Chronic Hyponatremia Causes Neurologic and Psychologic Impairments

BASIC RESEARCH www.jasn.org

† Haruki Fujisawa,* Yoshihisa Sugimura,* Hiroshi Takagi,* Hiroyuki Mizoguchi, ‡ Hideyuki Takeuchi, Hisakazu Izumida,* Kohtaro Nakashima,* Hiroshi Ochiai,* † | Seiji Takeuchi,* Atsushi Kiyota,* Kazuya Fukumoto, Shintaro Iwama,*§ Yoshiko Takagishi, | | Yoshitaka Hayashi, Hiroshi Arima,* Yukio Komatsu,¶ Yoshiharu Murata, and Yutaka Oiso*

*Department of Endocrinology and Diabetes, Nagoya University Graduate School of Medicine, Nagoya, Japan; †Futuristic Environmental Simulation Center, Research Institute of Environmental Medicine, Nagoya University, Nagoya, Japan; ‡Department of Neuroimmunology, Research Institute of Environmental Medicine, Nagoya University, Nagoya, Japan; §Research Center of Health, Physical Fitness and Sports, Nagoya University, Nagoya, | Japan; Department of Genetics, Research Institute of Environmental Medicine, Nagoya University, Nagoya, Japan; and ¶Department of Neuroscience, Research Institute of Environmental Medicine, Nagoya University, Nagoya, Japan

ABSTRACT Hyponatremia is the most common clinical electrolyte disorder. Once thought to be asymptomatic in response to adaptation by the brain, recent evidence suggests that chronic hyponatremia may be linked to attention deficits, gait disturbances, risk of falls, and cognitive impairments. Such neurologic defects are associated with a reduction in quality of life and may be a significant cause of mortality. However, because underlying diseases such as adrenal insufficiency, heart failure, liver cirrhosis, and cancer may also affect brain function, the contribution of hyponatremia alone to neurologic manifestations and the underlying mechanisms remain unclear. Using a syndrome of inappropriate secretion of antidiuretic hormone rat model, we show here that sustained reduction of serum sodium ion concentration induced gait disturbances; facilitated the extinction of a contextual fear memory; caused cognitive impairment in a novel object recognition test; and impaired long-term potentiation at hippocampal CA3–CA1 synapses. In vivo microdialysis revealed an elevated extracellular glutamate concentration in the hippocampus of chronically hyponatremic rats. A sustained low extracellular sodium ion concentration also decreased glutamate uptake by primary astrocyte cultures, suggesting an underlying mechanism of impaired long-term potentiation. Furthermore, gait and memory performances of corrected hyponatremic rats were equivalent to those of control rats. Thus, these results suggest chronic hyponatremia in humans may cause gait disturbance and cognitive impairment, but these abnormalities are reversible and careful correction of this condition may improve quality of life and reduce mortality.

J Am Soc Nephrol 27: 766–780, 2016. doi: 10.1681/ASN.2014121196

Hyponatremia is the most common clinical elec- attention deﬁcits,6 gait disturbances,6 ariskof trolyte disorder.1,2 Symptoms of hyponatremia fracture associated with falls,7,8 and cognitive depend chieﬂy on its magnitude and rapidity of onset.3 Acute hyponatremia can cause neurologic Received December 9, 2014. Accepted May 12, 2015. complications and death as a result of osmotically Published online ahead of print. Publication date available at 4 induced cerebral edema. On the other hand, www.jasn.org. chronic hyponatremia has been considered Correspondence: Dr. Yoshihisa Sugimura, Department of En- asymptomatic because the brain can successfully docrinology and Diabetes, Nagoya University Graduate School adapt to hyponatremia that is associated with of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550, hypo-osmolarity.5 However, recent evidence sug- Japan. Email: [email protected] gests that chronic hyponatremia may be linked to Copyright © 2016 by the American Society of Nephrology

766 ISSN : 1046-6673/2703-766 J Am Soc Nephrol 27: 766–780, 2016 www.jasn.org BASIC RESEARCH impairments.9 Furthermore, in Study of Ascending Levels of RESULTS Tolvaptan in Hyponatremia (SALT)-1 and SALT-2 trials, correcting chronic hyponatremia improved self-assessed mental Induction of Chronic Hyponatremia health status.10 These neurologic impairments are associated Continuous injections of the vasopressin V2 receptor agonist, with a reduction of quality of life and may be a significant 1-deamino-8-D-arginine vasopressin (dDAVP) and liquid diet cause of mortality. However, because underlying diseases feeding were used to induce hyponatremia in rats. A decreased such as adrenal insufficiency, heart failure, liver cirrhosis, serum [Na+]of121.3360.93 mEq/l in the moderate and cancer may affect brain function, the contribution of hyponatremia group (dDAVP was administered at a rate of hyponatremia itself to neurologic manifestations remains 0.3 ng/h) and 111.3361.54 mEq/l in the severe hyponatremia unknown. group (dDAVP was administered at a rate of 0.7 ng/h), as Brain cells can adapt to hyponatremia. After an acute measured on day 6 after the start of dDAVP injections, was noted decrease in external osmolality, cells will initially swell, as a (Figure 1, A and B). Body weight was comparable among the result of water movement into the cells along an osmotic three groups (Figure 1C). We measured the apparent diffusion gradient. Very soon thereafter, a process known as volume coefficient (ADC) using magnetic resonance imaging (MRI) to regulatory decrease begins, in which intracellular solutes rule out brain cell swelling in chronically hyponatremic rats. (electrolytes and organic osmolytes) are extruded together MRI analysis revealed no significant difference in ADC between with osmotically obligated water.5 Glutamate, a known major control and chronically, severely hyponatremic rats, whereas the excitatory neurotransmitter, is one such organic osmolyte that ADC of acutely hyponatremic rats (a serum [Na+] of 113.256 is extruded into the extracellular space during cellular adap- 1.21 mEq/l) was significantly decreased as compared with the tation to hyponatremia.5 In fact, under acute hypo-osmotic former two groups (Figure 1D). This meant that the brain water conditions, the brain’s extracellular glutamate concentration content of chronically hyponatremic animals could not be distin- is increased.11 guished from that of controls with the methods used. In a chronically hyponatremic state, as a result of adaptation to hyponatremia, brain volume normalizes Chronic Hyponatremia Induces Gait Disturbances completely.12 However, the brain content of glutamate re- To investigate the influence of chronic hyponatremia on gait in portedly decreases by 38.6% after 14 days’ sustained hypo- detail, we performed CatWalk automated gait analysis.14 As natremia in rats,12 which suggests that synaptic excitatory seen in the movie (Supplemental data), moderately or severely neurotransmissions are affected by chronic hyponatremia.5 hyponatremic rats with chronic disease seemed to walk with The effect of chronic hyponatremia on neurotransmission, larger alternating, lateral trunk movements. Footprint images however, remains unknown. Furthermore, the extracellular suggested moderately and severely hyponatremic rats had a glutamate concentration in a chronically hyponatremic smaller stride, wider-based stance, and separated front and state remains unquantified. The extracellular glutamate hind paw prints as compared with control rats (Figure 2A). concentration must be kept low to maintain a high signal- Quantitative analysis of footprint patterns showed moderately to-noise ratio in synaptic and extrasynaptic transmissions and severely hyponatremic rats displayed a significantly and to prevent glutamate neurotoxicity resulting from ex- shorter stride length (Figure 2B) and a significantly wider cessive activation of glutamate receptors.13 The mechanism base of support of hind paws as compared with control rats responsible for the long-term maintenance of a low extra- (Figure 2C). In addition, hyponatremic rats demonstrated a cellular glutamate concentration is astrocytic glutamate significantly larger duty cycle for front paws (Figure 2D) uptake, in which the sodium-dependent glial glutamate reflecting a significantly smaller support two gait phase (the transporters, GLT-1 and GLAST, play a critical role.13 Con- relative duration of simultaneous contact with the glass plate sidering that chronic hyponatremia reduces the brain’sglu- of two paws) and a significantly larger support three plus four tamate content by about 40%, it is possible that chronic gait phase (that of three or four paws) (Figure 2E). These hyponatremia affects glial glutamate uptake and glutamate findings suggest that chronic hyponatremia causes ataxic gait. metabolism. In this study, we developed a syndrome of inappropriate Chronic Hyponatremia Causes Memory Impairment antidiuretic hormone secretion rat model with different serum We evaluated the effect of chronic hyponatremia on recogni- sodium ion concentrations ([Na+]). Then, we showed that a tion memory using a novel-object recognition test (NORT). reduction in serum [Na+] in chronic hyponatremia induces Therewerenosignificant differences in exploratory times gait disturbances, memory impairment and decreased long- among the three groups (Figure 3A). During training sessions, term potentiation (LTP) at hippocampal CA3–CA1 synapses all three groups spent approximately equal time with each as an underlying mechanism of memory impairment. Fur- object (Figure 3B). However, during retention sessions, the thermore, the extracellular glutamate concentration was ele- preference index of moderately and severely hyponatremic vated in the chronically hyponatremic rat brain through rats was significantly decreased as compared with control decreased astrocytic glutamate uptake, which seems to be rats, indicating that chronic hyponatremia impairs recogni- the cause of decreased LTP. tion memory (Figure 3B).

