Identification of Key Genes Potentially Related to Triple Receptor Negative Breast Cancer by Microarray Analysis

bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti

1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India.

2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India.

3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India.

* Chanabasayya Vastrad

[email protected]

Ph: +919480073398

Chanabasava Nilaya, Bharthinagar,

Dharwad 580001 , Karanataka, India

Abstract

Triple receptor negative breast cancer (TNBC) is the type of gynecological cancer in the elderly women. This study is aimed to explore molecular mechanism of TNBC via bioinformatics analysis. The gene expression profiles of GSE88715 (including 38 TNBC and 38 normal control) was downloaded from the Gene Expression Omnibus (GEO) database. Differentially expressed genes (DEGs) were screened using the limma package in R software. Pathway and gene ontology (GO) enrichment analysis were performed based on various pathway dabases and GO database. Then, InnateDb interactome database, Cytoscape and PEWCC1 were applied to construct the protein-protein interaction (PPI) network and screen hub genes. Similarly, miRNet database, NetworkAnalyst database and Cytoscape were applied to construct the target gene ‐ miRNA network and target gene ‐ TF network, and screen targate genes. Pathway and GO enrichment analysis was further performed for hub genes, gene clusters identified via module analysis and targate genes. The expression of hub genes with prognostic values was validated on the UALCAN, cBio Portal, The Human Protein Atlas, receiver operator characteristic (ROC) curve analysis, RT-PCR analysis and immune infiltration analysis. A total of 949 DEGs were identified in TNBC (469 up regulated genes, and 480 down regulated genes), and they were mainly enriched in the terms of phospholipases, toxoplasmosis, immune response, cell surface, glycolysis, biosynthesis of amino acids, carboxylic acid metabolic process and organic substance catabolic process extracellular space. Hub genes including UBD, HLA- B, MYC and HSP90AB1 were identified via PPI network and modules, which were mainly enriched in immune response, antigen processing and presentation, cell cycle and pathways in cancer. Targate genes including CCDC80, PEG10, HOPX and CCNA2 were identified via target gene ‐ miRNA network and target gene ‐ TF network, which were mainly enriched in extracellular structure organization, validated targets of C-MYC transcriptional activation, ensemble of genes encoding core extracellular matrix including ECM glycoproteins and cell cycle. The top five significantly overexpressed mRNA (ADAM15, BATF, NOTCH3, ITGAX and SDC1) and the top five significantly underexpressed mRNA (RPL4, EEF1G, RPL3, RBMX and ABCC2) were selected for further bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

validation in TNBCpatients and healthy controls. Analysis of the expression of genes in the various databases showed that ADAM15, BATF, NOTCH3, ITGAX, SDC1, RPL4, EEF1G, RPL3, RBMX and ABCC2 expressions have a cancer specific pattern in TNBC. Collectively, ADAM15, BATF, NOTCH3, ITGAX, SDC1, RPL4, EEF1G, RPL3, RBMX and ABCC2 may be useful candidate biomarkers for TNBC diagnosis, prognosis and theraputic targates.

Key words: triple receptor negative breast cancer; Gene Expression Omnibus (GEO) data; bioinformatic analysis; overall survival; Protein-protein interaction

Introduction

Triple receptor negative breast cancer (TNBC) is one of the most common malignant tumors in women and a major cause of cancer-related death worldwide, especially in developing countries [Boyle, 2012]. This cancer is linked with absence of estrogen receptor (ER), progesterone receptor (PR), and HER2 [Bauer et al. 2007]. The mean survival time of TNBC patients without intervention is estimated between 12 and 18 months [Kassam et al. 2009]. Although surgical resection [Puglisi, 2010], radiation therapy [Abdulkarim et al. 2011], chemotherapy [Bhola et al. 2013] and immunotherapy [Stagg and Allard, 2013] have been used to treat HCC, treatment outcomes are still unsatisfactory due to postsurgical recurrence and chemo resistance. Therefore, a further examination into the underlying molecular mechanisms of TNBC initiation and development is urgently needed, which will contribute to the discovery of new prognostic, diagnostic and therapeutic targets for TNBC.

In the past decades, there have been many reports of genes and signaling pathways associated in TNBC initiation and advancement. Genes such as Cav- 1[Witkiewicz et al. 2010], Notch-1 and Notch-4 [Speiser et al. 2012], androgen receptor, EGFR, and BRCA1 [Zhang et al. 2015], p53 [Bae et al. 2018] and ZEB1 [Jang et al. 2015] were associated with pathogenesis of TNBC. Signaling pathways such as Wnt- β-Catenin pathway [De et al. 2017], FGFR signaling pathway [Sharpe et al. 2011], PI3K- AKT pathway [Wu et al. 2018], insulin-like growth factor-binding protein-3 signaling pathway [Martin et al. 2014] and TDO2-AhR signaling pathway [D'Amato et al. 2015] were responsible for pathogenesis of TNBC. Therefore, it is meaningful to conduct an analysis of gene profiles to provide novel clues to the pathogenesis of TNBC.

DNA microarray is multiplex labs on a chip. This screening uses miniaturized and multiplexed corollary transform and disclosure methods. It is favored technology in current years [Schena et al. 1995] and is frequently used to obtain data regarding genetic modifications during cancer progression [Mischel et al. 2004]. This data may be important in the recognition of molecular markers. In the current study, data from mRNA microarray dataset was used to analyze the bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

differentially expressed genes (DEGs) in TNBC (tumor stroma) compared with normal tissue (normal stroma). Bioinformatics methods, including pathway enrichment analysis and Gene Ontology (GO) enrichment analysis using toppcluster online tool, protein-protein interaction network and module analysis using InnateDB and PEWCC1, target genes - miRNA regulatory network and target genes - miRNA regulatory network using mirnet and Jasper databases, and validation of hub genes using the UALCAN, cBio Portal, The Human Protein Atlas, receiver operator characteristic (ROC) curve analysis , RT-PCR analysis and immune infiltration anaysis, were used to identify the important genes in TNBC.

Materials and methods

Microarray dataset and data processing

The mRNA dataset GSE88715 [Gruosso et al. 2019] was downloaded from Gene Expression Omnibus (GEO) database (www.ncbi.nlm.nih.gov/geo/) [Barrett et al. 2013]. GSE88715 was produced on the platform GPL14550 Agilent-028004 SurePrint G3 Human GE 8x60K Microarray (Probe Name Version). A total of 38 tissue samples from TNBC (tumor stroma) and 38 tissue samples from normal tissue (normal stroma) were included in the GSE88715 dataset.

Normalization for the downloaded original data was performed using limma package (version: 3.9) [Ritchie et al. 2013] in R software. The preprocessing in this investigation enclosed background correction, normalization, and expression quantification. If different probes were profiled to the same mRNA symbol, the mean value of these probes was treated as the final expression value of this mRNA.

Identification of DEGs

Based on classical Bayes decision method, the P values of DEGs between TNBC (tumor stroma) samples and normal tissue (normal stroma) samples were calculated respectively by limma package (version: 3.9) [Ritchie et al. 2013] in R software (version: 3.6.1). Then, differentially expressed genes (DEGs) meeting the cut-off criteria of adjusted P<0.05, |log2fold-change (FC)|>2.28 were selected as the up regulated genes and |log2fold-change (FC)|>-1.947 were selected as the down regulated genes. The bidirectional hierarchical clustering and volcano plot analysis for DEGs were performed by R software (version: 3.6.1). bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Pathway enrichment analysis of DEGs

BIOCYC (https://biocyc.org/) [Caspi et al. 2016], Kyoto Encyclopedia of Genes and Genomes (KEGG) (http://www.genome.jp/kegg/pathway.html) [Kanehisa et al. 2018], Pathway Interaction Database (PID) (https://wiki.nci.nih.gov/pages/viewpage.action?pageId=315491760) [Schaefer et al. 2009], REACTOME (https://reactome.org/) [Fabregat et al. 2018], GenMAPP (http://www.genmapp.org/) [Dahlquist et al. 2002], MSigDB C2 BIOCARTA (http://software.broadinstitute.org/gsea/msigdb/collections.jsp) [Subramanian et al. 2005], PantherDB (http://www.pantherdb.org/) [Mi et al. 2017], Pathway Ontology (http://www.obofoundry.org/ontology/pw.html) [Petri et al. 2017] and Small Molecule Pathway Database (SMPDB) (http://smpdb.ca/) [Jewison et al. 2014], a comprehensive knowledge databases, plays an essential role in both functional interpretation and practical application of genomic information. The DEGs (up and down regulated genes) list was uploaded to online tool ToppCluster (https://toppcluster.cchmc.org/) [Kaimal et al. 2010] to obtain enriched significant pathway analysis with P<0.05.

Gene ontology (GO) enrichment analysis of DEGs

Gene ontology (GO) (http://www.geneontology.org/) [Harris et al. 2004] enrichment analysis were performed using the online tool ToppCluster (https://toppcluster.cchmc.org/) [Kaimal et al. 2010]. By this way, the biological process (BP), cellular component (CC) and molecule function (MF) of target genes can be defined. The up and down regulated genes were detached. Enriched items with p value < 0.05 was considered to be statistically significant.

PPI network construction and module analysis InnateDb interactome database (https://www.innatedb.com/) [Breuer et al. 2013] is an online database of known and predicted protein ‑ protein interactions (PPI). InnateDb interactome integrates various PPI databases such as IntAct Molecular Interaction Database (https://www.ebi.ac.uk/intact/) [Orchard et al. 2014], Biological General Repository for Interaction Datasets (BioGRID) (https://thebiogrid.org/) [Chatr-Aryamontri et al. 2017], the Molecular INTeraction database (MINT) (https://mint.bio.uniroma2.it/) [Licata et al. 2012], Database of Interacting Proteins (DIP) (http://dip.doe-mbi.ucla.edu/dip/Main.cgi) [Salwinski et bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

al. 2004] and Biomolecular Interaction Network Database (BIND) (http://bond.unleashedinformatics.com/) [Willis and Hogue, 2006]. To assess the interactions among up and down regulated genes, we mapped them to InnateDb interactome database and and the coactions with a combined score of >0.4 were considered. Then, the PPI networks were visualized using Cytoscape software version 3.7.0 software (http://cytoscape.org/) [Shannon et al. 2003]. Network Analyzer plugin in Cytoscape topologically calculates the usefulness of nodes in a biological network by metrics such as node degree [Rito et al. 2010], betweenness [Yang and Lonardi, 2003], stress [Chen et al. 2014], closeness [Hsu et al. 2008] and clustering coefficient [Asur et al. 2007]. Modules of up and down regulated genes were established by the PEWCC1 [Zaki et al. 2013] with the concrete selection standards, which were as follows: PEWCC1 scores >2 and number of nodes >9.

Construction of the target gene ‐ miRNA network

To understand the associations between target gene expression and miRNAs, the target genes (up and down regulated genes) were predicted using various miRNA databases such as TarBase (http://diana.imis.athena- innovation.gr/DianaTools/index.php?r=tarbase/index) [Vlachos et al. 2015], miRTarBase (http://mirtarbase.mbc.nctu.edu.tw/php/download.php) [Chou et al. 2018], miRecords (http://miRecords.umn.edu/miRecords) [Xiao et al. 2009], miR2Disease (http://www.mir2disease.org/) [Jiang et al. 2009], HMDD (http://www.cuilab.cn/hmdd) [Huang et al. 2019], PhenomiR (http://mips.helmholtz-muenchen.de/phenomir/) [Ruepp et al. 2010], SM2miR (http://bioinfo.hrbmu.edu.cn/SM2miR/) [Liu et al. 2013], PharmacomiR (http://www.pharmaco-mir.org/) [Rukov et al. 2014], EpimiR (http://bioinfo.hrbmu.edu.cn/EpimiR/) [Dai et al. 2014] and starBase (http://starbase.sysu.edu.cn/) [Li et al. 2014]. The target gene -miRNA interactions were generated by miRNet (https://www.mirnet.ca/) [Fan and Xia, 2018] and was visualized using Cytoscape software version 3.7.0 software (http://cytoscape.org/) [Shannon et al. 2003] to further characterize correlations between potential target genes and miRNAs.

Construction of the target gene ‐ TF network bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

JASPAR (http://jaspar.genereg.net/) [Khan et al. 2018] is an international research consortium that uses large-scale, genome-wide assays to identify the role of all transcription factors (TFs) of the human genome. The transcription regulatory association between up and down regulated genes were explored by JASPAR, generated by NetworkAnalyst (https://www.networkanalyst.ca/) [Zhou et al. 2019] and was visualized using Cytoscape software version 3.7.0 software (http://cytoscape.org/) [Shannon et al. 2003] to further characterize correlations between potential target genes and TFs.

Validation of hub genes

Overall survival (OS) analysis of hub genes were downloaded from TCGA database by UALCAN (http://ualcan.path.uab.edu/analysis.html) [Chandrashekar et al. 2017]. According to the median mRNA expression of each hub genes, the TNBC samples were divided into two groups: high (expression higher than median value) and low (expression lower than median value) and P<0.05 was thought to be significant. Expression analysis of hub genes in TNBC was performed (normal and TNBC patients) from TCGA database by UALCAN (http://ualcan.path.uab.edu/analysis.html) [Chandrashekar et al. 2017]. Stage analysis of hub genes in TNBC was performed (all ten stages of cancer) from TCGA database by UALCAN (http://ualcan.path.uab.edu/analysis.html) [Chandrashekar et al. 2017]. Mutation analysis of hub genes was performed from TCGA database by cBioPortal online platform (http://www.cbioportal.org) [Gao et al. 2013]. We used the immunohistochemical analysis (IHC) of hub genes from The Human Protein Atlas (https://www.proteinatlas.org) [Uhlén et al. 2015] to verify the protein expression level in TNBC. pROC package of the R software was used for receiver operator characteristic (ROC) curve analysis and were analyzed using the generalized linear model (GLM) in machine learning algorithms [Robin et al. 2011]. Area under the ROC curve (AUC) was used to evaluate the predictive accuracy of selected hub genes for TNBC. P < 0.05 was considered statistically significant. For validation of hub genes by RT-PCR first total RNA from the TNBC and normal breast tissue was extracted using TRI Reagent® (Sigma, USA) according to the manufacturer’s instructions. Total RNA was reverse-transcribed to cDNA using FastQuant RT kit (with gDNase; Tiangen Biotech Co., Ltd.). Real- time quantitative PCR was performed using QuantStudio 7 Flex real-time PCR system (Thermo Fisher Scientific, Waltham, MA, USA) with the following bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

conditions: 50◦C for 2 min and 95◦C for 10 min, followed by 40 cycles of 95◦C for 10 s and 60◦C for 60 s. All PCR reactions were performed in triplicate. The mRNA expression levels of the tested hub genes relative to β-actin were determined using the 2‐ΔΔCt method and as fold induction [Livak and Schmittgen, 2001]. Primers used are listed in Table 1. The TIMER (https://cistrome.shinyapps.io/timer/) [Li et al. 2017] is a RNA-Seq expression profiling database which provides a comprehensive resource for systematic analysis of immune infiltrates across various cancer types. Immune cell types such as B cells, CD4+ T cells, CD8+ T cells, neutrophils, macrophages, and dendritic cells were assessed by TIMER on breast cancer sample data, and the correlation between 10 hub genes expression and immune infiltration.

Results

Identification of DEGs

The raw data of dataset was normalized following data pretreatment. Fig. 1A and Fig. 1B demonstrates the boxplot of each sample prior to and following data normalization. The study included 38 tissue samples from TNBC (tumor stroma) and 38 tissue samples from normal tissue (normal stroma). A total of 949 DEGs were identified after the analysis of GSE88715 by limma package in R software. Of these, 469 were up regulated and 480 were down regulated in TNBC (tumor stroma) samples compared with normal tissue (normal stroma) samples (Table 2). A volcano plot and heat map of DEGs is shown in Fig. 2. Heat map of up and down regulated genes are shown in Fig. 3 and Fig. 4, respectively.

Pathway enrichment analysis of DEGs

For a deeper insight into the DEGs (up and down regulated genes), we performed pathway enrichment analyses. Pathway enrichment analyses revealed that up regulated genes were mainly associated with phospholipases, resolvin D biosynthesis, toxoplasmosis, antigen processing and presentation, IL12-mediated signaling events, CXCR4-mediated signaling events, innate immune system, assembly of collagen fibrils and other multimeric structures, prostaglandin and leukotriene metabolism, sphingoglycolipid metabolism, ensemble of genes encoding core extracellular matrix including ECM glycoproteins, collagens and proteoglycans, genes encoding collagen proteins, integrin signalling pathway, bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

inflammation mediated by chemokine and cytokine signaling pathway, eicosanoids metabolic, gamma-hexachlorocyclohexane degradation, MNGIE (mitochondrial neurogastrointestinal encephalopathy) and intracellular signalling through PGD2 receptor and prostaglandin D2 are listed in Table 3; while down regulated genes were mainly associated with glycolysis, lactate fermentation (reoxidation of cytosolic NADH), biosynthesis of amino acids, carbon metabolism, FOXA2 and FOXA3 transcription factor networks, HIF-1-alpha transcription factor network, peptide chain elongation, cell cycle, glycolysis gluconeogenesis, pentose phosphate, extrinsic prothrombin activation pathway, ATP synthesis and enoxaparin pathway are listed in Table 4.

Gene ontology (GO) enrichment analysis of DEGs

In order to investigate the biological functions of these up and down regulated genes in TNBC, GO enrichment analysis was performed using ToppCluster (Table 5 and Table 6). For BPs, GO analysis results indicated that up and down regulated genes were significantly enriched in immune response, regulation of immune system process, carboxylic acid metabolic process and oxoacid metabolic process. CC analysis showed that these up and down regulated genes were particularly associated in cell surface, side of membrane, extracellular space and cytosolic part. Similarly, changes in MF of up and down regulated genes were significantly enriched in serine-type peptidase activity, antigen binding, protein-containing complex binding and enzyme binding.

PPI network construction and module analysis The InnateDb interactome database and Cytoscape were used to construct a PPI network of the potential interactions between the up and down regulated genes. As presented in Fig. 5, there were 2762 nodes and 4473 interactions found in the PPI network for up regulated genes. Hub genes with high node degree distribution, betweenness centrality, stress centrality, closeness centrality such as UBD, HLA- B, IL7R, CD4, PDGFRB, IRF8 and STAT2, and low clustering coefficient such as DERL3, IGFLR1, RAMP1, MARCO and ICOS are listed in Table 7. The statistical results and scatter plot for node degree distribution, betweenness centrality, stress centrality, closeness centrality and clustring coefficient for up regulated genes are shown in Fig. 6A - 6E. Pathway and GO enrichment analysis bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

displayed that the top up regulated hub genes were primarily enriched in the immune response, antigen processing and presentation, PI3K-Akt signaling pathway, regulation of immune system process, HTLV-I infection, cytokine signaling in immune system, herpes simplex infection, endoplasmic reticulum part, cell surface, intrinsic component of plasma membrane and cell adhesion molecules (CAMs). Similarly, as presented in Fig. 7, there were 4710 nodes and 12360 interactions found in the PPI network for down regulated genes. Hub genes with high node degree such as high node degree distribution, betweenness centrality, stress centrality, closeness centrality such as MYC, HSP90AB1, BRCA1, EEF1A1, HNRNPA1, PCNA, RPSA, GAPDH, and low clustering coefficient such as C8A, GDF11, SERPINA1, TFRC and MET are listed in Table 7. The statistical results and scatter plot for node degree distribution, betweenness centrality, stress centrality, closeness centrality and clustring coefficient for down regulated genes are shown in Fig. 8A - 8E. Pathway and GO enrichment analysis displayed that the top down regulated hub genes were primarily enriched in the cell cycle, pathways in cancer, ubiquitin mediated proteolysis, peptide chain elongation, mitotic cell cycle process, ribosome, biosynthesis of amino acids, complement and coagulation cascades, ensemble of genes encoding extracellular matrix and extracellular matrix-associated proteins, negative regulation of protein metabolic process, FOXA2 and FOXA3 transcription factor networks and response to oxygen-containing compound.

Module 4 (13 nodes and 43 edges), module 5 (12 nodes and 29 edges), module 6 (12 nodes and 21 edges) and module 15 (8 nodes and 16 edges) were key modules in this PPI network for up regulated genes (Fig.9). The results of patway and GO enricment analysis presented that up regulated hub genes were mainly enriched in herpes simplex infection, toxoplasmosis, chemokine signaling pathway, PI3K-Akt signaling pathway, immune response, regulation of immune system process, positive regulation of cell motility and hematopoietic or lymphoid organ development. Module 11 (64 nodes and 274 edges) , module 18 (42 nodes and 116 edges), module 19 (42 nodes and 116 edges) and module 26 (32 nodes and 95 edges) were key modules in this PPI network for down regulated genes (Fig.10). The results of patway and GO enricment analysis presented that down regulated hub genes were mainly enriched in cell cycle, metabolism of amino acids and derivatives, ubiquitin mediated proteolysis, HIF-1-alpha transcription factor bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

network, negative regulation of protein metabolic process, carboxylic acid metabolic process, mitotic cell cycle process and organonitrogen compound biosynthetic process.

Construction of target gene - miRNA regulatory network

Expression of miRNAs was linked with pathogenesis of TNBC [Radojicic et al. 2011]. An up regulated target gene - miRNA regulatory network is shown in Fig. 11. Top five up regulated target genes such as CCDC80 interacts with 135 miRNAs (ex, hsa-mir-6499-3p), MYO1F interacts with 104 miRNAs (ex, hsa-mir- 6882-3p), CDH7 interacts with 88 miRNAs (ex, hsa-mir-7845-5p), KLF2 interacts with 85 miRNAs (ex, hsa-mir-548as-3p) and FPR1 interacts with 85 miRNAs (ex, hsa-mir-4722-3p) are listed in Table 8. Pathway and GO enrichment analysis displayed that the top up regulated targate genes were primarily enriched in the extracellular structure organization, immune response, hematopoietic or lymphoid organ development and innate immune system. Similarly, down regulated target gene - miRNA regulatory network is shown in Fig. 12. Top five down regulated target genes such as PEG10 interacts with 139 miRNAs (ex, hsa-mir-4443), HNRNPA1 interacts with 139 miRNAs (ex, hsa-mir-6504-5p), PTP4A1 interacts with 132 miRNAs (ex, hsa-mir-548aq-5p), SLC7A5 interacts with 130 miRNAs (ex, hsa-mir-4434) and MYC interacts with 103 miRNAs (ex, hsa-mir-6507-3p) are listed in Table 8. Pathway and GO enrichment analysis displayed that the top down regulated targate genes were primarily enriched in the validated targets of C- MYC transcriptional activation, signaling events mediated by PRL, metabolism of amino acids and derivatives and carboxylic acid metabolic process.

Construction of target gene - TF regulatory network

Expressions of TFs were important for progression of TNBC [Lawrence et al. 2015]. An up regulated target gene - TF regulatory network is shown in Fig. 13. Top five up regulated target genes such as HOPX interacts with 218 TFs (ex, FOXC1), NYX interacts with 163 TFs (ex, GATA2), CXCL9 interacts with 110 TFs (ex, YY1), ACTA2 interacts with 100 TFs (ex, FOXL1) and CYP1B1 interacts with 91 TFs (ex, PPARG) are listed in Table 9. Pathway and GO enrichment analysis displayed that the top up regulated targate genes were primarily enriched in the ensemble of genes encoding core extracellular matrix bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

including ECM glycoproteins, collagens and proteoglycans, chemokine signaling pathway, inflammation mediated by chemokine and cytokine signaling pathway, and positive regulation of cell motility. Similarly, down regulated target gene - TF regulatory network is shown in Fig. 14. Top five down regulated target genes such as CCNA2 interacts with 207 TFs (ex, FOXC1), NR0B2 interacts with 167 TFs (ex, GATA2), CPS1 interacts with 109 TFs (ex, YY1), CCNB2 interacts with 93 TFs (ex, FOXL1) and STAR interacts with 87 TFs (ex, E2F1) are listed in Table 9. Pathway and GO enrichment analysis displayed that the top down regulated targate genes were primarily enriched in the cell cycle, mechanism of gene regulation by peroxisome proliferators via PPARa (alpha), biosynthesis of amino acids, mitotic cell cycle process and carboxylic acid metabolic process.

Validation of hub genes

The prognostic information of the 10 hub genes was available in the free online UALCAN database. As shown in Fig 15, the increase expression levels of the six hub genes such as ADAM15 (P = 0.0028), BATF (P = 0.002), NOTCH3 (P = 0.02), SDC1 (P = 0.00044), RBMX (P = 0.029) and ABCC2 (P = 0.0046) were associated with a worst OS for TNBC, while low expression levels of the four hub genes such ITGAX (P = 0.043), RPL4 (P = 0.048), EEF1G (P = 0.025) and RPL3 (P = 0.011) were associated with worst OS for TNBC (Fig. 16). Based on the UALCAN database, it was identified that the mRNA expression levels of ADAM15, BATF, NOTCH3, ITGAX and SDC1 were significantly increased in TNBC samples compared with normal breast samples (Fig. 17), while mRNA expression levels of RPL4, EEF1G, RPL3, RBMX and ABCC2 were significantly decreased in TNBC samples compared with normal breast samples (Fig. 18). In addition, UALCAN box plots of gene expression by pathological stages of breast cancer based on the TCGA database results shows that ADAM15, BATF, NOTCH3, ITGAX and SDC1 were more expressed in all stages of breast cancer compared to normal breast samples (Fig. 19), while RPL4, EEF1G, RPL3, RBMX and ABCC2 less expressed in all stages of breast cancer compared to normal breast samples (Fig. 20). We used cBioportal tool to explore the specific modification of hub genes. Percentages of modification in hub genes such as 10% ADAM15 (missense mutation, truncating mutation and amplification), 0.6% BATF (missense mutation, amplification and deep deletion), 3% NOTCH3 (missense mutation, truncating mutation, fusion and amplification), 5% ITGAX (missense bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

mutation, truncating mutation and amplification), 0.4% SDC1 (truncating mutation and amplification), 0.7% RPL4 (missense mutation, truncating mutation and amplification), 1.1% EEF1G (missense mutation, truncating mutation and amplification), 0.5% RPL3 (fusion, amplification and deep deletion), 1.4% RBMX (missense mutation, truncating mutation, amplification and deep deletion) and 1.2 % ABCC2 (missense mutation, truncating mutation, fusion, amplification and deep deletion) (Fig.21). The Human Protein Atlas and IHC assays were performed to validate the expression level of hub genes. Meanwhile, IHC staining exhibited that the protein expression of ADAM15, BATF, NOTCH3, ITGAX and SDC1 were elevated in TNBC tissue compared with normal breast samples (Fig. 22A- 22E), while protein expression of RPL4, EEF1G, RPL3, RBMX and ABCC2 were decreased in TNBC tissue compared with normal breast samples (Fig. 22F-22J) . In order to detect the discriminatory ability of common DEGs abovementioned among TNBC patients and healthy individuals, the ROC analyses in GSE88715 dataset was performed. The AUC under ROC curve were 0.887, 0.933, 0.824, 0.925, 0.833, 0.786, 0.876, 0.834, 0.861 and 0.918 for ADAM15, BATF, NOTCH3, ITGAX, SDC1, RPL4, EEF1G, RPL3, RBMX and ABCC2, respectively (Fig. 23). To validate these major results, we selectively performed RT-PCR analysis of ten hub genes including ADAM15, BATF, NOTCH3, ITGAX, SDC1, RPL4, EEF1G, RPL3, RBMX and ABCC2 in TNBC patients and healthy control. The relative mRNA expression levels of ADAM15, BATF, NOTCH3, ITGAX and SDC1 were significantly higher in TNBC patients when compared with those from healthy controls (Fig. 24A-E). The expression levels of RPL4, EEF1G, RPL3, RBMX and ABCC2 were significantly lower in TNBC patients than healthy control group (Fig. 24F-J). In the TNBC, the high expression levels of the ADAM15, BATF, NOTCH3, ITGA and SDC1 all negatively associated with tumor purity (Fig. 25 A-E), whereas low expression of RPL4, EEF1G, RPL3, RBMX and ABCC2 were all positively associated with tumor purity (Fig. 25 F-J). It can be inferred from this result that all ten hub genes are probably expressed not in the microenvironment, but expressed in the tumor cells.

Discussion

Although many basic and clinical examinations have been conducted to illuminate the molecular origins of TNBC, the process has been slow and unsatisfying due to the absence of stable and effective biomarkers [Lehmann et al. 2011]. In this study, we diagnosed significant DEGs between TNBC (tumor stroma) and tissue samples from normal tissue (normal stroma). Furthermore, we implemented a series of bioinformatics analysis to screen important genes and pathways.

A total of 949 DEGs were found, consisting of 469 up regulated genes and 480 down regulated genes. CSF1R was associated with tumor-infiltrating macrophages in pancreatic cancer [Zhu et al. 2014], but this gene may be linked tumor-infiltrating macrophages in TNBC. Genes such as CD14 [Lobba et al. 2012], AHSG (alpha 2-HS glycoprotein) [Yi et al. 2009] and AFP (alpha fetoprotein) [Parikh et al. 2005] were responsible for pathogenesis of hormonal- receptor positive breast cancer, but these genes may be liable for progression of TNBC. Methylation inactivation of tumor suppressor PLEKHO1 was involved in progression of gastric cancer [Ma et al. 2016], but loss of this gene may be important for advancement of TNBC. Gene such as CCL4 [Sasaki et al. 2016], TYMP (thymidine phosphorylase) [Marangoni et al. 2018] and IGFBP1 [Zhang and Yee, 2000] were responsible for development of TNBC. ALB (albumin) was linked with advancement of colorectal cancer [Dixon et al. 2003], but this gene may be associated with pathogenesis of TNBC. FABP1 was liable for invasion of gastric cancer cells [Satoh et al. 2012], but this gene may be important for invasion of TNBC cells.

