Supplementary Table 1: List of the Lung Cancer Cell Lines Used in the Present Study for Determining the Status of PARD3
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Responses of Bats to White-Nose Syndrome and Implications for Conservation
University of New Hampshire University of New Hampshire Scholars' Repository Doctoral Dissertations Student Scholarship Spring 2020 Responses of Bats to White-Nose Syndrome and Implications for Conservation Meghan Stark University of New Hampshire, Durham Follow this and additional works at: https://scholars.unh.edu/dissertation Recommended Citation Stark, Meghan, "Responses of Bats to White-Nose Syndrome and Implications for Conservation" (2020). Doctoral Dissertations. 2518. https://scholars.unh.edu/dissertation/2518 This Dissertation is brought to you for free and open access by the Student Scholarship at University of New Hampshire Scholars' Repository. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of University of New Hampshire Scholars' Repository. For more information, please contact [email protected]. RESPONSES OF BATS TO WHITE-NOSE SYNDROME AND IMPLICATIONS FOR CONSERVATION BY MEGHAN A. STARK B.S., University of Alabama at Birmingham, 2013 DISSERTATION Submitted to the University of New Hampshire in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy In Genetics May 2020 i This dissertation was examined and approved in partial fulfillment of the requirements for the degree of Ph.D. in Genetics by: Dissertation Director, Matthew MacManes, Assoc. Prof. UNH MCBS Jeffrey T. Foster, Associate Professor, NAU PMI W. Kelley Thomas, Professor, UNH MCBS Rebecca Rowe, Associate Professor, UNH NREN Thomas Lee, Associate Professor Emeritus, UNH NREN On April 6, 2020 Approval signatures are on file with the University of New Hampshire Graduate School. ii DEDICATION I dedicate this work to all of the strong women in my life: Myra Michele Ange Heather Michelle Coons Kaitlyn Danielle Cagle Brindlee Michelle Coons Patricia Gail Miller Sarah Jean Lane “Here’s to strong women. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4). -
Transcriptional Control of Tissue-Resident Memory T Cell Generation
Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2019 © 2019 Filip Cvetkovski All rights reserved ABSTRACT Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Tissue-resident memory T cells (TRM) are a non-circulating subset of memory that are maintained at sites of pathogen entry and mediate optimal protection against reinfection. Lung TRM can be generated in response to respiratory infection or vaccination, however, the molecular pathways involved in CD4+TRM establishment have not been defined. Here, we performed transcriptional profiling of influenza-specific lung CD4+TRM following influenza infection to identify pathways implicated in CD4+TRM generation and homeostasis. Lung CD4+TRM displayed a unique transcriptional profile distinct from spleen memory, including up-regulation of a gene network induced by the transcription factor IRF4, a known regulator of effector T cell differentiation. In addition, the gene expression profile of lung CD4+TRM was enriched in gene sets previously described in tissue-resident regulatory T cells. Up-regulation of immunomodulatory molecules such as CTLA-4, PD-1, and ICOS, suggested a potential regulatory role for CD4+TRM in tissues. Using loss-of-function genetic experiments in mice, we demonstrate that IRF4 is required for the generation of lung-localized pathogen-specific effector CD4+T cells during acute influenza infection. Influenza-specific IRF4−/− T cells failed to fully express CD44, and maintained high levels of CD62L compared to wild type, suggesting a defect in complete differentiation into lung-tropic effector T cells. -
SELP Asp603asn and Severe Thrombosis in COVID-19 Males