J Am Soc Nephrol 27: 766–780, 2016 Chronic Hyponatremia Affects Central Nervous System 767 BASIC RESEARCH www.jasn.org

Figure 1. Hyponatremia without brain cell swelling was induced in rats. (A) Experimental protocol. Injection of saline (control group) or 1- deamino-8-D-arginine vasopressin (dDAVP) (hyponatremia group) was started on day 0 and rats were fed a liquid diet from day 2. Experiments were performed after day 6. (B) Serum sodium concentrations in control (n=11),moderatelyhyponatremic(n=9) and severely hyponatremic (n=9) rats. One-way ANOVA followed by Fisher’sprojectedleastsignificant difference test; **P,0.01. (C) Body weights in control (n=9), moderately hyponatremic (n=8) and severely hyponatremic (n=6) rats over time. Two-way ANOVA. (D) Ratio of brain apparent diffusion coefficient values before and after induction of hyponatremia (control n=6, chronically severe hyponatremia n=6, acute hyponatremia n=8). One-way ANOVA followed by Fisher’sprojectedleastsignificant difference test; *P,0.05, **P,0.01. NS, not significant.

We subsequently measured associative memory using a control rats, but the difference was extremely small (Figure contextual fear conditioning test. Moderately and severely 4A); by day 23, however, serum [Na+] was similar between the hyponatremic rats showed fewer freezing responses when they two groups (Figure 4A). dDAVP-infused normonatremic rats were placed in the conditioning cage, a day after delivery of foot showed no significant changes when compared with control shocks, indicating that chronic hyponatremia impairs asso- rats in the NORT, contextual fear conditioning and open field ciative memory (Figure 3C). tests (Figure 4, B–G). These results indicate that subcutane- To rule out the difference in locomotor activity among the ously injected dDAVP did not affect the behaviors tested in the three groups, we performed an open field test. There was no present study and that it is therefore chronic hyponatremia significant difference in the number of total crossings (the sum itself that induces memory impairment. of inner and outer sector crossings; Figure 3D) among the three groups indicating that chronic hyponatremia does not affect Chronic Hyponatremia Impairs Hippocampal CA3–CA1 locomotor activity. However, unexpectedly, both moderately Synaptic Plasticity and severely hyponatremic rats showed a significantly reduced Then, we focused on chronic hyponatremia-induced memory number of inner sector crossings (Figure 3E) and time in the impairment to elucidate the mechanisms underlying the inner sector (Figure 3F), suggesting that chronic hyponatremia behavioral abnormalities. It has been shown by others that increases anxiety levels. LTP in the hippocampal CA1 region is involved in the Many studies indicate that vasopressin per se influences formation of certain types of memory.21 We therefore studied memory and anxiety.15–19 Although most of the central ac- high frequency stimulation (HFS)-induced LTP at hippocam- tions of vasopressin are mediated via the V1b receptor, some pal CA3–CA1 synapses in chronic, moderately hyponatremic clinical studies have suggested a V2 receptor mediated effect rats in vivo. on memory.20 Therefore, to exclude any possible direct effect At 60–69 minutes after HFS, the initial falling slope of field of subcutaneously injected dDAVP on behavior, we induced excitatory postsynaptic potential (fEPSP) of hyponatremic dDAVP-infused normonatremia in rats by injecting dDAVP at rats was significantly smaller than that observed in control 0.7 ng/h and feeding them a high salt, liquid diet formula. Such rats (Figure 5, A and B). The input-output curve, used as a rats’ serum [Na+] on day 6 was significantly lower than that of measure of basal synaptic transmission, was not significantly

768 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 766–780, 2016 www.jasn.org BASIC RESEARCH

Figure 2. CatWalk automated gait analysis revealed chronic hyponatremia-induced gait disturbances. (A) Representative footprint images. (B–E) Quantitative analysis of footprint patterns in control (n=9), moderately hyponatremic (n=8) and severely hyponatremic (n=6) rats. (B) Stride length; (C) base of support; (D) duty cycle; and (E) support. One-way ANOVA followed by Fisher’s projected least signiﬁcant difference test; *P,0.05, **P,0.01 versus control.

altered in hyponatremic as compared with control rats (Figure We subsequently hypothesized that decreased astrocytic 5C). In addition, paired-pulse facilitation was indistinguish- glutamate uptake may cause an increase in extracellular able between the two groups, suggesting that the presynaptic glutamate concentration because astrocytic glutamate uptake release probability is not altered in hyponatremic rats (Figure is the mechanism responsible for the long-term maintenance 5D). These results indicate that chronic hyponatremia of low extracellular concentrations of glutamate.13 We there- decreases the magnitude of LTP at CA3–CA1 synapses without fore evaluated what effect a chronic reduction in extracellular + 3 affecting basal synaptic transmission. [Na ] has on astrocytic glutamate uptake by measuring L-[ H] glutamate uptake by primary mouse astrocytes cultured in Chronic Hyponatremia Increases Extracellular medium in which [Na+] was gradually decreased to 117 Glutamate Concentration by Decreasing Astrocytic mEq/l over 6 days, and which was then maintained hypo- Glutamate Uptake natremic for at least a further 2 days. As shown in Figure 3 An elevated extracellular glutamate concentration has been 7A, L-[ H] glutamate uptake by astrocytes was significantly shown to impair LTP induction.22,23 Acute hypo-osmotic decreased after long-term culturing in hyponatremic me- conditions stimulate glutamate release from neurons and as- dium. In addition, after gradual correction of hyponatremia, 3 trocytes24 and increase the extracellular glutamate concentra- L-[ H] glutamate uptake was comparable to that of controls tion of the cerebral cortex as demonstrated by microdialysis.11 (Figure 7A). However, the extracellular glutamate concentration of The glutamate transporters GLT-1 and GLAST are re- the chronically hyponatremic brain remains unknown. We ported to play a crucial role in removing glutamate from therefore investigated, by microdialysis, whether chronic the synaptic cleft.25 We therefore measured the GLT-1 and hyponatremia increases the extracellular glutamate con- GLAST mRNA expression levels of astrocytes cultured in hy- centration of the hippocampal CA1 region (Figure 6A). As ponatremic medium and found these to be significantly de- showninFigure6B,thesteadystate extracellular glutamate creased compared with those of astrocytes cultured in control concentration of the hippocampal CA1 region in chronically medium (Figure 7, B and C). The results obtained in vitro using hyponatremic rats was significantly increased compared with cultured mouse astrocytes may not translate into the in vivo that of control rats. situation as these cells would differ from in vivo astrocytes.

J Am Soc Nephrol 27: 766–780, 2016 Chronic Hyponatremia Affects Central Nervous System 769 BASIC RESEARCH www.jasn.org

Figure 3. Chronic hyponatremia impairs memory without affecting locomotor activity. (A and B) Performance of control (n=11), moderately hyponatremic (n=8) and severely hyponatremic (n=7) rats in novel-object recognition tests (NORTs); (A) exploratory times and (B) exploratory preferences. (C) The freezing performance of control (n=9), moderately hyponatremic (n=8) and severely hyponatremic (n=6) rats during contextual fear conditioning tests. (D–F) Performance of control (n=11), moderately hyponatremic (n=9) and severely hyponatremic (n=9) rats in open ﬁeld tests. The number of (D) total and (E) inner sector crossings. (F) Time in the inner sector. One-way ANOVA followed by Fisher’s projected least signiﬁcant difference test; *P,0.05, **P,0.01 versus control.