In pathway enrichment analysis, up regulated genes were enriched in numerous pathways from various pathway databases. Single nucleotide polymorphism (SNP) in enriched genes such as PLA2G4C [Olsen et al. 2016], HLA-DPB1 [Ivansson et al. 2011], HLA-DRB1 [Mahmoodi et al. 2012], C1QA [Azzato et al. 2010], CFH (complement factor H) [Zhang et al. 2012], CHIT1 [Li et al. 2016], FCGR3A [Gavin et al. 2017] and POSTN (periostin) [Försti et al. 2007] were important for pathogenesis of various cancers, but these polymorphic genes may be linked with progression of TNBC. High expression of enriched genes such as PLD1 [Gozgit et al. 2007], HLA-DRA (major histocompatibility complex, class II, DR alpha) [Rangel et al. 2004], IL10RA [Zadka et al. 2018], bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

LAMC2 [Xu et al. 2017], TLR2 [Xin et al. 2014], GZMA (granzyme A) [Legrand et al. 2010], FCER1G [Chen et al. 2017], FGR (FGR proto-oncogene, Src family tyrosine kinase) [Kim et al. 2011], ICOS (inducible T cell costimulator) [Tiriveedhi et al. 2013], LAT2 [Barollo et al. 2016], SAA1 [Kim et al. 2015], VWF (von Willebrand factor) [Röhsig et al. 2001], EFEMP1 [Chen et al. 2013], FMOD (fibromodulin) [Dawoody Nejad et al. 2017] and FNDC1 [Das and Ogunwobi, 2017] were involved in advancement of various cancers, but elevated expression of these genes may be linked with development of TNBC. ALOX5 was linked with proliferation of colorectal cancer cells [Wang et al. 2018], but this gene may be responsible for proliferation of TNBC cells. Enriched gene such as CCR5 [Norton et al. 2017], LAMA4 [Yang et al. 2018], CD4 [Matsumoto et al. 2016], ADAM8 [Das et al. 2016], BST2 [Woodman et al. 2016], CTSB (cathepsin B) [Yang et al. 2017], FPR1 [Baracco et al. 2016], MMP9 [Mehner et al. 2014], S100A8 [Parris et al. 2014], COL4A2 [JingSong et al. 2017], DCN (decorin) [Yang et al. 2015], HAPLN3 [Kuo et al. 2010] and MFAP5 [Chen et al. 2019] were associated with pathogenesis of TNBC. Enriched genes such as CCL3 [Zhang et al. 2016], ADA2 [Aghaei et al. 2005], ARHGAP9 [Sun et al. 2019], CHI3L1 [Chen et al. 2017], CTSH (cathepsin H) [Jevnikar et al. 2013], CTSK (cathepsin K) [Kleer et al. 2008], DDX58 [Chang et al. 2017], IRF7 [Li et al. 2015], ITGB2 [Liu et al. 2018], JAK3 [Ye et al. 2013], MNDA (myeloid cell nuclear differentiation antigen) [Sun et al. 2014], NCF2 [Zhang et al. 2018], NLRP3 [Wang et al. 2016], PDGFRB (platelet derived growth factor receptor beta) [Schito et al. 2012], SLC2A5 [Weng et al. 2018], PTGDS (prostaglandin D2 synthase) [Shyu et al. 2013], AEBP1 [Liu et al. 2018], COL10A1 [Li et al. 2018], COL12A1 [Duan et al. 2018], COL1A1 [Zhang et al. 2018], COL4A1 [Huang et al. 2018], COL5A1 [Liu et al. 2018], COL5A2 [Zeng et al. 2018], COMP (cartilage oligomeric matrix protein) [Englund et al. 2016], DPT (dermatopontin) [Yamatoji et al. 2012], EMILIN2 [Marastoni et al. 2014],MGP (matrix Gla protein) [Tiago et al. 2016], SMOC2 [Shvab et al. 2016], SPARCL1 [Cao et al. 2013] and SPON2 [Chandrasinghe et al. 2017] were responsible for invasion of various cancer cells, but these genes may be liable for invasion of TNBC cells. IGHG1 was important for inhibition of apoptosis in prostate cancer [Pan et al. 2013], but this gene may be liable for inhibition of apoptosis in TNBC. Methylation inactivation of tumor suppressors enriched genes such as FBLN1 [Xu et al. 2015], SLIT3 [Kim et al. 2016] and LIMS2 [Kim et al. 2006] were important for progression of various bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

cancers, but inactivation of these genes may be associated with development of TNBC. HSPG2 was involved in drug resistance in hormonal-receptor positive breast cancer [Hu et al. 2013], but this gene may be associated with chemo resistance in TNBC. Our study found that PLCB2, CD40LG, HLA-DMA (major histocompatibility complex, class II, DM alpha), HLA-DMB (major histocompatibility complex, class II, DM beta), HLA-DOA (major histocompatibility complex, class II, DO alpha), HLA-DOB (major histocompatibility complex, class II, DO beta), HLA-DPA1, HLA-DRB4, HLA- DRB5, CD8A, GZMB (granzyme B), IL18RAP, ADCY4, C1QB, C1R, C1S, CALML5, CD300E, CFD (complement factor D), DOK3, FCN1, GNLY (granulysin), GPR84, HBB (hemoglobin subunit beta), HLA-B (major histocompatibility complex, class I, B), HLA-C (major histocompatibility complex, class I, C), IL3RA, ITGAX (integrin subunit alpha X), LAIR1, LCP2, LILRB3, NCF1, NFAM1, PECAM1, PTPRC (protein tyrosine phosphatase, receptor type C), RASAL3, RASGRP2, SELL (selectin L), SIGLEC14, TBC1D10C, TCIRG1, TYROBP (TYRO protein tyrosine kinase binding protein), VAMP8, CILP (cartilage intermediate layer protein), COL16A1, COL8A2, EGFLAM (EGF like, fibronectin type III and laminin G domains), EMILIN1, FBLN2, NYX (nyctalopin), VWA1 and GGT5 are up regulated in TNBC and has potential as a novel diagnostic and prognostic biomarker, and therapeutic target. Similarly, down regulated genes were enriched in numerous pathways from various pathway databases. Enriched genes such as ALDOC (aldolase, fructose- bisphosphate C) [Li et al. 2016], CPS1 [Zhang et al. 2018], ENO1 [Principe et al. 2017], TKT (transketolase) [Tseng et al. 2018], TFRC (transferrin receptor) [Wada et al. 2006] and RPL7A [Zhu et al. 2001] were involved in invasion of various cancer cells, but these genes may be liable for invasion of TNBC cells. Enriched genes such as ENO2 [Soh et al. 2011], ACY1 [Cook et al. 1993], APOA1 [Cine et al. 2014] and RPL7 [Boleij et al. 2010] were associated with pathogenesis of various cancers. Enriched genes such as PFKP (phosphofructokinase, platelet) [Moon et al. 2011] and PGK1 [Shashni et al. 2013] were linked with proliferation of hormonal-receptor positive breast cancer cells, but these genes may be liable for proliferation of TNBC cells. Enriched genes such as GAPDH (glyceraldehyde-3- phosphate dehydrogenase) [Higashimura et al. 2011], PGAM1 [Peng et al. 2016] and RPS2 [Wang et al. 2009] were important for pathogenesis of various cancers, but these genes may be identified with progression of TNBC. SNP in MAT1A was bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

linked with advancement of hormonal-receptor positive breast cancer [Mumbrekar et al. 2017], but this polymorphic gene may be important for progression of TNBC. Enriched genes such as PSAT1 [Gao et al. 2017], DLK1 [Nueda et al. 2017], FOXA2 [Perez-Balaguer et al. 2015], LDHA (lactate dehydrogenase A) [Dong et al. 2017] and LDHB (lactate dehydrogenase B) [McCleland et al. 2012] were associated with advancement of TNBC. Low expression of enriched genes such as TTR (transthyretin) [Liu et al. 2007], RPL15 [Yan et al. 2015], RPL6 [Wu et al. 2011], RPLP0 [Teller et al. 2015] and RPSA (ribosomal protein SA) [Song et al. 2013] were liable for advancement of various cancers, but less expression of these genes may be identified with growth of TNBC. Enriched genes such as EEF1A1 [Lin et al. 2018] and RPL3 [Pagliara et al. 2016] were associated with control of cell cycle in various cancers, but these genes may be linked with control cell cycle in TNBC. Our study found that ENO3, TPI1, F2 (coagulation factor II, thrombin), RPL23A, RPL4, RPS10, RPS4Y1, RPS4Y2 and PGM1 are down regulated in TNBC and has potential as a novel diagnostic and prognostic biomarker, and therapeutic target.

In GO enrichment analysis, up regulated genes were enriched in all GO categories. Enriched genes such as CXCL9 [Tokunaga et al. 2018], CCL18 [Wang et al. 2016], IFI6 [Cheriyath et al. 2018], VTCN1 [Gao et al. 2015], ADAM19 [Zhang et al. 2015], MRC2 [Gai et al. 2014], CXCR3 [Bronger et al. 2012] and MMP19 [Djonov et al. 2001] were important invasion of various cancer cells, but these genes may be associated with invasion of TNBC cells. SNP in enriched genes such as HLA-DQA1 [Spraggs et al. 2011], HLA-DQB1 [Madeleine et al. 2008], IGKC (immunoglobulin kappa constant) [Pandey et al. 2014], TNFSF10 [Charbonneau et al. 2014], ADAM15 [Maretzky et al. 2009], CD27 [Xu et al. 2012], APOE (apolipoprotein E) [Saadat and Apolipoprotein, 2012] and SULF1 [Zhou et al. 2016] were liable for pathogenesis of various cancers, but these polymorphic genes may be identified with progression of TNBC. VSIG4 was inhibiting T-cell activation results in progression of lung cancer [Liao et al. 2014], but this gene may be inhibiting T-cell activation in TNBC. Enriched genes such as HMOX1 [Zhu et al. 2015], LAMP3 [Nagelkerke et al. 2014] and MX1 [Bajo et al. 2003] were liable for chemo resistance in hormonal-receptor positive breast cancer, but these genes may be associated with drug resistance in TNBC. Enriched genes such as CCL2 [Fang et al. 2016], CCL5 [Araujo et al. 2018], CCR7 [Li et al. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

2017], MMP7 [Han et al. 2018], UBD (ubiquitin D) [Han et al. 2015], IFITM1 [Ogony et al. 2016], CXCL14 [Sjöberg et al. 2016], IFIT2 [Koh et al. 2019], IFIT1 [Danish et al. 2013], CTLA4 [Liu et al. 2018], IRF5 [Pimenta et al. 2015], STAT2 [Ogony et al. 2016], OSM (oncostatin M) [Bottai et al. 2017], SUSD2 [Hultgren et al. 2017], SDC1 [Cui et al. 2017], CRYAB (crystallin alpha B) [Chen et al. 2014], MYLK (myosin light chain kinase) [Choi et al. 2016], MMP11 [Kwon et al. 2011] and MMP14 [Ling et al. 2017] were responsible for advancement of TNBC. Over expression of genes such as CCL19 [Zhang et al. 2017], IGHA2 [Kang et al. 2012], TFEB (transcription factor EB) [Giatromanolaki et al. 2017], THY1 [Lu et al. 2011], RAMP1 [Logan et al. 2013], ACVRL1 [Chien et al. 2013] and CPXM2 [Niu et al. 2019] were involved in pathogenesis of various cancers, but high expression of these genes may be liable for advancement of TNBC. IRF8 was associated with immune surveillance in hormonal-receptor positive breast cancer and pancreatic cancer [Meyer et al. 2018], but this gene may be responsible for immune surveillance in TNBC. Enriched genes such as CRIP1 [Ludyga et al. 2013], XAF1 [Iravani et al. 2017], IFI44L [Huang et al. 2018], GZMH (granzyme H) [Tahbaz-Lahafi et al. 2014] and PRSS8 [Zhang et al. 2016] were important for development of various cancers, but low expression of these genes may be associated with development of TNBC. Genes such as MYO1F [Diquigiovanni et al. 2018], FOXP1 [Chiang et al. 2017], DAPK3 [Tan et al. 2017], FAP (fibroblast activation protein alpha) [Jia et al. 2014] and FOLR2 [Xu et al. 2018] were linked with proliferation of various cancer cells, but these genes may be associated with proliferation of TNBC cells. Methylation inactivation of tumarsupressor GREM1 was associated with advancement of renal cancer [Vlodrop et al. 2017], but loss of this gene may be linked with progression of TNBC. Our study found that HLA-F (major histocompatibility complex, class I, F), TRAC (T cell receptor alpha constant), TNFRSF4, FCGRT (Fc fragment of IgG receptor and transporter), IFI30, CMKLR1, DHX58, BATF (basic leucine zipper ATF-like transcription factor), LILRA6, ACKR4, IFI27, SLAMF1, RSAD2, IGHA1, IGHM (immunoglobulin heavy constant mu), OASL (2'-5'-oligoadenylate synthetase like), FCRL5, SLAMF7, MARCO (macrophage receptor with collagenous structure), IL7R, S1PR4, SP100, JAML (junction adhesion molecule like), HCST (hematopoietic cell signal transducer), SSC5D, GBP4, GBP5, LILRB4, LST1, OAS2, RGS1, CD79A, ADGRF5, GPIHBP1, GGTA1P, CD2, PCSK5 and GZMK (granzyme K) are up regulated in TNBC and has potential as a novel diagnostic bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

and prognostic biomarker, and therapeutic target. Similarly, down regulated genes were enriched in all GO categories. Enriched genes such as ACAT1 [Antalis et al. 2010], PGD (phosphogluconate dehydrogenase) [Yang et al. 2018], FOLR1 [Necela et al. 2015], EGLN1 [Briggs et al. 2016], TRIB3 [Wennemers et al. 2011], MYC (MYC proto-oncogene, bHLH transcription factor) [Camarda et al. 2016], PSMB5 [Wei et al. 2018], GATA3 [Krings et al. 2014], AKR1C1 [Wenners et al. 2016], BRCA1 [Greenup et al. 2013], SLC7A5 [El Ansari et al. 2018], MET (MET proto-oncogene, receptor tyrosine kinase) [Mueller et al. 2012], HP (haptoglobin) [Tabassum et al. 2012], AGR2 [Ondrouskova et al. 2017], MST1 [Ercolani et al. 2017], IGFBP3 [Marzec et al. 2015], GFRA1 [He et al. 2017], SERPINA6 [Ronde et al. 2013], TIMP4 [Liss et al. 2009] and GDF11 [Bajikar et al. 2017] were linked with progression of TNBC. Increase expression of genes such as TYMS (thymidylatesynthetase) [Lee et al. 2013], ELOVL2 [González- Bengtsson et al. 2016], ADA (adenosine deaminase) [Aghaei et al. 2010], SERPINA1 [Chan et al. 2015], FGG (fibrinogen gamma chain) [Zhu et al. 2009], AKR1B1 [Reddy et al. 2017], AMBP (alpha-1-microglobulin/bikunin precursor) [Huang et al. 2013], VTN (vitronectin) [Niu et al. 2016], HYAL1 [Tan et al. 2011], AREG (amphiregulin) [Wang et al. 2008], C1QBP [Amamoto et al. 2011], C4BPA [Sogawa et al. 2016], RBP4 [Fei et al. 2017], ORM2 [Zhang et al. 2012], PRDX1 [O'Leary et al. 2014], PTTG1 [Ghayad et al. 2009], CD55 [Cui et al. 2012], ITIH3 [Chong et al. 2010] and NPM1 [Zhu et al. 2015] were responsible for development of various cancers, but high expression of these genes may be liable for development of TNBC. Genes such as TYRP1 [Agarwal et al. 2003], CYP26A1 [Osanai and Lee, 2015], STAR (steroidogenic acute regulatory protein) [Moog- Lutz et al. 1997], HPR (haptoglobin-related protein) [Shurbaji et al. 1991], ANG (angiogenin) [Dutta et al. 2014], IGF2 [Gebeshuber and Martinez, 2013], GPC3 [Castillo et al. 2016], PTX3 [Chang et al. 2015], TFF1 [Prest et al. 2002], TFPI (tissue factor pathway inhibitor) [Sierko et al. 2015], RACK1 [Cao et al. 2011], PHACTR1 [Fils-Aimé et al. 2013] and TESC (tescalcin) [Kang et al. 2016] were important for invasion of various cancer cells, but these genes may be identified with invasion of TNBC cells. Decrease expression of enriched genes such as ACSM3 [Ruan et al. 2017], PLA2G4A [Gosenca et al. 2012], OGDHL (oxoglutarate dehydrogenase like) [Fedorova et al. 2015], DNMT3B [Roscigno et al. 2016], GDF3 [Li et al. 2012], APOM (apolipoprotein M) [Hu et al. 2015] and TFPI2 [Xu et al. 2013] were associated with advancement of various cancers, but bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

low expression of these genes may be liable for pathogenesis of TNBC. SNP in enriched genes such AGT (angiotensinogen) [González-Zuloeta et al. 2007], APOC3 [Launonen et al. 1999], FADS1 [Chen et al. 2017], SELENOP (selenoprotein P) [Ekoue et al. 2017], APOB (apolipoprotein B) [Liu et al. 2013], BCHE (butyrylcholinesterase) [Boberg et al. 2013], BMP5 [Huang et al. 2012] and UTS2 [Yumrutas et al. 2015] were involved in development of various cancers, but these polymorphic genes may be linked with development of TNBC. AKR1C3 was linked with drug resistance in hormonal-receptor positive breast cancer [Zhong et al. 2015], but this gene may be associated with chemo resistance in TNBC. LAMA1 was associated with proliferation of gastric cancer cells [Meng et al. 2016], but this gene may be involved in proliferation of TNBC cells. Methylation inactivation of tumor suppressor CAMK2N1 was liable for progression of ovarian cancer [Häfner et al. 2016], but loss of this gene may be liable for pathogenesis of TNBC. Our study found that HGD (homogentisate 1,2- dioxygenase), TYR (tyrosinase), UGT2B10, FADS2, PLP1, IARS (isoleucyl- tRNAsynthetase), ERO1A, APOA2, SLC7A2, SNCA (synuclein alpha), SLC37A4, CYP2F1, PSMA5, DCT (dopachrometautomerase), PSMD6, ADSSL1, AGMAT (agmatinase), GDF6, F11 (coagulation factor XI), UBB (ubiquitin B), FGL1, APOH (apolipoprotein H), IL23A, SERPINC1, PRSS2, SAAL1, TNFSF9, ITIH2, RBMX (RNA binding motif protein X-linked), TAC3, C8A, GAL (galanin and GMAP prepropeptide), ORM1, INA (internexin neuronal intermediate filament protein alpha), HBA2, HBG2, SERPIND1, VIL1, PTTG2, PPP1R26 and CAMK2N2 are down regulated in TNBC and has potential as a novel diagnostic and prognostic biomarker, and therapeutic target.

In PPI network for up regulated genes were identified as hub genes showing with highest node degree, betweenness, stress, closeness, and low clustering coefficient. DERL3 was associated with pathogenesis of TNBC [Shibata et al. 2017]. Our study found that IGFLR1 is up regulated in TNBC and has potential as a novel diagnostic and prognostic biomarker, and therapeutic target. Similarly, in PPI network for down regulated genes were identified as hub genes showing the highest node degree, betweenness, stress, closeness, and low clustering coefficient. Genes such as HSP90AB1 [Cheng et al. 2012] and PCNA [Yu et al. 2013] were responsible for progression of TNBC. HNRNPA1 important for invasion of bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

hormonal-receptor positive breast cancer cells [Loh et al. 2015], but this gene may be liable for invasion of TNBC cells.

In module analysis, up regulated genes were identified as hub genes showing the highest node degree in all four significant modules. SLA was identified as novel biomarker for pathogenesis of TNBC. Similarly, down regulated genes were identified as hub genes showing the highest node degree in all four significant modules. Genes such as CCT2 [Guest et al. 2015], CCT8 [Qiu et al. 2015], CCNA2 [Gao et al. 2014] and CCNB1 [Ding et al. 2014] were involved in proliferation of various cancer cells, but these genes may be linked with proliferation of TNBC cells. Genes such as CCT6A [Huang et al. 2019], CDK1 [Liu et al. 2014], SKP2 [Huang et al. 2015] and CDC20 [Karra et al. 2014] were important for advancement of TNBC. Low expression of genes such as EIF3E [Gillis and Lewis, 2013] and EIF3I [Lin et al. 2014] were liable for development of various cancers, but less expression of these genes may be assoited with progression of TNBC. Our study found that CCT4 and TUBA1B are down regulated in TNBC and has potential as a novel diagnostic and prognostic biomarker, and therapeutic target.

In target gene ‐ miRNA network, up regulated genes were identified as target genes showing the highest number of integration with miRNAs. Decrease expression of CCDC80 was involved in development of thyroid cancer [Ferraro et al. 2013], but less expression of this gene may be liable for progression of TNBC. Methylation inactivation KLF2 was important for development gastric cancer [Nie et al. 2017], but loss this gene may be associated with progression of TNBC. Our study found that CDH7 is up regulated in TNBC and has potential as a novel diagnostic and prognostic biomarker, and therapeutic target. Similarly, down regulated genes were identified as target genes showing the highest number of integration with miRNAs. Genes such as PEG10 [Li et al. 2016] and PTP4A1 [Hu et al. 2016] were associated with invasion of hormonal-receptor positive breast cancer cells, but these genes may be involved in invasion of TNBC cells.

In target gene ‐ TF network, up regulated genes were identified as target genes showing the highest number of integration with TFs. HOPX was responsible for pathogensis of TNBC [Tanaka et al. 2019]. ACTA2 was involved in invasion of hormonal-receptor positive breast cancer cells [Jeon et al. 2016], but this gene bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

may be linked with invasion of TNBC cells. SNP in CYP1B1 was liable for advancement of hormonal-receptor positive breast cancer [Ahsan et al. 2004], but this poly morphic gene may be responsible for development of TNBC. Similarly, down regulated genes were identified as target genes showing the highest number of integration with TFs. Methylation inactivation of tumorsupressor NR0B2 was associated witrh peogression of renal cancer [Kudryavtseva et al. 2018], but loss of this gene may be important for pathogensis of TNBC. CCNB2 was linked with progression of TNBC [Shubbar et al. 2013].

Identified ten hub genes from PPI network were validated by survival analysis, expression analysis, stage analysis, mutation analysis, IHC analysis, ROC analysis, RT-PCR and immune infiltration analysis. Future studies with in-depth verification of more candidate genes.

In conclusion, a total of 949 DEGs are identified by GEO profile, and ADAM15, BATF, NOTCH3, ITGAX, SDC1, RPL4, EEF1G, RPL3, RBMX and ABCC2 may be the key genes relevant to TNBC. Comprehensive bioinformatics analysis is a powerful tool for the biomarker screening. The interaction among selected proteins provides essential report on the development of TNBC, and molecular mechanism underlying the incidence, progression, metastasis and drug resistance of cancers. However, the predictive values of these biomarkers should be proved in more studies before their clinical application. The molecular mechanism elemental the activities of these genes is also required to be clear up, which is helpful for the picture of the predicted network of these genes. We optimize the parameters of integrated bioinformatics analysis to screen the ability biomarkers for the initial TNBC diagnosis, prognosis and thraputic targates, and we prospect our study implements novel approaches for the inital diagnosis, prognosis and thraputic targates of TNBC.

Acknowledgement

I thank Benjamin Haibe-Kains, Princess Margaret Cancer Centre, Princess Margaret Research, Bioinformatics and Computational Genomics, 610 University Avenue, Toronto, Ontario, Canada, very much, the author who deposited their microarray dataset, GSE88715, into the public GEO database.

Conflict of interest bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

The authors declare that they have no conflict of interest.

Ethical approval

This article does not contain any studies with human participants or animals performed by any of the authors.

Informed consent

No informed consent because this study does not contain human or animals participants.

Availability of data and materials

The datasets supporting the conclusions of this article are available in the GEO (Gene Expression Omnibus) (https://www.ncbi.nlm.nih.gov/geo/) repository. [(GSE88715) (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc= GSE88715)]

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Author Contributions

B. V. - Writing original draft, and review and editing

C. V. - Software and investigation

I. K. - Supervision and resources

Authors

Basavaraj Vastrad ORCID ID: 0000-0003-2202-7637

Chanabasayya Vastrad ORCID ID: 0000-0003-3615-4450

Iranna Kotturshetti ORCID ID: 0000-0003-1988-7345

References bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Abdulkarim BS, Cuartero J, Hanson J, Deschênes J, Lesniak D, Sabri S (2011) Increased risk of locoregional recurrence for women with T1-2N0 triple-negative breast cancer treated with modified radical mastectomy without adjuvant radiation therapy compared with breast-conserving therapy. J Clin Oncol 29(21):2852-2858. doi:10.1200/JCO.2010.33.4714

Agarwal D, Goodison S, Nicholson B, Tarin D, Urquidi V (2003) Expression of matrix metalloproteinase 8 (MMP-8) and tyrosinase-related protein-1 (TYRP-1) correlates with the absence of metastasis in an isogenic human breast cancer model. Differentiation.71(2):114-125. doi:10.1046/j.1432-0436.2003.710202.x

Aghaei M, Karami-Tehrani F, Salami S, Atri M (2005) Adenosine deaminase activity in the serum and malignant tumors of breast cancer: the assessment of isoenzyme ADA1 and ADA2 activities. Clin Biochem 38(10):887-891. doi:10.1016/j.clinbiochem.2005.05.015

Aghaei M, Karami-Tehrani F, Salami S, Atri M (2010) Diagnostic value of adenosine deaminase activity in benign and malignant breast tumors. Arch Med Res 41(1):14-18. doi:10.1016/j.arcmed.2009.10.012

Ahsan H, Chen Y, Whittemore AS, Kibriya MG, Gurvich I, Senie RT, Santella RM (2004) A family-based genetic association study of variants in estrogen- metabolism genes COMT and CYP1B1 and breast cancer risk. Breast Cancer Res Treat 85(2):121-131. doi:10.1023/B:BREA.0000025401.60794.68

Amamoto R, Yagi M, Song Y, Oda Y, Tsuneyoshi M, Naito S, Yokomizo A, Kuroiwa K, Tokunaga S, Kato S et al (2011) Mitochondrial p32/C1QBP is highly expressed in prostate cancer and is associated with shorter prostate-specific antigen relapse time after radical prostatectomy. Cancer Sci 102(3):639-647. doi:10.1111/j.1349-7006.2010.01828.x

Antalis CJ, Arnold T, Rasool T, Lee B, Buhman KK, Siddiqui RA (2010) High ACAT1 expression in estrogen receptor negative basal-like breast cancer cells is associated with LDL-induced proliferation. Breast Cancer Res Treat 122(3):661- 670. doi:10.1007/s10549-009-0594-8

Araujo JM, Gomez AC, Aguilar A, Salgado R, Balko JM, Bravo L, Doimi F, Bretel D, Morante Z, Flores C et al (2018) Effect of CCL5 expression in the bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

recruitment of immune cells in triple negative breast cancer. Sci Rep 8(1):4899. doi:10.1038/s41598-018-23099-7

Asur S, Ucar D, Parthasarathy S (2007) An ensemble framework for clustering protein-protein interaction networks. Bioinformatics 23(13):i29-i40. doi:10.1093/bioinformatics/btm212

Azzato EM, Lee AJ, Teschendorff A, Ponder BA, Pharoah P, Caldas C, Maia AT (2010) Common germ-line polymorphism of C1QA and breast cancer survival. Br J Cancer 102(8):1294-1299. doi:10.1038/sj.bjc.6605625

Bae SY, Jung SP, Lee SK, Yu J, Lee JE, Kim SW, Nam SJ (2018) Prognostic value of immunohistochemically detected p53 in adjuvant chemotherapy-treated triple negative breast cancer. Kaohsiung J Med Sci 34(12):663-672. doi:10.1016/j.kjms.2018.07.003

Bajikar SS, Wang CC, Borten MA, Pereira EJ, Atkins KA, Janes KA (2017) Tumor-Suppressor Inactivation of GDF11 Occurs by Precursor Sequestration in Triple-Negative Breast Cancer. Dev Cell 43(4):418-435.e13. doi:10.1016/j.devcel.2017.10.027

Bajo AM, Schally AV, Halmos G, Nagy A (2003) Targeted doxorubicin- containing luteinizing hormone-releasing hormone analogue AN-152 inhibits the growth of doxorubicin-resistant MX-1 human breast cancers. Clin Cancer Res 9(10 Pt 1):3742-3748.

Barollo S, Bertazza L, Watutantrige-Fernando S, Censi S, Cavedon E, Galuppini F, Pennelli G, Fassina A, Citton M, Rubin B et al (2016) Overexpression of L-Type Amino Acid Transporter 1 (LAT1) and 2 (LAT2): Novel Markers of Neuroendocrine Tumors. PLoS One 11(5):e0156044. doi:10.1371/journal.pone.0156044

Barrett T, Wilhite SE, Ledoux P, Evangelista C, Kim IF, Tomashevsky M, Marshall KA, Phillippy KH, Sherman PM, Holko M et al (2013) NCBI GEO: archive for functional genomics data sets--update. Nucleic Acids Res 41(Database issue):D991-D995. doi:10.1093/nar/gks1193 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Baracco EE, Pietrocola F, Buqué A, Bloy N, Senovilla L, Zitvogel L, Vacchelli E, Kroemer G (2016) Inhibition of formyl peptide receptor 1 reduces the efficacy of anticancer chemotherapy against carcinogen-induced breast cancer. Oncoimmunology 5(6):e1139275. doi:10.1080/2162402X.2016.1139275

Bauer KR, Brown M, Cress RD, Parise CA, Caggiano V (2007) Descriptive analysis of estrogen receptor (ER)-negative, progesterone receptor (PR)-negative, and HER2-negative invasive breast cancer, the so-called triple-negative phenotype: a population-based study from the California cancer Registry. Cancer 109(9):1721-1728. doi:10.1002/cncr.22618

Bhola NE, Balko JM, Dugger TC, Kuba MG, Sánchez V, Sanders M, Stanford J, Cook RS, Arteaga CL (2013) TGF-β inhibition enhances chemotherapy action against triple-negative breast cancer. J Clin Invest 123(3):1348-1358. doi:10.1172/JCI65416

Boberg DR, Batistela MS, Pecharki M, Ribeiro EM, Cavalli IJ, Lima RS, Urban CA, Furtado-Alle L, Souza RL (2013) Copy number variation in ACHE/EPHB4 (7q22) and in BCHE/MME (3q26) genes in sporadic breast cancer. Chem Biol Interact 203(1):344-347. doi:10.1016/j.cbi.2012.09.020

Boleij A, Roelofs R, Schaeps RM, Schülin T, Glaser P, Swinkels DW, Kato I, Tjalsma H (2010) Increased exposure to bacterial antigen RpL7/L12 in early stage colorectal cancer patients. Cancer 116(17):4014-4022. doi:10.1002/cncr.25212

Bottai G, Diao L, Baggerly KA, Paladini L, Győrffy B, Raschioni C, Pusztai L, Calin GA, Santarpia L (2017) Integrated MicroRNA-mRNA Profiling Identifies Oncostatin M as a Marker of Mesenchymal-Like ER-Negative/HER2-Negative Breast Cancer. Int J Mol Sci 18(1). doi:10.3390/ijms18010194

Boyle P (2012) Triple-negative breast cancer: epidemiological considerations and recommendations. Ann Oncol 6:vi7-vi12. doi:10.1093/annonc/mds187

Breuer K, Foroushani AK, Laird MR, Chen C, Sribnaia A, Lo R, Winsor GL, Hancock RE, Brinkman FS, Lynn DJ (2013) InnateDB: systems biology of innate immunity and beyond--recent updates and continuing curation. Nucleic Acids Res 41(Database issue):D1228-33. doi:10.1093/nar/gks1147 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Briggs KJ, Koivunen P, Cao S, Backus KM, Olenchock BA, Patel H, Zhang Q, Signoretti S, Gerfen GJ, Richardson AL at al (2016) Paracrine Induction of HIF by Glutamate in Breast Cancer: EglN1 Senses Cysteine. Cell 166(1):126-39. doi:10.1016/j.cell.2016.05.042

Bronger H, Kraeft S, Schwarz-Boeger U, Cerny C, Stöckel A, Avril S, Kiechle M, Schmitt M (2012) Modulation of CXCR3 ligand secretion by prostaglandin E2 and cyclooxygenase inhibitors in human breast cancer. Breast Cancer Res 14(1):R30. doi:10.1186/bcr3115

Cao F, Wang K, Zhu R, Hu YW, Fang WZ, Ding HZ (2013) Clinicopathological significance of reduced SPARCL1 expression in human breast cancer. Asian Pac J Cancer Prev 14(1):195-200. doi:10.7314/apjcp.2013.14.1.195

Cao XX, Xu JD, Xu JW, Liu XL, Cheng YY, Li QQ, Xu ZD, Liu XP (2011) RACK1 promotes breast carcinoma migration/metastasis via activation of the RhoA/Rho kinase pathway. Breast Cancer Res Treat 126(3):555-563. doi:10.1007/s10549-010-0955-3

Camarda R, Zhou AY, Kohnz RA, Balakrishnan S, Mahieu C, Anderton B, Eyob H, Kajimura S, Tward A, Krings G et al (2016) Inhibition of fatty acid oxidation as a therapy for MYC-overexpressing triple-negative breast cancer. Nat Med 22(4):427-432. doi:10.1038/nm.4055

Caspi R, Billington R, Ferrer L, Foerster H, Fulcher CA, Keseler IM, Kothari A, Krummenacker M, Latendresse M, Mueller LA et al (2016) The MetaCyc database of metabolic pathways and enzymes and the BioCyc collection of pathway/genome databases. Nucleic Acids Res 44(D1)D471-D480. doi:10.1093/nar/gkv1164

Castillo LF, Tascón R, Lago Huvelle MR, Novack G, Llorens MC, Dos Santos AF, Shortrede J, Cabanillas AM, Bal de Kier Joffé E, Labriola L et al (2016) Glypican- 3 induces a mesenchymal to epithelial transition in human breast cancer cells. Oncotarget 7(37):60133-60154. doi:10.18632/oncotarget.11107