Fallerini et al. J Hematol Oncol (2021) 14:123 https://doi.org/10.1186/s13045-021-01136-9 LETTER TO THE EDITOR Open Access SELP Asp603Asn and severe thrombosis in COVID-19 males Chiara Fallerini1,2, Sergio Daga1,2, Elisa Benetti2, Nicola Picchiotti3,4, Kristina Zguro2, Francesca Catapano1,2, Virginia Baroni1,2, Simone Lanini5, Alessandro Bucalossi6, Giuseppe Marotta6, Francesca Colombo7, Margherita Baldassarri1,2, Francesca Fava1,2,8, Giada Beligni1,2, Laura Di Sarno1,2, Diana Alaverdian1,2, Maria Palmieri1,2, Susanna Croci1,2, Andrea M. Isidori9, Simone Furini2, Elisa Frullanti1,2 on behalf of GEN-COVID Multicenter Study, Alessandra Renieri1,2,8* and Francesca Mari1,2,8 Abstract Thromboembolism is a frequent cause of severity and mortality in COVID-19. However, the etiology of this phenom- enon is not well understood. A cohort of 1186 subjects, from the GEN-COVID consortium, infected by SARS-CoV-2 with diferent severity was stratifed by sex and adjusted by age. Then, common coding variants from whole exome sequencing were mined by LASSO logistic regression. The homozygosity of the cell adhesion molecule P-selectin gene (SELP) rs6127 (c.1807G > A; p.Asp603Asn) which has been already associated with thrombotic risk is found to be associated with severity in the male subcohort of 513 subjects (odds ratio 2.27, 95% Confdence Interval 1.54–3.36). As the SELP gene is downregulated by testosterone, the odd ratio is increased= in males older than 50 (OR 2.42, 95% CI 1.53–3.82). Asn/Asn homozygotes have increased D-dimers values especially when associated with poly Q 23 in the androgen receptor (OR 3.26, 95% CI 1.41–7.52). -
Supplementary Tables S1-S3
Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse) -
Engineered Type 1 Regulatory T Cells Designed for Clinical Use Kill Primary
ARTICLE Acute Myeloid Leukemia Engineered type 1 regulatory T cells designed Ferrata Storti Foundation for clinical use kill primary pediatric acute myeloid leukemia cells Brandon Cieniewicz,1* Molly Javier Uyeda,1,2* Ping (Pauline) Chen,1 Ece Canan Sayitoglu,1 Jeffrey Mao-Hwa Liu,1 Grazia Andolfi,3 Katharine Greenthal,1 Alice Bertaina,1,4 Silvia Gregori,3 Rosa Bacchetta,1,4 Norman James Lacayo,1 Alma-Martina Cepika1,4# and Maria Grazia Roncarolo1,2,4# Haematologica 2021 Volume 106(10):2588-2597 1Department of Pediatrics, Division of Stem Cell Transplantation and Regenerative Medicine, Stanford School of Medicine, Stanford, CA, USA; 2Stanford Institute for Stem Cell Biology and Regenerative Medicine, Stanford School of Medicine, Stanford, CA, USA; 3San Raffaele Telethon Institute for Gene Therapy, Milan, Italy and 4Center for Definitive and Curative Medicine, Stanford School of Medicine, Stanford, CA, USA *BC and MJU contributed equally as co-first authors #AMC and MGR contributed equally as co-senior authors ABSTRACT ype 1 regulatory (Tr1) T cells induced by enforced expression of interleukin-10 (LV-10) are being developed as a novel treatment for Tchemotherapy-resistant myeloid leukemias. In vivo, LV-10 cells do not cause graft-versus-host disease while mediating graft-versus-leukemia effect against adult acute myeloid leukemia (AML). Since pediatric AML (pAML) and adult AML are different on a genetic and epigenetic level, we investigate herein whether LV-10 cells also efficiently kill pAML cells. We show that the majority of primary pAML are killed by LV-10 cells, with different levels of sensitivity to killing. Transcriptionally, pAML sensitive to LV-10 killing expressed a myeloid maturation signature. -
Forms of Supplemental Selenium in Vitamin-Mineral