Therefore, we evaluated GLT-1 and GLAST protein levels in signiﬁcantly decreased compared with that of neurons cul- membrane fractions and total protein lysates (data from total tured in control medium (Figure 8E). These results suggest protein lysates were not shown) derived from the hippocampi that chronic hyponatremia directly induces neuronal dysfunc- and found that the expression of GLT-1 and GLAST proteins in tion by energy loss. moderately hyponatremic rats was comparable to that of control rats (Figure 7, D–G). Gait and Memory Performances of Corrected Hyponatremic Rats are Comparable to those of Control Chronic Hyponatremia Impairs Neuronal Mitochondrial Rats Distribution and Decreases ATP Production Finally, we assessed whether correcting chronic hyponatremia We next evaluated the direct effects of a chronic reduction in restores gait disturbances and memory impairment. We extracellular [Na+] on cultured primary neurons. Neuritic corrected moderately chronic hyponatremia with increasing beading formation, thought to be an early pathologic sign of doses of tolvaptan, a vasopressin V2 receptor antagonist, after neuronal dysfunction,26 was indistinguishable between pri- hyponatremia was maintained for 3–4 weeks. It has been mary neurons cultured in control medium and those cultured shown that this method of administration of tolvaptan grad- in a low sodium concentration (117 mEq/l) (Figure 8, A and ually increased serum [Na+] and did not cause osmotic de- B). In primary neurons cultured in control medium, mito- myelination syndrome in chronically hyponatremic rats.27 In chondria, which were stained by anti-manganese superoxide fact, the serum [Na+] of our tolvaptan-administered rats grad- dismutase (green), were distributed throughout neurites and ually but signiﬁcantly increased from 119.3860.74 mEq/l to the cell body (Figure 8C); however, in primary neurons cul- 135.4660.73 mEq/l (Figure 9A, Supplemental Table 1). Gait tured in hyponatremic medium, mitochondria disappeared performances, locomotor activities, recognition and associa- from neurites, suggesting that chronic hyponatremia impaired tive memory of these corrected hyponatremic rats were equiv- neuritic transport and mitochondrial function (Figure 8D), as alent to those of control rats (Figure 9, B–K) suggesting that previously described.26 In addition, the ATP content of pri- chronic hyponatremia-induced behavioral abnormalities are mary neurons cultured in hyponatremic medium was reversible. In this experiment, we used a separate set of

770 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 766–780, 2016 www.jasn.org BASIC RESEARCH

Figure 4. Continuous 1-deamino-8-D-arginine vasopressin (dDAVP) administration does not directly affect memory and anxiety. (A) Serum sodium concentration of dDAVP injected (n=6) and control (n=6) rats on days 6 and 23. (B and C) The performance of dDAVP injected (n=6) and control (n=6) rats in novel-object recognition tests (NORTs): (B) exploratory time and (C) exploratory preferences. (D) The freezing performance of dDAVP injected (n=6) and control (n=6) rats in contextual fear conditioning tests. (E–G) The performance of dDAVP injected (n=6) and control (n=6) rats in the open ﬁeld test: number of (E) total and (F) inner sector crossings, and (G) time in the inner sector. Student’s t test; **P,0.01 versus control. NS, not signiﬁcant.

corrected animals because repeated determinations of loco- therefore play an important role in hyponatremia-induced motor and neurocognitive tests may be impacted by the rats gait disturbances. having previously taken this test. In relation to the detrimental effects of hyponatremia on memory, our results concur with those of a previous study in which a passiveavoidance test was usedto evaluate memory in a DISCUSSION chronic hyponatremia rat model.27 In our study, we used two behavioral tests of memory, a contextual fear conditioning test Several clinical studies have identified a relationship between and NORT, to evaluate the effect of chronic hyponatremia on chronic hyponatremia and gait disturbances.6,7 However, a memory more definitively. The contextual fear conditioning past animal experiment using the rotarod test failed to dem- test evaluates associative memory and NORTevaluates recog- onstrate an effect of chronic hyponatremia on gait.27 In the nition memory, and they are mainly dependent on the hippo- present study, we used CatWalk because this is more sensi- campus34 and perirhinal cortex,35–37 respectively. Therefore, it tive in measuring gait deficits in some animals than the is suggested that chronic hyponatremia affects several kinds of rotarod test.28 Using CatWalk, we found that chronically memory and a broad range of brain areas related to memory hyponatremic rats displayed findings similar to those seen processing. in Purkinje cell-specificvesicularg-aminobutyric acid The extracellular glutamate concentration of the chroni- transporter knockout29 or atm-deficient mice,30 which ex- cally hyponatremic rat hippocampus was shown to be elevated hibit cerebellar ataxia. The mechanisms underlying compared with that of control rats. An excessive extracellular hyponatremia-induced gait abnormalities are currently un- glutamate concentration has been demonstrated to impair LTP known. However, a mutation in the glutamate transporter without affecting basal glutamatergic transmission in GLT- GLAST, which is mainly expressed in the cerebellum, has 1,22,38 aquaporin-423 and glia-specific tuberous sclerosis been reported to decrease glutamate uptake and cause epi- complex-1 knockout mice,39 in which the expression of glutamate sodic ataxia in human subjects.31,32 In addition, GLASTmu- transporters is decreased. One postulated mechanism of LTP im- tant mice exhibited mild motor discoordination.33 In light pairment may be excessive activation of N-methyl-D-aspartate of such findings, the elevated extracellular glutamate con- (NMDA) receptors during HFS because impaired LTP is restored centrations observed in our hyponatremic rat model may by the presence of a low concentration of NMDA antagonist.22

J Am Soc Nephrol 27: 766–780, 2016 Chronic Hyponatremia Affects Central Nervous System 771 BASIC RESEARCH www.jasn.org

GLAST both contain functional cysteine residues that are sensitive to the oxidative formation of cysteine bridges and cause the inhibition of glutamate flux through the transporters.44 GLT-1 (+/2) mice, a possible model of mild glutamatergic hyperactivity, show impaired contextual fear conditioning test performances in accordance with our results; however, they also show reduced levels of anxiety contrary to those seen in our hyponatremic rat.45 This suggests that the increased anxiety levels induced by chronic hyponatremia are not caused by increased extracellular glutamate. Therefore, further research is required to elucidate the exact mechanisms involved in elevated anxiety levels. Several reports indicated that total brain water content, measured by weighing be- Figure 5. Chronic hyponatremia impairs long-term potentiation (LTP) in hippo- fore and after desiccation, was not signif- campal CA3–CA1synapses.(AandB)ThemagnitudeofLTPinducedinmoder- icantlydifferent between hyponatremic and atelyhyponatremicrats(n=12) is significantly smaller as compared with control control rats.46,47 In contrast, Verbalis and (n=10) rats. (A) Plots of normalized field excitatory postsynaptic potential (fEPSP) Gullans reported that hyponatremic rats – slopes. (B) The average percentage change of fEPSP slopes before and 60 69 developed an element of brain edema.12 ’ , minutes after high frequency stimulation (HFS). Student s t test; *P 0.05 versus Such a contrast in findings is likely to be control. (C) Input-output curve (input is given by the amplitude of stimulus in- due to differences in the periods of chronic tensity applied in the Schaffer collateral/commissural pathway and output is given by the amplitude of fEPSP) of moderately hyponatremic (n=12) and control (n=10) hyponatremia. In order to evaluate rats. Two-way ANOVA. (D) Paired-pulse ratio of moderately hyponatremic (n=12) whether our hyponatremic rats show brain and control (n=10) rats. The graph shows the averaged ratio of consecutive fEPSP cell swelling, we measured ADC. A decrease amplitudes (second fEPSP amplitude/first fEPSP amplitude). Student’s t test; NS, in ADC is believed to be the result of water not significant. moving into the intracellular compartment in acute cerebral infarction.48 It has been reported that the plots of ADC versus total Another possible mechanism may be the desensitization of brain water showed a statistically significant, inverse linear NMDA receptors by ambient extracellular glutamate. A substan- relationship between ADC and increasing brain water.49 tial portion of all ionotropic glutamate receptor subtypes (espe- Several lines of evidence also showed that an approximately cially NMDA receptors) are tonically desensitized by ambient 10% decrease in ADC values is observed in the acute hypona- extracellular glutamate.40 tremic rat brain.49,50 ADC of the brains of severely hypona- In an acute hyponatremic state, glutamate is extruded as tremic rats was comparable to that of controls, indicating that one of several organic osmolytes that reduce cell volume. our chronically hyponatremic rat model did not develop brain However, this hypo-osmolarity-elicited glutamate efflux is cell swelling. rapidly activated and then inactivated.41 Our results indicate In addition to its effect on astrocytes, our study suggests that a chronic reduction of extracellular [Na+] decreases as- chronic hyponatremia also directly impairs mitochondrial trocytic glutamate uptake. Glutamate uptake can be regulated distribution and decreases the ATP content of neurons, by both changes in transporter expression and activity.42 In findings that are known to be induced by excessive gluta- thelightofthecomparableproteinexpressionlevelsofGLT-1 mate.26 Therefore, the direct effects of a reduction in extracel- and GLAST in control and chronic hyponatremic rats, the lular [Na+] on neurons is thought to reinforce neurologic impairment of glutamate uptake seen in chronic symptoms in conjunction with elevated extracellular gluta- hyponatremia is thought to be caused by a decrease in mate levels in the chronically hyponatremic rat. transporter activity. One possible reason for the decrease in Some points remain as matters to be evaluated fur- transporter activity is a decrease in extracellular [Na+]itself ther. Firstly, the threshold of serum [Na+] that induces gait because these transporters utilize the ion gradient of sodium and memory impairments remains uncertain. Secondly, as an energy source for transport activity.13 Another possible differences in effects on the central nervous system by var- reason is hyponatremia-induced oxidative stress.43 GLT-1 and ious methods of correction of chronic hyponatremia are