Chan HJ, Li H, Liu Z, Yuan YC, Mortimer J, Chen S (2015) SERPINA1 is a direct estrogen receptor target gene and a predictor of survival in breast cancer patients. Oncotarget 6(28):25815-25827. doi:10.18632/oncotarget.4441 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Chandrashekar DS, Bashel B, Balasubramanya SAH, Creighton CJ, Ponce- Rodriguez I, Chakravarthi BVSK, Varambally S (2017) UALCAN: A Portal for Facilitating Tumor Subgroup Gene Expression and Survival Analyses. Neoplasia 19(8):649-658. doi:10.1016/j.neo.2017.05.002

Chandrasinghe P, Stebbing J, Warusavitarne J (2017) The MACC1-SPON2 axis: a new biomarker and therapeutic target in colorectal cancer. Oncogene 36(11):1474- 1475. doi:10.1038/onc.2016.322

Charbonneau B, Block MS, Bamlet WR, Vierkant RA, Kalli KR, Fogarty Z, Rider DN, Sellers TA, Tworoger SS, Poole E et al (2014) Risk of ovarian cancer and the NF-κB pathway: genetic association with IL1A and TNFSF10. Cancer Res 74(3):852-861. doi:10.1158/0008-5472.CAN-13-1051

Chatr-Aryamontri A, Oughtred R, Boucher L, Rust J, Chang C, Kolas NK, O'Donnell L, Oster S, Theesfeld C, Sellam A et al (2017) The BioGRID interaction database: 2017 update. Nucleic Acids Res 45(D1):D369-D379. doi:10.1093/nar/gkw1102

Chang WC, Wu SL, Huang WC, Hsu JY, Chan SH, Wang JM, Tsai JP, Chen BK (2015) PTX3 gene activation in EGF-induced head and neck cancer cell metastasis. Oncotarget 6(10):7741-7757. doi:10.18632/oncotarget.3482

Chang YC, Chi LH, Chang WM, Su CY, Lin YF, Chen CL, Chen MH Chang PM, Wu AT, Hsiao M (2017) Glucose transporter 4 promotes head and neck squamous cell carcinoma metastasis through the TRIM24-DDX58 axis. J Hematol Oncol 10(1):11. doi:10.1186/s13045-016-0372-0

Chen CY, Ho A, Huang HY, Juan HF, Huang HC (2014) Dissecting the human protein-protein interaction network via phylogenetic decomposition. Sci Rep 4:7153. doi:10.1038/srep07153

Chen F, He B, Yan L, Qiu Y, Lin L, Cai L (2017) FADS1 rs174549 Polymorphism May Predict a Favorable Response to Chemoradiotherapy in Oral Cancer Patients. J Oral Maxillofac Surg 75(1):214-220. doi:10.1016/j.joms.2016.07.005 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Chen J, Wei D, Zhao Y, Liu X, Zhang J (2013) Overexpression of EFEMP1 correlates with tumor progression and poor prognosis in human ovarian carcinoma. PLoS One 8(11):e78783. doi:10.1371/journal.pone.0078783

Chen L, Yuan L, Wang Y, Wang G, Zhu Y, Cao R, Qian G, Xie C, Liu X, Xiao Y et al (2017) Co-expression network analysis identified FCER1G in association with progression and prognosis in human clear cell renal cell carcinoma. Int J Biol Sci 13(11):1361-1372. doi:10.7150/ijbs.21657

Chen Y, Zhang S, Wang Q, Zhang X (2017) Tumor-recruited M2 macrophages promote gastric and breast cancer metastasis via M2 macrophage-secreted CHI3L1 protein. J Hematol Oncol 10(1):36. doi:10.1186/s13045-017-0408-0

Chen Z, Ruan Q, Han S, Xi L, Jiang W, Jiang H, Ostrov DA, Cai J (2014) Discovery of structure-based small molecular inhibitor of αB-crystallin against basal-like/triple-negative breast cancer development in vitro and in vivo. Breast Cancer Res Treat 145(1):45-59. doi:10.1007/s10549-014-2940-8

Chen Z, Yan X, Li K, Ling Y, Kang H (2019) Stromal fibroblast-derived MFAP5 promotes the invasion and migration of breast cancer cells via Notch1/slug signaling. Clin Transl Oncol. doi:10.1007/s12094-019-02156-1

Cheng Q, Chang JT, Geradts J, Neckers LM, Haystead T, Spector NL, Lyerly HK (2012) Amplification and high-level expression of heat shock protein 90 marks aggressive phenotypes of human epidermal growth factor receptor 2 negative breast cancer. Breast Cancer Res 14(2):R62. doi:10.1186/bcr3168

Cheriyath V, Kaur J, Davenport A, Khalel A, Chowdhury N, Gaddipati L (2018) G1P3 (IFI6), a mitochondrial localised antiapoptotic protein, promotes metastatic potential of breast cancer cells through mtROS. Br J Cancer 119(1):52-64. doi:10.1038/s41416-018-0137-3

Chiang K, Zielinska AE, Shaaban AM, Sanchez-Bailon MP, Jarrold J, Clarke TL, Zhang J, Francis A, Jones LJ, Smith S et al (2017) PRMT5 Is a Critical Regulator of Breast Cancer Stem Cell Function via Histone Methylation and FOXP1 Expression. Cell Rep 21(12):3498-3513. doi:10.1016/j.celrep.2017.11.096 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Chien CY, Chuang HC, Chen CH, Fang FM, Chen WC, Huang CC, Huang HY (2013) The expression of activin receptor-like kinase 1 among patients with head and neck cancer. Otolaryngol Head Neck Surg 148(6):965-973. doi:10.1177/0194599813479556

Choi C, Kwon J, Lim S, Helfman DM (2016) Integrin β1, myosin light chain kinase and myosin IIA are required for activation of PI3K-AKT signaling following MEK inhibition in metastatic triple negative breast cancer. Oncotarget 7(39):63466-63487. doi:10.18632/oncotarget.11525

Chong PK, Lee H, Zhou J, Liu SC, Loh MC, Wang TT, Chan SP, Smoot DT, Ashktorab H, So JB et al (2010) ITIH3 is a potential biomarker for early detection of gastric cancer. J Proteome Res 9(7):3671-3679. doi:10.1021/pr100192h

Chou CH, Shrestha S, Yang CD, Chang NW, Lin YL, Liao KW, Huang WC, Sun TH, Tu SJ, Lee WH et al (2018) miRTarBase update 2018: a resource for experimentally validated microRNA-target interactions. Nucleic Acids Res 46(D1):D296-D302. doi:10.1093/nar/gkx1067

Cine N, Baykal AT, Sunnetci D, Canturk Z, Serhatli M, Savli H (2014) Identification of ApoA1, HPX and POTEE genes by omic analysis in breast cancer. Oncol Rep 32(3):1078-1086. doi:10.3892/or.2014.3277

Cook RM, Burke BJ, Buchhagen DL, Minna JD, Miller YE (1993) Human aminoacylase-1. Cloning, sequence, and expression analysis of a chromosome 3p21 gene inactivated in small cell lung cancer. J Biol Chem 268(23):17010- 17017.

Cui W, Zhao Y, Shan C, Kong G, Hu N, Zhang Y, Zhang S, Zhang W, Zhang Y, Zhang X et al (2012) HBXIP upregulates CD46, CD55 and CD59 through ERK1/2/NF-κB signaling to protect breast cancer cells from complement attack. FEBS Lett 586(6):766-771. doi:10.1016/j.febslet.2012.01.039

Cui X, Jing X, Yi Q, Long C, Tian J, Zhu J (2017) Clinicopathological and prognostic significance of SDC1 overexpression in breast cancer. Oncotarget 8(67):111444-111455. doi:10.18632/oncotarget.22820 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Dahlquist KD, Salomonis N, Vranizan K, Lawlor SC, Conklin BR (2002) GenMAPP, a new tool for viewing and analyzing microarray data on biological pathways. Nat Genet 31(1)19-20. doi:10.1038/ng0502-19

Dai E, Yu X, Zhang Y, Meng F, Wang S, Liu X, Liu D, Wang J, Li X, Jiang W (2014) EpimiR: a database of curated mutual regulation between miRNAs and epigenetic modifications. Database (Oxford).;2014:bau023. doi:10.1093/database/bau023

D'Amato NC, Rogers TJ, Gordon MA, Greene LI, Cochrane DR, Spoelstra NS, Nemkov TG, D'Alessandro A, Hansen KC, Richer JK (2015) A TDO2-AhR signaling axis facilitates anoikis resistance and metastasis in triple-negative breast cancer. Cancer Res 75(21):4651-4664. doi:10.1158/0008-5472.CAN-15-2011

Danish HH, Goyal S, Taunk NK, Wu H, Moran MS, Haffty BG (2013) Interferon- induced protein with tetratricopeptide repeats 1 (IFIT1) as a prognostic marker for local control in T1-2 N0 breast cancer treated with breast-conserving surgery and radiation therapy (BCS + RT). Breast J 19(3):231-239. doi:10.1111/tbj.12097

Das DK, Ogunwobi OO (2017) A novel microRNA-1207-3p/FNDC1/FN1/AR regulatory pathway in prostate cancer. RNA Dis 4(1).

Das SG, Romagnoli M, Mineva ND, Barillé-Nion S, Jézéquel P, Campone M, Sonenshein GE (2016) miR-720 is a downstream target of an ADAM8-induced ERK signaling cascade that promotes the migratory and invasive phenotype of triple-negative breast cancer cells. Breast Cancer Res 18(1):40. doi:10.1186/s13058-016-0699-z

Dawoody Nejad L, Biglari A, Annese T, Ribatti D (2017) Recombinant fibromodulin and decorin effects on NF-κB and TGFβ1 in the 4T1 breast cancer cell line. Oncol Lett 13(6):4475-4480. doi:10.3892/ol.2017.5960

De P, Carlson JH, Jepperson T, Willis S, Leyland-Jones B, Dey N (2017) RAC1 GTP-ase signals Wnt-beta-catenin pathway mediated integrin-directed metastasis- associated tumor cell phenotypes in triple negative breast cancers. Oncotarget 8(2):3072-3103. doi:10.18632/oncotarget.13618 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Ding K, Li W, Zou Z, Zou X, Wang C (2014) CCNB1 is a prognostic biomarker for ER+ breast cancer. Med Hypotheses 83(3):359-364. doi:10.1016/j.mehy.2014.06.013

Diquigiovanni C, Bergamini C, Evangelisti C, Isidori F, Vettori A, Tiso N, Argenton F, Costanzini A, Iommarini L, Anbunathan H et al (2018) Mutant MYO1F alters the mitochondrial network and induces tumor proliferation in thyroid cancer. Int J Cancer. doi:10.1002/ijc.31548

Dixon MR, Haukoos JS, Udani SM, Naghi JJ, Arnell TD, Kumar RR, Stamos MJ (2003) Carcinoembryonic antigen and albumin predict survival in patients with advanced colon and rectal cancer. Arch Surg 138(9):962-966. doi:10.1001/archsurg.138.9.962

Djonov V, Högger K, Sedlacek R, Laissue J, Draeger A (2001) MMP-19: cellular localization of a novel metalloproteinase within normal breast tissue and mammary gland tumours. J Pathol.;195(2):147-155. doi:10.1002/path.927

Dong T, Liu Z, Xuan Q, Wang Z, Ma W, Zhang Q (2017) Tumor LDH-A expression and serum LDH status are two metabolic predictors for triple negative breast cancer brain metastasis. Sci Rep 7(1):6069. doi:10.1038/s41598-017-06378- 7

Duan S, Gong B, Wang P, Huang H, Luo L, Liu F (2018) Novel prognostic biomarkers of gastric cancer based on gene expression microarray: COL12A1, GSTA3, FGA and FGG. Mol Med Rep 18(4):3727-3736. doi:10.3892/mmr.2018.9368

Dutta S, Bandyopadhyay C, Bottero V, Veettil MV, Wilson L, Pins MR, Johnson KE, Warshall C, Chandran B (2014) Angiogenin interacts with the plasminogen activation system at the cell surface of breast cancer cells to regulate plasmin formation and cell migration. Mol Oncol 8(3):483-507. doi:10.1016/j.molonc.2013.12.017

Ekoue DN, Zaichick S, Valyi-Nagy K, Picklo M, Lacher C, Hoskins K, Warso MA, Bonini MG, Diamond AM (2017) Selenium levels in human breast carcinoma tissue are associated with a common polymorphism in the gene for SELENOP bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

(Selenoprotein P). J Trace Elem Med Biol 39:227-233. doi:10.1016/j.jtemb.2016.11.003

El Ansari R, Craze ML, Miligy I, Diez-Rodriguez M, Nolan CC, Ellis IO, Rakha EA, Green AR (2018) The amino acid transporter SLC7A5 confers a poor prognosis in the highly proliferative breast cancer subtypes and is a key therapeutic target in luminal B tumours. Breast Cancer Res 20(1):21. doi:10.1186/s13058-018- 0946-6

Englund E, Bartoschek M, Reitsma B, Jacobsson L, Escudero-Esparza A, Orimo A, Leandersson K, Hagerling C, Aspberg A, Storm P et al (2016) Cartilage oligomeric matrix protein contributes to the development and metastasis of breast cancer. Oncogene 35(43):5585-5596. doi:10.1038/onc.2016.98

Ercolani C, Di Benedetto A, Terrenato I, Pizzuti L, Di Lauro L, Sergi D, Sperati F, Buglioni S, Ramieri MT, Mentuccia L et al (2017) Expression of phosphorylated Hippo pathway kinases (MST1/2 and LATS1/2) in HER2-positive and triple- negative breast cancer patients treated with neoadjuvant therapy. Cancer Biol Ther 18(5):339-346. doi:10.1080/15384047.2017.1312230

Fabregat A, Jupe S, Matthews L, Sidiropoulos K, Gillespie M, Garapati P, Haw R, Jassal B, Korninger F, May B et al (2018) The Reactome Pathway Knowledgebase. Nucleic Acids Res 46(D1):D649-D655. doi:10.1093/nar/gkx1132

Fan Y, Xia J (2018) miRNet-Functional Analysis and Visual Exploration of miRNA-Target Interactions in a Network Context. Methods Mol Biol 1819:215- 233. doi:10.1007/978-1-4939-8618-7_10

Fang WB, Yao M, Brummer G, Acevedo D, Alhakamy N, Berkland C, Cheng N (2016) Targeted gene silencing of CCL2 inhibits triple negative breast cancer progression by blocking cancer stem cell renewal and M2 macrophage recruitment. Oncotarget 7(31):49349-49367. doi:10.18632/oncotarget.9885

Fedorova MS, Kudryavtseva AV, Lakunina VA, Snezhkina AV, Volchenko NN, Slavnova EN, Danilova TV, Sadritdinova AF, Melnikova NV, Belova AA et al (2015) Downregulation of OGDHL expression is associated with promoter hypermethylation in colorectal cancer. Mol Biol (Mosk) 49(4):678-88. doi:10.7868/S0026898415040047 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Fei W, Chen L, Chen J, Shi Q, Zhang L, Liu S, Li L, Zheng L, Hu X (2017) RBP4 and THBS2 are serum biomarkers for diagnosis of colorectal cancer. Oncotarget 8(54):92254-92264. doi:10.18632/oncotarget.21173

Ferraro A, Schepis F, Leone V, Federico A, Borbone E, Pallante P, Berlingieri MT, Chiappetta G, Monaco M, Palmieri D et al (2013) Tumor suppressor role of the CL2/DRO1/CCDC80 gene in thyroid carcinogenesis. J Clin Endocrinol Metab 98(7):2834-2843. doi:10.1210/jc.2012-2926

Fils-Aimé N, Dai M, Guo J, El-Mousawi M, Kahramangil B, Neel JC, Lebrun JJ (2013) MicroRNA-584 and the protein phosphatase and actin regulator 1 (PHACTR1), a new signaling route through which transforming growth factor-β Mediates the migration and actin dynamics of breast cancer cells. J Biol Chem 288(17):11807-11823. doi:10.1074/jbc.M112.430934

Försti A, Jin Q, Altieri A, Johansson R, Wagner K, Enquist K, Grzybowska E, Pamula J, Pekala W, Hallmans G, Lenner P et al (2007) Polymorphisms in the KDR and POSTN genes: association with breast cancer susceptibility and prognosis. Breast Cancer Res Treat 101(1):83-93. doi:10.1007/s10549-006-9265-1

Gai X, Tu K, Lu Z, Zheng X (2014) MRC2 expression correlates with TGFβ1 and survival in hepatocellular carcinoma. Int J Mol Sci 15(9):15011-15025. doi:10.3390/ijms150915011

Gao A, Zhang L, Chen X, Chen Y, Xu Z, Liu Y, Zhu W (2015) Effect of VTCN1 on progression and metastasis of ovarian carcinoma in vitro and vivo. Biomed Pharmacother 73:129-34. doi:10.1016/j.biopha.2015.05.016

Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, Sun Y, Jacobsen A, Sinha R, Larsson E et al (2013) Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal 6(269):pl1. doi:10.1126/scisignal.2004088

Gao S, Ge A, Xu S, You Z, Ning S, Zhao Y, Pang D (2017) PSAT1 is regulated by ATF4 and enhances cell proliferation via the GSK3β/β-catenin/cyclin D1 signaling pathway in ER-negative breast cancer. J Exp Clin Cancer Res 36(1):179. doi:10.1186/s13046-017-0648-4 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Gao T, Han Y, Yu L, Ao S, Li Z, Ji J (2014) CCNA2 is a prognostic biomarker for ER+ breast cancer and tamoxifen resistance. PLoS One 9(3):e91771. doi:10.1371/journal.pone.0091771

Gavin PG, Song N, Kim SR, Lipchik C, Johnson NL, Bandos H, Finnigan M, Rastogi P, Fehrenbacher L, Mamounas EP et al (2017) Association of Polymorphisms in FCGR2A and FCGR3A With Degree of Trastuzumab Benefit in the Adjuvant Treatment of ERBB2/HER2-Positive Breast Cancer: Analysis of the NSABP B-31 Trial. JAMA Oncol 3(3):335-341. doi:10.1001/jamaoncol.2016.4884

Gebeshuber CA, Martinez J (2013) miR-100 suppresses IGF2 and inhibits breast tumorigenesis by interfering with proliferation and survival signaling. Oncogene 32(27):3306-3310. doi:10.1038/onc.2012.372

Ghayad SE, Vendrell JA, Bieche I, Spyratos F, Dumontet C, Treilleux I, Lidereau R, Cohen PA (2009) Identification of TACC1, NOV, and PTTG1 as new candidate genes associated with endocrine therapy resistance in breast cancer. J Mol Endocrinol 42(2):87-103. doi:10.1677/JME-08-0076

Giatromanolaki A, Sivridis E, Kalamida D, Koukourakis MI (2017) Transcription Factor EB Expression in Early Breast Cancer Relates to Lysosomal/Autophagosomal Markers and Prognosis. Clin Breast Cancer 17(3):e119-e125. doi:10.1016/j.clbc.2016.11.006

Gillis LD, Lewis SM (2013) Decreased eIF3e/Int6 expression causes epithelial-to- mesenchymal transition in breast epithelial cells. Oncogene 32(31):3598-605. doi:10.1038/onc.2012.371

González-Bengtsson A, Asadi A, Gao H, Dahlman-Wright K, Jacobsson A (2016) Estrogen Enhances the Expression of the Polyunsaturated Fatty Acid Elongase Elovl2 via ERα in Breast Cancer Cells. PLoS One 11(10):e0164241. doi:10.1371/journal.pone.0164241

González-Zuloeta Ladd AM, Arias Vásquez A, Siemes C, Yazdanpanah M, Coebergh JW, Hofman A, Stricker BH, van Duijn CM (2007) Differential roles of Angiotensinogen and Angiotensin Receptor type 1 polymorphisms in breast cancer risk. Breast Cancer Res Treat 101(3):299-304. doi:10.1007/s10549-006-9290-0 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Gosenca D, Gabriel U, Steidler A, Mayer J, Diem O, Erben P, Fabarius A, Leib- Mösch C, Hofmann WK, Seifarth W (2012) HERV-E-mediated modulation of PLA2G4A transcription in urothelial carcinoma. PLoS One 7(11):e49341. doi:10.1371/journal.pone.0049341

Gozgit JM, Pentecost BT, Marconi SA, Ricketts-Loriaux RS, Otis CN, Arcaro KF (2007) PLD1 is overexpressed in an ER-negative MCF-7 cell line variant and a subset of phospho-Akt-negative breast carcinomas. Br J Cancer 97(6):809-817. doi:10.1038/sj.bjc.6603926

Greenup R, Buchanan A, Lorizio W, Rhoads K, Chan S, Leedom T, King R, McLennan J, Crawford B, Kelly Marcom P et al (2013) Prevalence of BRCA mutations among women with triple-negative breast cancer (TNBC) in a genetic counseling cohort. Ann Surg Oncol 20(10):3254-3258. doi:10.1245/s10434-013- 3205-1

Gruosso T, Gigoux M, Manem VSK, Bertos N, Zuo D, Perlitch I, Saleh SMI, Zhao H, Souleimanova M, Johnson RM et al (2019) Spatially distinct tumor immune microenvironments stratify triple-negative breast cancers. J Clin Invest 129(4):1785-1800. doi:10.1172/JCI96313

Guest ST, Kratche ZR, Bollig-Fischer A, Haddad R, Ethier SP (2015) Two members of the TRiC chaperonin complex, CCT2 and TCP1 are essential for survival of breast cancer cells and are linked to driving oncogenes. Exp Cell Res 332(2):223-235. doi:10.1016/j.yexcr.2015.02.005

Häfner N, Steinbach D, Jansen L, Diebolder H, Dürst M, Runnebaum IB (2016) RUNX3 and CAMK2N1 hypermethylation as prognostic marker for epithelial ovarian cancer. Int J Cancer 138(1):217-28. doi:10.1002/ijc.29690

Han B, Zhou B, Qu Y, Gao B, Xu Y, Chung S, Tanaka H, Yang W, Giuliano AE, Cui X (2018) FOXC1-induced non-canonical WNT5A-MMP7 signaling regulates invasiveness in triple-negative breast cancer. Oncogene 37(10):1399-1408. doi:10.1038/s41388-017-0021-2

Han T, Liu Z, Li H, Xie W, Zhang R, Zhu L, Guo F, Han Y, Sheng Y, Xie X (2015) High expression of UBD correlates with epirubicin resistance and indicates bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

poor prognosis in triple-negative breast cancer. Onco Targets Ther 8:1643-1649. doi:10.2147/OTT.S81214

Harris MA, Clark J, Ireland A, Lomax J, Ashburner M, Foulger R, Eilbeck K, Lewis S, Marshall B, Mungall C et al (2004) The Gene Ontology (GO) database and informatics resource. Nucleic Acids Res 32(Database issue):D258-D261. doi:10.1093/nar/gkh036

He R, Liu P, Xie X, Zhou Y, Liao Q, Xiong W, Li X1, Li G, Zeng Z, Tang H (2017) circGFRA1 and GFRA1 act as ceRNAs in triple negative breast cancer by regulating miR-34a. J Exp Clin Cancer Res 36(1):145. doi:10.1186/s13046-017- 0614-1

Higashimura Y, Nakajima Y, Yamaji R, Harada N, Shibasaki F, Nakano Y, Inui H (2011) Up-regulation of glyceraldehyde-3-phosphate dehydrogenase gene expression by HIF-1 activity depending on Sp1 in hypoxic breast cancer cells. Arch Biochem Biophys 509(1):1-8. doi:10.1016/j.abb.2011.02.011

Hsu CW, Juan HF, Huang HC (2008) Characterization of microRNA-regulated protein-protein interaction network. Proteomics 8(10):1975-1979. doi:10.1002/pmic.200701004

Hu H, Li S, Cui X, Lv X, Jiao Y, Yu F, Yao H, Song E, Chen Y, Wang M et al (2013) The overexpression of hypomethylated miR-663 induces chemotherapy resistance in human breast cancer cells by targeting heparin sulfate proteoglycan 2 (HSPG2). J Biol Chem 288(16):10973-10985. doi:10.1074/jbc.M112.434340

Hu JY, Yi W, Wei X, Zhang MY, Xu R, Zeng LS, Huang ZJ, Chen JS (2016) miR-601 is a prognostic marker and suppresses cell growth and invasion by targeting PTP4A1 in breast cancer. Biomed Pharmacother 79:247-253. doi:10.1016/j.biopha.2016.02.014

Hu YW, Chen ZP, Hu XM, Zhao JY, Huang JL, Ma X, Li SF, Qiu YR, Wu XJ, Sha YH et al (2015) The miR-573/apoM/Bcl2A1-dependent signal transduction pathway is essential for hepatocyte apoptosis and hepatocarcinogenesis. Apoptosis 20(10):1321-1337. doi:10.1007/s10495-015-1153-x bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Huang C, Chen YJ, Chen WJ, Lin CL, Wei YX, Huang HC (2015) Combined treatment with chrysin and 1,2,3,4,6-penta-O-galloyl-β-D-glucose synergistically inhibits LRP6 and Skp2 activation in triple-negative breast cancer and xenografts. Mol Carcinog 54(12):1613-25. doi:10.1002/mc.22234

Huang K, Zeng Y, Xie Y, Huang L, Wu Y (2019) Bioinformatics analysis of the prognostic value of CCT6A and associated signalling pathways in breast cancer. Mol Med Rep 19(5):4344-4352. doi:10.3892/mmr.2019.10100

Huang H, Han Y, Gao J, Feng J, Zhu L, Qu L, Shen L, Shou C (2013) High level of serum AMBP is associated with poor response to paclitaxel-capecitabine chemotherapy in advanced gastric cancer patients. Med Oncol 30(4):748. doi:10.1007/s12032-013-0748-8

Huang R, Gu W, Sun B, Gao L (2018) Identification of COL4A1 as a potential gene conferring trastuzumab resistance in gastric cancer based on bioinformatics analysis. Mol Med Rep 17(5):6387-6396. doi:10.3892/mmr.2018.8664

Huang SP, Bao BY, Hour TC, Huang CY, Yu CC, Liu CC, Lee YC, Huang CN, Pao JB, Huang CH (2012) Genetic variants in CASP3, BMP5, and IRS2 genes may influence survival in prostate cancer patients receiving androgen-deprivation therapy. PLoS One 7(7):e41219. doi:10.1371/journal.pone.0041219

Huang WC, Tung SL, Chen YL, Chen PM, Chu PY (2018) IFI44L is a novel tumor suppressor in human hepatocellular carcinoma affecting cancer stemness, metastasis, and drug resistance via regulating met/Src signaling pathway. BMC Cancer 18(1):609. doi:10.1186/s12885-018-4529-9

Huang Z, Shi J, Gao Y, Cui C, Zhang S, Li J, Zhou Y, Cui Q (2019) HMDD v3.0: a database for experimentally supported human microRNA-disease associations. Nucleic Acids Res 47(D1):D1013-D1017. doi:10.1093/nar/gky1010Z

Hultgren EM, Patrick ME, Evans RL, Stoos CT, Egland KA (2017) SUSD2 promotes tumor-associated macrophage recruitment by increasing levels of MCP-1 in breast cancer. PLoS One 12(5):e0177089. doi:10.1371/journal.pone.0177089 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Iravani O, Bay BH, Yip GW (2017) Silencing HS6ST3 inhibits growth and progression of breast cancer cells through suppressing IGF1R and inducing XAF1. Exp Cell Res 350(2):380-389. doi:10.1016/j.yexcr.2016.12.019

Ivansson EL, Juko-Pecirep I, Erlich HA, Gyllensten UB (2011) Pathway-based analysis of genetic susceptibility to cervical cancer in situ: HLA-DPB1 affects risk in Swedish women. Genes Immun 12(8):605-614. doi:10.1038/gene.2011.40

Jang MH, Kim HJ, Kim EJ, Chung YR, Park SY (2015) Expression of epithelial- mesenchymal transition-related markers in triple-negative breast cancer: ZEB1 as a potential biomarker for poor clinical outcome. Hum Pathol 46(9):1267-1274. doi:10.1016/j.humpath.2015.05.010

Jeon M, You D, Bae SY, Kim SW, Nam SJ, Kim HH, Kim S, Lee JE (2016) Dimerization of EGFR and HER2 induces breast cancer cell motility through STAT1-dependent ACTA2 induction. Oncotarget 8(31):50570-50581. doi:10.18632/oncotarget.10843

Jevnikar Z, Rojnik M, Jamnik P, Doljak B, Fonovic UP, Kos J (2013) Cathepsin H mediates the processing of talin and regulates migration of prostate cancer cells. J Biol Chem 288(4):2201-2209. doi:10.1074/jbc.M112.436394

Jewison T, Su Y, Disfany FM, Liang Y, Knox C, Maciejewski A, Poelzer J, Huynh J, Zhou Y, Arndt D et al (2014) SMPDB 2.0: big improvements to the Small Molecule Pathway Database. Nucleic Acids Res 42(Database issue):D478-D484. doi:10.1093/nar/gkt1067

Jia J, Martin TA, Ye L, Jiang WG (2014) FAP-α (Fibroblast activation protein-α) is involved in the control of human breast cancer cell line growth and motility via the FAK pathway. BMC Cell Biol 15:16. doi:10.1186/1471-2121-15-16

Jiang Q, Wang Y, Hao Y, Juan L, Teng M, Zhang X, Li M, Wang G, Liu Y (2009) miR2Disease: a manually curated database for microRNA deregulation in human disease. Nucleic Acids Res 37(Database issue):D98-104. doi:10.1093/nar/gkn714

JingSong H, Hong G, Yang J, Duo Z, Li F, WeiCai C, XueYing L, YouSheng M, YiWen O, Yue P et al (2017) siRNA-mediated suppression of collagen type iv bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

alpha 2 (COL4A2) mRNA inhibits triple-negative breast cancer cell proliferation and migration. Oncotarget 8(2):2585-2593. doi:10.18632/oncotarget.13716

Kaimal V, Bardes EE, Tabar SC, Jegga AG, Aronow BJ (2010) ToppCluster: a multiple gene list feature analyzer for comparative enrichment clustering and network-based dissection of biological systems. Nucleic Acids Res 38(Web Server issue):W96-W102. doi:10.1093/nar/gkq418

Kanehisa M, Sato Y, Furumichi M, Morishima K, Tanabe M (2018) New approach for understanding genome variations in KEGG. Nucleic Acids Res. doi:10.1093/nar/gky962

Kang J, Kang YH, Oh BM, Uhm TG, Park SY, Kim TW, Han SR, Lee SJ, Lee Y, Lee HG (2016) Tescalcin expression contributes to invasive and metastatic activity in colorectal cancer. Tumour Biol 37(10):13843-13853. doi:10.1007/s13277-016- 5262-0

Kang S, Maeng H, Kim BG, Qing GM, Choi YP, Kim HY, Kim PS, Kim Y, Kim YH, Choi YD et al (2012) In situ identification and localization of IGHA2 in the breast tumor microenvironment by mass spectrometry. J Proteome Res 11(9):4567- 4574. doi:10.1021/pr3003672

Karra H, Repo H, Ahonen I, Löyttyniemi E, Pitkänen R, Lintunen M, Kuopio T, Söderström M, Kronqvist P (2014) Cdc20 and securin overexpression predict short-term breast cancer survival. Br J Cancer 110(12):2905-2913. doi:10.1038/bjc.2014.252

Kassam F, Enright K, Dent R, Dranitsaris G, Myers J, Flynn C, Fralick M, Kumar R, Clemons M (2009) Survival outcomes for patients with metastatic triple- negative breast cancer: implications for clinical practice and trial design. Clin Breast Cancer 9(1):29-33. doi:10.3816/CBC.2009.n.005