University of Kentucky UKnowledge Theses and Dissertations--Animal and Food Sciences Animal and Food Sciences 2019 FORMS OF SUPPLEMENTAL SELENIUM IN VITAMIN-MINERAL MIXES DIFFERENTIALLY AFFECT SEROLOGICAL AND HEPATIC PARAMETERS OF GROWING BEEF STEERS GRAZING ENDOPHYTE-INFECTED TALL FESCUE Yang Jia University of Kentucky, [email protected] Digital Object Identifier: https://doi.org/10.13023/etd.2019.028 Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Jia, Yang, "FORMS OF SUPPLEMENTAL SELENIUM IN VITAMIN-MINERAL MIXES DIFFERENTIALLY AFFECT SEROLOGICAL AND HEPATIC PARAMETERS OF GROWING BEEF STEERS GRAZING ENDOPHYTE- INFECTED TALL FESCUE" (2019). Theses and Dissertations--Animal and Food Sciences. 97. https://uknowledge.uky.edu/animalsci_etds/97 This Doctoral Dissertation is brought to you for free and open access by the Animal and Food Sciences at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Animal and Food Sciences by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known. -
The Histone Variant Macroh2a1 Regulates Key Genes for Myogenic Cell Fusion in a Splice-Isoform Dependent Manner
cells Article The Histone Variant MacroH2A1 Regulates Key Genes for Myogenic Cell Fusion in a Splice-Isoform Dependent Manner Sarah Hurtado-Bagès 1, Melanija Posavec Marjanovic 2, Vanesa Valero 1, Roberto Malinverni 1, David Corujo 1 , Philippe Bouvet 3 , Anne-Claire Lavigne 4 , Kerstin Bystricky 4 and Marcus Buschbeck 1,2,* 1 Cancer and Leukemia Epigenetics and Biology Program, Josep Carreras Leukaemia Research Institute (IJC), Campus ICO-GTP-UAB, 08916 Badalona, Spain; shb.scientifi[email protected] (S.H.-B.); [email protected] (V.V.); [email protected] (R.M.); [email protected] (D.C.) 2 Program for Predictive and Personalized Medicine of Cancer, Germans Trias i Pujol Research Institute (PMPPC-IGTP), 08916 Badalona, Spain; [email protected] 3 Université de Lyon, Ecole Normale Supérieure de Lyon, Centre Léon Bérard, Centre de Recherche en Cancérologie de Lyon, INSERM 1052, CNRS 5286, F-69008 Lyon, France; [email protected] 4 Center for Integrative Biology (CBI), LBME, University of Toulouse, UPS, CNRS, F-31062 Toulouse, France; [email protected] (A.-C.L.); [email protected] (K.B.) * Correspondence: [email protected]; Tel.: +34-93-557-2800 Received: 31 March 2020; Accepted: 23 April 2020; Published: 30 April 2020 Abstract: MacroH2A histone variants have functions in differentiation, somatic cell reprogramming and cancer. However, at present, it is not clear how macroH2As affect gene regulation to exert these functions. We have parted from the initial observation that loss of total macroH2A1 led to a change in the morphology of murine myotubes differentiated ex vivo. The fusion of myoblasts to myotubes is a key process in embryonic myogenesis and highly relevant for muscle regeneration after acute or chronic injury. -
Supplemental Materials
The infection-tolerant mammalian reservoir of Lyme disease and other zoonoses broadly counters the inflammatory effects of endotoxin Supplemental Materials Figures S1-S5 Tables S1-S20 Figure S1. Digital photograph of two adult Peromyscus leucopus with exudative conjunctivitis and huddled together. The animals had received 10 mg/gm body of Escherichia coli lipopolysaccharide intraperitoneally the day before. Figure S2. Species- and tissue-specific responses to LPS. Independent differential gene expression analysis of RNA-seq data were performed for blood, spleen, and liver tissues of P. leucopus and M. musculus collected 4 h after injection with LPS or buffer alsone as control. These are represented as volcano plots with range- adjusted scales for the log2-transformed fold-changes on x-axes and log10-transformed FDR p values on y- axes. Colors of symbols denote the following: red, up-regulated gene with absolute fold-change > 4.0 and p value < 0.05; purple, down-regulated gene with absolute fold-change > 4.0 and p value < 0.05; and gray, all others. Numbers at the top left and right corners in each plot respresent numbers of down- and up-regulated genes, respectively. Figure 3 is same data with constant scales for x- and y-axes across the plots. Numerical values for each gene in the 6 datasets are provided in Tables S4-S9. Figure S3. Correlation of IL-10 and IL-10 P. leucopus and M. musculus from RNA-seq of spleen and of Figure 6B and TaBle S14. The scatter plot is log10 values of normalized unique reads of one coding sequence against another for each of the four groups, as defined in the legend for Figure 6 and indicated By different symBols. -