772 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 766–780, 2016 www.jasn.org BASIC RESEARCH

Male Sprague–Dawley rats (body wt, 160– 230 g; Chubu Science Materials, Nagoya, Japan) were housed in a standard animal facility kept at constant temperature (23°C) and on a 12/12- hour light/dark cycle. Rats had ad libitum access to standard chow and tap water until the induction of hyponatremia according to previously described methods.51–53 Briefly, osmotic mini- pumps (Alzet model 2002 or 2004; DURECT Corporation, Cupertino, CA) containing dDAVP (10 mg/ml; Kyowa Hakko Kogyo Co. Ltd., Tokyo, Japan) were implanted subcutaneously into rats under ether anesthesia. For the moderately or severely hyponatremic groups, Figure 6. Chronic hyponatremia increases the extracellular glutamate concentration of dDAVP was injected continuously at rates of the hippocampus CA1 region in vivo. (A) The area delineated by a dashed line shows 0.3 or 0.7 ng/h, respectively. After 2 days of the prior location of an intra-CA1 microdialysis probe. Scale bar, 500 mm. (B) The extracellular glutamate concentration of control (n=7) and moderately hyponatremic dDAVP administration, rats were water loaded (n=7) rats as measured by microdialysis. For each rat, the average of six successive by substituting their daily feed with a liquid for- fractions is shown after the collection of baseline fractions for 2 hours. Student’s t test; mula (Isocal plus; Mead-Johnson, Evansville, *P,0.05 versus control. IN) and 10% glucose mixed at a 1:1 ratio. Con- trol rats were implanted with osmotic mini- pumps containing saline and fed a liquid unknown. In our study, we corrected chronic hyponatremia formula. More than 6 days after starting either dDAVP or saline in- with tolvaptan because this method is reported to correct jections, rats were used for experiments as described in the following hyponatremia stably without causing osmotic demyelin- sections. ation syndrome in rats.27 However, in clinical settings, To correct hyponatremia, tolvaptan mixed in a powder diet other methods (i.e., water restriction, high salt diet, urea, (delivered by Otsuka Pharmaceutical Co. Ltd., Tokushima, Japan) was etc.)maybemoresuitableasappropriatetreatment. administered orally by dose titrations after moderate hyponatremia Thirdly, reversibility should be evaluated by more rigorous was maintained by injecting dDAVP at a rate of 0.3 ng/h and feeding methods. It would be preferable to compare behaviors be- them a liquid diet formula for 3–4 weeks. Administered doses of fore and after the induction of chronic hyponatremia, and tolvaptan were as follows (day 1 was defined as the first day of the after the correction of chronic hyponatremia, in the same administration of tolvaptan): 0.25 (day 1), 0.5 (day 2), 1.0 (day 3), 2.0 animals. However, it is probable that some tests such as (day 4), 4.0 (day 5), and 8.0 (days 6 onwards) mg/kg.27 Behavioral those of contextual fear conditioning, which includes elec- tests were performed after day 12. tric shock, may affect the next behavior analysis, and the Normonatremic dDAVP-infused rats were induced by injecting body weight gain during a long-term experiment for revers- them with dDAVP at a rate of 0.7 ng/h and feeding them a high salt ibility would modify the results of gait or memory tests. In liquid diet formula (Isocal plus, 10% glucose and 3% saline solution addition, we did not directly compare animals with correc- mixed at a 1:1 ratio). The final [Na+] of this high salt liquid diet ted hyponatremia to animals with uncorrected hyponatre- formula was estimated to be 314 mEq/l. mia, and without such a comparison cannot say definitively Acute hyponatremia was induced in rats by a 15 ml dextrose that chronic hyponatremia-induced behavioral abnormali- solution (140 mmol/l) intraperitoneally and 1 mg dDAVP subcutane- ties are reversible. ously, followed by an additional dose of 10 ml dextrose intraperito- Our results will encourage further research on the effect of neally and 1 mg dDAVP subcutaneously after 40 minutes.54 chronic hyponatremia on human subjects and treatment for Blood samples for the determination of serum [Na+]wereob- chronic hyponatremia, the importance of which has been tained from the tail vein under light ether anesthesia. Serum [Na+] constantly overlooked. was measured at LSI Medience Corporation Co. Ltd., Tokyo, Japan.

Behavioral Analysis CONCISE METHODS CatWalk CatWalk is a video-based analysis system to assess gait in voluntarily Animal Experiments walking mice or rats (Noldus Information Technology, Wageningen, All of the procedures were performed in accordance with the The Netherlands).14 CatWalk was performed 11 days after starting institutional guidelines for animal care at Nagoya University, Japan, dDAVP injections. Animals were placed in a corridor and allowed to which, in turn, conform to the National Institutes of Health animal move freely across a glass plate walkway. When rat paws made contact care guidelines. on the glass plate, light became reﬂected downward. The illuminated

J Am Soc Nephrol 27: 766–780, 2016 Chronic Hyponatremia Affects Central Nervous System 773 BASIC RESEARCH www.jasn.org

of a square area with gray walls (100 cm width, 45 cm height) and was set in a dark, sound- attenuated room. The floor of the field was divided into 25 identical areas so that the animal’s ambulation could be precisely measured. The field was divided into inner (50 cm square) and outer sectors. An LED light was positioned 190 cm above the center of the floor of the apparatus. Each rat was placed in the center of the open field. The rats were allowed to explore the environment freely for 10 minutes. During this time, the ambulation of the rats was measured by counting the number of times that the animals crossed from one area to another. We also measured the time spent visiting the inner sector.