Khan A, Fornes O, Stigliani A, Gheorghe M, Castro-Mondragon JA, van der Lee R, Bessy A, Chèneby J, Kulkarni SR, Tan G et al (2018) JASPAR 2018: update of the open-access database of transcription factor binding profiles and its web framework. Nucleic Acids Res 46(D1):D1284. doi:10.1093/nar/gkx1188 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Kim HS, Han HD, Armaiz-Pena GN, Stone RL, Nam EJ, Lee JW, Shahzad MM, Nick AM, Lee SJ, Roh JW et al (2011) Functional roles of Src and Fgr in ovarian carcinoma. Clin Cancer Res 17(7):1713-1721. doi:10.1158/1078-0432.CCR-10- 2081

Kim M, Kim JH, Baek SJ, Kim SY, Kim YS (2016) Specific expression and methylation of SLIT1, SLIT2, SLIT3, and miR-218 in gastric cancer subtypes. Int J Oncol 48(6):2497-2507. doi:10.3892/ijo.2016.3473

Kim SK, Jang HR, Kim JH, Noh SM, Song KS, Kim MR, Kim SY, Yeom YI, Kim NS, Yoo HS et al (2006) The epigenetic silencing of LIMS2 in gastric cancer and its inhibitory effect on cell migration. Biochem Biophys Res Commun 349(3):1032-1040. doi:10.1016/j.bbrc.2006.08.128

Kim YJ, Gallien S, El-Khoury V, Goswami P, Sertamo K, Schlesser M, Berchem G, Domon B (2015) Quantification of SAA1 and SAA2 in lung cancer plasma using the isotype-specific PRM assays. Proteomics 15(18):3116-3125. doi:10.1002/pmic.201400382

Kleer CG, Bloushtain-Qimron N, Chen YH, Carrasco D, Hu M, Yao J, Kraeft SK, Collins LC, Sabel MS, Argani P et al (2008) Epithelial and stromal cathepsin K and CXCL14 expression in breast tumor progression. Clin Cancer Res 14(17):5357-5367. doi:10.1158/1078-0432.CCR-08-0732

Koh SY, Moon JY, Unno T, Cho SK (2019) Baicalein Suppresses Stem Cell-Like Characteristics in Radio- and Chemoresistant MDA-MB-231 Human Breast Cancer Cells through Up-Regulation of IFIT2. Nutrients 11(3).doi:10.3390/nu11030624

Krings G, Nystrom M, Mehdi I, Vohra P, Chen YY (2014) Diagnostic utility and sensitivities of GATA3 antibodies in triple-negative breast cancer. Hum Patho 45(11):2225-2232. doi:10.1016/j.humpath.2014.06.022

Kwon YJ, Hurst DR, Steg AD, Yuan K, Vaidya KS, Welch DR, Frost AR (2011) Gli1 enhances migration and invasion via up-regulation of MMP-11 and promotes metastasis in ERα negative breast cancer cell lines. Clin Exp Metastasis 28(5):437- 449. doi:10.1007/s10585-011-9382-z bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Kudryavtseva AV, Nyushko KM, Zaretsky AR, Shagin DA, Sadritdinova AF, Fedorova MS, Savvateeva MV, Guvatova ZG, Pudova EA, Alekseev BY et al (2018) Suppression of NR0B2 gene in Clear Cell Renal Cell Carcinoma Is Associated with Hypermethylation of Its Promoter. Mol Biol (Mosk) 52(3):482- 488. doi:10.7868/S0026898418030114

Kuo SJ, Chien SY, Lin C, Chan SE, Tsai HT, Chen DR (2010) Significant elevation of CLDN16 and HAPLN3 gene expression in human breast cancer. Oncol Rep 24(3):759-766. doi:10.3892/or_00000918

Launonen V, Laake K, Huusko P, Niederacher D, Beckmann MW, Barkardottir RB, Geirsdottir EK, Gudmundsson J, Rio P, Bignon YJ, Seitz S et al (1999) European multicenter study on LOH of APOC3 at 11q23 in 766 breast cancer patients: relation to clinical variables. Breast Cancer Somatic Genetics Consortium. Br J Cancer 80(5-6):879-882. doi:10.1038/sj.bjc.6690435

Lawrence RT, Perez EM, Hernández D, Miller CP, Haas KM, Irie HY, Lee SI, Blau CA, Villén J (2015) The Proteomic Landscape of Triple-Negative Breast Cancer. Cell Rep 11(6):990. doi:10.1016/j.celrep.2015.04.059

Lee SW, Chen TJ, Lin LC, Li CF, Chen LT, Hsing CH, Hsu HP, Tsai CJ, Huang HY, Shiue YL (2013) Overexpression of thymidylate synthetase confers an independent prognostic indicator in nasopharyngeal carcinoma. Exp Mol Pathol 95(1):83-90. doi:10.1016/j.yexmp.2013.05.006

Legrand F, Driss V, Delbeke M, Loiseau S, Hermann E, Dombrowicz D (2010) Capron M. Human eosinophils exert TNF-α and granzyme A-mediated tumoricidal activity toward colon carcinoma cells. J Immunol 185(12):7443-7451. doi:10.4049/jimmunol.1000446

Lehmann BD, Bauer JA, Chen X, Sanders ME, Chakravarthy AB, Shyr Y, Pietenpol JA (2011) Identification of human triple-negative breast cancer subtypes and preclinical models for selection of targeted therapies. J Clin Invest 121(7):2750-2767. doi:10.1172/JCI45014

Li FF, Yan P, Zhao ZX, Liu Z, Song DW, Zhao XW, Wang XS, Wang GY, Liu SL (2016) Polymorphisms in the CHIT1 gene: Associations with colorectal cancer. Oncotarget 7(26):39572-39581. doi:10.18632/oncotarget.9138 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Li JH, Liu S, Zhou H, Qu LH, Yang JH (2014) starBase v2.0: decoding miRNA- ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-Seq data. Nucleic Acids Res 42(Database issue):D92-D97. doi:10.1093/nar/gkt1248

Li Q, Ling Y, Yu L (2012) GDF3 inhibits the growth of breast cancer cells and promotes the apoptosis induced by Taxol. J Cancer Res Clin Oncol 138(6):1073- 1079. doi:10.1007/s00432-012-1213-3

Li T, Fan J, Wang B, Traugh N, Chen Q, Liu JS, Li B, Liu XS (2017) TIMER: A Web Server for Comprehensive Analysis of Tumor-Infiltrating Immune Cells. Cancer Res 77(21):e108–e110. doi:10.1158/0008-5472.CAN-17-0307

Li T, Huang H, Shi G, Zhao L, Li T, Zhang Z, Liu R, Hu Y, Liu H, Yu J et al (2018) TGF-β1-SOX9 axis-inducible COL10A1 promotes invasion and metastasis in gastric cancer via epithelial-to-mesenchymal transition. Cell Death Dis 9(9):849. doi:10.1038/s41419-018-0877-2

Li X, Sun S, Li N, Gao J, Yu J, Zhao J, Li M, Zhao Z (2017) High Expression of CCR7 Predicts Lymph Node Metastasis and Good Prognosis in Triple Negative Breast Cancer. Cell Physiol Biochem 43(2):531-539. doi:10.1159/000480526

Li X, Xiao R, Tembo K, Hao L, Xiong M, Pan S, Yang X, Yuan W, Xiong J, Zhang Q (2016) PEG10 promotes human breast cancer cell proliferation, migration and invasion. Int J Oncol 48(5):1933-1942. doi:10.3892/ijo.2016.3406

Li Y, Huang R, Wang L, Hao J, Zhang Q, Ling R, Yun J (2015) microRNA-762 promotes breast cancer cell proliferation and invasion by targeting IRF7 expression. Cell Prolif 48(6):643-649. doi:10.1111/cpr.12223

Li YJ, Huang TH, Hsiao M, Lin BR, Cheng SJ, Yang CN, Lai WT, Wu TS, Fan JR, Kuo MY et al (2016) Suppression of fructose-bisphosphate aldolase C expression as a predictor of advanced oral squamous cell carcinoma. Head Neck Suppl 1:E1075-E1085. doi:10.1002/hed.24161

Liao Y, Guo S, Chen Y, Cao D, Xu H, Yang C, Fei L, Ni B, Ruan Z (2014) VSIG4 expression on macrophages facilitates lung cancer development. Lab Invest 94(7):706-715. doi:10.1038/labinvest.2014.73 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Licata L, Briganti L, Peluso D, Perfetto L, Iannuccelli M, Galeota E, Sacco F, Palma A, Nardozza AP, Santonico E et al (2012) MINT, the molecular interaction database: 2012 update. Nucleic Acids Res 40(Database issue):D857-D861. doi:10.1093/nar/gkr930

Lin CY, Beattie A, Baradaran B, Dray E, Duijf PHG (2018) Contradictory mRNA and protein misexpression of EEF1A1 in ductal breast carcinoma due to cell cycle regulation and cellular stress. Sci Rep 8(1):13904. doi:10.1038/s41598-018-32272- x

Lin VC, Kuo PT, Lin YC, Chen Y, Hseu YC, Yang HL, Kao JY, Ho CT, Way TD (2014) Penta-O-galloyl-β-D-glucose suppresses EGF-induced eIF3i expression through inhibition of the PI3K/AKT/mTOR pathway in prostate cancer cells. J Agric Food Chem 62(36):8990-8996. doi:10.1021/jf502447e

Ling B, Watt K, Banerjee S, Newsted D, Truesdell P, Adams J, Sidhu SS, Craig AWB (2017) A novel immunotherapy targeting MMP-14 limits hypoxia, immune suppression and metastasis in triple-negative breast cancer models. Oncotarget 8(35):58372-58385. doi:10.18632/oncotarget.17702

Liss M, Sreedhar N, Keshgegian A, Sauter G, Chernick MR, Prendergast GC, Wallon UM (2009) Tissue inhibitor of metalloproteinase-4 is elevated in early- stage breast cancers with accelerated progression and poor clinical course. Am J Pathol 175(3):940-946. doi:10.2353/ajpath.2009.081094

Liu JY, Jiang L, Liu JJ, He T, Cui YH, Qian F, Yu PW (2018) AEBP1 promotes epithelial-mesenchymal transition of gastric cancer cells by activating the NF-κB pathway and predicts poor outcome of the patients. Sci Rep 8(1):11955. doi:10.1038/s41598-018-29878-6

Liu L, Liu J, Dai S, Wang X, Wu S, Wang J, Huang L, Xiao X, He D (2007) Reduced transthyretin expression in sera of lung cancer. Cancer Sci 98(10):1617- 1624. doi:10.1111/j.1349-7006.2007.00576.x

Liu L, Wang Y, Miao L, Liu Q, Musetti S, Li J, Huang L (2018) Combination Immunotherapy of MUC1 mRNA Nano-vaccine and CTLA-4 Blockade Effectively Inhibits Growth of Triple Negative Breast Cancer. Mol Ther 26(1):45- 55. doi:10.1016/j.ymthe.2017.10.020 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Liu M, Gou L, Xia J, Wan Q, Jiang Y, Sun S, Tang M, He T, Zhang Y (2018) LncRNA ITGB2-AS1 Could Promote the Migration and Invasion of Breast Cancer Cells through Up-Regulating ITGB2. Int J Mol Sci 19(7). doi:10.3390/ijms19071866

Liu W, Wei H, Gao Z, Chen G, Liu Y, Gao X, Bai G, He S, Liu T, Xu W et al (2018) COL5A1 may contribute the metastasis of lung adenocarcinoma. Gene 665:57-66. doi:10.1016/j.gene.2018.04.066

Liu X, Wang S, Meng F, Wang J, Zhang Y, Dai E, Yu X, Li X, Jiang W (2013) SM2miR: a database of the experimentally validated small molecules' effects on microRNA expression. Bioinformatics 29(3):409-411. doi:10.1093/bioinformatics/bts698

Liu X, Wang Y, Qu H, Hou M, Cao W, Ma Z, Wang H (2013) Associations of polymorphisms of rs693 and rs1042031 in apolipoprotein B gene with risk of breast cancer in Chinese. Jpn J Clin Oncol 43(4):362-368. doi:10.1093/jjco/hyt018

Liu Y, Zhu YH, Mao CQ, Dou S, Shen S, Tan ZB, Wang J (2014) Triple negative breast cancer therapy with CDK1 siRNA delivered by cationic lipid assisted PEG- PLA nanoparticles. J Control Release 192:114-21. doi:10.1016/j.jconrel.2014.07.001

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4):402–408. doi:10.1006/meth.2001.1262

Lobba AR, Forni MF, Carreira AC, Sogayar MC (2012) Differential expression of CD90 and CD14 stem cell markers in malignant breast cancer cell lines. Cytometry A 81(12):1084-1091. doi:10.1002/cyto.a.22220

Logan M, Anderson PD, Saab ST, Hameed O, Abdulkadir SA (2013) RAMP1 is a direct NKX3.1 target gene up-regulated in prostate cancer that promotes tumorigenesis. Am J Pathol 183(3):951-963. doi:10.1016/j.ajpath.2013.05.021

Loh TJ, Moon H, Cho S, Jang H, Liu YC, Tai H, Jung DW, Williams DR, Kim HR, Shin MG et al (2015) CD44 alternative splicing and hnRNP A1 expression are bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

associated with the metastasis of breast cancer. Oncol Rep 34(3):1231-1238. doi:10.3892/or.2015.4110

Lu JW, Chang JG, Yeh KT, Chen RM, Tsai JJ, Hu RM (2011) Overexpression of Thy1/CD90 in human hepatocellular carcinoma is associated with HBV infection and poor prognosis. Acta Histochem 113(8):833-838. doi:10.1016/j.acthis.2011.01.001

Ludyga N, Englert S, Pflieger K, Rauser S, Braselmann H, Walch A, Auer G, Höfler H, Aubele M (2013) The impact of cysteine-rich intestinal protein 1 (CRIP1) in human breast cancer. Mol Cancer 12:28. doi:10.1186/1476-4598-12-28

Ma HW, Xie M, Sun M, Chen TY, Jin RR, Ma TS, Chen QN Zhang EB, He XZ, De W et al (2016) The pseudogene derived long noncoding RNA DUXAP8 promotes gastric cancer cell proliferation and migration via epigenetically silencing PLEKHO1 expression. Oncotarget 8(32):52211-52224. doi:10.18632/oncotarget.11075

Madeleine MM, Johnson LG, Smith AG, Hansen JA, Nisperos BB, Li S, Zhao LP, Daling JR, Schwartz SM, Galloway DA (2008) Comprehensive analysis of HLA- A, HLA-B, HLA-C, HLA-DRB1, and HLA-DQB1 loci and squamous cell cervical cancer risk. Cancer Res 68(9):3532-3539. doi:10.1158/0008-5472.CAN-07-6471

Mahmoodi M, Nahvi H, Mahmoudi M, Kasaian A, Mohagheghi MA, Divsalar K, Nahavandian B, Jafari A, Ansarpour B, Moradi B et al (2012) HLA-DRB1,-DQA1 and -DQB1 allele and haplotype frequencies in female patients with early onset breast cancer. Pathol Oncol Res 18(1):49-55. doi:10.1007/s12253-011-9415-6

Marangoni E, Laurent C, Coussy F, El-Botty R, Château-Joubert S, Servely JL, de Plater L, Assayag F, Dahmani A, Montaudon E et al (2018) Capecitabine Efficacy Is Correlated with TYMP and RB1 Expression in PDX Established from Triple- Negative Breast Cancers. Clin Cancer Res 24(11):2605-2615. doi:10.1158/1078- 0432.CCR-17-3490

Marastoni S, Andreuzzi E, Paulitti A, Colladel R, Pellicani R, Todaro F, Schiavinato A, Bonaldo P, Colombatti A, Mongiat M (2014) EMILIN2 down- modulates the Wnt signalling pathway and suppresses breast cancer cell growth and migration. J Pathol 232(4):391-404. doi:10.1002/path.4316 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Maretzky T, Le Gall SM, Worpenberg-Pietruk S, Eder J, Overall CM, Huang XY, Poghosyan Z, Edwards DR, Blobel CP (2009) Src stimulates fibroblast growth factor receptor-2 shedding by an ADAM15 splice variant linked to breast cancer. Cancer Res 69(11):4573-4576. doi:10.1158/0008-5472.CAN-08-4766

Martin JL, de Silva HC, Lin MZ, Scott CD, Baxter RC (2014) Inhibition of insulin-like growth factor-binding protein-3 signaling through sphingosine kinase- 1 sensitizes triple-negative breast cancer cells to EGF receptor blockade. Mol Cancer Ther 13(2):316-328. doi:10.1158/1535-7163.MCT-13-0367

Marzec KA, Baxter RC, Martin JL (2015) Targeting Insulin-Like Growth Factor Binding Protein-3 Signaling in Triple-Negative Breast Cancer. Biomed Res Int 2015:638526. doi:10.1155/2015/638526

Matsumoto H, Thike AA, Li H, Yeong J, Koo SL, Dent RA, Tan PH, Iqbal J (2016) Increased CD4 and CD8-positive T cell infiltrate signifies good prognosis in a subset of triple-negative breast cancer. Breast Cancer Res Treat156(2):237- 247. doi:10.1007/s10549-016-3743-x

McCleland ML, Adler AS, Shang Y, Hunsaker T, Truong T, Peterson D, Torres E, Li L, Haley B, Stephan JP, Belvin M et al (2012) An integrated genomic screen identifies LDHB as an essential gene for triple-negative breast cancer. Cancer Res 72(22):5812-5823. doi:10.1158/0008-5472.CAN-12-1098

Mehner C, Hockla A, Miller E, Ran S, Radisky DC, Radisky ES (2014) Tumor cell-produced matrix metalloproteinase 9 (MMP-9) drives malignant progression and metastasis of basal-like triple negative breast cancer. Oncotarget 5(9):2736- 2749. doi:10.18632/oncotarget.1932

Meng X, Chen X, Lu P, Ma W, Yue D, Song L, Fan Q (2016) MicroRNA-202 inhibits tumor progression by targeting LAMA1 in esophageal squamous cell carcinoma. Biochem Biophys Res Commun 473(4):821-827. doi:10.1016/j.bbrc.2016.03.130

Meyer MA, Baer JM, Knolhoff BL, Nywening TM, Panni RZ, Su X, Weilbaecher KN, Hawkins WG, Ma C, Fields RC et al (2018) Breast and pancreatic cancer interrupt IRF8-dependent dendritic cell development to overcome immune surveillance. Nat Commun 9(1):1250. doi:10.1038/s41467-018-03600-6 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Mi H, Huang X, Muruganujan A, Tang H, Mills C, Kang D, Thomas PD (2017) PANTHER version 11: expanded annotation data from Gene Ontology and Reactome pathways, and data analysis tool enhancements. Nucleic Acids Res 45(D1)D183-D189. doi:10.1093/nar/gkw1138

Mischel PS, Cloughesy TF, Nelson SF (2004) DNA-microarray analysis of brain cancer: molecular classification for therapy. Nat Rev Neurosci 5(10):782-792. doi:10.1038/nrn1518

Moog-Lutz C, Tomasetto C, Régnier CH, Wendling C, Lutz Y, Muller D, Chenard MP, Basset P, Rio MC (1997) MLN64 exhibits homology with the steroidogenic acute regulatory protein (STAR) and is over-expressed in human breast carcinomas. Int J Cancer 71(2):183-191. doi:10.1002/(sici)1097- 0215(19970410)71:2<183::aid-ijc10>3.0.co;2-j

Moon JS, Kim HE, Koh E, Park SH, Jin WJ, Park BW, Park SW, Kim KS (2011) Krüppel-like factor 4 (KLF4) activates the transcription of the gene for the platelet isoform of phosphofructokinase (PFKP) in breast cancer. J Biol Chem 286(27):23808-23816. doi:10.1074/jbc.M111.236737

Mueller KL, Madden JM, Zoratti GL, Kuperwasser C, List K, Boerner JL (2012) Fibroblast-secreted hepatocyte growth factor mediates epidermal growth factor receptor tyrosine kinase inhibitor resistance in triple-negative breast cancers through paracrine activation of Met. Breast Cancer Res 14(4):R104. doi:10.1186/bcr3224

Mumbrekar KD, Bola Sadashiva SR, Kabekkodu SP, Fernandes DJ, Vadhiraja BM, Suga T, Shoji Y, Nakayama F, Imai T, Satyamoorthy K (2017) Genetic Variants in CD44 and MAT1A Confer Susceptibility to Acute Skin Reaction in Breast Cancer Patients Undergoing Radiation Therapy. Int J Radiat Oncol Biol Phys 97(1):118-127. doi:10.1016/j.ijrobp.2016.09.017

Nagelkerke A, Sieuwerts AM, Bussink J, Sweep FC, Look MP, Foekens JA, Martens JW, Span PN (2014) LAMP3 is involved in tamoxifen resistance in breast cancer cells through the modulation of autophagy. Endocr Relat Cancer 21(1):101- 112. doi:10.1530/ERC-13-0183 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Necela BM, Crozier JA, Andorfer CA, Lewis-Tuffin L, Kachergus JM, Geiger XJ, Kalari KR, Serie DJ, Sun Z, Moreno-Aspitia A et al (2015) Folate receptor-α (FOLR1) expression and function in triple negative tumors. PLoS One 10(4):e0127133. doi:10.1371/journal.pone.0127133

Norton KA, Wallace T, Pandey NB, Popel AS (2017) An agent-based model of triple-negative breast cancer: the interplay between chemokine receptor CCR5 expression, cancer stem cells, and hypoxia. BMC Syst Biol 11(1):68. doi:10.1186/s12918-017-0445-x

Nie F, Yu X, Huang M, Wang Y, Xie M, Ma H, Wang Z, De W, Sun M (2017) Long noncoding RNA ZFAS1 promotes gastric cancer cells proliferation by epigenetically repressing KLF2 and NKD2 expression. Oncotarget 8(24):38227- 38238. doi:10.18632/oncotarget.9611

Niu G, Yang Y, Ren J, Song T, Hu Z, Chen L, Hong R, Xia J, Ke C, Wang X (2019) Overexpression of CPXM2 predicts an unfavorable prognosis and promotes the proliferation and migration of gastric cancer. Oncol Rep. doi:10.3892/or.2019.7254

Niu Y, Zhang L, Bi X, Yuan S, Chen P (2016) Evaluation of Vitronectin Expression in Prostate Cancer and the Clinical Significance of the Association of Vitronectin Expression with Prostate Specific Antigen in Detecting Prostate Cancer. Urol J 13(1):2527-2532.

Nueda ML, Naranjo AI, Baladrón V, Laborda J (2017) Different expression levels of DLK1 inversely modulate the oncogenic potential of human MDA-MB-231 breast cancer cells through inhibition of NOTCH1 signaling. FASEB J 31(8):3484- 3496. doi:10.1096/fj.201601341RRR

Ogony J, Choi HJ, Lui A, Cristofanilli M, Lewis-Wambi J (2016) Interferon- induced transmembrane protein 1 (IFITM1) overexpression enhances the aggressive phenotype of SUM149 inflammatory breast cancer cells in a signal transducer and activator of transcription 2 (STAT2)-dependent manner. Breast Cancer Res 18(1):25. doi:10.1186/s13058-016-0683-7

O'Leary PC, Terrile M, Bajor M, Gaj P, Hennessy BT, Mills GB, Zagozdzon A, O'Connor DP, Brennan DJ, Connor K et al (2014) Peroxiredoxin-1 protects bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

estrogen receptor α from oxidative stress-induced suppression and is a protein biomarker of favorable prognosis in breast cancer. Breast Cancer Res 16(4):R79. doi:10.1186/bcr3691

Olsen RS, Andersson RE, Zar N, Löfgren S, Wågsäter D, Matussek A, Dimberg J (2016) Prognostic significance of PLA2G4C gene polymorphism in patients with stage II colorectal cancer. Acta Oncol 55(4):474-479. doi:10.3109/0284186X.2015.1073350

Ondrouskova E, Sommerova L, Nenutil R, Coufal O, Bouchal P, Vojtesek B, Hrstka R (2017) AGR2 associates with HER2 expression predicting poor outcome in subset of estrogen receptor negative breast cancer patients. Exp Mol Pathol 102(2):280-283. doi:10.1016/j.yexmp.2017.02.016

Orchard S, Ammari M, Aranda B, Breuza L, Briganti L, Broackes-Carter F, Campbell NH, Chavali G, Chen C, del-Toro N, Duesbury M et al (2014) The MIntAct project--IntAct as a common curation platform for 11 molecular interaction databases. Nucleic Acids Res 42(Database issue):D358-D363. doi:10.1093/nar/gkt1115

Osanai M, Lee GH (2015) he retinoic acid-metabolizing enzyme CYP26A1 upregulates fascin and promotes the malignant behavior of breast carcinoma cells. Oncol Rep 34(2):850-858. doi:10.3892/or.2015.4042

Pagliara V, Saide A, Mitidieri E, d'Emmanuele di Villa Bianca R, Sorrentino R, Russo G, Russo A (2016) 5-FU targets rpL3 to induce mitochondrial apoptosis via cystathionine-β-synthase in colon cancer cells lacking p53. Oncotarget 7(31):50333-50348. doi:10.18632/oncotarget.10385

Pan B, Zheng S, Liu C, Xu Y (2013) Suppression of IGHG1 gene expression by siRNA leads to growth inhibition and apoptosis induction in human prostate cancer cell. Mol Biol Rep 40(1):27-33. doi:10.1007/s11033-012-1944-x

Pandey JP, Kistner-Griffin E, Black L, Namboodiri AM, Iwasaki M, Kasuga Y, Hamada GS, Tsugane S (2014) IGKC and FcγR genotypes and humoral immunity to HER2 in breast cancer. Immunobiology 219(2):113-117. doi:10.1016/j.imbio.2013.08.005 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Parikh RR, Gildener-Leapman N, Narendran A, Lin HY, Lemanski N, Bennett JA, Jacobson HI, Andersen TT (2005) Prevention of N-methyl-N-nitrosourea-induced breast cancer by alpha-fetoprotein (AFP)-derived peptide, a peptide derived from the active site of AFP. Clin Cancer Res 11(23):8512-8520. doi:10.1158/1078- 0432.CCR-05-1651

Parris TZ, Kovács A, Aziz L, Hajizadeh S, Nemes S, Semaan M, Forssell- Aronsson E, Karlsson P, Helou K (2014) Additive effect of the AZGP1, PIP, S100A8 and UBE2C molecular biomarkers improves outcome prediction in breast carcinoma. Int J Cancer 134(7):1617-1629. doi:10.1002/ijc.28497

Peng XC, Gong FM, Chen Y, Qiu M, Cheng K, Tang J, Ge J, Chen N, Zeng H, Liu JY (2016) Proteomics identification of PGAM1 as a potential therapeutic target for urothelial bladder cancer. J Proteomics 132:85-92. doi:10.1016/j.jprot.2015.11.027

Perez-Balaguer A, Ortiz-Martínez F, García-Martínez A, Pomares-Navarro C, Lerma E, Peiró G (2015) FOXA2 mRNA expression is associated with relapse in patients with Triple-Negative/Basal-like breast carcinoma. Breast Cancer Res Treat 153(2):465-474. doi:10.1007/s10549-015-3553-6

Petri V, Jayaraman P, Tutaj M, Hayman GT, Smith JR, De Pons J, Laulederkind SJ, Lowry TF, Nigam R, Wang SJ et al (2014) The pathway ontology - updates and applications. J Biomed Semantics 5(1)7. doi:10.1186/2041-1480-5-7

Pimenta EM, De S, Weiss R, Feng D, Hall K, Kilic S, Bhanot G, Ganesan S, Ran S, Barnes BJ (2015) IRF5 is a novel regulator of CXCL13 expression in breast cancer that regulates CXCR5(+) B- and T-cell trafficking to tumor-conditioned media. Immunol Cell Biol 93(5):486-499. doi:10.1038/icb.2014.110

Prest SJ, May FE, Westley BR (2002) The estrogen-regulated protein, TFF1, stimulates migration of human breast cancer cells. FASEB J 16(6):592-594. doi:10.1096/fj.01-0498fje

Principe M, Borgoni S, Cascione M, Chattaragada MS, Ferri-Borgogno S, Capello M, Bulfamante S, Chapelle J, Di Modugno F, Defilippi P et al (2017) Alpha- enolase (ENO1) controls alpha v/beta 3 integrin expression and regulates pancreatic cancer adhesion, invasion, and metastasis. J Hematol Oncol 10(1):16. doi:10.1186/s13045-016-0385-8 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Puglisi F (2010) Locoregional recurrence of triple-negative breast cancer after breast-conserving surgery and radiation. Cancer 116(2):538-539. doi:10.1002/cncr.24826

Qiu X, He X, Huang Q, Liu X, Sun G, Guo J, Yuan D, Yang L, Ban N, Fan S et al (2015) Overexpression of CCT8 and its significance for tumor cell proliferation, migration and invasion in glioma. Pathol Res Pract 211(10):717-725. doi:10.1016/j.prp.2015.04.012

Radojicic J, Zaravinos A, Vrekoussis T, Kafousi M, Spandidos DA, Stathopoulos EN (2011) MicroRNA expression analysis in triple-negative (ER, PR and Her2/neu) breast cancer. Cell Cycle 10(3):507-517. doi:10.4161/cc.10.3.14754

Rangel LB, Agarwal R, Sherman-Baust CA, Mello-Coelho Vd, Pizer ES, Ji H, Taub DD, Morin PJ (2004) Anomalous expression of the HLA-DR alpha and beta chains in ovarian and other cancers. Cancer Biol Ther 3(10):1021-1027. doi:10.4161/cbt.3.10.1142

Reddy KA, Kumar PU, Srinivasulu M, Triveni B, Sharada K, Ismail A, Reddy GB (2017) Overexpression and enhanced specific activity of aldoketo reductases (AKR1B1 & AKR1B10) in human breast cancers. Breast 31:137-143. doi:10.1016/j.breast.2016.11.003

Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, Smyth GK (2015) limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res 43(7):e47. doi:10.1093/nar/gkv007

Rito T, Wang Z, Deane CM, Reinert G (2010) How threshold behaviour affects the use of subgraphs for network comparison. Bioinformatics 26(18):i611-i617. doi:10.1093/bioinformatics/btq386

Robin X, Turck N, Hainard A, Tiberti N, Lisacek F, Sanchez JC, Müller M. (2011) pROC: an open-source package for R and S+ to analyze and compare ROC curves. BMC Bioinformatics 12:77. doi:10.1186/1471-2105-12-77

Röhsig LM, Damin DC, Stefani SD, Castro CG Jr, Roisenberg I, Schwartsmann G (2001) von Willebrand factor antigen levels in plasma of patients with malignant bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

breast disease. Braz J Med Biol Res 34(9):1125-1129. doi:10.1590/s0100- 879x2001000900004

Ronde JJ, Lips EH, Mulder L, Vincent AD, Wesseling J, Nieuwland M, Kerkhoven R, Vrancken Peeters MJ, Sonke GS, Rodenhuis S et al (2013) SERPINA6, BEX1, AGTR1, SLC26A3, and LAPTM4B are markers of resistance to neoadjuvant chemotherapy in HER2-negative breast cancer. Breast Cancer Res Treat 137(1):213-223. doi:10.1007/s10549-012-2340-x

Roscigno G, Quintavalle C, Donnarumma E, Puoti I, Diaz-Lagares A, Iaboni M, Fiore D, Russo V, Todaro M, Romano G et al (2016) MiR-221 promotes stemness of breast cancer cells by targeting DNMT3b. Oncotarget. 7(1):580-592. doi:10.18632/oncotarget.5979

Ruan HY, Yang C, Tao XM, He J, Wang T, Wang H, Wang C, Jin GZ, Jin HJ, Qin WX (2017) Downregulation of ACSM3 promotes metastasis and predicts poor prognosis in hepatocellular carcinoma. Am J Cancer Res 7(3):543-553.

