1 LCS + (2/2) + (2/2) + (2/2) NT + (2/2) + (2/2) + (2/2) 16 17 a, primers of V. tasmaniensis; b, primers of V. splendidus; c, Amount of tested DNA: picograms and femtograms; d,
18 the pair of primers VTS/VS were not tested with 1fg; NT: not tested; in brackets No. of positive strains/total number
19 of tested strains.
20
Accepted Manuscript
3 Page 22 of 23 21 Table 4. Sensitivity of V. neptunius primers by using the DNA from colonies 22 23 Strains Amplification by PCR 100pga 10pg 1pg 500fg V. neptunius LMG 20536; 2 LCS + (3/3) + (2/3) + (1/3) + (0/3) V. parahaemolyticus CECT 5306; CECT 588; CAIM 58 + (3/3) + (2/3) + (1/3) + (0/3) 24 a, Amount of tested DNA: picograms and femtograms; in brackets No. of positive strains/total number of
25 tested strains.
26
Accepted Manuscript
4 Page 23 of 23