NORT NORTwas carried out as described previously56 with minor modifications between day 18 and day 22. We used the open field described above as the experimental apparatus. The apparatus was located in a sound-attenuated room and was illuminated with an LED light. In a standard procedure, NORT consisted of Figure 7. Chronic hyponatremia decreased astrocytic glutamate uptake. (A) (Left) three sessions: habituation, training, and re- 3 L-[ H] glutamate uptake by primary mouse astrocytes cultured in control (n=6) or tention. Each rat was individually habituated to 3 hyponatremic medium (n=6). (Right) L-[ H] glutamate uptake by primary mouse the apparatus, with 10 minutes of exploration in astrocytes cultured in control (n=6) or corrected hyponatremic medium (n=6). (B the absence of objects for three consecutive days andC)ExpressionofGLT-1(B)andGLAST(C) mRNA in primary astrocytes cultured (habituation session, days 1–3). During the in control (n=7) or hyponatremic (n=7) medium was determined by quantitative training session, two novel objects were sym- PCR. (D and F) Western blot analysis of GLT-1 (D) and GLAST (F) in hippocampal metrically fixed to the floor of the apparatus, membrane fractions from control (n=6) and moderately hyponatremic (n=5) rats. (E 25 cm from the walls, and each animal was al- and G) Quantification of the data presented in D (E) and F (G). Student’s t test; *P,0.05, **P,0.01 versus control. NS, not significant. lowed to explore the apparatus for 10 minutes (day 4). The objects were constructed from a plastic cup, a plastic ink bottle, and a sake bottle, contact areas were recorded with a CCD camera underneath the glass which were different in shape and color but similar in size. An animal plate to visualize the different paw contacts. From these data, multiple was considered to be exploring the object when its head was facing the parameters were calculated. For instance, in this study, we focused on object and/or it was touching or sniffing the object. The time spent stride length, base of support, duty cycle and support. A base of support exploring each object was recorded, and the rats were immediately was defined as the average width between either the front paws or the returned to their home cages after training. The animals were placed hind paws. A duty cycle was defined as the stance duration as a percent- back into the same apparatus 24 hours after each training session age of the step cycle duration, i.e., stance phase/(stance+swing phases) (retention session). During the retention session, one of the two fa- 3100, where the stance phase is measured as the duration, in seconds, of miliar objects used during the training session was replaced with a contact of a paw with the glass plate, and the swing phase is measured as novel object. The animals were then allowed to explore freely for the duration, in seconds, of no contact of a paw with the glass plate. 5 minutes and the time spent exploring each object was recorded. Support two was defined as the relative duration of simultaneous con- Throughout the experiments, the objects were used in a counter- tact with the glass plate of two paws, and support three plus four as of balanced manner in terms of their physical complexity and emo- that three or four paws. The animals were allowed to traverse the walk- tional neutrality. During each retention session, a preference index, way as many times as needed to obtain at least three smooth crossings which is a ratio of the amount of time spent exploring the novel (without stops or hesitations).55 object to the total time spent exploring both objects, was used to measure cognitive function. In the training session, the preference Open field test index was calculated as the ratio of the time spent exploring the The open field test was carried out as described previously, with minor object that was replaced by a novel object in the retention session modifications56 on day 12. The open field used in this study consisted to the total exploring time.

774 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 766–780, 2016 www.jasn.org BASIC RESEARCH

Figure 8. Chronic hyponatremia influences neurons directly. (A and B) Neurons cultured in control (A) or hyponatremic (B) medium were stained with anti-microtubule-associated protein 2 (MAP2). Scale bar, 50 mm. (C and D) Neurons were stained with anti-neuron-specific tubulin bIII isoform (bIII-tubulin) (red), anti-manganese superoxide dismutase (MnSOD; a mitochondrial marker, green) and Hoechst (blue). Neurons were cultured in control (C) or hyponatremic (D) medium. Samples were visualized by immunofluorescence microscopy and representative micrographs shown. Note that neurons cultured in control medium displayed mitochondria throughout their cell body and neurite. On the other hand, neurons cultured in hyponatremic medium lost mitochondria in their neurites. Scale bar, 50 mm. (E) Intracellular ATP levels (control n=4; hyponatremic medium n=4) were measured by luminometric assay. Student’s t test; **P,0.01 versus control.

Contextual fear conditioning test Haer & Co., Bowdoinham, ME) in response to stimulation of the A contextual fear conditioning test was performed in accordance with Schaffer collateral/commissural pathway using a pair of bipolar previous reports56 with minor modifications on days 27–28. Freezing stimulating tungsten electrodes (diameter, 100 mm; interpolar dis- behavior, as indicated by a rat’s head, arms and legs not moving, was tance, about 200 mm). Electrode implantation sites were deter- measured by stop-watch. For measuring basal levels of a freezing mined using stereotaxic coordinates relative to the bregma, with response (preconditioning phase), rats were individually placed the recording site located 3 mm posterior and 2 mm lateral of the in a conditioning cage (a transparent Plexiglas box, 30330345 cm, midline, and the stimulating electrode 4 mm posterior to the W3L3H) for 2 minutes. For training (conditioning phase), rats were bregma and 3 mm lateral of the midline. The stimulating electrodes placed in the conditioning cage, and a foot shock of 0.6 mA was de- and the recording electrodes were slowly lowered through the cortex livered by a shock generator (Brain Science Idea Co. Ltd., Osaka, and the upper layers of the hippocampus into the CA1 region to a Japan). This procedure was repeated four times at 15-second inter- depth of 2.2 mm below the cortex surface and were positioned to vals. Contextual tests were carried out one day after fear conditioning; record maximal fEPSPs. rats were placed in the conditioning cage and the freezing response In all experiments test EPSPs were evoked at a frequency of 0.1 Hz, was measured for 2 minutes. and an input-output curve (stimulus intensity versus EPSP amplitude) was plotted for each experiment at this test frequency. For the Electrophysiological analysis test EPSPs, the stimulation intensity was adjusted to give an EPSP Electrophysiological analysis was performed as described previously57 amplitude of 30–40% of maximum. The intensity was increased to with minor modifications. Rats were anesthetized with urethane give an EPSP of 60–70% maximum amplitude during stimulation to (ethyl carbamate, 1.5 mg/kg, intraperitoneally) and then placed in a induce LTP.58 LTP was induced by applying HFS (five trains of 100 stereotaxic frame. A local anesthetic, lidocaine, was administered at pulses at 100 Hz delivered at 120-second intervals) to the Schaffer pressure points caused by the stereotaxic frame and around surgical collateral/commissural pathway.58 LTP was measured as a percentage incisions. Body temperature was maintained at about 37°C. fEPSPs of the baseline EPSP slope recorded over the 15-minute period before were recorded from the CA1 stratum radiatum of either hippocampal HFS. Paired-pulse facilitation was measured at an interstimulus in- hemisphere using a tungsten electrode (300–500 KV;Frederick terval of 50 ms.

J Am Soc Nephrol 27: 766–780, 2016 Chronic Hyponatremia Affects Central Nervous System 775 BASIC RESEARCH www.jasn.org

Figure 9. Gait and memory performances of corrected hyponatremic rats were equivalent to those of control rats suggesting that chronic hyponatremia-induced behavioral abnormalities are reversible. (A) Serum sodium concentration of control (n=14) and corrected hyponatremic (n=13) rats. Two-way ANOVA followed by Tukey’stest;**P,0.01 versus corrected hyponatremia on day 6. (B–E) Quantitative analysis of footprint patterns in control (n=8) and corrected hyponatremic (n=8) rats; (B) stride length; (C) base of support; (D) duty cycle and (E) support. (F and G) Performance of novel-object recognition tests (NORTs) in control (n=11) and corrected hyponatremic (n=11) rats; (F) exploratory time; (G) exploratory preference. (H) The freezing performance of control (n=11) and corrected hyponatremic (n=11) rats in contextual fear conditioning tests. (I–K) Performance of control (n=11) and corrected hyponatremic (n=11) rats in open ﬁeld tests; number of (I) total and (J) inner sector crossings, and (K) time in the inner sector. Student’s t test.

776 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 766–780, 2016 www.jasn.org BASIC RESEARCH