Ruepp A, Kowarsch A, Schmidl D, Buggenthin F, Brauner B, Dunger I, Fobo G, Frishman G, Montrone C, Theis FJ (2010) PhenomiR: a knowledgebase for microRNA expression in diseases and biological processes. Genome Biol 11(1):R6. doi:10.1186/gb-2010-11-1-r6

Rukov JL, Wilentzik R, Jaffe I, Vinther J, Shomron N (2014) Pharmaco-miR: linking microRNAs and drug effects. Brief Bioinform 15(4):648-659. doi:10.1093/bib/bbs082

Saadat M. Apolipoprotein E (2012) (APOE) Polymorphisms and Susceptibility to Breast Cancer: A Meta-Analysis. Cancer Res Treat 44(2):121-6. doi:10.4143/crt.2012.44.2.121

Salwinski L, Miller CS, Smith AJ, Pettit FK, Bowie JU, Eisenberg D (2004) The Database of Interacting Proteins: 2004 update. Nucleic Acids Res 32(Database issue):D449-D451. doi:10.1093/nar/gkh086

Sasaki S, Baba T, Nishimura T, Hayakawa Y, Hashimoto S, Gotoh N, Mukaida N (2016) Essential roles of the interaction between cancer cell-derived chemokine, bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

CCL4, and intra-bone CCR5-expressing fibroblasts in breast cancer bone metastasis. Cancer Lett 378(1):23-32. doi:10.1016/j.canlet.2016.05.005

Satoh Y, Mori K, Kitano K, Kitayama J, Yokota H, Sasaki H, Uozaki H, Fukayama M, Seto Y, Nagawa H et al (2012) Analysis for the combination expression of CK20, FABP1 and MUC2 is sensitive for the prediction of peritoneal recurrence in gastric cancer. Jpn J Clin Oncol 42(2):148-152. doi:10.1093/jjco/hyr179

Schaefer CF, Anthony K, Krupa S, Buchoff J, Day M, Hannay T, Buetow KH (2009) PID: the Pathway Interaction Database. Nucleic Acids Res 37(Database issue)D674-D679. doi:10.1093/nar/gkn653

Schena M, Shalon D, Davis RW, Brown PO (1995) Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 270(5235):467-470. doi:10.1126/science.270.5235.467

Schito L, Rey S, Tafani M, Zhang H, Wong CC, Russo A, Russo MA, Semenza GL (2012) Hypoxia-inducible factor 1-dependent expression of platelet-derived growth factor B promotes lymphatic metastasis of hypoxic breast cancer cells. Proc Natl Acad Sci U S A 109(40):E2707-E2716. doi:10.1073/pnas.1214019109

Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, Amin N, Schwikowski B, Ideker T (2003) Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res 13(11):2498-2504. doi:10.1101/gr.1239303

Sharpe R, Pearson A, Herrera-Abreu MT, Johnson D, Mackay A, Welti JC, Natrajan R, Reynolds AR, Reis-Filho JS, Ashworth A et al (2011) Clin Cancer Res 17(16):5275-5286. doi:10.1158/1078-0432.CCR-10-2727

Shashni B, Sakharkar KR, Nagasaki Y, Sakharkar MK (2013) Glycolytic enzymes PGK1 and PKM2 as novel transcriptional targets of PPARγ in breast cancer pathophysiology. J Drug Target 21(2):161-174. doi:10.3109/1061186X.2012.736998

Shibata M, Kanda M, Tanaka H, Umeda S, Miwa T, Shimizu D, Hayashi M, Inaishi T, Miyajima N, Adachi Y et al (2017) Overexpression of Derlin 3 is bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

associated with malignant phenotype of breast cancer cells. Oncol Rep 38(3):1760- 1766. doi:10.3892/or.2017.5800

Shubbar E, Kovács A, Hajizadeh S, Parris TZ, Nemes S, Gunnarsdóttir K, Einbeigi Z, Karlsson P, Helou K (2013) Elevated cyclin B2 expression in invasive breast carcinoma is associated with unfavorable clinical outcome. BMC Cancer 13:1. doi:10.1186/1471-2407-13-1

Shurbaji MS, Pasternack GR, Kuhajda FP (1991) Expression of haptoglobin- related protein in primary and metastatic breast cancers. A longitudinal study of 48 fatal tumors. Am J Clin Pathol 96(2):238-242. doi:10.1093/ajcp/96.2.238

Shvab A, Haase G, Ben-Shmuel A, Gavert N, Brabletz T, Dedhar S, Ben-Ze'ev A (2016) Induction of the intestinal stem cell signature gene SMOC-2 is required for L1-mediated colon cancer progression. Oncogene 35(5):549-557. doi:10.1038/onc.2015.127

Shyu RY, Wu CC, Wang CH, Tsai TC, Wang LK, Chen ML, Jiang SY, Tsai FM (2013) H-rev107 regulates prostaglandin D2 synthase-mediated suppression of cellular invasion in testicular cancer cells. J Biomed Sci 20:30. doi:10.1186/1423- 0127-20-30

Sierko E, Wojtukiewicz MZ, Zimnoch L, Kisiel W (2010) Expression of tissue factor pathway inhibitor (TFPI) in human breast and colon cancer tissue. Thromb Haemost 103(1):198-204. doi:10.1160/TH09-06-0416

Sjöberg E, Augsten M, Bergh J, Jirström K, Östman A (2016) Expression of the chemokine CXCL14 in the tumour stroma is an independent marker of survival in breast cancer. Br J Cancer 114(10):1117-1124. doi:10.1038/bjc.2016.104

Sogawa K, Takano S, Iida F, Satoh M, Tsuchida S, Kawashima Y, Yoshitomi H, Sanda A, Kodera Y, Takizawa H et al (2016) Identification of a novel serum biomarker for pancreatic cancer, C4b-binding protein α-chain (C4BPA) by quantitative proteomic analysis using tandem mass tags. Br J Cancer 115(8):949- 956. doi:10.1038/bjc.2016.295

Soh MA, Garrett SH, Somji S, Dunlevy JR, Zhou XD, Sens MA, Bathula CS, Allen C, Sens DA (2011) Arsenic, cadmium and neuron specific enolase (ENO2, bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

γ-enolase) expression in breast cancer Cancer Cell Int 11(1):41. doi:10.1186/1475- 2867-11-41

Song DG, Kim YS, Jung BC, Rhee KJ, Pan CH (2013) Parkin induces upregulation of 40S ribosomal protein SA and posttranslational modification of cytokeratins 8 and 18 in human cervical cancer cells. Appl Biochem Biotechnol 171(7):1630-1638. doi:10.1007/s12010-013-0443-4

Speiser J, Foreman K, Drinka E, Godellas C, Perez C, Salhadar A, Erşahin Ç, Rajan P (2012) Notch-1 and Notch-4 biomarker expression in triple-negative breast cancer. Int J Surg Pathol 20(2):139-145. doi:10.1177/1066896911427035

Spraggs CF, Budde LR, Briley LP, Bing N, Cox CJ, King KS, Whittaker JC, Mooser VE, Preston AJ, Stein SH et al (2011) HLA-DQA1*02:01 is a major risk factor for lapatinib-induced hepatotoxicity in women with advanced breast cancer. J Clin Oncol 29(6):667-673. doi:10.1200/JCO.2010.31.3197

Stagg J, Allard B (2013) Immunotherapeutic approaches in triple-negative breast cancer: latest research and clinical prospects. Ther Adv Med Oncol 5(3):169-181. doi:10.1177/1758834012475152

Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES et al (2005) Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci. U. S. A 102(43)15545-15550. doi:10.1073/pnas.0506580102

Sun C, Liu C, Dong J, Li D, Li W (2014) Effects of the myeloid cell nuclear differentiation antigen on the proliferation, apoptosis and migration of osteosarcoma cells. Oncol Lett 7(3):815-819. doi:10.3892/ol.2014.1811

Sun MY, Song YN, Zhang M, Zhang CY, Zhang LJ, Zhang H (2019) Ginsenoside Rg3 inhibits the migration and invasion of liver cancer cells by increasing the protein expression of ARHGAP9. Oncol Lett 17(1):965-973. doi:10.3892/ol.2018.9701 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Tabassum U, Reddy O, Mukherjee G (2012) Elevated serum haptoglobin is associated with clinical outcome in triple-negative breast cancer patients. Asian Pac J Cancer Prev 13(9):4541-4544. doi:10.7314/apjcp.2012.13.9.4541

Tahbaz-Lahafi B, Akbari ME, Amir-Rassouli H, Rahimipour A, Azargashb E, Nafissi N, Jahani F (2014) Granzyme h serum levels variations with both reproductive hormone receptors, and related hormone receptors in breast cancer patients.Iran J Cancer Prev 7(1):48-52.

Tan J, Jiang X, Yin G, He L, Liu J, Long Z, Jiang Z, Yao K (2017) Anacardic acid induces cell apoptosis of prostatic cancer through autophagy by ER stress/DAPK3/Akt signaling pathway. Oncol Rep 38(3):1373-1382. doi:10.3892/or.2017.5841

Tan JX, Wang XY, Li HY, Su XL, Wang L, Ran L, Zheng K, Ren GS (2011) HYAL1 overexpression is correlated with the malignant behavior of human breast cancer. Int J Cancer 128(6):1303-1315. doi:10.1002/ijc.25460

Tanaka Y, Kosaka Y, Waraya M, Yokota K, Harada H, Kaida T, Kikuchi M, Minatani N, Nishimiya H, Katoh H et al (2019) Differential Prognostic Relevance of Promoter DNA Methylation of CDO1 and HOPX in Primary Breast Cancer. Anticancer Res 39(5):2289-2298. doi:10.21873/anticanres.13345

Teller A, Jechorek D, Hartig R, Adolf D, Reißig K, Roessner A, Franke S (2015) Dysregulation of apoptotic signaling pathways by interaction of RPLP0 and cathepsin X/Z in gastric cancer. Pathol Res Pract211(1):62-70. doi:10.1016/j.prp.2014.09.005

Tiago DM, Conceição N, Caiado H, Laizé V, Cancela ML (2016) Matrix Gla protein repression by miR-155 promotes oncogenic signals in breast cancer MCF-7 cells. FEBS Lett 590(8):1234-1241. doi:10.1002/1873-3468.12155

Tiriveedhi V, Fleming TP, Goedegebuure PS, Naughton M, Ma C, Lockhart C, Gao F, Gillanders WE, Mohanakumar T (2013) Mammaglobin-A cDNA vaccination of breast cancer patients induces antigen-specific cytotoxic CD4+ICOShi T cells. Breast Cancer Res Treat 138(1):109-118. doi:10.1007/s10549-012-2110-9 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Tokunaga R, Zhang W, Naseem M, Puccini A, Berger MD, Soni S, McSkane M, Baba H, Lenz HJ (2018) CXCL9, CXCL10, CXCL11/CXCR3 axis for immune activation - A target for novel cancer therapy. Cancer Treat Rev 63:40-47. doi:10.1016/j.ctrv.2017.11.007

Tseng CW, Kuo WH, Chan SH, Chan HL, Chang KJ, Wang LH (2018) Transketolase Regulates the Metabolic Switch to Control Breast Cancer Cell Metastasis via the α-Ketoglutarate Signaling Pathway. Cancer Res 78(11):2799- 2812. doi:10.1158/0008-5472.CAN-17-2906

Uhlén M, Fagerberg L, Hallström BM, Lindskog C, Oksvold P, Mardinoglu A, Sivertsson Å, Kampf C, Sjöstedt E, Asplund A et al (2015) Proteomics. Tissue- based map of the human proteome. Science 347(6220):1260419. doi:10.1126/science.1260419

Vlachos IS, Paraskevopoulou MD, Karagkouni D, Georgakilas G, Vergoulis T, Kanellos I, Anastasopoulos IL, Maniou S, Karathanou K, Kalfakakou D et al (2015) DIANA-TarBase v7.0: indexing more than half a million experimentally supported miRNA:mRNA interactions. Nucleic Acids Res 43(Database issue):D153-D159. doi:10.1093/nar/gku1215

Vlodrop IJH, Joosten SC, De Meyer T, Smits KM, Van Neste L, Melotte V, Baldewijns MMLL, Schouten LJ, van den Brandt PA, Jeschke J et al (2017) A Four-Gene Promoter Methylation Marker Panel Consisting of GREM1, NEURL, LAD1, and NEFH Predicts Survival of Clear Cell Renal Cell Cancer Patients. Clin Cancer Res 23(8):2006-2018. doi:10.1158/1078-0432.CCR-16-1236

Wada S, Noguchi T, Takeno S, Kawahara K (2006) PIK3CA and TFRC located in 3q are new prognostic factors in esophageal squamous cell carcinoma. Ann Surg Oncol 13(7):961-966. doi:10.1245/ASO.2006.08.006

Wang D Li Y, Zhang C, Li X4, Yu J (2018) MiR-216a-3p inhibits colorectal cancer cell proliferation through direct targeting COX-2 and ALOX5. J Cell Biochem 119(2):1755-1766. doi:10.1002/jcb.26336

Wang L, Wang YX, Zhang DZ, Fang XJ, Sun PS, Xue HC (2016) Let-7a mimic attenuates CCL18 induced breast cancer cell metastasis through Lin 28 pathway. Biomed Pharmacother 78:301-307. doi:10.1016/j.biopha.2016.01.028 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Wang M, Hu Y, Stearns ME (2009) RPS2: a novel therapeutic target in prostate cancer. J Exp Clin Cancer Res 28:6. doi:10.1186/1756-9966-28-6

Wang X, Masri S, Phung S, Chen S (2008) The role of amphiregulin in exemestane-resistant breast cancer cells: evidence of an autocrine loop. Cancer Res 68(7):2259-2265. doi:10.1158/0008-5472.CAN-07-5544

Wang Y, Kong H, Zeng X, Liu W, Wang Z, Yan X, Wang H, Xie W (2016) Activation of NLRP3 inflammasome enhances the proliferation and migration of A549 lung cancer cells. Oncol Rep 35(4):2053-2064. doi:10.3892/or.2016.4569

Wei W, Zou Y, Jiang Q, Zhou Z, Ding H, Yan L, Yang S (2018) PSMB5 is associated with proliferation and drug resistance in triple-negative breast cancer. Int J Biol Markers 33(1):102-108. doi:10.5301/ijbm.5000283

Weng Y, Fan X, Bai Y, Wang S, Huang H, Yang H, Zhu J, Zhang F (2018) SLC2A5 promotes lung adenocarcinoma cell growth and metastasis by enhancing fructose utilization. Cell Death Discov 4:38. doi:10.1038/s41420-018-0038-5

Wennemers M, Bussink J, Grebenchtchikov N, Sweep FC, Span PN (2011) TRIB3 protein denotes a good prognosis in breast cancer patients and is associated with hypoxia sensitivity. Radiother Oncol 101(1):198-202. doi:10.1016/j.radonc.2011.05.057

Wenners A, Hartmann F, Jochens A, Roemer AM, Alkatout I, Klapper W, van Mackelenbergh M, Mundhenke C, Jonat W, Bauer M (2016) Stromal markers AKR1C1 and AKR1C2 are prognostic factors in primary human breast cancer. Int J Clin Oncol 21(3):548-556. doi:10.1007/s10147-015-0924-2

Willis RC, Hogue CW (2006) Searching, viewing, and visualizing data in the Biomolecular Interaction Network Database (BIND). Curr Protoc Bioinformatics Chapter 8:Unit 8.9. doi:10.1002/0471250953.bi0809s12

Witkiewicz AK, Dasgupta A, Sammons S, Er O, Potoczek MB, Guiles F, Sotgia F, Brody JR, Mitchell EP, Lisanti MP (2010) Loss of stromal caveolin-1 expression predicts poor clinical outcome in triple negative and basal-like breast cancers. Cancer Biol Ther 10(2):135-143. doi:10.4161/cbt.10.2.11983 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Woodman N, Pinder SE, Tajadura V, Le Bourhis X, Gillett C, Delannoy P, Burchell JM, Julien S (2016) Two E-selectin ligands, BST-2 and LGALS3BP, predict metastasis and poor survival of ER-negative breast cancer. Int J Oncol 49(1):265-275. doi:10.3892/ijo.2016.3521

Wu Q, Gou Y, Wang Q, Jin H, Cui L, Zhang Y, He L, Wang J, Nie Y, Shi Y et al (2011) Downregulation of RPL6 by siRNA inhibits proliferation and cell cycle progression of human gastric cancer cell lines. PLoS One 6(10):e26401. doi:10.1371/journal.pone.0026401

Wu T, Song H, Xie D, Zhao B, Xu H, Wu C, Hua K, Deng Y, Ji C, Hu J et al (2018) Silencing of ASPP2 promotes the proliferation, migration and invasion of triple-negative breast cancer cells via the PI3K/AKT pathway. Int J Oncol 52(6):2001-2010. doi:10.3892/ijo.2018.4331

Xiao F, Zuo Z, Cai G, Kang S, Gao X, Li T (2009) miRecords: an integrated resource for microRNA-target interactions. Nucleic Acids Res 37(Database issue):D105-D110. doi:10.1093/nar/gkn851

Xin C, Zhang H, Liu Z (2014) miR-154 suppresses colorectal cancer cell growth and motility by targeting TLR2. Mol Cell Biochem 387(1-2):271-277. doi:10.1007/s11010-013-1892-3

Xu C, Wang H, He H, Zheng F, Chen Y, Zhang J, Lin X, Ma D, Zhang H (2013) Low expression of TFPI-2 associated with poor survival outcome in patients with breast cancer. BMC Cance 13:118. doi:10.1186/1471-2407-13-118

Xu F, Li D, Zhang Q, Fu Z, Yuan W, Pang D, Li D (2012) Association of CD27 and CD70 gene polymorphisms with risk of sporadic breast cancer in Chinese women in Heilongjiang Province. Breast Cancer Res Treat 133(3):1105-1113. doi:10.1007/s10549-012-1987-7

Xu L, Hou Y, Tu G, Chen Y, Du YE, Zhang H, Wen S, Tang X, Yin J, Lang L et al (2017) Nuclear Drosha enhances cell invasion via an EGFR-ERK1/2-MMP7 signaling pathway induced by dysregulated miRNA-622/197 and their targets LAMC2 and CD82 in gastric cancer. Cell Death Dis 8(3):e2642. doi:10.1038/cddis.2017.5 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Xu X, Jiang J, Yao L, Ji B (2018) Silencing the FOLR2 Gene Inhibits Cell Proliferation and Increases Apoptosis in the NCI-H1650 Non-Small Cell Lung Cancer Cell Line via Inhibition of AKT/Mammalian Target of Rapamycin (mTOR)/Ribosomal Protein S6 Kinase 1 (S6K1) Signaling. Med Sci Monit 24:8064-8073. doi:10.12659/MSM.911384

Xu Z, Chen H, Liu D, Huo J (2015) Fibulin-1 is downregulated through promoter hypermethylation in colorectal cancer: a CONSORT study. Medicine (Baltimore) 94(13):e663. doi:10.1097/MD.0000000000000663

Yamatoji M, Kasamatsu A, Kouzu Y, Koike H, Sakamoto Y, Ogawara K, Shiiba M, Tanzawa H, Uzawa K (2012) Dermatopontin: a potential predictor for metastasis of human oral cancer. Int J Cancer 130(12):2903-2911. doi:10.1002/ijc.26328

Yan TT, Fu XL, Li J, Bian YN, Liu DJ, Hua R, Ren LL, Li CT, Sun YW, Chen HY et al (2015) Downregulation of RPL15 may predict poor survival and associate with tumor progression in pancreatic ductal adenocarcinoma. Oncotarget 6(35):37028-37042. doi:10.18632/oncotarget.5939

Yang KM, Bae E, Ahn SG, Pang K, Park Y, Park J, Lee J, Ooshima A, Park B, Kim J et al (2017) Co-chaperone BAG2 Determines the Pro-oncogenic Role of Cathepsin B in Triple-Negative Breast Cancer Cells. Cell Rep21(10):2952-2964. doi:10.1016/j.celrep.2017.11.026

Yang Q, Lonardi S (2007) A parallel edge-betweenness clustering tool for Protein- Protein Interaction networks. Int J Data Min Bioinform 1(3):241-247.

Yang X, Peng X, Huang J (2018) Inhibiting 6-phosphogluconate dehydrogenase selectively targets breast cancer through AMPK activation. Clin Transl Oncol 20(9):1145-1152. doi:10.1007/s12094-018-1833-4

Yang Y, Xu W, Neill T, Hu Z, Wang CH, Xiao X, Stock SR, Guise T, Yun CO, Brendler CB et al (2015) Systemic Delivery of an Oncolytic Adenovirus Expressing Decorin for the Treatment of Breast Cancer Bone Metastases. Hum Gene Ther 26(12):813-825. doi:10.1089/hum.2015.098 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Yang ZX, Zhang B, Wei J, Jiang GQ, Wu YL, Leng BJ, Xing CG. MiR-539 inhibits proliferation and migration of triple-negative breast cancer cells by down- regulating LAMA4 expression. Cancer Cell Int. 2018;18:16. doi:10.1186/s12935- 018-0512-4

Ye Q, Kantonen S, Gomez-Cambronero J (2013) Serum deprivation confers the MDA-MB-231 breast cancer line with an EGFR/JAK3/PLD2 system that maximizes cancer cell invasion. J Mol Biol 425(4):755-766. doi:10.1016/j.jmb.2012.11.035

Yi JK, Chang JW, Han W, Lee JW, Ko E, Kim DH, Bae JY, Yu J, Lee C, Yu MH et al (2009) Autoantibody to tumor antigen, alpha 2-HS glycoprotein: a novel biomarker of breast cancer screening and diagnosis. Cancer Epidemiol Biomarkers Prev 18(5):1357-1364. doi:10.1158/1055-9965.EPI-08-0696

Yu YL, Chou RH, Liang JH, Chang WJ, Su KJ, Tseng YJ, Huang WC, Wang SC, Hung MC (2013) Targeting the EGFR/PCNA signaling suppresses tumor growth of triple-negative breast cancer cells with cell-penetrating PCNA peptides. PLoS One 8(4):e61362. doi:10.1371/journal.pone.0061362

Yumrutas O, Oztuzcu S, Büyükhatipoglu H, Bozgeyik I, Bozgeyik E, Igci YZ, Bagis H, Cevik MO, Kalender ME, Eslik Z et al (2015) The role of the UTS2 gene polymorphisms and plasma Urotensin-II levels in breast cancer. Tumour Biol 36(6):4427-4432. doi:10.1007/s13277-015-3082-2

Zadka Ł, Kulus MJ, Kurnol K, Piotrowska A, Glatzel-Plucińska N, Jurek T, Czuba M, Nowak A, Chabowski M, Janczak D et al (2018) The expression of IL10RA in colorectal cancer and its correlation with the proliferation index and the clinical stage of the disease. Cytokine 110:116-125. doi:10.1016/j.cyto.2018.04.030

Zaki N, Efimov D, Berengueres J (2013) Protein complex detection using interaction reliability assessment and weighted clustering coefficient. BMC Bioinformatics 14:163. doi:10.1186/1471-2105-14-163

Zeng XT, Liu XP, Liu TZ, Wang XH (2018) The clinical significance of COL5A2 in patients with bladder cancer: A retrospective analysis of bladder cancer gene expression data. Medicine (Baltimore) 97(10):e0091. doi:10.1097/MD.0000000000010091 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Zhang J, Chang L, Jin H, Xia Y, Wang L, He W, Li W, Chen H (2016) Benzopyrene promotes lung cancer A549 cell migration and invasion through up- regulating cytokine IL8 and chemokines CCL2 and CCL3 expression.Exp Biol Med (Maywood) 241(14):1516-1523. doi:10.1177/1535370216644530

Zhang JX, Chen ZH, Chen DL, Tian XP, Wang CY, Zhou ZW, Gao Y, Xu Y, Chen C, Zheng ZS et al (2018) LINC01410-miR-532-NCF2-NF-kB feedback loop promotes gastric cancer angiogenesis and metastasis. Oncogene 37(20):2660-2675. doi:10.1038/s41388-018-0162-y

Zhang L, Fang C, Xu X, Li A, Cai Q, Long X (2015) Androgen receptor, EGFR, and BRCA1 as biomarkers in triple-negative breast cancer: a meta-analysis. Biomed Res Int 2015:357485. doi:10.1155/2015/357485

Zhang L, Jia G, Shi B, Ge G, Duan H, Yang Y (2016) PRSS8 is Downregulated and Suppresses Tumour Growth and Metastases in Hepatocellular Carcinoma. Cell Physiol Biochem 40(3-4):757-769. doi:10.1159/000453136

Zhang Q, Yu L, Qin D, Huang R, Jiang X, Zou C, Tang Q, Chen Y, Wang G, Wang X et al (2015) Role of microRNA-30c targeting ADAM19 in colorectal cancer. PLoS One 10(3):e0120698. doi:10.1371/journal.pone.0120698

Zhang W, Yuan W, Song J, Wang S, Gu X (2018) LncRNA CPS1-IT1 suppresses EMT and metastasis of colorectal cancer by inhibiting hypoxia-induced autophagy through inactivation of HIF-1α. Biochimie 144:21-27. doi:10.1016/j.biochi.2017.10.002

Zhang X, Wang Y, Cao Y, Zhang X, Zhao H (2017) Increased CCL19 expression is associated with progression in cervical cancer. Oncotarget 8(43):73817-73825. doi:10.18632/oncotarget.17982

Zhang X, Xiao Z, Liu X, Du L, Wang L, Wang S, Zheng N, Zheng G, Li W, Zhang X et al (2012) The potential role of ORM2 in the development of colorectal cancer. PLoS One 7(2):e31868. doi:10.1371/journal.pone.0031868

Zhang X, Yee D (2002) Insulin-like growth factor binding protein-1 (IGFBP-1) inhibits breast cancer cell motility. Cancer Res 62(15):4369-4375. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Zhang Z, Wang Y, Zhang J, Zhong J, Yang R (2018) COL1A1 promotes metastasis in colorectal cancer by regulating the WNT/PCP pathway. Mol Med Rep 17(4):5037-5042. doi:10.3892/mmr.2018.8533

Zhang Z, Yu D, Yuan J, Guo Y, Wang H, Zhang X (2012) Cigarette smoking strongly modifies the association of complement factor H variant and the risk of lung cancer. Cancer Epidemiol 36(2):e111-e115. doi:10.1016/j.canep.2011.11.004

Zhong T, Xu F, Xu J, Liu L, Chen Y (2015) Aldo-keto reductase 1C3 (AKR1C3) is associated with the doxorubicin resistance in human breast cancer via PTEN loss. Biomed Pharmacother 69:317-325. doi:10.1016/j.biopha.2014.12.022

Zhou G, Soufan O, Ewald J, Hancock REW, Basu N, Xia J (2019) NetworkAnalyst 3.0: a visual analytics platform for comprehensive gene expression profiling and meta-analysis. Nucleic Acids Res 47(W1):W234-W241. doi:10.1093/nar/gkz240

Zhou Q, Jiang Y, Yin W, Wang Y, Lu J (2016) Single-nucleotide polymorphism in microRNA-binding site of SULF1 target gene as a protective factor against the susceptibility to breast cancer: a case-control study. Onco Targets Ther 9:2749- 2757. doi:10.2147/OTT.S102433

Zhu WL, Fan BL, Liu DL, Zhu WX (2009) Abnormal expression of fibrinogen gamma (FGG) and plasma level of fibrinogen in patients with hepatocellular carcinoma. Anticancer Res 29(7):2531-2534.

Zhu XF, Li W, Ma JY, Shao N, Zhang YJ, Liu RM, Wu WB, Lin Y, Wang SM (2015) Knockdown of heme oxygenase-1 promotes apoptosis and autophagy and enhances the cytotoxicity of doxorubicin in breast cancer cells. Oncol Lett 10(5):2974-2980. doi:10.3892/ol.2015.3735

Zhu Y, Knolhoff BL, Meyer MA, Nywening TM, West BL, Luo J, Wang-Gillam A, Goedegebuure SP, Linehan DC, DeNardo DG (2014) CSF1/CSF1R blockade reprograms tumor-infiltrating macrophages and improves response to T-cell checkpoint immunotherapy in pancreatic cancer models. Cancer Res 74(18):5057- 5069. doi:10.1158/0008-5472.CAN-13-3723 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Zhu Y, Lin H, Li Z, Wang M, Luo J (2001) Modulation of expression of ribosomal protein L7a (rpL7a) by ethanol in human breast cancer cells. Breast Cancer Res Treat 69(1):29-38.