Normalized Expression Values *
Normalized expression values 0.0 0.2 0.4 0.6 0.8 1.0 1.2 PLCG1 * T CD5 MP T B TCF7 cDC UBASH3A BCL11B C5AR1 * MP TLR4 CXCR5 B CD79B VPREB3 XCR1 CADM1 BEND5 * ARGHAP22 * cDC CIITA ZBTB46 FLT3 PLEKHA5 Figure S1. qPCR analysis of the core gene expression signature of cDC, MP, B and T cells in the chicken cell suBsets. RNA from cDC, MP, T and B cells of 2 disUnct pools of 4 chicken spleen was subjected to qPCR detecUon of the core gene expression signatures of immune cell subsets established in Fig. 3 and of transcripts from the mouse and human gene subset selected compendia that could not be detected on the array due to defecUve probes, i.e. ARGHAP22, BEND5, C5AR1, and PLCG1 (labeled by a star on the figure). Data are represented as the mean and SD of relave gene expression levels normalized to GAPDH expression and the maximal expression across the cell types was set to 1 (independent experimental duplicates). B cell T cell cDC Monocyte/MP Chicken Human Mouse Figure S2. Unsupervised hierarchical clustering of orthologous immune response genes across chicken, human and mouse reveals globally conserved clusters of lymphoïd- specific and myeloïd- specific genes. Heatmap of cross-normalized expression profiles for immune response genes present on all three species arrays and regulated at least 2 folds across all cell suBsets, including chicken B cells (c_B), T cells (c_CD3), MP (c_MP) and cDC (c_cDC), human B cells (h_B), T cells (h_CD4_T and h_CD8_T), monocyte-derived MP (h_MoMP), peripheral blood mononucleated cell-derived MP (h_PBMC_MP), non-classical monocytes (h_non- classical_MO), classical monocytes (h_classical_MO), BDCA3+ cDC (h_BDCA3), BDCA1+ cDC (h_BDCA1), murine B cells (m_B), T cells (m_CD4_T and m_CD8_T), peritoneal cavity MP (m_PC_MPII-480HI), lung MP (m_LU_MP), non-classical monocytes (m_non-classical_MO), classical monocytes (m_classical_MO), splenic CD8α+ cDC (m_SP_DC1), suBcutaneous lymph node CD8α+ cDC (m_LN_DC1), splenic CD11B+ cDC (m_SP_DC2), suBcutaneous lymph node CD11B+ cDC (m_LN_DC2). -
1 SUPPLEMENTAL DATA Figure S1. Poly I:C Induces IFN-Β Expression
SUPPLEMENTAL DATA Figure S1. Poly I:C induces IFN-β expression and signaling. Fibroblasts were incubated in media with or without Poly I:C for 24 h. RNA was isolated and processed for microarray analysis. Genes showing >2-fold up- or down-regulation compared to control fibroblasts were analyzed using Ingenuity Pathway Analysis Software (Red color, up-regulation; Green color, down-regulation). The transcripts with known gene identifiers (HUGO gene symbols) were entered into the Ingenuity Pathways Knowledge Base IPA 4.0. Each gene identifier mapped in the Ingenuity Pathways Knowledge Base was termed as a focus gene, which was overlaid into a global molecular network established from the information in the Ingenuity Pathways Knowledge Base. Each network contained a maximum of 35 focus genes. 1 Figure S2. The overlap of genes regulated by Poly I:C and by IFN. Bioinformatics analysis was conducted to generate a list of 2003 genes showing >2 fold up or down- regulation in fibroblasts treated with Poly I:C for 24 h. The overlap of this gene set with the 117 skin gene IFN Core Signature comprised of datasets of skin cells stimulated by IFN (Wong et al, 2012) was generated using Microsoft Excel. 2 Symbol Description polyIC 24h IFN 24h CXCL10 chemokine (C-X-C motif) ligand 10 129 7.14 CCL5 chemokine (C-C motif) ligand 5 118 1.12 CCL5 chemokine (C-C motif) ligand 5 115 1.01 OASL 2'-5'-oligoadenylate synthetase-like 83.3 9.52 CCL8 chemokine (C-C motif) ligand 8 78.5 3.25 IDO1 indoleamine 2,3-dioxygenase 1 76.3 3.5 IFI27 interferon, alpha-inducible