Microdialysis In order to induce hyponatremia gradually, after confluent cell In vivo microdialysis was performed as described previously59,60 with growth, half of the medium was replaced every 2 days with normal minor modifications. Rats were anesthetized with sodium pentobar- DMEM (control group) or hyponatremic ([Na+]=117 mEq/l) DMEM bital before stereotaxic implantation of a guide cannula into the hip- (hyponatremia group). After four medium changes, cells were pocampus CA1 region (AP –3.8, ML +2.0 from the bregma, DV –2.1 cultured in DMEM (control group) or hyponatremic DMEM (hypo- from the skull).61 After 2 days, a dialysis probe (A-I-4–01; 1 mm natremia group) for at least 2 days and used for subsequent experi- membrane length; Eicom, Kyoto, Japan) was inserted through the ments. For neuronal cultures, F-12 with N2 supplement was added to guide cannula. The next day, the dialysis probe was perfused with both normal and hyponatremic DMEM. To correct hyponatremia, artificial cerebrospinal fluid (147 mM sodium chloride, 4 mM after induction of hyponatremia described above, half of the medium potassium chloride, 2.3 mM calcium chloride) at a flow rate of was replaced every 2 days with normal DMEM for four times and cells 1.0 ml/min. Outflow fractions were collected every 10 minutes. were cultured in normal DMEM for 2 days. After the collection of baseline fractions for 2 hours, we measured the levels of glutamate in six successive fractions with a HPLC Glutamate Uptake Assay system (Eicom). Glutamate uptake assays were performed as described previously63 with minor modifications. Briefly, control and hyponatremic astro- Magnetic Resonance Imaging cytes grown in 12-well mutidishes were washed twice and incubated MRI data were acquired by an MRmini SA device equipped with a 1.5- with either prewarmed Krebs–Ringer solution (125 mM sodium Tesla permanent magnet made of Nd-Fe-B material (DS Pharma chloride, 2.5 mM potassium chloride, 1.25 mM monosodium phos- Biomedical Co. Ltd., Osaka, Japan). Anesthesia was induced and phate, 2 mM calcium chloride, 1 mM magnesium chloride, 25 mM maintained with 1.0% isoflurane. Sets of diffusionweighted spin-echo sodium bicarbonate, 25 mM glucose) or prewarmed hyponatremic images were acquired using a repetition time of 2000 ms, echo time of Krebs–Ringer solution (91 mM sodium chloride, 2.5 mM potassium 69 ms and b-values of 0, 45, 170, 380, 660 and 1000 s/mm2.Thefield of chloride, 1.25 mM monosodium phosphate, 2 mM calcium chloride, view was 30 mm 3 60 mm and the data matrix was 128 3 256 for ten 1 mM magnesium chloride, 25 mM sodium bicarbonate, 25 mM slices 2.0 mm thick throughout the cortex. An ADC map was calcu- glucose), respectively. The glutamate uptake assay was initiated by 3 lated by MRI Analysis Calculator v. 1.0, and the ADC value was mea- adding a mixture of nonradioactive glutamate and 0.25 mCi/ml L-[ H] sured in two slices comprising the hippocampus and cerebral cortex. glutamate (specific activity, 51.1 Ci/mmol; PerkinElmer, Waltham, MA) to the reaction media to provide a final concentration of 100 nM Cell Culture glutamate. The reaction was continued for 10 minutes at 37°C and Astrocytes were prepared from the primary mixed glial cell cultures of terminated by washing three times with ice-cold PBS, immediately newborn C57BL/6 mice (Chubu Science Materials), which contained followed by cell lysis in 1 ml of 1 N sodium hydroxide. An aliquot of both astrocytes and microglia, as previously described with minor 750 ml was taken out into scintillation vials and neutralized with 75 ml modifications.62 Astrocytes and microglia made up the primary of 10 N hydrochloric acid. After adding 3 ml of liquid scintillation mixed glial cell cultures of newborn C57BL/6 mice from which mi- fluid, the radioactivity was measured using a liquid scintillation croglia were isolated on the 14th day using the shaking off method. counter (LS 6500; Beckman Coulter, Brea, CA). Sample protein The remaining attached layer of the culture contained astrocytes, concentrations were determined by BCA assay (Thermo Fisher which were subsequently purified by repeated trypsinization and re- Scientific, Waltham, MA). Glutamate uptake activity was calculated plating three to four times. Such cultures were more than 95% pure as pmol glutamate/milligram protein/minute after correcting for when examined by indirect immunofluorescence staining with an protein levels. anti-glial fibrillary acidic protein (rabbit monoclonal; EMD Milli- pore, Billerica, MA). Cultures were maintained in Dulbecco’smod- Quantitative PCR ified eagle medium (DMEM) supplemented with 10% fetal bovine Total RNA was extracted from cultured astrocytes using an RNeasy serum, 5 mg/ml bovine insulin, and 0.2% glucose. Mini Kit (Qiagen, Venlo, The Netherlands), following the manufac- NeuronalcultureswerepreparedfromC57BL/6miceatembryonic turer’s instructions. cDNA was generated by SuperScript II (Invitro- day 17 using a nerve-cell culture system (Sumitomo Bakelite Co. Ltd., gen, Carlsbad, CA). Quantitative PCR was performed on reverse Akita, Japan) as described previously.26 Briefly, cortices were dissected transcription products using Power SYBR Green PCR Master Mix and freed of meninges. Cortical fragments were dissociated into sin- (Applied Biosystems, Foster City, CA) and a Rotor-Gene Q Real- gle cells using dissociation solution, and were resuspended in nerve- Time PCR cycler (Qiagen). Each sample’s mRNA level was normal- cell culture medium (serum-free conditioned medium from 48 hour ized relative to glyceraldehyde-3-phosphate dehydrogenase mRNA rat astrocyte confluent cultures based on Dulbecco’smodified Eagle’s (Table 1). minimum essential medium/F-12 with N2 supplement, Sumitomo Bakelite). Primary neuronal cells were plated on 12-mm Western Blotting polyethyleneimine-coated coverslips (Asahi Techno Glass Corp., Chiba, Membrane protein fractions were prepared using ProteoExtract Japan) in 24-well multidishes at a density of 5 3 104 cells/well. The purity Transmembrane Protein Extraction Kit (EMD Millipore) following of the cultures was more than 95% as determined by NeuN-specific manufacturer’s instructions. Protein samples were separated by sodium immunostaining. dodecyl sulfate-polyacrylamide gel electrophoresis and probed by

J Am Soc Nephrol 27: 766–780, 2016 Chronic Hyponatremia Affects Central Nervous System 777 BASIC RESEARCH www.jasn.org

Table 1. Primer sequences (59 to 39) 24591360 (to Y.S.) and a grant-in-aid for scientific research (Research GLT-1 Forward TGACCTTCATCATGGCCTAAACA on Hypothalamo-hypophyseal Disorders) (to Y.S. and Y.O.) from the Reverseward TCAGGCTCACCTGCATGACTACTAA Ministry of Health, Labor and Welfare, Japan. The authors thank GLAST Forward AGAGTGAGGCTCCCAAATGGTC Otsuka Pharmaceutical Co. Ltd., for the gift of tolvaptan. Reverseward CTGATGTTCCAGAAGTTTGGGCTA GAPDH Forward TGTGTCCGTCGTGGATCTGA Reverseward TTGCTGTTGAAGTCGCAGGAG DISCLOSURES GAPDH, glyceraldehyde-3-phosphate dehydrogenase. None. immunoblotting with the following primary antibodies: GLT-1 guinea REFERENCES pig polyclonal (1:2000; EMD Millipore), GLAST rabbit polyclonal (1:200; Santa Cruz Biotechnology, Dallas, TX), b-actin mouse mono- 1. Wald R, Jaber BL, Price LL, Upadhyay A, Madias NE: Impact of hospital- clonal (1:2000; Sigma-Aldrich, St Louis, MO). Bound antibodies were associated hyponatremia on selected outcomes. Arch Intern Med 170: detected by using appropriate horseradish peroxidase-conjugated sec- 294–302, 2010 2. Liamis G, Rodenburg EM, Hofman A, Zietse R, Stricker BH, Hoorn EJ: ondary antibodies (1:20,000; Jackson ImmunoResearch, West Grove, Electrolyte disorders in community subjects: prevalence and risk fac- PA) and SuperSignal West Pico Chemiluminescent Substrate (Thermo tors. Am J Med 126: 256–263, 2013 Fisher Scientific). Western blots were quantified using ImageJ software. 3. Decaux G: Is asymptomatic hyponatremia really asymptomatic? Am J Optical density values were normalized to b-actin signal. Med 119[Suppl 1]: S79–S82, 2006 4. Adrogué HJ, Madias NE: Hyponatremia. N Engl J Med 342: 1581– 1589, 2000 Immunocytochemistry fi 5. Verbalis JG: Brain volume regulation in response to changes in osmo- Neurons were xed with 4% paraformaldehyde for 30 minutes and lality. Neuroscience 168: 862–870, 2010 permeabilized with 0.05% Triton X-100 for 10 minutes at room 6. Renneboog B, Musch W, Vandemergel X, Manto MU, Decaux G: Mild temperature. Cells were stained with primary antibody at 4°C over- chronic hyponatremia is associated with falls, unsteadiness, and at- night as follows: mouse monoclonal anti–bIII-tubulin (1:2000; tention deficits. Am J Med 119: e1–e8, 2006 7. Gankam Kengne F, Andres C, Sattar L, Melot C, Decaux G: Mild hy- Chemicon International, Temecula, CA), mouse monoclonal anti- ponatremia and risk of fracture in the ambulatory elderly. QJM 101: microtubule-associated protein 2 (1:500; Chemicon International), 583–588, 2008 rabbit polyclonal anti- manganese superoxide dismutase (1:2000; 8. Sandhu HS, Gilles E, DeVita MV, Panagopoulos G, Michelis MF: Hy- Stressgen Biotechnologies Corp., Victoria, BC, Canada). They were ponatremia associated with large-bone fracture in elderly patients. Int subsequently stained with secondary antibody-conjugated Alexa-488 Urol Nephrol 41: 733–737, 2009 9. Gunathilake R, Oldmeadow C, McEvoy M, Kelly B, Inder K, Schofield P, or 568 (1:1000; Molecular Probes-Life Technologies) at room tem- Attia J: Mild hyponatremia is associated with impaired cognition and perature for 90 minutes. Cells were then counterstained with 1 mg/ml falls in community-dwelling older persons. J Am Geriatr Soc 61: 1838– Hoechst 33342 (Molecular Probes) at room temperature for 10 minutes, 1839, 2013 and mounted in antifade reagent. Cells were analyzed under a 10. Schrier RW, Gross P, Gheorghiade M, Berl T, Verbalis JG, Czerwiec FS, deconvolution fluorescence microscope system (BZ-8000; Keyence, Orlandi C; SALT Investigators: Tolvaptan, a selective oral vasopressin V2- receptor antagonist, for hyponatremia. NEnglJMed355: 2099–2112, 2006 Osaka, Japan). 11. Haskew-Layton RE, Rudkouskaya A, Jin Y, Feustel PJ, Kimelberg HK, Mongin AA: Two distinct modes of hypoosmotic medium-induced re- Assessment of Intracellular ATP Levels lease of excitatory amino acids and taurine in the rat brain in vivo. PLoS Tomeasure intracellular ATP levels, we used a luminometric assay, the ONE 3: e3543, 2008 ApoSENSORCell Viability Assay Kit (BioVision, Mountain View, CA) 12. Verbalis JG, Gullans SR: Hyponatremia causes large sustained reduc- tions in brain content of multiple organic osmolytes in rats. Brain Res according to the manufacturer’s protocol. The ATP concentration was 567: 274–282, 1991 calculated as a percentage of control. 13. Danbolt NC: Glutamate uptake. Prog Neurobiol 65: 1–105, 2001 14. Hamers FP, Lankhorst AJ, van Laar TJ, Veldhuis WB, Gispen WH: Au- Statistical Analysis tomated quantitative gait analysis during overground locomotion in Resultsareexpressedasthemean6SEM. Statistical analyses were the rat: its application to spinal cord contusion and transection injuries. JNeurotrauma18: 187–201, 2001 performed using Student’s t test (two-tailed), one-way ANOVA fol- ’ fi 15. Landgraf R, Gerstberger R, Montkowski A, Probst JC, Wotjak CT, lowed by Fisher s projected least signi cant difference test or two-way Holsboer F, Engelmann M: V1 vasopressin receptor antisense oligo- ANOVA followed by Tukey’s test as indicated in the figure legends. deoxynucleotide into septum reduces vasopressin binding, social dis- P values less than 0.05 were considered to be significant. crimination abilities, and anxiety-related behavior in rats. J Neurosci 15: 4250–4258, 1995 16. Van Londen L, Goekoop JG, Zwinderman AH, Lanser JB, Wiegant VM, De Wied D: Neuropsychological performance and plasma cortisol, ar- ACKNOWLEDGMENTS ginine vasopressin and oxytocin in patients with major depression. Psychol Med 28: 275–284, 1998 17. Alescio-Lautier B, Paban V, Soumireu-Mourat B: Neuromodulation of fi This work was supported in part by a grant-in-aid for scienti c re- memory in the hippocampus by vasopressin. Eur J Pharmacol 405: 63– search from the Japanese Society for the Promotion of Science 72, 2000