Zhu Y, Shi M, Chen H, Gu J, Zhang J, Shen B, Deng X, Xie J, Zhan X, Peng C (2015) NPM1 activates metabolic changes by inhibiting FBP1 while promoting the tumorigenicity of pancreatic cancer cells. Oncotarget 6(25):21443-21451. doi:10.18632/oncotarget.4167

Tables

Table 1. Primers used for quantitative PCR

Primer sequence (5'→3') Gene Forward Reverse

ADAM15 CAGGACGATCTCCCAATTAGC GGACCAACTCCCTATTCTGTAGC BATF TATTGCCGCCCAGAAGAGC GCTTGATCTCCTTGCGTAGAG NOTCH3 TGGCGACCTCACTTACGACT CACTGGCAGTTATAGGTGTTGAC ITGAX AGAGCTGTGATAAGCCAGTTCC AATTCCTCGAAAGTGAAGTGTGT SDC1 CTGCCGCAAATTGTGGCTAC TGAGCCGGAGAAGTTGTCAGA RPL4 GCCTGCTGTATTCAAGGCTC GGTTGGTGCAAACATTCGGC EEF1G AACCGCACCCCTGAATTTCTC GGCGTTGCTCTCAAACACAC RPL3 TGAAGAGCTTCCCTAAGGATGA CTTCCCGCACGATGTGAGTC RBMX CTTCAGGACCAGTTCGCAGTA TCACGACCACTTGAGTAGAGAT ABCC2 CCCTGCTGTTCGATATACCAATC TCGAGAGAATCCAGAATAGGGAC

Table 2 The statistical metrics for key differentially expressed genes (DEGs)