778 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 766–780, 2016 www.jasn.org BASIC RESEARCH

18. Frank E, Landgraf R: The vasopressin system—from antidiuresis to 38. Tanaka K, Watase K, Manabe T, Yamada K, Watanabe M, Takahashi K, psychopathology. Eur J Pharmacol 583: 226–242, 2008 Iwama H, Nishikawa T, Ichihara N, Kikuchi T, Okuyama S, Kawashima N, 19. Neumann ID, Landgraf R: Balance of brain oxytocin and vasopressin: Hori S, Takimoto M, Wada K: Epilepsy and exacerbation of brain injury implications for anxiety, depression, and social behaviors. Trends in mice lacking the glutamate transporter GLT-1. Science 276: 1699– Neurosci 35: 649–659, 2012 1702, 1997 20. Juul KV, Bichet DG, Nielsen S, Nørgaard JP: The physiological and 39. Zeng L-H, Ouyang Y, Gazit V, Cirrito JR, Jansen LA, Ess KC, Yamada KA, pathophysiological functions of renal and extrarenal vasopressin V2 Wozniak DF, Holtzman DM, Gutmann DH, Wong M: Abnormal gluta- receptors. Am J Physiol Renal Physiol 306: F931–F940, 2014 mate homeostasis and impaired synaptic plasticity and learning in a 21. Malenka RC, Bear MF: LTP and LTD: an embarrassment of riches. mouse model of tuberous sclerosis complex. Neurobiol Dis 28: 184– Neuron 44: 5–21, 2004 196, 2007 22. Katagiri H, Tanaka K, Manabe T: Requirement of appropriate glutamate 40. Featherstone DE, Shippy SA: Regulation of synaptic transmission concentrations in the synaptic cleft for hippocampal LTP induction. Eur by ambient extracellular glutamate. Neuroscientist 14: 171–181, J Neurosci 14: 547–553, 2001 2008 23. Yang J, Li MX, Luo Y, Chen T, Liu J, Fang P, Jiang B, Hu ZL, Jin Y, Chen 41. Franco R, Torres-Márquez ME, Pasantes-Morales H: Evidence for two JG, Wang F: Chronic ceftriaxone treatment rescues hippocampal mechanisms of amino acid osmolyte release from hippocampal slices. memory deficit in AQP4 knockout mice via activation of GLT-1. Neu- Pflugers Arch 442: 791–800, 2001 ropharmacology 75: 213–222, 2013 42. Anderson CM, Swanson RA: Astrocyte glutamate transport: review of 24. Pasantes-Morales H, Alavez S, Sánchez Olea R, Morán J: Contribution properties, regulation, and physiological functions. Glia 32: 1–14, of organic and inorganic osmolytes to volume regulation in rat brain 2000 cells in culture. Neurochem Res 18: 445–452, 1993 43. Barsony J, Sugimura Y, Verbalis JG: Osteoclast response to low extra- 25. Kanai Y, Clémençon B, Simonin A, Leuenberger M, Lochner M, cellular sodium and the mechanism of hyponatremia-induced bone Weisstanner M, Hediger MA: The SLC1 high-affinity glutamate and loss. JBiolChem286: 10864–10875, 2011 neutral amino acid transporter family. Mol Aspects Med 34: 108–120, 44. Trotti D, Danbolt NC, Volterra A: Glutamate transporters are oxidant- 2013 vulnerable: a molecular link between oxidative and excitotoxic neuro- 26. Takeuchi H, Mizuno T, Zhang G, Wang J, Kawanokuchi J, Kuno R, degeneration? Trends Pharmacol Sci 19: 328–334, 1998 Suzumura A: Neuritic beading induced by activated microglia is an 45. Kiryk A, Aida T, Tanaka K, Banerjee P, Wilczynski GM, Meyza K, Knapska early feature of neuronal dysfunction toward neuronal death by in- E, Filipkowski RK, Kaczmarek L, Danysz W: Behavioral characterization hibition of mitochondrial respiration and axonal transport. JBiolChem of GLT1 (+/–) mice as a model of mild glutamatergic hyperfunction. 280: 10444–10454, 2005 Neurotox Res 13: 19–30, 2008 27. Miyazaki T, Ohmoto K, Hirose T, Fujiki H: Chronic hyponatremia impairs 46. Verbalis JG, Drutarosky MD: Adaptation to chronic hypoosmolality in memory in rats: effects of vasopressin antagonist tolvaptan. JEndo- rats. Kidney Int 34: 351–360, 1988 crinol 206: 105–111, 2010 47. Lien YH, Shapiro JI, Chan L: Study of brain electrolytes and organic 28. Vandeputte C, Taymans JM, Casteels C, Coun F, Ni Y, Van Laere K, osmolytes during correction of chronic hyponatremia. Implications for Baekelandt V: Automated quantitative gait analysis in animal models of the pathogenesis of central pontine myelinolysis. JClinInvest88: 303– movement disorders. BMC Neurosci 11: 92, 2010 309, 1991 29. Kayakabe M, Kakizaki T, Kaneko R, Sasaki A, Nakazato Y, Shibasaki K, 48. Schaefer PW, Grant PE, Gonzalez RG: Diffusion-weighted MR imaging Ishizaki Y, Saito H, Suzuki N, Furuya N, Yanagawa Y: Motor dysfunction of the brain. Radiology 217: 331–345, 2000 in cerebellar Purkinje cell-specific vesicular GABA transporter knockout 49. Sevick RJ, Kanda F, Mintorovitch J, Arieff AI, Kucharczyk J, Tsuruda JS, mice. Front Cell Neurosci 7: 286, 2013 Norman D, Moseley ME: Cytotoxic brain edema: assessment with 30. Barlow C, Hirotsune S, Paylor R, Liyanage M, Eckhaus M, Collins F, diffusion-weighted MR imaging. Radiology 185: 687–690, 1992 Shiloh Y, Crawley JN, Ried T, Tagle D, Wynshaw-Boris A: Atm-deficient 50. Steier R, Aradi M, Pál J, Bukovics P, Perlaki G, Orsi G, Janszky J, mice: a paradigm of ataxia telangiectasia. Cell 86: 159–171, 1996 Schwarcz A, Sulyok E, Dóczi T: The influence of benzamil hydrochloride 31. Jen JC, Wan J, Palos TP, Howard BD, Baloh RW: Mutation in the glu- on the evolution of hyponatremic brain edema as assessed by in vivo tamate transporter EAAT1 causes episodic ataxia, hemiplegia, and MRI study in rats. Acta Neurochir (Wien) 153: 2091–2097, discussion seizures. Neurology 65: 529–534, 2005 2097, 2011 32. de Vries B, Mamsa H, Stam AH, Wan J, Bakker SL, Vanmolkot KR, Haan 51. Sugimura Y, Murase T, Takefuji S, Hayasaka S, Takagishi Y, Oiso Y, J, Terwindt GM, Boon EM, Howard BD, Frants RR, Baloh RW, Ferrari Murata Y: Protective effect of dexamethasone on osmotic-induced MD, Jen JC, van den Maagdenberg AM: Episodic ataxia associated demyelination in rats. Exp Neurol 192: 178–183, 2005 with EAAT1 mutation C186S affecting glutamate reuptake. Arch 52. Suzuki H, Sugimura Y, Iwama S, Suzuki H, Nobuaki O, Nagasaki H, Neurol 66: 97–101, 2009 Arima H, Sawada M, Oiso Y: Minocycline prevents osmotic de- 33. Watase K, Hashimoto K, Kano M, Yamada K, Watanabe M, Inoue Y, myelination syndrome by inhibiting the activation of microglia. JAm Okuyama S, Sakagawa T, Ogawa S, Kawashima N, Hori S, Takimoto M, Soc Nephrol 21: 2090–2098, 2010 Wada K, Tanaka K: Motor discoordination and increased susceptibility 53. Takagi H, Sugimura Y, Suzuki H, Iwama S, Izumida H, Fujisawa H, to cerebellar injury in GLAST mutant mice. Eur J Neurosci 10: 976–988, Ogawa K, Nakashima K, Ochiai H, Takeuchi S, Kiyota A, Suga H, 1998 Goto M, Banno R, Arima H, Oiso Y: Minocycline prevents osmotic 34. Holland PC, Bouton ME: Hippocampus and context in classical condi- demyelination associated with aquaresis. Kidney Int 86: 954–964, tioning. Curr Opin Neurobiol 9: 195–202, 1999 2014 35. Winters BD, Saksida LM, Bussey TJ: Object recognition memory: 54. Vajda Z, Promeneur D, Dóczi T, Sulyok E, Frøkiaer J, Ottersen OP, neurobiological mechanisms of encoding, consolidation and retrieval. Nielsen S: Increased aquaporin-4 immunoreactivity in rat brain in re- Neurosci Biobehav Rev 32: 1055–1070, 2008 sponse to systemic hyponatremia. Biochem Biophys Res Commun 270: 36. Gilbert PE, Kesner RP: Recognition memory for complex visual dis- 495–503, 2000 criminations is influenced by stimulus interference in rodents with 55. Ferdinandusse S, Zomer AW, Komen JC, van den Brink CE, Thanos M, perirhinal cortex damage. Learn Mem 10: 525–530, 2003 Hamers FP, Wanders RJ, van der Saag PT, Poll-The BT, Brites P: Ataxia 37. Murray EA, Bussey TJ, Hampton RR, Saksida LM: The parahippocampal with loss of Purkinje cells in a mouse model for Refsum disease. Proc region and object identification. Ann N Y Acad Sci 911: 166–174, 2000 Natl Acad Sci U S A 105: 17712–17717, 2008

J Am Soc Nephrol 27: 766–780, 2016 Chronic Hyponatremia Affects Central Nervous System 779 BASIC RESEARCH www.jasn.org

56. Mizoguchi H, Ibi D, Takuma K, Toth E, Sato J, Itohara S, Nabeshima T, amyotrophic lateral sclerosis and Alzheimer’s disease. PLoS ONE 6: Yamada K: Alterations of emotional and cognitive behaviors in matrix e21108, 2011 metalloproteinase-2 and -9-deﬁcient mice. The Open Behavioral Sci- 61. Paxinos G, Watson C: The Rat Brain in Stereotaxic Coordinates,San ence Journal 4: 19–25, 2010 Diego, CA, Academic Press, 1998 57. Hölscher C, Anwyl R, Rowan MJ: Stimulation on the positive phase of 62. Liang J, Takeuchi H, Doi Y, Kawanokuchi J, Sonobe Y, Jin S, Yawata I, Li hippocampal theta rhythm induces long-term potentiation that can Be H, Yasuoka S, Mizuno T, Suzumura A: Excitatory amino acid transporter depotentiated by stimulation on the negative phase in area CA1 in vivo. expression by astrocytes is neuroprotective against microglial ex- J Neurosci 17: 6470–6477, 1997 citotoxicity. Brain Res 1210: 11–19, 2008 58. Yilmaz-Rastoder E, Miyamae T, Braun AE, Thiels E: LTP- and LTD-inducing 63. Karki P, Webb A, Zerguine A, Choi J, Son DS, Lee E: Mechanism of stimulations cause opposite changes in arc/arg3.1 mRNA level in hippo- raloxifene-induced upregulation of glutamate transporters in rat pri- campal area CA1 in vivo. Hippocampus 21: 1290–1301, 2011 mary astrocytes. Glia 62: 1270–1283, 2014 59. Mizoguchi H, Yamada K, Niwa M, Mouri A, Mizuno T, Noda Y, Nitta A, Itohara S, Banno Y, Nabeshima T: Reduction of methamphetamine- induced sensitization and reward in matrix metalloproteinase-2 and -9- deﬁcient mice. JNeurochem100: 1579–1588, 2007 See related editorial, “Modeling the Neurologic and Cognitive Effects of Hy- 60. Takeuchi H, Mizoguchi H, Doi Y, Jin S, Noda M, Liang J, Li H, Zhou Y, ponatremia,” on pages 659–661. Mori R, Yasuoka S, Li E, Parajuli B, Kawanokuchi J, Sonobe Y, Sato J, Yamanaka K, Sobue G, Mizuno T, Suzumura A: Blockade of gap junction This article contains supplemental material online at http://jasn.asnjournals. hemichannel suppresses disease progression in mouse models of org/lookup/suppl/doi:10.1681/ASN.2014121196/-/DCSupplemental.

780 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 766–780, 2016 ii

i iiipiiiiiiiB]h

ii iiii ii ii ii ii q q)/ q)) q)/ q)L / q)( q)T qL q)q L q)q q)T q)/ q)q ) q)( q)T q)q qL T qL q) q)/ q)q qL q) q)/ q)( qL q)T q)/ q)q qL q)L q)q q)q qL q)T q)q q)q q( qL q)( q)q q)/ qq qL qL q)q q)( q/ qL qL q)( q)( qL q)( q)q q)( q)/ q) q)/ q)q q)/ q)L qL+q q)/+L q)q+q) q)q+( (+L/ (+ (+/T (+L(

i q qq qq qL q/ / qq qq qL qL) L q/( q/q qLL q/ ) q/q qq qL qLL T q/L q/) qL qL) q/ q/) qL qLL q/q qq qL q/ qq qq qLT qL q/ q/( qLT qL q( q( qq q/ qL( qq q/( q/( qL) qL) q/ qq) qq) qL qLq qL qq) qq qL) q/ i qq+/L qq+L qLT+) qLq+L q+) (+) (+L q+((