Adj. P Agilent Id Gene Symbol logFC p Value Value t value Regulation Gene Name A_23_P110791 CSF1R 8.146901 1.63E-80 6.93E-76 90.97976 Up colony stimulating factor 1 receptor A_33_P3409062 TYROBP 8.436376 8.36E-79 1.77E-74 86.43198 Up TYRO protein tyrosine kinase binding protein A_33_P3284508 CD14 7.573326 2.47E-72 1.16E-68 71.14063 Up CD14 molecule A_23_P200138 SLAMF8 8.056666 2.22E-69 7.83E-66 65.06787 Up SLAM family member 8 A_23_P49816 ADAP2 5.256131 8.03E-64 2E-60 54.96295 Up ArfGAP with dual PH domains 2 A_33_P3330039 PLEKHO1 3.585786 1.89E-62 4.23E-59 52.70899 Up pleckstrin homology domain containing O1 immunoglobulin superfamily containing leucine rich A_23_P3312 ISLR 7.20434 5.27E-61 1.12E-57 50.43218 Up repeat A_23_P137366 C1QB 7.356669 8.12E-61 1.64E-57 50.14278 Up complement C1q B chain A_23_P207564 CCL4 7.039427 2.01E-57 2.75E-54 45.17821 Up C-C motif chemokine ligand 4 A_33_P3255949 TYMP 5.60819 1.27E-56 1.68E-53 44.07701 Up thymidine phosphorylase A_33_P3247042 FPR3 5.789611 1.62E-56 2.08E-53 43.9325 Up formyl peptide receptor 3 A_23_P74778 C1orf54 3.591214 3.25E-56 3.83E-53 43.52276 Up chromosome 1 open reading frame 54 A_23_P252082 TMEM176A 6.268084 7.07E-56 8.1E-53 43.0707 Up transmembrane protein 176A A_32_P452655 LGALS9C 5.026 1.14E-54 1.15E-51 41.48727 Up galectin 9C A_24_P103469 LST1 5.247082 1.98E-54 1.96E-51 41.17999 Up leukocyte specific transcript 1 A_23_P160849 FCER1G 4.954628 1.04E-53 9.36E-51 40.27001 Up Fc fragment of IgE receptor Ig A_24_P945113 ACVRL1 5.146109 1.21E-52 9.17E-50 38.95267 Up activin A receptor like type 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_23_P39386 HCST 5.341941 1.38E-52 1.03E-49 38.88244 Up hematopoietic cell signal transducer A_33_P3405424 IL4I1 6.574999 2.49E-52 1.79E-49 38.57373 Up interleukin 4 induced 1 A_24_P295999 CD4 4.644497 2.9E-52 2.05E-49 38.49392 Up CD4 molecule A_23_P259621 LAT2 2.721391 3.12E-52 2.17E-49 38.45621 Up linker for activation of T cells family member 2 A_23_P412321 CCR5 7.175737 9.88E-52 6.45E-49 37.85803 Up C-C motif chemokine receptor 5 (gene/pseudogene) A_23_P43164 SULF1 5.03611 1.01E-51 6.46E-49 37.84934 Up sulfatase 1 A_23_P114883 FMOD 4.978174 1.17E-51 7.39E-49 37.77266 Up fibromodulin A_23_P92499 TLR2 4.002793 1.39E-51 8.7E-49 37.68118 Up toll like receptor 2 A_23_P142447 MYO1F 3.777055 2.03E-51 1.19E-48 37.4898 Up myosin IF A_33_P3341686 XIST 3.561119 2.8E-51 1.58E-48 37.32527 Up X inactive specific transcript A_32_P356316 HLA-DOA 6.332437 8.2E-51 4.4E-48 36.78315 Up major histocompatibility complex, class II, DO alpha A_23_P217269 VSIG4 6.217314 1.99E-50 1.03E-47 36.34004 Up V-set and immunoglobulin domain containing 4 A_33_P3220837 MAFB 4.302055 3.69E-50 1.86E-47 36.03542 Up MAF bZIP transcription factor B A_23_P6413 SELENOM 4.530579 5.58E-50 2.75E-47 35.83223 Up selenoprotein M A_19_P00329511 XIST 3.356124 7.33E-50 3.53E-47 35.69877 Up X inactive specific transcript A_33_P3417695 ODF3B 4.806827 9.09E-50 4.28E-47 35.59361 Up outer dense fiber of sperm tails 3B A_19_P00323692 XIST 3.368313 1.1E-49 5.11E-47 35.50222 Up X inactive specific transcript A_33_P3255304 GGT5 4.680411 1.26E-49 5.81E-47 35.43486 Up gamma-glutamyltransferase 5 major histocompatibility complex, class II, DR beta A_24_P343233 HLA-DRB1 5.444127 1.46E-49 6.64E-47 35.3648 Up 1 A_23_P103932 FGR 5.019624 3.61E-49 1.61E-46 34.92808 Up FGR proto-oncogene, Src family tyrosine kinase A_23_P422071 B3GALT4 2.91212 9.63E-49 4.09E-46 34.46008 Up beta-1,3-galactosyltransferase 4 A_19_P00331623 XIST 3.421885 1.18E-48 4.91E-46 34.36384 Up X inactive specific transcript A_33_P3213064 STAT2 2.587895 1.67E-48 6.82E-46 34.2001 Up signal transducer and activator of transcription 2 A_23_P48596 RNASE1 5.427088 2.16E-48 8.62E-46 34.0806 Up ribonuclease A family member 1, pancreatic A_23_P200728 FCGR3A 6.740786 4.49E-48 1.73E-45 33.73801 Up Fc fragment of IgG receptor IIIa A_23_P376735 ZNF524 2.717507 5.04E-48 1.93E-45 33.68441 Up zinc finger protein 524 A_33_P3379939 HLA-F 3.826301 1.07E-47 3.86E-45 33.33465 Up major histocompatibility complex, class I, F A_23_P67661 COX7A1 5.985081 3.7E-47 1.29E-44 32.76979 Up cytochrome c oxidase subunit 7A1 A_23_P200741 DPT 6.389717 1.22E-46 4.1E-44 32.23459 Up dermatopontin A_23_P414913 GLIPR2 3.690445 2.37E-46 7.67E-44 31.93845 Up GLI pathogenesis related 2 A_23_P105562 VWF 5.042897 2.82E-46 8.92E-44 31.8616 Up von Willebrand factor major histocompatibility complex, class II, DP alpha A_23_P30913 HLA-DPA1 5.528231 1.11E-45 3.32E-43 31.26202 Up 1 A_33_P3393821 C1R 2.837008 3.1E-45 8.88E-43 30.81618 Up complement C1r A_23_P56746 FAP 3.803345 3.36E-45 9.5E-43 30.78152 Up fibroblast activation protein alpha A_33_P3316273 CCL3 5.235665 3.44E-45 9.66E-43 30.77132 Up C-C motif chemokine ligand 3 A_23_P42306 HLA-DMA 4.003799 4.02E-45 1.12E-42 30.70418 Up major histocompatibility complex, class II, DM alpha A_24_P270728 NUPR1 4.511394 4.09E-45 1.13E-42 30.69701 Up nuclear protein 1, transcriptional regulator A_23_P155057 CYTH4 3.23874 4.51E-45 1.24E-42 30.65521 Up cytohesin 4 A_33_P3321657 HSPG2 3.300021 6.06E-45 1.64E-42 30.52902 Up heparansulfate proteoglycan 2 A_33_P3333455 EMILIN1 4.086757 7.02E-45 1.87E-42 30.46645 Up elastin microfibrilinterfacer 1 A_23_P381261 ADCY4 4.71769 1.04E-44 2.7E-42 30.3001 Up adenylatecyclase 4 A_23_P33723 CD163 5.441843 1.18E-44 3.04E-42 30.24541 Up CD163 molecule bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_23_P216340 SLA 3.985918 1.97E-44 4.95E-42 30.02929 Up Src like adaptor A_33_P3398448 PARP10 3.3462 2.31E-44 5.73E-42 29.96289 Up poly(ADP-ribose) polymerase family member 10 A_33_P3253394 LAIR1 3.599438 7.2E-44 1.7E-41 29.48929 Up leukocyte associated immunoglobulin like receptor 1 A_33_P3364821 PTPRC 4.279692 9.31E-44 2.15E-41 29.38292 Up protein tyrosine phosphatase, receptor type C A_24_P378019 IRF7 4.449279 1.26E-43 2.86E-41 29.25811 Up interferon regulatory factor 7 A_33_P3286157 TNFRSF4 3.925296 1.92E-43 4.22E-41 29.0853 Up TNF receptor superfamily member 4 A_23_P153745 IFI30 3.135411 2.32E-43 5.04E-41 29.00828 Up IFI30, lysosomalthiolreductase A_24_P222655 C1QA 4.876159 2.73E-43 5.84E-41 28.94207 Up complement C1q A chain cardiac mesoderm enhancer-associated non-coding A_19_P00324470 CARMN 5.292786 4.84E-43 9.87E-41 28.7091 Up RNA A_32_P30905 WDFY4 4.446352 5.87E-43 1.19E-40 28.63097 Up WDFY family member 4 A_23_P137935 MNDA 3.953913 7E-43 1.4E-40 28.55989 Up myeloid cell nuclear differentiation antigen A_23_P34744 CTSK 4.395069 1.43E-42 2.74E-40 28.27327 Up cathepsin K A_33_P3415923 FMNL3 2.948147 1.59E-42 3.03E-40 28.22974 Up formin like 3 A_23_P125423 C1R 2.873166 1.76E-42 3.32E-40 28.18965 Up complement C1r A_23_P2492 C1S 4.09372 2.16E-42 3.98E-40 28.10864 Up complement C1s A_33_P3224710 TFEC 4.267058 2.26E-42 4.15E-40 28.09066 Up transcription factor EC A_23_P70307 SMOC2 5.676699 2.35E-42 4.27E-40 28.07566 Up SPARC related modular calcium binding 2 A_33_P3251148 TSPO 2.715211 4.98E-42 8.84E-40 27.77754 Up translocator protein A_33_P3395605 TMEM119 5.612234 6.99E-42 1.21E-39 27.64432 Up transmembrane protein 119 A_23_P157007 TMEM176B 4.052463 7.99E-42 1.37E-39 27.59208 Up transmembrane protein 176B A_32_P70158 LILRB3 4.490913 8.87E-42 1.5E-39 27.55128 Up leukocyte immunoglobulin like receptor B3 A_23_P17345 MAFB 2.726781 1.69E-41 2.76E-39 27.29891 Up MAF bZIP transcription factor B A_33_P3259393 HAPLN3 3.436205 2.21E-41 3.55E-39 27.19597 Up hyaluronan and proteoglycan link protein 3 A_23_P140146 IFI27L2 2.63175 2.37E-41 3.78E-39 27.16812 Up interferon alpha inducible protein 27 like 2 A_33_P3344618 TFEB 3.694495 4.78E-41 7.34E-39 26.89866 Up transcription factor EB A_23_P6771 LMCD1 2.793578 4.81E-41 7.36E-39 26.89598 Up LIM and cysteine rich domains 1 A_23_P28434 VAMP8 2.372347 6.22E-41 9.33E-39 26.79721 Up vesicle associated membrane protein 8 A_33_P3260614 PLCB2 2.796766 6.38E-41 9.53E-39 26.78741 Up phospholipase C beta 2 A_23_P143016 ARID5A 2.281122 7.09E-41 1.05E-38 26.74745 Up AT-rich interaction domain 5A A_24_P237878 MCRIP1 3.220673 1.19E-40 1.71E-38 26.55163 Up MAPK regulated corepressor interacting protein 1 A_33_P3304668 COL1A1 5.067677 2.01E-40 2.81E-38 26.35119 Up collagen type I alpha 1 chain A_24_P300777 ADAM8 3.91431 4.54E-40 6.06E-38 26.04532 Up ADAM metallopeptidase domain 8 A_23_P50508 PLA2G4C 3.019722 1.37E-39 1.73E-37 25.63369 Up phospholipase A2 group IVC A_23_P64661 ARHGAP9 3.117354 1.45E-39 1.82E-37 25.61303 Up Rho GTPase activating protein 9 A_23_P3911 PLXDC1 4.392403 1.46E-39 1.83E-37 25.611 Up plexin domain containing 1 A_23_P72157 SLC49A3 3.009956 1.57E-39 1.94E-37 25.58531 Up solute carrier family 49 member 3 A_33_P3354607 CCL4 4.331312 1.68E-39 2.07E-37 25.55938 Up C-C motif chemokine ligand 4 A_23_P252471 PECAM1 4.062062 1.72E-39 2.11E-37 25.55096 Up platelet and endothelial cell adhesion molecule 1 A_23_P119196 KLF2 3.126318 2.02E-39 2.44E-37 25.49239 Up Kruppel like factor 2 A_23_P97141 RGS1 5.035275 4.61E-39 5.35E-37 25.18988 Up regulator of G protein signaling 1 A_23_P120883 HMOX1 2.280017 5.58E-39 6.42E-37 25.12009 Up hemeoxygenase 1 A_33_P3312877 CCDC107 2.768439 7.18E-39 8.07E-37 25.02889 Up coiled-coil domain containing 107 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_23_P27315 EMILIN2 2.400204 8.31E-39 9.2E-37 24.97571 Up elastin microfibrilinterfacer 2 A_33_P3389634 CAPG 2.941991 1.54E-38 1.65E-36 24.75234 Up capping actin protein, gelsolin like A_23_P51646 PLK3 2.427261 1.78E-38 1.9E-36 24.70112 Up polo like kinase 3 serine/arginine-rich splicing factor 8 (SRSF8) A_33_P3415086 AP002383.3 3.737236 2.61E-38 2.74E-36 24.56426 Up pseudogene A_23_P75786 SLC15A3 2.880363 3.1E-38 3.21E-36 24.50342 Up solute carrier family 15 member 3 A_23_P104464 ALOX5 3.039436 3.51E-38 3.61E-36 24.45862 Up arachidonate 5-lipoxygenase A_33_P3228285 ANKRD13D 2.813305 1.16E-37 1.12E-35 24.03535 Up ankyrin repeat domain 13D A_23_P114740 CFH 3.264039 1.7E-37 1.59E-35 23.90285 Up complement factor H A_23_P74290 GBP5 5.997267 1.87E-37 1.75E-35 23.86919 Up guanylate binding protein 5 A_23_P9883 NLRP3 3.467695 3.64E-37 3.31E-35 23.63675 Up NLR family pyrin domain containing 3 A_23_P137689 OLFML2B 3.971392 5.58E-37 4.95E-35 23.48925 Up olfactomedin like 2B A_33_P3218760 UPF2 3.11175 7.14E-37 6.21E-35 23.40406 Up UPF2, regulator of nonsense mediated mRNA decay A_33_P3356220 STARD3 2.826018 1.03E-36 8.76E-35 23.27941 Up StAR related lipid transfer domain containing 3 A_24_P166443 HLA-DPB1 4.017682 1.26E-36 1.06E-34 23.20987 Up major histocompatibility complex, class II, DP beta 1 A_33_P3328559 TBC1D10C 4.221141 2.58E-36 2.13E-34 22.96513 Up TBC1 domain family member 10C A_23_P55936 FCGRT 2.348701 2.93E-36 2.4E-34 22.92232 Up Fc fragment of IgG receptor and transporter A_33_P3399064 RNA5-8SN5 3.530301 3.85E-36 3.13E-34 22.82985 Up RNA, 5.8S ribosomal N5 A_23_P203173 IL10RA 3.118002 4.38E-36 3.52E-34 22.78597 Up interleukin 10 receptor subunit alpha A_33_P3283833 FOXS1 3.625927 6.3E-36 4.96E-34 22.66343 Up forkhead box S1 A_24_P82106 MMP14 4.105134 6.58E-36 5.15E-34 22.64917 Up matrix metallopeptidase 14 A_23_P50946 RAMP1 3.067506 6.84E-36 5.34E-34 22.63591 Up receptor activity modifying protein 1 A_33_P3229032 CLEC11A 3.212895 7.03E-36 5.47E-34 22.62667 Up C-type lectin domain containing 11A A_33_P3224045 DAPK3 2.585117 9.47E-36 7.25E-34 22.52683 Up death associated protein kinase 3 A_23_P214144 COL10A1 6.476208 1.16E-35 8.77E-34 22.45871 Up collagen type X alpha 1 chain A_23_P160159 SLC2A5 3.413797 1.61E-35 1.2E-33 22.35086 Up solute carrier family 2 member 5 A_33_P3287631 CTSB 2.606066 1.84E-35 1.36E-33 22.30642 Up cathepsin B A_23_P155257 FOXP1 2.42151 2.46E-35 1.8E-33 22.20875 Up forkhead box P1 A_33_P3223592 APOE 3.610208 2.87E-35 2.09E-33 22.15798 Up apolipoprotein E A_33_P3364741 MRC2 2.842998 3.07E-35 2.2E-33 22.13577 Up mannose receptor C type 2 A_33_P3225522 OAS2 3.491672 3.27E-35 2.34E-33 22.11475 Up 2'-5'-oligoadenylate synthetase 2 A_23_P161076 CD2 5.302292 3.45E-35 2.45E-33 22.09781 Up CD2 molecule A_23_P79069 RASAL3 3.338232 3.56E-35 2.53E-33 22.08691 Up RAS protein activator like 3 A_23_P142075 ACP5 2.388966 3.7E-35 2.62E-33 22.07492 Up acid phosphatase 5, tartrate resistant major histocompatibility complex, class II, DQ beta A_23_P8108 HLA-DQB1 3.881059 7.42E-35 5.07E-33 21.84601 Up 1 hes related family bHLH transcription factor with A_23_P430658 HEYL 4.54965 1.67E-34 1.08E-32 21.58183 Up YRPW motif-like A_23_P111188 ZBTB22 2.530061 1.76E-34 1.13E-32 21.56489 Up zinc finger and BTB domain containing 22 A_19_P00318734 #N/A 3.927447 1.87E-34 1.2E-32 21.54564 Up NA A_33_P3222069 SPHK1 2.989168 2.94E-34 1.83E-32 21.39887 Up sphingosine kinase 1 A_23_P329573 ITGB2 3.488845 3.62E-34 2.22E-32 21.33173 Up integrin subunit beta 2 A_33_P3362611 ADGRL4 3.821675 5.01E-34 3.01E-32 21.22794 Up adhesion G protein-coupled receptor L4 A_23_P200260 PCNX2 2.755008 6.26E-34 3.72E-32 21.15631 Up pecanex 2 A_23_P73429 HCLS1 2.308751 8.69E-34 5.11E-32 21.05172 Up hematopoietic cell-specific Lyn substrate 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_19_P00326720 #N/A 3.384887 1.2E-33 6.93E-32 20.94875 Up NA FAM20A, golgi associated secretory pathway A_32_P108254 FAM20A 2.93072 1.44E-33 8.18E-32 20.8924 Up pseudokinase A_23_P40174 MMP9 6.170882 1.46E-33 8.28E-32 20.88769 Up matrix metallopeptidase 9 T cell immune regulator 1, ATPase H+ transporting A_33_P3219965 TCIRG1 2.506913 1.85E-33 1.04E-31 20.81147 Up V0 subunit a3 A_23_P14774 CTSH 2.397775 2.14E-33 1.19E-31 20.76629 Up cathepsin H scavenger receptor cysteine rich family member with A_33_P3358898 SSC5D 4.431843 2.14E-33 1.19E-31 20.76603 Up 5 domains A_23_P128974 BATF 3.496779 2.35E-33 1.3E-31 20.73722 Up basic leucine zipper ATF-like transcription factor major histocompatibility complex, class II, DQ beta A_33_P3424222 HLA-DQB1 4.299795 3.2E-33 1.74E-31 20.63908 Up 1 A_23_P434809 S100A8 6.071873 3.7E-33 2E-31 20.59354 Up S100 calcium binding protein A8 A_33_P3268304 LIMS2 3.183231 4.23E-33 2.27E-31 20.55187 Up LIM zinc finger domain containing 2 A_33_P3421351 TRAF3IP3 3.035134 4.3E-33 2.29E-31 20.54711 Up TRAF3 interacting protein 3 A_23_P205031 COL4A2 2.533728 4.35E-33 2.32E-31 20.54302 Up collagen type IV alpha 2 chain A_23_P17663 MX1 3.997776 4.37E-33 2.32E-31 20.54205 Up MX dynamin like GTPase 1 A_33_P3380693 ADAM15 2.360481 5.51E-33 2.9E-31 20.4693 Up ADAM metallopeptidase domain 15 A_33_P3400374 HELZ2 2.595964 5.51E-33 2.9E-31 20.4692 Up helicase with zinc finger 2 ADP ribosylation factor like GTPase 6 interacting A_24_P287233 ARL6IP4 2.329797 6.63E-33 3.45E-31 20.41138 Up protein 4 A_19_P00803351 AC148477.2 2.592247 7.4E-33 3.83E-31 20.37726 Up novel transcript A_19_P00320798 #N/A 2.33242 1.07E-32 5.42E-31 20.26397 Up NA A_19_P00315824 PCAT19 3.230478 1.2E-32 6.01E-31 20.22827 Up prostate cancer associated transcript 19 A_19_P00326615 #N/A 3.345966 1.23E-32 6.16E-31 20.2196 Up NA A_33_P3322654 RNPEPL1 2.488335 1.28E-32 6.42E-31 20.20599 Up arginylaminopeptidase like 1 A_23_P157299 AEBP1 3.13961 1.59E-32 7.86E-31 20.13993 Up AE binding protein 1 A_33_P3350748 KRT7 3.647858 1.59E-32 7.87E-31 20.13945 Up keratin 7 zinc finger CCCH-type and G-patch domain A_23_P218654 ZGPAT 2.380092 1.66E-32 8.16E-31 20.12721 Up containing A_23_P119042 NKG7 5.448908 2.63E-32 1.27E-30 19.98485 Up natural killer cell granule protein 7 A_23_P374082 ADAM19 2.353983 3.05E-32 1.46E-30 19.93951 Up ADAM metallopeptidase domain 19 A_33_P3379947 HLA-B 3.796721 3.52E-32 1.67E-30 19.89549 Up major histocompatibility complex, class I, B A_23_P142974 ARHGAP25 3.056695 4.1E-32 1.93E-30 19.84868 Up Rho GTPase activating protein 25 potassium channel tetramerization domain containing A_33_P3240512 KCTD12 2.448519 5.35E-32 2.49E-30 19.7676 Up 12 A_33_P3881262 CSF3R 2.780288 5.43E-32 2.52E-30 19.76316 Up colony stimulating factor 3 receptor major histocompatibility complex, class II, DQ alpha A_33_P3293049 HLA-DQA1 7.107921 7.71E-32 3.53E-30 19.65662 Up 1 scavenger receptor cysteine rich family member with A_33_P3303542 SSC5D 3.868952 8.22E-32 3.74E-30 19.63711 Up 5 domains A_33_P3253144 DOK3 2.610393 1.24E-31 5.52E-30 19.51335 Up docking protein 3 A_33_P3395743 VWA1 3.286206 1.3E-31 5.75E-30 19.49886 Up von Willebrand factor A domain containing 1 A_33_P3251703 CRIP1 3.040709 1.41E-31 6.22E-30 19.47447 Up cysteine rich protein 1 A_23_P208900 SEMA6B 2.607021 1.63E-31 7.13E-30 19.4308 Up semaphorin 6B A_33_P3424217 #N/A 4.942998 1.7E-31 7.45E-30 19.41644 Up NA A_23_P27424 ZNF418 2.588805 1.71E-31 7.46E-30 19.41563 Up zinc finger protein 418 A_23_P113351 SPARCL1 4.192284 1.81E-31 7.89E-30 19.39805 Up SPARC like 1 A_33_P3329664 ZFP92 3.364986 1.92E-31 8.31E-30 19.38129 Up ZFP92 zinc finger protein A_23_P38346 DHX58 2.468599 2.02E-31 8.73E-30 19.36468 Up DExH-box helicase 58 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_19_P00808575 #N/A 3.354996 2.74E-31 1.17E-29 19.27347 Up NA A_32_P171061 ASCL2 2.879366 2.86E-31 1.21E-29 19.26055 Up achaete-scute family bHLH transcription factor 2 A_23_P142424 IGFLR1 3.918565 2.95E-31 1.25E-29 19.25117 Up IGF like family receptor 1 A_23_P47709 FOLR2 5.012386 3.01E-31 1.27E-29 19.24576 Up folate receptor beta A_23_P211631 FBLN1 3.116617 3.03E-31 1.28E-29 19.2433 Up fibulin 1 A_33_P3267799 LILRB4 3.216155 3.4E-31 1.42E-29 19.20933 Up leukocyte immunoglobulin like receptor B4 A_33_P3343090 MAP1S 2.506139 3.61E-31 1.5E-29 19.19089 Up microtubule associated protein 1S A_33_P3257513 FAT3 2.660948 4E-31 1.65E-29 19.16031 Up FAT atypical cadherin 3 A_33_P3280845 THY1 2.848963 4.49E-31 1.85E-29 19.12581 Up Thy-1 cell surface antigen A_24_P405054 SZRD1 2.739025 5.65E-31 2.3E-29 19.05735 Up SUZ RNA binding domain containing 1 A_33_P3249743 GOLGA2P11 3.11224 5.8E-31 2.35E-29 19.04968 Up GOLGA2 pseudogene 11 A_23_P58588 SLIT3 3.387079 5.84E-31 2.36E-29 19.04776 Up slit guidance ligand 3 A_23_P46936 EGR2 3.315331 6.88E-31 2.76E-29 18.99889 Up early growth response 2 A_24_P382287 CDH7 3.113031 8.63E-31 3.43E-29 18.93176 Up cadherin 7 A_19_P00322176 AC124312.6 2.364946 1.02E-30 4.01E-29 18.88247 Up TEC A_24_P209455 GIMAP4 3.645297 1.1E-30 4.32E-29 18.85888 Up GTPase, IMAP family member 4 A_24_P192914 JAML 4.677037 1.2E-30 4.68E-29 18.83411 Up junction adhesion molecule like A_19_P00326662 #N/A 2.849534 1.37E-30 5.3E-29 18.79498 Up NA A_23_P30547 LCP2 2.593092 1.42E-30 5.48E-29 18.78456 Up lymphocyte cytosolic protein 2 A_23_P33196 COL5A2 3.529964 1.43E-30 5.52E-29 18.78247 Up collagen type V alpha 2 chain A_33_P3233150 ZSWIM4 2.286282 2.16E-30 8.15E-29 18.66115 Up zinc finger SWIM-type containing 4 A_33_P3228325 SP100 2.914649 2.71E-30 1.02E-28 18.59413 Up SP100 nuclear antigen A_23_P166408 OSM 3.170379 2.84E-30 1.06E-28 18.58068 Up oncostatin M A_33_P3401243 OLFML2B 2.650351 3.4E-30 1.26E-28 18.52805 Up olfactomedin like 2B ADAM metallopeptidase with thrombospondin type A_23_P360754 ADAMTS4 2.873579 3.5E-30 1.29E-28 18.52007 Up 1 motif 4 A_33_P3424803 HLA-C 2.958764 3.59E-30 1.32E-28 18.51228 Up major histocompatibility complex, class I, C A_33_P3208970 ZNF683 5.480801 3.77E-30 1.38E-28 18.49774 Up zinc finger protein 683 A_23_P421401 PDGFRB 3.34055 6.16E-30 2.21E-28 18.35474 Up platelet derived growth factor receptor beta A_24_P406060 RNF144B 2.280889 8.08E-30 2.85E-28 18.27622 Up ring finger protein 144B A_33_P3236881 NBL1 2.751853 8.25E-30 2.9E-28 18.27023 Up NBL1, DAN family BMP antagonist A_23_P48826 TRIM69 2.312803 9.44E-30 3.3E-28 18.2312 Up tripartite motif containing 69 A_23_P320578 RGS16 3.427242 9.48E-30 3.31E-28 18.22993 Up regulator of G protein signaling 16 A_23_P144911 EGFLAM 3.083254 1.01E-29 3.52E-28 18.2109 Up EGF like, fibronectin type III and laminin G domains A_23_P1083 GJA4 3.875599 1.14E-29 3.93E-28 18.17607 Up gap junction protein alpha 4 A_23_P128993 GZMH 5.44432 1.16E-29 3.99E-28 18.17146 Up granzyme H A_23_P145874 SAMD9L 3.045808 1.41E-29 4.77E-28 18.1157 Up sterile alpha motif domain containing 9 like A_23_P122924 INHBA 2.8537 1.5E-29 5.06E-28 18.09824 Up inhibin subunit beta A A_33_P3629678 COL5A1 2.499651 2.24E-29 7.39E-28 17.98264 Up collagen type V alpha 1 chain A_23_P65240 COL4A1 2.749231 2.58E-29 8.47E-28 17.94184 Up collagen type IV alpha 1 chain A_33_P3285545 CLDN4 2.97241 2.59E-29 8.5E-28 17.94029 Up claudin 4 A_23_P371215 ICOS 4.932775 2.78E-29 9.06E-28 17.92073 Up inducible T cell costimulator A_33_P3237927 ARHGAP4 2.465032 2.93E-29 9.55E-28 17.90567 Up Rho GTPase activating protein 4 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_33_P3282556 TMEM204 2.686327 3.33E-29 1.08E-27 17.86841 Up transmembrane protein 204 A_32_P351968 HLA-DMB 3.074488 3.46E-29 1.12E-27 17.85794 Up major histocompatibility complex, class II, DM beta A_23_P72737 IFITM1 2.682726 4.14E-29 1.33E-27 17.8063 Up interferon induced transmembrane protein 1 A_33_P3401826 CMPK2 2.577836 4.18E-29 1.34E-27 17.80407 Up cytidine/uridine monophosphate kinase 2 A_24_P319923 MYLK 3.291111 5E-29 1.6E-27 17.75282 Up myosin light chain kinase A_23_P85800 CD52 3.688988 6.19E-29 1.95E-27 17.69204 Up CD52 molecule A_23_P325690 ANKRD35 2.856751 8.34E-29 2.6E-27 17.60754 Up ankyrin repeat domain 35 A_33_P3220911 BST2 2.530538 1.2E-28 3.67E-27 17.50525 Up bone marrow stromal cell antigen 2 A_33_P3358099 CD300E 3.274574 1.44E-28 4.38E-27 17.45245 Up CD300e molecule A_23_P161727 HSPB2 3.107089 1.58E-28 4.76E-27 17.4268 Up heat shock protein family B (small) member 2 A_23_P64873 DCN 3.073018 1.59E-28 4.77E-27 17.42584 Up decorin major histocompatibility complex, class II, DP beta 2 A_24_P288836 HLA-DPB2 3.178038 2.22E-28 6.56E-27 17.33188 Up (pseudogene) A_33_P3332348 RN7SL1 2.324256 2.29E-28 6.75E-27 17.32353 Up RNA, 7SL, cytoplasmic 1 A_32_P116556 ZNF469 3.281045 3.92E-28 1.13E-26 17.17248 Up zinc finger protein 469 A_33_P3290709 EGFL6 5.046696 4.43E-28 1.27E-26 17.13822 Up EGF like domain multiple 6 A_33_P3268910 SPRY1 2.587226 4.6E-28 1.31E-26 17.12797 Up sprouty RTK signaling antagonist 1 A_23_P201459 IFI6 3.663774 5.36E-28 1.52E-26 17.08527 Up interferon alpha inducible protein 6 A_19_P00316597 #N/A 3.376082 5.68E-28 1.6E-26 17.06955 Up NA A_32_P217750 IL3RA 2.561181 5.93E-28 1.67E-26 17.05744 Up interleukin 3 receptor subunit alpha A_33_P3281273 S1PR4 3.877904 9.53E-28 2.63E-26 16.92572 Up sphingosine-1-phosphate receptor 4 A_23_P1962 RARRES3 2.84671 1.09E-27 2.99E-26 16.88892 Up retinoic acid receptor responder 3 A_23_P393777 PTGDR 2.424021 1.16E-27 3.18E-26 16.8706 Up prostaglandin D2 receptor A_23_P121533 SPON2 2.720058 1.21E-27 3.3E-26 16.85946 Up spondin 2 A_19_P00327745 #N/A 2.647128 1.56E-27 4.19E-26 16.78971 Up NA A_23_P323761 TRAF3IP3 2.583993 1.6E-27 4.29E-26 16.78202 Up TRAF3 interacting protein 3 A_19_P00813192 CASP17P 2.993089 1.8E-27 4.77E-26 16.75055 Up caspase 17, pseudogene A_33_P3414880 AC008105.3 2.82609 1.84E-27 4.88E-26 16.74419 Up novel transcript, antisense to FMNL1 A_23_P204286 MGP 3.975201 1.9E-27 5.02E-26 16.73495 Up matrix Gla protein A_23_P254507 HOPX 3.410108 1.97E-27 5.18E-26 16.72521 Up HOP homeobox A_33_P3380944 ADGRF5 2.750821 1.99E-27 5.21E-26 16.72351 Up adhesion G protein-coupled receptor F5 A_33_P3367392 FAM167B 2.417959 2.08E-27 5.46E-26 16.71045 Up family with sequence similarity 167 member B immunoglobulin heavy constant gamma 1 (G1m A_33_P3424591 IGHG1 7.191424 2.11E-27 5.52E-26 16.70692 Up marker) A_33_P3313055 NOTCH3 2.443512 2.23E-27 5.82E-26 16.69117 Up notch 3 A_23_P160318 COL16A1 2.51807 2.83E-27 7.28E-26 16.62666 Up collagen type XVI alpha 1 chain A_19_P00321682 MIR3150BHG 2.556402 2.86E-27 7.35E-26 16.62388 Up MIR3150B host gene A_33_P3232203 SAG 2.358853 3.03E-27 7.76E-26 16.60773 Up S-antigen visual arrestin A_24_P59667 JAK3 2.299409 3.29E-27 8.39E-26 16.58548 Up Janus kinase 3 A_23_P138524 CPXM2 3.057772 4.8E-27 1.21E-25 16.48182 Up carboxypeptidase X, M14 family member 2 A_19_P00812261 #N/A 2.369734 5E-27 1.25E-25 16.47077 Up NA A_33_P3274696 SLC52A2 2.548096 5.97E-27 1.48E-25 16.42268 Up solute carrier family 52 member 2 A_23_P25155 GPR84 3.298763 7.22E-27 1.77E-25 16.37109 Up G protein-coupled receptor 84 A_23_P357284 GPR4 3.009127 7.36E-27 1.8E-25 16.36591 Up G protein-coupled receptor 4 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_23_P141429 ABI3 2.478904 8.16E-27 1.98E-25 16.33771 Up ABI family member 3 A_23_P204277 H2AFJ 2.465065 8.2E-27 1.99E-25 16.33652 Up H2A histone family member J A_23_P143981 FBLN2 2.710785 9.89E-27 2.38E-25 16.28565 Up fibulin 2 A_23_P123853 CCL19 5.894996 1.09E-26 2.62E-25 16.25925 Up C-C motif chemokine ligand 19 A_23_P18452 CXCL9 6.896603 1.1E-26 2.63E-25 16.25732 Up C-X-C motif chemokine ligand 9 A_23_P203888 MMP19 2.399238 1.15E-26 2.74E-25 16.24583 Up matrix metallopeptidase 19 A_23_P52761 MMP7 5.084254 1.31E-26 3.12E-25 16.20957 Up matrix metallopeptidase 7 A_19_P00806168 #N/A 2.386154 1.33E-26 3.17E-25 16.2049 Up NA A_33_P3262635 ADA2 2.610774 1.34E-26 3.19E-25 16.20292 Up adenosine deaminase 2 A_23_P404494 IL7R 3.415871 1.43E-26 3.37E-25 16.18689 Up interleukin 7 receptor A_24_P557479 XAF1 2.379617 1.88E-26 4.39E-25 16.1119 Up XIAP associated factor 1 A_32_P74409 C11orf96 2.570999 2.03E-26 4.71E-25 16.09197 Up chromosome 11 open reading frame 96 A_23_P312132 ITGAX 2.406552 2.42E-26 5.56E-25 16.04471 Up integrin subunit alpha X A_23_P412562 C1orf162 2.597401 2.44E-26 5.6E-25 16.04287 Up chromosome 1 open reading frame 162 A_23_P161439 ADIRF 3.174346 2.47E-26 5.66E-25 16.03952 Up adipogenesis regulatory factor A_32_P140139 F13A1 4.362725 2.57E-26 5.88E-25 16.02883 Up coagulation factor XIII A chain inter-alpha-trypsin inhibitor heavy chain family A_23_P109881 ITIH4 2.909148 2.65E-26 6.06E-25 16.0203 Up member 4 A_19_P00322207 LINC01375 2.33579 2.77E-26 6.32E-25 16.00857 Up long intergenic non-protein coding RNA 1375 A_23_P38795 FPR1 3.10281 3.04E-26 6.9E-25 15.98371 Up formyl peptide receptor 1 A_23_P26024 C15orf48 3.339086 3.89E-26 8.76E-25 15.91748 Up chromosome 15 open reading frame 48 A_33_P3362153 TMEM238 3.063604 4.3E-26 9.64E-25 15.89094 Up transmembrane protein 238 A_23_P23074 IFI44 2.913787 5.17E-26 1.15E-24 15.84149 Up interferon induced protein 44 A_33_P3708413 MFAP5 3.644666 5.42E-26 1.2E-24 15.82912 Up microfibril associated protein 5 A_23_P427023 GIMAP1 2.44747 5.52E-26 1.23E-24 15.82392 Up GTPase, IMAP family member 1 A_23_P121253 TNFSF10 2.38014 6.49E-26 1.43E-24 15.78074 Up TNF superfamily member 10 major histocompatibility complex, class II, DP alpha A_33_P3234277 HLA-DPA1 2.74151 6.63E-26 1.46E-24 15.77536 Up 1 A_24_P369232 CCDC3 3.433898 7.67E-26 1.67E-24 15.7365 Up coiled-coil domain containing 3 A_23_P203475 CAVIN3 2.293461 7.97E-26 1.73E-24 15.72631 Up caveolae associated protein 3 A_33_P3361636 MGP 4.034051 8.16E-26 1.77E-24 15.72006 Up matrix Gla protein A_33_P3376821 GZMA 5.05819 9E-26 1.94E-24 15.69418 Up granzyme A A_23_P87011 TAGLN 3.201287 9.43E-26 2.03E-24 15.68178 Up transgelin A_23_P382065 EMCN 2.642168 9.7E-26 2.08E-24 15.67434 Up endomucin potassium channel tetramerization domain containing A_33_P3240507 KCTD12 2.535347 1.01E-25 2.16E-24 15.6647 Up 12 A_33_P3220570 UBTD1 2.631832 1.71E-25 3.59E-24 15.5236 Up ubiquitin domain containing 1 A_33_P3396139 CTLA4 2.831386 1.75E-25 3.67E-24 15.51758 Up cytotoxic T-lymphocyte associated protein 4 A_23_P89431 CCL2 2.496139 1.98E-25 4.11E-24 15.48622 Up C-C motif chemokine ligand 2 A_23_P16944 SDC1 2.504832 2E-25 4.16E-24 15.48327 Up syndecan 1 A_19_P00802258 ERICH1 2.896129 2.49E-25 5.13E-24 15.42524 Up glutamate rich 1 A_23_P114299 CXCR3 3.744321 2.64E-25 5.43E-24 15.41017 Up C-X-C motif chemokine receptor 3 A_33_P3369393 NCF1 2.526259 3.01E-25 6.15E-24 15.37527 Up neutrophil cytosolic factor 1 A_33_P3337896 PDE4DIP 2.943475 3.28E-25 6.69E-24 15.35267 Up phosphodiesterase 4D interacting protein A_23_P44674 CRIP1 2.677011 3.38E-25 6.87E-24 15.34549 Up cysteine rich protein 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_19_P00328159 #N/A 2.600923 3.56E-25 7.2E-24 15.33185 Up NA A_33_P3423941 IFITM1 2.356102 5.01E-25 9.96E-24 15.24207 Up interferon induced transmembrane protein 1 A_23_P138194 NCF2 2.388908 5.68E-25 1.12E-23 15.20948 Up neutrophil cytosolic factor 2 A_23_P60079 ANGPT2 3.138329 9E-25 1.74E-23 15.0896 Up angiopoietin 2 A_23_P149042 PYCR2 2.422796 1.29E-24 2.45E-23 14.99644 Up pyrroline-5-carboxylate reductase 2 A_23_P55356 VMO1 2.898622 1.74E-24 3.27E-23 14.91894 Up vitelline membrane outer layer 1 homolog A_23_P257003 PCSK5 2.442204 1.85E-24 3.46E-23 14.90304 Up proproteinconvertasesubtilisin/kexin type 5 A_33_P3263319 IGHM 6.755527 1.91E-24 3.57E-23 14.89483 Up immunoglobulin heavy constant mu A_23_P137665 CHI3L1 3.948465 1.99E-24 3.71E-23 14.88391 Up chitinase 3 like 1 A_33_P3237634 TSC22D3 2.774008 2.27E-24 4.21E-23 14.85035 Up TSC22 domain family member 3 interferon induced protein with tetratricopeptide A_23_P52266 IFIT1 3.266942 2.59E-24 4.78E-23 14.81568 Up repeats 1 A_23_P45871 IFI44L 3.382727 2.6E-24 4.79E-23 14.81505 Up interferon induced protein 44 like A_33_P3292769 NFAM1 2.293441 2.85E-24 5.23E-23 14.79162 Up NFAT activating protein with ITAM motif 1 glycoprotein, alpha-galactosyltransferase 1 A_23_P112452 GGTA1P 2.727895 3.74E-24 6.79E-23 14.72127 Up pseudogene A_23_P101992 MARCO 4.728794 4.16E-24 7.48E-23 14.69441 Up macrophage receptor with collagenous structure A_32_P87697 HLA-DRA 3.45946 4.46E-24 8.02E-23 14.67622 Up major histocompatibility complex, class II, DR alpha A_23_P24384 CCDC88B 2.468769 5.01E-24 8.99E-23 14.64658 Up coiled-coil domain containing 88B A_23_P152838 CCL5 2.50258 5.48E-24 9.8E-23 14.62353 Up C-C motif chemokine ligand 5 A_23_P166797 RTP4 2.453564 6.96E-24 1.23E-22 14.56256 Up receptor transporter protein 4 A_19_P00804124 TRAC 3.278694 7.3E-24 1.29E-22 14.55017 Up T cell receptor alpha constant immunoglobulin heavy constant gamma 1 (G1m A_23_P218126 IGHG1 4.593835 7.65E-24 1.35E-22 14.53829 Up marker) A_24_P365975 COL8A2 2.930569 7.88E-24 1.39E-22 14.53074 Up collagen type VIII alpha 2 chain A_23_P53081 OSBPL5 2.431059 8.06E-24 1.42E-22 14.52485 Up oxysterol binding protein like 5 A_23_P69573 GUCY1A1 3.139824 8.25E-24 1.45E-22 14.51903 Up guanylatecyclase 1 soluble subunit alpha 1 A_23_P115022 TMEM125 2.989701 8.56E-24 1.5E-22 14.50955 Up transmembrane protein 125 A_19_P00326763 CCDC80 3.213775 9.22E-24 1.61E-22 14.49072 Up coiled-coil domain containing 80 A_32_P56249 USP30-AS1 2.541819 9.92E-24 1.72E-22 14.47207 Up USP30 antisense RNA 1 A_33_P3405213 PECAM1 2.322737 1.12E-23 1.93E-22 14.44072 Up platelet and endothelial cell adhesion molecule 1 A_23_P28857 SIRPG 3.448153 1.14E-23 1.95E-22 14.43765 Up signal regulatory protein gamma A_33_P3311403 MRVI1 2.298325 1.25E-23 2.14E-22 14.41221 Up murine retrovirus integration site 1 homolog A_19_P00808044 #N/A 2.485688 1.27E-23 2.17E-22 14.40889 Up NA interferon induced protein with tetratricopeptide A_23_P24004 IFIT2 3.221453 1.44E-23 2.45E-22 14.37673 Up repeats 2 A_23_P55270 CCL18 4.857775 1.45E-23 2.46E-22 14.37552 Up C-C motif chemokine ligand 18 A_23_P101960 ZFP36L2 2.296428 2.64E-23 4.37E-22 14.22391 Up ZFP36 ring finger protein like 2 A_33_P3397599 LILRA6 3.052069 2.96E-23 4.87E-22 14.19454 Up leukocyte immunoglobulin like receptor A6 A_19_P00317484 CCDC80 3.112243 3.02E-23 4.95E-22 14.18972 Up coiled-coil domain containing 80 A_23_P152305 CDH11 2.833765 3.07E-23 5.03E-22 14.18577 Up cadherin 11 A_23_P314101 SUSD2 2.699992 3.74E-23 6.05E-22 14.13607 Up sushi domain containing 2 A_23_P107735 CD79A 3.830327 3.79E-23 6.14E-22 14.13219 Up CD79a molecule A_33_P3298159 PTGDS 3.380722 3.99E-23 6.44E-22 14.11966 Up prostaglandin D2 synthase signaling lymphocytic activation molecule family A_23_P62647 SLAMF1 2.999546 4.15E-23 6.69E-22 14.10974 Up member 1 A_24_P353638 SLAMF7 2.387546 5.22E-23 8.32E-22 14.05203 Up SLAM family member 7 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_23_P343398 CCR7 3.841302 7.16E-23 1.12E-21 13.97268 Up C-C motif chemokine receptor 7 A_23_P28334 IL18RAP 3.479752 9.1E-23 1.41E-21 13.91242 Up interleukin 18 receptor accessory protein A_23_P213102 PALLD 2.433168 1.29E-22 1.97E-21 13.82509 Up palladin, cytoskeletal associated protein A_19_P00331458 #N/A 5.14152 1.38E-22 2.1E-21 13.80772 Up NA Ras association (RalGDS/AF-6) and pleckstrin A_33_P3421571 RAPH1 2.725589 1.75E-22 2.63E-21 13.74963 Up homology domains 1 A_23_P117602 GZMB 3.360443 2.18E-22 3.25E-21 13.69476 Up granzyme B A_23_P167017 POPDC2 2.633201 2.69E-22 3.97E-21 13.64274 Up popeye domain containing 2 A_23_P214168 COL12A1 3.043023 3.46E-22 5.05E-21 13.57995 Up collagen type XII alpha 1 chain A_24_P45446 GBP4 2.79413 3.9E-22 5.67E-21 13.55038 Up guanylate binding protein 4 A_33_P3391603 LAMA4 2.417918 4.25E-22 6.14E-21 13.52939 Up laminin subunit alpha 4 A_23_P30736 HLA-DOB 2.881424 4.63E-22 6.66E-21 13.50789 Up major histocompatibility complex, class II, DO beta A_23_P23611 AMY1C 2.384318 5.08E-22 7.28E-21 13.485 Up amylase, alpha 1C (salivary) A_24_P28722 RSAD2 2.336287 5.62E-22 8.03E-21 13.46018 Up radical S-adenosyl methionine domain containing 2 A_23_P217845 RGS16 2.593426 6.83E-22 9.68E-21 13.41222 Up regulator of G protein signaling 16 A_19_P00811696 AL390719.2 2.994809 9.09E-22 1.27E-20 13.34166 Up novel transcript A_23_P209625 CYP1B1 2.660318 1.3E-21 1.78E-20 13.2542 Up cytochrome P450 family 1 subfamily B member 1 A_23_P360804 CPNE5 3.293586 1.41E-21 1.93E-20 13.23407 Up copine 5 A_24_P270460 IFI27 2.637896 1.43E-21 1.96E-20 13.23008 Up interferon alpha inducible protein 27 A_33_P3230037 #N/A 2.599916 1.61E-21 2.18E-20 13.20212 Up NA A_23_P372834 AQP1 2.396249 1.65E-21 2.24E-20 13.19575 Up aquaporin 1 (Colton blood group) A_24_P227927 IL21R 2.460218 2.02E-21 2.71E-20 13.14637 Up interleukin 21 receptor A_23_P201211 FCRL5 3.608743 2.06E-21 2.77E-20 13.14084 Up Fc receptor like 5 A_23_P157879 FCN1 4.157824 2.1E-21 2.81E-20 13.13694 Up ficolin 1 A_33_P3724155 DERL3 2.394784 2.46E-21 3.27E-20 13.09778 Up derlin 3 A_23_P407840 FNDC1 2.791325 2.59E-21 3.42E-20 13.08561 Up fibronectin type III domain containing 1 A_23_P145096 PLA2G7 2.297705 2.82E-21 3.72E-20 13.06482 Up phospholipase A2 group VII A_33_P3321507 TNRC18 3.905301 3.66E-21 4.78E-20 13.00137 Up trinucleotide repeat containing 18 A_33_P3382498 SIGLEC14 3.001418 4.89E-21 6.32E-20 12.93048 Up sialic acid binding Ig like lectin 14 A_33_P3374893 LINC00487 2.557785 5.54E-21 7.09E-20 12.90053 Up long intergenic non-protein coding RNA 487 A_23_P211561 MEI1 2.37965 6.03E-21 7.71E-20 12.87981 Up meiotic double-stranded break formation protein 1 A_33_P3352098 MS4A7 2.339486 6.35E-21 8.1E-20 12.86744 Up membrane spanning 4-domains A7 A_33_P3303394 #N/A 3.109412 8.27E-21 1.04E-19 12.80339 Up NA A_24_P264943 COMP 3.440126 1.01E-20 1.27E-19 12.75395 Up cartilage oligomeric matrix protein A_33_P3343120 IRF8 2.299344 1.02E-20 1.27E-19 12.75338 Up interferon regulatory factor 8 A_19_P00331252 #N/A 2.4998 1.05E-20 1.3E-19 12.74621 Up NA A_19_P00810590 #N/A 2.337062 1.1E-20 1.36E-19 12.73487 Up NA A_33_P3380383 TIFAB 3.39964 1.18E-20 1.47E-19 12.71668 Up TIFA inhibitor A_23_P137046 NYX 2.586592 1.27E-20 1.57E-19 12.69906 Up nyctalopin A_23_P64058 RASGRP2 2.509768 1.43E-20 1.75E-19 12.67194 Up RAS guanyl releasing protein 2 A_23_P57417 MMP11 3.429715 1.83E-20 2.23E-19 12.61167 Up matrix metallopeptidase 11 A_19_P00327301 #N/A 3.916609 1.83E-20 2.23E-19 12.61156 Up NA A_33_P3351180 IGHA1 6.13942 1.83E-20 2.23E-19 12.61138 Up immunoglobulin heavy constant alpha 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_23_P143817 MYLK 2.312813 1.87E-20 2.27E-19 12.60615 Up myosin light chain kinase A_19_P00320390 PLD1 2.449235 2.11E-20 2.55E-19 12.57692 Up phospholipase D1 A_23_P82775 SOX17 2.554028 2.42E-20 2.9E-19 12.5447 Up SRY-box 17 A_23_P20101 TAS2R4 2.45774 2.84E-20 3.38E-19 12.5059 Up taste 2 receptor member 4 A_33_P3226154 IGKC 5.527303 3.41E-20 4.02E-19 12.46244 Up immunoglobulin kappa constant A_23_P501007 EFEMP1 2.431346 3.64E-20 4.28E-19 12.44676 Up EGF containing fibulin extracellular matrix protein 1 A_33_P3511265 POSTN 2.777667 4.35E-20 5.08E-19 12.40409 Up periostin A_33_P3319870 GREM1 2.811949 4.59E-20 5.35E-19 12.39134 Up gremlin 1, DAN family BMP antagonist A_23_P156218 GZMK 3.250669 4.84E-20 5.62E-19 12.37866 Up granzyme K A_23_P145631 GIMAP6 2.304357 5.9E-20 6.81E-19 12.33102 Up GTPase, IMAP family member 6 A_33_P3329088 PRSS8 2.406087 6.51E-20 7.46E-19 12.30764 Up serine protease 8 A_32_P170397 LOC105370792 2.436955 1.39E-19 1.54E-18 12.12678 Up uncharacterized LOC105370792 immunoglobulin heavy constant alpha 2 (A2m A_32_P190951 IGHA2 3.545332 2.04E-19 2.22E-18 12.03575 Up marker) A_23_P253317 GPR171 3.010564 2.08E-19 2.25E-18 12.03176 Up G protein-coupled receptor 171 A_23_P500271 IRF5 2.37109 2.89E-19 3.09E-18 11.95391 Up interferon regulatory factor 5 A_23_P209954 GNLY 3.636916 5.01E-19 5.22E-18 11.82382 Up granulysin A_23_P151895 CILP 3.705489 5.03E-19 5.23E-18 11.82306 Up cartilage intermediate layer protein A_23_P140190 FAM30A 3.754873 7.21E-19 7.37E-18 11.73829 Up family with sequence similarity 30 member A A_19_P00322332 AC004585.1 2.553099 9.89E-19 9.98E-18 11.66406 Up novel transcrip A_19_P00317953 AC004585.1 2.615041 1.04E-18 1.05E-17 11.65233 Up novel transcript A_32_P163247 CD8A 2.528068 1.67E-18 1.65E-17 11.5409 Up CD8a molecule A_33_P3590259 CXCL14 3.497385 1.8E-18 1.77E-17 11.52364 Up C-X-C motif chemokine ligand 14 A_23_P29773 LAMP3 2.679608 3.48E-18 3.32E-17 11.37018 Up lysosomal associated membrane protein 3 glycosylphosphatidylinositol anchored high density A_23_P72697 GPIHBP1 2.593933 6.29E-18 5.84E-17 11.2322 Up lipoprotein binding protein 1 A_23_P138706 ADRA2A 2.349375 6.5E-18 6.03E-17 11.22444 Up adrenoceptor alpha 2A A_23_P48088 CD27 2.302382 6.61E-18 6.12E-17 11.22082 Up CD27 molecule A_24_P766716 CMKLR1 2.28056 7.96E-18 7.32E-17 11.17741 Up chemerin chemokine-like receptor 1 A_33_P3271711 AC018816.1 2.418895 8.28E-18 7.58E-17 11.16842 Up novel transcript, antisense to ITPR1 A_19_P00806410 #N/A 2.987755 9E-18 8.2E-17 11.14899 Up NA A_23_P119562 CFD 2.316475 1.16E-17 1.04E-16 11.09089 Up complement factor D A_33_P3236392 NECTIN4 2.396997 1.43E-17 1.27E-16 11.04228 Up nectin cell adhesion molecule 4 A_33_P3400273 SELL 2.619696 1.56E-17 1.38E-16 11.02197 Up selectin L A_23_P139786 OASL 2.700262 1.61E-17 1.43E-16 11.0147 Up 2'-5'-oligoadenylate synthetase like A_33_P3285565 CLDN3 2.501519 1.65E-17 1.46E-16 11.00924 Up claudin 3 A_33_P3372910 DDX58 3.199323 1.69E-17 1.5E-16 11.00258 Up DExD/H-box helicase 58 A_23_P150053 ACTA2 2.470308 1.72E-17 1.52E-16 10.99876 Up actin, alpha 2, smooth muscle, aorta major histocompatibility complex, class II, DR beta A_24_P370472 HLA-DRB4 3.229888 2.07E-17 1.81E-16 10.95641 Up 4 A_24_P335092 SAA1 3.497804 2.83E-17 2.45E-16 10.88411 Up serum amyloid A1 A_23_P81898 UBD 3.449891 4.56E-17 3.86E-16 10.77433 Up ubiquitin D A_24_P117410 KLHDC7B 3.330251 6.04E-17 5.04E-16 10.70994 Up kelch domain containing 7B A_24_P417352 IGHM 4.644246 2.16E-16 1.71E-15 10.41778 Up immunoglobulin heavy constant mu A_33_P3335506 FCRL5 3.578874 2.73E-16 2.14E-15 10.36429 Up Fc receptor like 5 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_19_P00329989 #N/A 2.299985 3.65E-16 2.81E-15 10.29844 Up NA A_19_P00809075 #N/A 3.659289 6.57E-16 4.93E-15 10.16431 Up NA A_23_P125233 CNN1 2.515036 8.03E-16 5.97E-15 10.11864 Up calponin 1 A_33_P3250680 CD40LG 2.32671 1.25E-15 9.09E-15 10.01805 Up CD40 ligand A_23_P6535 KLHDC7B 2.313632 1.42E-15 1.03E-14 9.988564 Up kelch domain containing 7B A_24_P110242 #N/A 2.568836 2.11E-15 1.5E-14 9.899904 Up NA A_33_P3424800 HLA-B 2.367461 2.2E-15 1.56E-14 9.890471 Up major histocompatibility complex, class I, B A_33_P3424612 IGKV3-11 2.648946 2.2E-15 1.57E-14 9.889708 Up immunoglobulin kappa variable 3-11 IGHV3OR16- immunoglobulin heavy variable 3/OR16-10 (non- A_24_P144346 10 2.683612 2.71E-15 1.91E-14 9.842796 Up functional) A_23_P203558 HBB 2.848402 4.41E-15 3.04E-14 9.732888 Up hemoglobin subunit beta major histocompatibility complex, class II, DR beta A_23_P45099 HLA-DRB5 3.542728 5.21E-15 3.57E-14 9.694871 Up 5 A_23_P259292 C1QTNF5 2.794209 7.99E-15 5.37E-14 9.598521 Up C1q and TNF related 5 A_23_P518 VTCN1 2.323212 1.02E-14 6.78E-14 9.543397 Up V-set domain containing T cell activation inhibitor 1 A_23_P76249 KRT6B 4.445944 1.11E-14 7.32E-14 9.524954 Up keratin 6B A_23_P253123 VGLL1 2.558962 1.27E-14 8.39E-14 9.493014 Up vestigial like family member 1 A_24_P206776 CRYAB 2.816682 1.47E-14 9.61E-14 9.460952 Up crystallin alpha B A_23_P6909 ACKR4 2.281579 1.61E-14 1.05E-13 9.439988 Up atypical chemokine receptor 4 A_23_P258769 HLA-DPB1 3.522415 1.76E-14 1.14E-13 9.420854 Up major histocompatibility complex, class II, DP beta 1 A_33_P3418194 LYNX1 2.284545 4.22E-14 2.64E-13 9.22358 Up Ly6/neurotoxin 1 A_33_P3375859 CXCR2P1 2.587257 4.4E-14 2.74E-13 9.21424 Up C-X-C motif chemokine receptor 2 pseudogene 1 A_33_P3424489 IGLV3-25 2.785267 4.55E-14 2.83E-13 9.206692 Up immunoglobulin lambda variable 3-25 A_32_P152195 STAC2 3.260428 6.35E-14 3.9E-13 9.131667 Up SH3 and cysteine rich domain 2 A_33_P3346331 #N/A 2.529599 1.03E-13 6.2E-13 9.023136 Up NA A_33_P3339865 CALML5 3.580737 1.09E-13 6.55E-13 9.010372 Up calmodulin like 5 A_33_P3376958 BMS1P20 2.871766 1.74E-13 1.02E-12 8.905609 Up BMS1, ribosome biogenesis factor pseudogene 20 A_23_P101131 GRP 3.038959 3.85E-13 2.18E-12 8.726927 Up gastrin releasing peptide A_23_P201636 LAMC2 2.594013 1.68E-12 8.92E-12 8.395857 Up laminin subunit gamma 2 A_33_P3388501 CHIT1 3.055753 2.25E-12 1.17E-11 8.3308 Up chitinase 1 A_23_P18078 RARRES1 2.428316 4.4E-12 2.23E-11 8.180056 Up retinoic acid receptor responder 1 non-specific cytotoxic cell receptor protein 1 A_33_P3411477 NCCRP1 2.741693 4.77E-12 2.41E-11 8.161972 Up homolog (zebrafish) A_23_P218047 KRT5 2.920621 7.58E-12 3.76E-11 8.057882 Up keratin 5 A_23_P362694 FDCSP 4.988331 9.44E-12 4.62E-11 8.008374 Up follicular dendritic cell secreted protein A_32_P722809 IGKV2-28 2.315098 5.56E-11 2.5E-10 7.608729 Up immunoglobulin kappa variable 2-28 A_33_P3329078 HBG1 -9.87866 2.08E-78 2.94E-74 -85.4114 Down hemoglobin subunit gamma 1 A_23_P53137 HBG1 -9.17317 2.88E-78 3.05E-74 -85.0499 Down hemoglobin subunit gamma 1 A_23_P312851 PMEL -7.89712 6.14E-74 4.47E-70 -74.665 Down premelanosome protein A_23_P155514 AHSG -7.69506 6.33E-74 4.47E-70 -74.6358 Down alpha 2-HS glycoprotein A_23_P257834 ALB -7.68942 1.73E-73 1.05E-69 -73.6609 Down albumin A_23_P42868 IGFBP1 -7.65594 1.29E-72 6.83E-69 -71.7477 Down insulin like growth factor binding protein 1 A_33_P3421243 AFP -7.40751 1.57E-71 6.67E-68 -69.434 Down alpha fetoprotein A_23_P79562 FABP1 -6.46725 4.59E-71 1.77E-67 -68.4655 Down fatty acid binding protein 1 A_23_P38244 APOH -6.64857 2.01E-66 6.56E-63 -59.4881 Down apolipoprotein H bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_23_P256504 AMBP -6.54292 4.46E-65 1.35E-61 -57.1046 Down alpha-1-microglobulin/bikunin precursor TMEM132D- A_33_P3531979 AS1 -5.14294 1.07E-64 3.01E-61 -56.4506 Down TMEM132D antisense RNA 1 A_24_P302249 APOA2 -6.41694 6.32E-64 1.67E-60 -55.1375 Down apolipoprotein A2 A_33_P3843873 ESRG -6.08029 7.25E-63 1.71E-59 -53.3842 Down embryonic stem cell related A_33_P3421827 HBZ -5.01491 5.83E-60 1.12E-56 -48.8437 Down hemoglobin subunit zeta A_32_P385587 ALAS2 -5.52432 2.07E-59 3.82E-56 -48.0261 Down 5'-aminolevulinate synthase 2 A_23_P352494 RHOXF2 -5.40504 2.79E-59 4.94E-56 -47.8345 Down Rhoxhomeobox family member 2 A_23_P94879 F2 -4.89116 4.58E-59 7.77E-56 -47.52 Down coagulation factor II, thrombin A_23_P16866 VIL1 -3.82252 5.49E-59 8.96E-56 -47.4048 Down villin 1 A_23_P27107 TM4SF5 -4.57479 1.45E-58 2.28E-55 -46.7934 Down transmembrane 4 L six family member 5 A_23_P33216 ATP5F1B -3.61358 1.59E-58 2.41E-55 -46.7352 Down ATP synthase F1 subunit beta A_33_P3239214 TYR -4.7283 2.82E-58 4.13E-55 -46.3797 Down tyrosinase A_23_P43350 MLANA -4.31796 6.59E-58 9.31E-55 -45.8573 Down melan-A A_19_P00808320 #N/A -4.15688 1.96E-56 2.45E-53 -43.8181 Down NA sperm protein associated with the nucleus, X-linked, A_32_P219660 SPANXA1 -4.61521 2.14E-56 2.59E-53 -43.7674 Down family member A1 A_23_P42265 APOM -4.19315 8.41E-56 9.39E-53 -42.9701 Down apolipoprotein M immunoglobulin superfamily DCC subclass member A_33_P3234020 IGDCC3 -3.29658 1.55E-55 1.68E-52 -42.6199 Down 3 A_23_P130333 TTR -4.68389 2.54E-55 2.69E-52 -42.3366 Down transthyretin A_23_P401055 SOX2 -4.48371 5.72E-55 5.92E-52 -41.8757 Down SRY-box 2 A_24_P289709 HBG2 -4.20513 4.17E-54 4.01E-51 -40.7695 Down hemoglobin subunit gamma 2 A_24_P365515 FOXA2 -2.89902 8.11E-54 7.64E-51 -40.4044 Down forkhead box A2 A_33_P3240078 #N/A -4.29188 1.01E-53 9.3E-51 -40.2855 Down NA A_33_P3242798 CPS1 -4.54086 1.3E-53 1.13E-50 -40.1477 Down carbamoyl-phosphate synthase 1 A_33_P3233608 SPANXB1 -3.9946 1.31E-53 1.13E-50 -40.1438 Down SPANX family member B1 A_23_P317756 ACSM3 -2.94732 3.29E-53 2.79E-50 -39.6465 Down acyl-CoA synthetase medium chain family member 3 A_23_P66739 SLC13A5 -4.1449 4.68E-53 3.82E-50 -39.4573 Down solute carrier family 13 member 5 A_23_P137238 KDM5D -2.08371 8.08E-53 6.46E-50 -39.1669 Down lysine demethylase 5D A_23_P18579 PTTG2 -2.62564 9.8E-53 7.7E-50 -39.0644 Down pituitary tumor-transforming 2 A_33_P3395595 CCR9 -2.71911 1.17E-52 9.01E-50 -38.9715 Down C-C motif chemokine receptor 9 A_23_P42386 CGA -3.95064 1.5E-52 1.1E-49 -38.8383 Down glycoprotein hormones, alpha polypeptide A_33_P3376786 LINC01291 -2.06397 3.88E-52 2.65E-49 -38.3422 Down long intergenic non-protein coding RNA 1291 A_33_P3313145 ITIH3 -4.16368 7.69E-52 5.18E-49 -37.9874 Down inter-alpha-trypsin inhibitor heavy chain 3 A_19_P00812573 #N/A -3.31411 8.84E-52 5.86E-49 -37.9152 Down NA A_23_P63379 CA14 -3.95596 1.63E-51 9.89E-49 -37.6006 Down carbonic anhydrase 14 A_23_P23155 AJAP1 -2.30904 2.01E-51 1.19E-48 -37.4935 Down adherens junctions associated protein 1 A_23_P108437 FZD5 -3.05791 2.53E-51 1.47E-48 -37.3779 Down frizzled class receptor 5 A_23_P109928 PSMD6 -2.86998 2.62E-51 1.5E-48 -37.3586 Down proteasome 26S subunit, non-ATPase 6 A_23_P89981 CYP2F1 -3.66936 2.9E-51 1.62E-48 -37.3074 Down cytochrome P450 family 2 subfamily F member 1 A_23_P76622 DCT -3.20922 5.2E-51 2.86E-48 -37.0118 Down dopachrometautomerase A_24_P228796 GAGE7 -5.34821 6.4E-51 3.48E-48 -36.9071 Down G antigen 7 A_19_P00802276 #N/A -3.67595 1.18E-50 6.24E-48 -36.602 Down NA A_23_P94403 TYRP1 -3.50018 1.25E-50 6.56E-48 -36.5707 Down tyrosinase related protein 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_23_P218423 MRPL10 -2.10517 3.24E-50 1.66E-47 -36.0991 Down mitochondrial ribosomal protein L10 A_33_P3230264 GPC3 -5.63294 4.62E-50 2.3E-47 -35.9249 Down glypican 3 A_23_P28598 DLX2 -2.79906 6.53E-50 3.18E-47 -35.7552 Down distal-less homeobox 2 A_23_P203183 APOC3 -3.50277 8.81E-50 4.2E-47 -35.6093 Down apolipoprotein C3 A_19_P00809682 #N/A -4.51404 1.67E-49 7.55E-47 -35.2972 Down NA A_24_P58204 OR51B5 -2.51379 4.72E-49 2.08E-46 -34.7994 Down olfactory receptor family 51 subfamily B member 5 A_33_P3889179 LINC00698 -3.06659 8.19E-49 3.54E-46 -34.537 Down long intergenic non-protein coding RNA 698 A_23_P102876 CCT8 -2.03027 8.91E-49 3.82E-46 -34.4972 Down chaperonin containing TCP1 subunit 8 A_23_P21230 TRIM37 -2.75122 1.15E-48 4.84E-46 -34.3748 Down tripartite motif containing 37 A_24_P393571 GDA -2.8724 1.23E-48 5.06E-46 -34.3447 Down guanine deaminase A_24_P41570 H2AFZ -2.41443 2.09E-48 8.44E-46 -34.0952 Down H2A histone family member Z A_23_P25019 PRIM1 -2.36834 2.64E-48 1.03E-45 -33.9865 Down DNA primase subunit 1 phosphatidylinositol specific phospholipase C X A_23_P61180 PLCXD1 -3.25179 3.14E-48 1.22E-45 -33.9044 Down domain containing 1 A_24_P322771 TFF1 -4.05605 5.28E-48 2E-45 -33.663 Down trefoil factor 1 A_23_P119763 ABCG5 -2.03315 5.64E-48 2.12E-45 -33.6321 Down ATP binding cassette subfamily G member 5 A_23_P46639 C8A -2.25586 7.65E-48 2.85E-45 -33.4912 Down complement C8 alpha chain potassium voltage-gated channel subfamily Q A_33_P3395823 KCNQ2 -3.38127 7.92E-48 2.92E-45 -33.4754 Down member 2 A_23_P85218 SOX3 -3.54259 8.26E-48 3.02E-45 -33.456 Down SRY-box 3 A_23_P160800 NR0B2 -2.99242 9.44E-48 3.42E-45 -33.3943 Down nuclear receptor subfamily 0 group B member 2 A_23_P114626 SERPINC1 -2.4903 1.09E-47 3.89E-45 -33.3277 Down serpin family C member 1 A_23_P380526 DPPA4 -2.69636 1.38E-47 4.87E-45 -33.2202 Down developmental pluripotency associated 4 A_23_P214037 NPM1 -2.58775 2.54E-47 8.91E-45 -32.9407 Down nucleophosmin 1 A_33_P3298539 APOA1 -3.67939 5.85E-47 2.02E-44 -32.5636 Down apolipoprotein A1 A_24_P148450 UBE2E3 -1.95973 7.58E-47 2.57E-44 -32.447 Down ubiquitin conjugating enzyme E2 E3 A_23_P310274 PRSS2 -5.19228 1.88E-46 6.28E-44 -32.0407 Down serine protease 2 A_24_P934800 ERI2 -2.53982 2.21E-46 7.26E-44 -31.9699 Down ERI1 exoribonuclease family member 2 A_19_P00320202 #N/A -3.25129 2.21E-46 7.26E-44 -31.9692 Down NA A_24_P126691 #N/A -2.06447 2.36E-46 7.67E-44 -31.9405 Down NA A_24_P227091 KIF11 -2.13096 2.41E-46 7.75E-44 -31.9301 Down kinesin family member 11 A_23_P29939 SNCA -3.81037 2.82E-46 8.92E-44 -31.8613 Down synuclein alpha A_33_P3399980 TYRP1 -3.24745 3.14E-46 9.85E-44 -31.8144 Down tyrosinase related protein 1 A_23_P350005 TRIML2 -2.90954 3.4E-46 1.06E-43 -31.7782 Down tripartite motif family like 2 A_19_P00330360 #N/A -2.36259 5.57E-46 1.71E-43 -31.5614 Down NA A_33_P3241511 SERPIND1 -2.37304 5.76E-46 1.76E-43 -31.5467 Down serpin family D member 1 A_32_P54544 CCT6A -2.2397 1.27E-45 3.8E-43 -31.2013 Down chaperonin containing TCP1 subunit 6A A_23_P17844 PVALB -2.89281 1.35E-45 4.01E-43 -31.1741 Down parvalbumin A_24_P577694 ADCY1 -3.10085 1.76E-45 5.19E-43 -31.0593 Down adenylatecyclase 1 A_23_P59138 POU5F1 -3.97316 2.79E-45 8.11E-43 -30.8609 Down POU class 5 homeobox 1 A_23_P111273 TBC1D7 -2.64845 2.85E-45 8.22E-43 -30.8524 Down TBC1 domain family member 7 A_23_P122197 CCNB1 -2.85569 5.77E-45 1.58E-42 -30.55 Down cyclin B1 A_23_P110802 CENPH -2.07771 5.96E-45 1.62E-42 -30.5361 Down centromere protein H A_23_P69329 HYAL1 -2.48799 6.24E-45 1.68E-42 -30.5165 Down hyaluronidase 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_23_P217178 MAGEC1 -4.24312 7.78E-45 2.06E-42 -30.4227 Down MAGE family member C1 A_33_P3317168 EPS8L3 -2.75234 8.2E-45 2.15E-42 -30.4005 Down EPS8 like 3 A_19_P00807615 #N/A -4.31112 1.07E-44 2.76E-42 -30.2881 Down NA A_24_P89426 APOM -2.8366 1.36E-44 3.48E-42 -30.1849 Down apolipoprotein M A_23_P47565 LDHA -2.83018 2.11E-44 5.27E-42 -30.0005 Down lactate dehydrogenase A A_33_P3227990 MBP -3.00757 2.54E-44 6.27E-42 -29.9229 Down myelin basic protein A_23_P85560 EIF3I -2.17367 2.56E-44 6.28E-42 -29.9198 Down eukaryotic translation initiation factor 3 subunit I A_24_P468810 RBBP4 -2.14569 2.73E-44 6.65E-42 -29.8935 Down RB binding protein 4, chromatin remodeling factor A_23_P148475 KIF4A -2.29048 2.87E-44 6.96E-42 -29.8719 Down kinesin family member 4A A_19_P00324181 #N/A -2.68307 3.38E-44 8.14E-42 -29.8039 Down NA A_33_P3286349 DNAAF3 -2.12962 4.44E-44 1.06E-41 -29.6904 Down dynein axonemal assembly factor 3 pancreatic progenitor cell differentiation and A_32_P80741 PPDPFL -3.48917 5.76E-44 1.37E-41 -29.5821 Down proliferation factor like A_23_P78099 VTN -2.0135 6.01E-44 1.42E-41 -29.5641 Down vitronectin A_19_P00316836 LINC01291 -1.98061 7.76E-44 1.82E-41 -29.4583 Down long intergenic non-protein coding RNA 1291 A_32_P45738 PGAM1 -3.17773 7.92E-44 1.85E-41 -29.4496 Down phosphoglyceratemutase 1 A_23_P95930 HMGA2 -2.9074 1.03E-43 2.37E-41 -29.3404 Down high mobility group AT-hook 2 A_19_P00319465 MAVS -2.43983 1.37E-43 3.09E-41 -29.2238 Down mitochondrial antiviral signaling protein A_23_P148255 MAGEA2B -3.12491 1.47E-43 3.3E-41 -29.1945 Down MAGE family member A2B A_19_P00812044 MAVS -2.13396 1.59E-43 3.54E-41 -29.1633 Down mitochondrial antiviral signaling protein A_23_P41314 F11 -2.45439 1.61E-43 3.58E-41 -29.1572 Down coagulation factor XI A_23_P101642 PTPRH -3.18439 2.08E-43 4.55E-41 -29.0528 Down protein tyrosine phosphatase, receptor type H A_23_P330070 TFPI -4.71348 2.55E-43 5.49E-41 -28.9698 Down tissue factor pathway inhibitor A_23_P156310 SKP2 -2.29327 2.87E-43 6.13E-41 -28.9207 Down S-phase kinase associated protein 2 A_23_P137484 L1TD1 -3.30847 3E-43 6.37E-41 -28.9027 Down LINE1 type transposase domain containing 1 A_33_P3260223 TXLNGY -2.00809 3.1E-43 6.55E-41 -28.8894 Down taxilin gamma pseudogene, Y-linked A_23_P259314 RPS4Y1 -2.96302 4.55E-43 9.4E-41 -28.7345 Down ribosomal protein S4 Y-linked 1 A_23_P44569 ABCC2 -2.63138 4.69E-43 9.65E-41 -28.7222 Down ATP binding cassette subfamily C member 2 A_23_P76529 ITGB7 -3.98437 6.41E-43 1.29E-40 -28.5956 Down integrin subunit beta 7 A_23_P114983 TRIM63 -2.57143 7.8E-43 1.55E-40 -28.5163 Down tripartite motif containing 63 A_23_P145089 HSP90AB1 -2.08537 8.55E-43 1.69E-40 -28.4795 Down heat shock protein 90 alpha family class B member 1 A_23_P78108 ALDOC -2.74056 1E-42 1.97E-40 -28.4159 Down aldolase, fructose-bisphosphate C A_23_P130113 ASGR2 -3.68421 1.17E-42 2.28E-40 -28.3548 Down asialoglycoprotein receptor 2 A_23_P58321 CCNA2 -1.97342 1.25E-42 2.43E-40 -28.3277 Down cyclin A2 A_23_P103877 LRRC38 -2.06575 1.79E-42 3.37E-40 -28.1826 Down leucine rich repeat containing 38 A_24_P192994 FADS1 -2.38938 1.98E-42 3.7E-40 -28.1427 Down fatty acid desaturase 1 A_32_P194062 TYR -3.33854 2.07E-42 3.84E-40 -28.1251 Down tyrosinase A_23_P17134 MAL -4.83594 2.27E-42 4.15E-40 -28.0885 Down mal, T cell differentiation protein A_23_P150609 IGF2 -5.43738 2.51E-42 4.55E-40 -28.0486 Down insulin like growth factor 2 A_23_P202053 ITIH2 -2.18812 2.91E-42 5.25E-40 -27.9906 Down inter-alpha-trypsin inhibitor heavy chain 2 glyceraldehyde-3-phosphate dehydrogenase A_19_P00803548 GAPDHP14 -2.36137 4.95E-42 8.82E-40 -27.7802 Down pseudogene 14 A_24_P236091 ENO2 -2.26064 5.43E-42 9.56E-40 -27.7435 Down enolase 2 A_24_P463929 SMLR1 -2.10403 6.39E-42 1.12E-39 -27.6799 Down small leucine rich protein 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_33_P3212109 DCDC2 -2.43702 6.65E-42 1.16E-39 -27.6639 Down doublecortin domain containing 2 A_24_P690924 SEC23B -1.95568 7.88E-42 1.36E-39 -27.5977 Down Sec23 homolog B, coat complex II component A_33_P3413962 PFKP -2.34466 9.61E-42 1.62E-39 -27.52 Down phosphofructokinase, platelet A_23_P207400 BRCA1 -1.94925 1.07E-41 1.8E-39 -27.4774 Down BRCA1, DNA repair associated A_24_P276888 CENPO -1.96603 1.12E-41 1.88E-39 -27.459 Down centromere protein O A_23_P144684 SLF1 -2.05372 1.3E-41 2.16E-39 -27.4018 Down SMC5-SMC6 complex localization factor 1 A_23_P13753 NFE2 -4.24444 1.61E-41 2.65E-39 -27.3188 Down nuclear factor, erythroid 2 A_23_P206760 HP -5.6138 1.65E-41 2.7E-39 -27.3092 Down haptoglobin A_24_P182620 CELSR2 -2.76048 2.08E-41 3.38E-39 -27.2197 Down cadherin EGF LAG seven-pass G-type receptor 2 A_32_P193646 RBMX -2.02375 2.18E-41 3.51E-39 -27.2017 Down RNA binding motif protein X-linked A_23_P68072 WDR54 -2.30021 2.64E-41 4.2E-39 -27.1266 Down WD repeat domain 54 A_19_P00329711 MAVS -2.20856 3.2E-41 5.06E-39 -27.053 Down mitochondrial antiviral signaling protein A_23_P76851 PRMT5 -2.10868 3.43E-41 5.39E-39 -27.026 Down protein arginine methyltransferase 5 A_24_P42136 KRT18 -2.87681 3.7E-41 5.79E-39 -26.9965 Down keratin 18 gamma-aminobutyric acid type A receptor beta1 A_23_P125435 GABRB1 -2.05724 3.79E-41 5.9E-39 -26.9879 Down subunit A_33_P3358745 SELENOP -2.06878 3.85E-41 5.97E-39 -26.982 Down selenoprotein P A_33_P3214298 IMPDH2 -2.56619 5.29E-41 8.07E-39 -26.8594 Down inosine monophosphate dehydrogenase 2 A_23_P72817 GDF3 -1.95995 5.48E-41 8.34E-39 -26.8457 Down growth differentiation factor 3 A_23_P124905 NPTX1 -3.18101 5.94E-41 8.97E-39 -26.8148 Down neuronal pentraxin 1 A_33_P3290888 CPNE1 -2.22497 6.98E-41 1.04E-38 -26.7533 Down copine 1 A_33_P3258612 PCNA -2.32632 6.99E-41 1.04E-38 -26.7529 Down proliferating cell nuclear antigen A_32_P184796 RPLP0 -3.00113 1.24E-40 1.79E-38 -26.5331 Down ribosomal protein lateral stalk subunit P0 A_23_P106145 ERO1A -2.40244 1.44E-40 2.06E-38 -26.4765 Down endoplasmic reticulum oxidoreductase 1 alpha A_23_P126623 PGD -2.1888 1.46E-40 2.07E-38 -26.4724 Down phosphogluconate dehydrogenase A_24_P71468 QPCT -2.37603 1.78E-40 2.5E-38 -26.3972 Down glutaminyl-peptide cyclotransferase A_23_P215675 COA1 -2.24402 1.94E-40 2.72E-38 -26.3645 Down cytochrome c oxidase assembly factor 1 homolog A_19_P00810205 CCNB2P1 -2.08159 2.25E-40 3.11E-38 -26.3098 Down cyclin B2 pseudogene 1 A_23_P324384 RPS4Y2 -2.43635 2.58E-40 3.55E-38 -26.258 Down ribosomal protein S4 Y-linked 2 A_24_P245358 ATP5F1A -2.49088 2.58E-40 3.55E-38 -26.2575 Down ATP synthase F1 subunit alpha A_23_P212050 BCHE -2.87456 2.68E-40 3.68E-38 -26.2424 Down butyrylcholinesterase A_23_P258964 IARS -2.04822 3.36E-40 4.56E-38 -26.1584 Down isoleucyl-tRNAsynthetase A_33_P3639068 GFRA1 -3.19287 4.04E-40 5.46E-38 -26.0893 Down GDNF family receptor alpha 1 A_19_P00800668 #N/A -2.84689 4.08E-40 5.49E-38 -26.0858 Down NA A_24_P294832 PTP4A1 -2.35089 5.18E-40 6.87E-38 -25.996 Down protein tyrosine phosphatase type IVA, member 1 A_23_P103720 AGMAT -2.60988 5.35E-40 7.07E-38 -25.9838 Down agmatinase A_33_P3334630 PLP1 -2.40202 5.37E-40 7.07E-38 -25.9827 Down proteolipid protein 1 A_23_P138507 CDK1 -2.39285 5.83E-40 7.65E-38 -25.9522 Down cyclin dependent kinase 1 A_19_P00316257 AC005062.1 -2.07653 6.08E-40 7.94E-38 -25.9362 Down NA A_23_P11685 PLA2G4A -2.37937 6.22E-40 8.09E-38 -25.9277 Down phospholipase A2 group IVA A_24_P358328 TPI1P2 -2.33494 6.53E-40 8.47E-38 -25.9095 Down triosephosphateisomerase 1 pseudogene 2 A_23_P117363 SERPINA6 -2.94283 7.32E-40 9.4E-38 -25.8673 Down serpin family A member 6 A_23_P393620 TFPI2 -3.58672 8.56E-40 1.1E-37 -25.8091 Down tissue factor pathway inhibitor 2 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_23_P375165 TEX19 -2.17935 8.72E-40 1.11E-37 -25.8021 Down testis expressed 19 A_32_P62997 PBK -2.5487 8.8E-40 1.12E-37 -25.799 Down PDZ binding kinase A_23_P204640 NANOG -2.57023 1.31E-39 1.66E-37 -25.6509 Down Nanoghomeobox A_23_P327910 ZIC3 -2.12406 1.57E-39 1.94E-37 -25.5846 Down Zic family member 3 A_23_P28953 DNMT3B -2.48113 1.73E-39 2.11E-37 -25.5497 Down DNA methyltransferase 3 beta A_23_P57868 ACY1 -2.76309 1.74E-39 2.12E-37 -25.5475 Down aminoacylase 1 A_23_P7636 PTTG1 -2.49395 2.61E-39 3.14E-37 -25.3976 Down pituitary tumor-transforming 1 A_33_P3262890 RPSAP2 -2.31865 2.69E-39 3.23E-37 -25.3861 Down ribosomal protein SA pseudogene 2 A_32_P103633 MCM2 -2.90961 2.79E-39 3.33E-37 -25.3739 Down minichromosome maintenance complex component 2 A_23_P51085 SPC25 -2.74348 3.33E-39 3.96E-37 -25.3081 Down SPC25, NDC80 kinetochore complex component A_19_P00800298 #N/A -3.45934 3.97E-39 4.66E-37 -25.2445 Down NA A_19_P00803122 TUBBP9 -2.11114 4.28E-39 5.01E-37 -25.2171 Down tubulin beta class I pseudogene 9 A_23_P16915 QPCT -2.88103 5.04E-39 5.83E-37 -25.157 Down glutaminyl-peptide cyclotransferase A_23_P125829 PGK1 -3.33997 5.52E-39 6.36E-37 -25.1246 Down phosphoglycerate kinase 1 A_23_P204472 RPLP0 -3.21064 5.61E-39 6.43E-37 -25.1182 Down ribosomal protein lateral stalk subunit P0 A_32_P52018 PHACTR1 -2.82235 6.12E-39 6.96E-37 -25.0869 Down phosphatase and actin regulator 1 A_19_P00803706 #N/A -2.94796 7.03E-39 7.93E-37 -25.0366 Down NA A_23_P24515 ACAT1 -2.125 7.82E-39 8.78E-37 -24.9977 Down acetyl-CoA acetyltransferase 1 A_24_P335620 SLC7A5 -2.25529 7.96E-39 8.9E-37 -24.9916 Down solute carrier family 7 member 5 A_32_P140489 GDF6 -2.10581 8.07E-39 9E-37 -24.9865 Down growth differentiation factor 6 A_19_P00812587 RPL5P18 -2.14212 8.2E-39 9.13E-37 -24.9806 Down ribosomal protein L5 pseudogene 18 A_32_P313405 LAMA1 -2.07927 9.92E-39 1.09E-36 -24.9117 Down laminin subunit alpha 1 A_23_P92082 TKT -2.48357 9.97E-39 1.09E-36 -24.9101 Down transketolase A_24_P148796 MST1 -2.53342 1.02E-38 1.11E-36 -24.9018 Down macrophage stimulating 1 A_23_P370434 C1QBP -2.36695 1.04E-38 1.13E-36 -24.8961 Down complement C1q binding protein A_23_P29630 SPCS1 -2.22391 1.05E-38 1.14E-36 -24.8907 Down signal peptidase complex subunit 1 A_23_P2283 TAC3 -2.28399 1.2E-38 1.29E-36 -24.8424 Down tachykinin 3 guanine nucleotide binding protein (G protein), beta A_33_P3210702 AC034207.1 -2.0311 1.97E-38 2.08E-36 -24.6657 Down polypeptide 2-like 1 (GNB2L1) pseudogeneAG A_23_P54055 AJUBA -2.40198 2.36E-38 2.48E-36 -24.6011 Down ajuba LIM protein A_23_P383132 HIC2 -2.98777 2.76E-38 2.89E-36 -24.544 Down HIC ZBTB transcriptional repressor 2 A_23_P95302 RFC5 -2.14209 3.37E-38 3.47E-36 -24.4735 Down replication factor C subunit 5 A_23_P20484 FGL1 -5.10514 4.1E-38 4.18E-36 -24.4039 Down fibrinogen like 1 A_23_P4144 COASY -2.00317 4.21E-38 4.27E-36 -24.3943 Down Coenzyme A synthase A_23_P37191 PSMB5 -2.5039 4.36E-38 4.39E-36 -24.3817 Down proteasome subunit beta 5 A_33_P3368328 PHB2 -2.04361 4.37E-38 4.39E-36 -24.3809 Down prohibitin 2 A_24_P135902 RPS2 -2.92823 6.45E-38 6.32E-36 -24.2428 Down ribosomal protein S2 A_23_P69537 NMU -3.66989 1.01E-37 9.85E-36 -24.0831 Down neuromedin U A_33_P3229397 CCT4 -2.4973 1.28E-37 1.23E-35 -24.0006 Down chaperonin containing TCP1 subunit 4 A_23_P63343 UTS2 -1.97821 1.4E-37 1.33E-35 -23.9711 Down urotensin 2 A_19_P00804525 #N/A -2.50578 1.66E-37 1.57E-35 -23.9099 Down NA A_24_P3804 SAPCD1 -2.00015 2.04E-37 1.9E-35 -23.8388 Down suppressor APC domain containing 1 A_23_P50000 FAM57A -2.05907 2.39E-37 2.21E-35 -23.7832 Down family with sequence similarity 57 member A bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_23_P145935 EPHB6 -2.21854 2.46E-37 2.28E-35 -23.7727 Down EPH receptor B6 A_33_P3376873 CARHSP1 -2.23531 3.15E-37 2.88E-35 -23.6871 Down calcium regulated heat stable protein 1 A_23_P105392 CCT2 -2.18012 3.37E-37 3.07E-35 -23.6638 Down chaperonin containing TCP1 subunit 2 A_23_P75283 RBP4 -4.22422 3.6E-37 3.28E-35 -23.6403 Down retinol binding protein 4 A_23_P110531 FST -2.42668 4.17E-37 3.77E-35 -23.5902 Down follistatin A_19_P00803996 #N/A -2.16766 5.27E-37 4.7E-35 -23.5086 Down NA A_23_P137391 ENO1 -2.42327 6.14E-37 5.4E-35 -23.4558 Down enolase 1 A_24_P319715 PDIA6 -1.95166 6.49E-37 5.67E-35 -23.4372 Down protein disulfideisomerase family A member 6 A_23_P7582 TCF7 -2.19952 6.7E-37 5.85E-35 -23.4259 Down transcription factor 7 A_23_P135084 RPL7A -2.24426 8.48E-37 7.32E-35 -23.345 Down ribosomal protein L7a A_33_P3287815 DDX21 -2.56782 9.61E-37 8.25E-35 -23.3021 Down DExD-box helicase 21 A_24_P84048 #N/A -2.05279 1.03E-36 8.76E-35 -23.2799 Down NA A_33_P3356210 NCR3LG1 -2.61222 1.25E-36 1.06E-34 -23.213 Down natural killer cell cytotoxicity receptor 3 ligand 1 A_33_P3220615 LIN28B -3.97672 1.64E-36 1.37E-34 -23.1203 Down lin-28 homolog B A_33_P3231357 KISS1R -1.9473 2.18E-36 1.81E-34 -23.0226 Down KISS1 receptor A_23_P161297 OGDHL -2.71302 2.38E-36 1.98E-34 -22.9919 Down oxoglutarate dehydrogenase like internexin neuronal intermediate filament protein A_23_P35444 INA -2.71482 2.54E-36 2.1E-34 -22.9703 Down alpha A_33_P3289236 HPR -2.25226 3.04E-36 2.49E-34 -22.9098 Down haptoglobin-related protein A_33_P3336652 NDUFC2 -2.37574 3.91E-36 3.17E-34 -22.8247 Down NADH:ubiquinoneoxidoreductase subunit C2 A_23_P159952 BEX1 -2.66121 4.09E-36 3.3E-34 -22.8095 Down brain expressed X-linked 1 A_33_P3419785 BNIP3 -2.86854 4.1E-36 3.3E-34 -22.8084 Down BCL2 interacting protein 3 A_24_P766208 RPL3 -2.26929 4.39E-36 3.52E-34 -22.785 Down ribosomal protein L3 A_24_P231546 FAM178B -2.87306 6.2E-36 4.89E-34 -22.6689 Down family with sequence similarity 178 member B A_23_P68942 RPL3 -2.07425 6.86E-36 5.35E-34 -22.6348 Down ribosomal protein L3 A_23_P76102 GDF11 -1.96357 7.27E-36 5.64E-34 -22.6157 Down growth differentiation factor 11 A_24_P236251 DLK1 -4.60106 8.66E-36 6.67E-34 -22.5568 Down delta like non-canonical Notch ligand 1 deleted in primary ciliary dyskinesia homolog A_33_P3286046 DPCD -2.60274 9.04E-36 6.94E-34 -22.5427 Down (mouse) A_24_P166645 REPIN1 -2.37378 9.62E-36 7.35E-34 -22.5216 Down replication initiator 1 A_33_P3321205 BEGAIN -1.96494 9.97E-36 7.6E-34 -22.5099 Down brain enriched guanylate kinase associated phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide A_24_P200427 PAICS -2.75654 1.02E-35 7.75E-34 -22.5027 Down synthase A_23_P1682 TMEM45B -3.41017 1.03E-35 7.8E-34 -22.5002 Down transmembrane protein 45B A_23_P321349 SAAL1 -2.52896 1.39E-35 1.05E-33 -22.3979 Down serum amyloid A like 1 A_32_P42197 HNRNPA1 -2.11576 1.6E-35 1.2E-33 -22.3519 Down heterogeneous nuclear ribonucleoprotein A1 A_33_P3231739 ELOVL2 -3.11372 1.95E-35 1.44E-33 -22.2866 Down ELOVL fatty acid elongase 2 A_23_P25204 SLC25A3 -1.99583 2.03E-35 1.49E-33 -22.2735 Down solute carrier family 25 member 3 A_23_P151321 RPL6 -2.48723 2.17E-35 1.59E-33 -22.2504 Down ribosomal protein L6 A_23_P128147 TUBA1B -1.97597 2.27E-35 1.66E-33 -22.2352 Down tubulin alpha 1b A_23_P70007 HMMR -2.38534 2.91E-35 2.11E-33 -22.1535 Down hyaluronan mediated motility receptor A_23_P146497 PPP1R26 -2.34728 3.07E-35 2.2E-33 -22.1357 Down protein phosphatase 1 regulatory subunit 26 A_33_P3451508 CCDC26 -2.099 3.09E-35 2.21E-33 -22.1341 Down CCDC26 long non-coding RNA A_19_P00813148 #N/A -2.38451 3.28E-35 2.34E-33 -22.114 Down NA bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_19_P00801088 #N/A -2.17287 3.77E-35 2.66E-33 -22.0679 Down NA A_24_P331704 KRT80 -1.98878 3.91E-35 2.74E-33 -22.056 Down keratin 80 A_24_P11061 CSAG1 -3.97252 5.54E-35 3.84E-33 -21.9418 Down chondrosarcoma associated gene 1 A_23_P67648 CAPNS1 -2.40295 5.58E-35 3.87E-33 -21.9394 Down calpain small subunit 1 A_32_P6015 MNX1 -2.65085 6.54E-35 4.49E-33 -21.8873 Down motor neuron and pancreas homeobox 1 A_33_P3316539 SLC7A2 -2.95123 7.46E-35 5.09E-33 -21.8443 Down solute carrier family 7 member 2 A_33_P3209176 AC017116.2 -2.11858 8.02E-35 5.43E-33 -21.8208 Down novel transcript A_23_P212617 TFRC -3.08135 8.66E-35 5.82E-33 -21.7955 Down transferrin receptor A_23_P34788 KIF2C -2.82989 8.98E-35 6.02E-33 -21.7836 Down kinesin family member 2C A_23_P76823 ADSSL1 -2.69707 1E-34 6.65E-33 -21.7485 Down adenylosuccinate synthase like 1 A_23_P135381 SP5 -4.28424 1.02E-34 6.76E-33 -21.742 Down Sp5 transcription factor A_23_P50096 TYMS -2.73327 1.03E-34 6.8E-33 -21.7398 Down thymidylatesynthetase A_23_P163481 BUB1B -2.36037 1.22E-34 8.03E-33 -21.6834 Down BUB1 mitotic checkpoint serine/threonine kinase B A_32_P200238 UCA1 -4.25866 1.56E-34 1.01E-32 -21.6049 Down urothelial cancer associated 1 A_23_P71319 FDFT1 -2.36572 1.97E-34 1.26E-32 -21.5279 Down farnesyl-diphosphatefarnesyltransferase 1 A_32_P95739 TPI1 -2.25022 2.24E-34 1.42E-32 -21.4869 Down triosephosphateisomerase 1 A_23_P258190 AKR1B1 -2.42961 2.59E-34 1.63E-32 -21.4396 Down aldo-ketoreductase family 1 member B A_23_P343935 EGLN1 -2.17189 3.04E-34 1.89E-32 -21.388 Down egl-9 family hypoxia inducible factor 1 A_23_P27215 UBB -2.5212 3.07E-34 1.9E-32 -21.3854 Down ubiquitin B A_23_P144005 SSUH2 -2.85572 3.25E-34 2.01E-32 -21.3669 Down ssu-2 homolog (C. elegans) A_19_P00807028 #N/A -2.11745 3.92E-34 2.39E-32 -21.3064 Down NA A_24_P763243 EEF1A1 -2.13027 4.74E-34 2.86E-32 -21.2456 Down eukaryotic translation elongation factor 1 alpha 1 A_33_P3400578 HLF -2.69094 5.18E-34 3.11E-32 -21.2171 Down HLF, PAR bZIP transcription factor A_23_P141032 COX4I1 -1.96288 6.45E-34 3.81E-32 -21.147 Down cytochrome c oxidase subunit 4I1 A_33_P3254335 BEND4 -2.03827 8.77E-34 5.14E-32 -21.049 Down BEN domain containing 4 A_24_P25346 UTP4 -2.61645 9.92E-34 5.78E-32 -21.0096 Down UTP4, small subunit processome component A_23_P257945 HCCS -2.44088 1.29E-33 7.4E-32 -20.9267 Down holocytochrome c synthase A_23_P215956 MYC -2.55549 1.34E-33 7.68E-32 -20.9145 Down MYC proto-oncogene, bHLH transcription factor A_23_P35970 SLC37A4 -2.14061 1.43E-33 8.18E-32 -20.893 Down solute carrier family 37 member 4 A_24_P190168 TMEM97 -2.24984 1.93E-33 1.08E-31 -20.7993 Down transmembrane protein 97 A_23_P32165 LHX2 -3.2283 2.2E-33 1.22E-31 -20.7568 Down LIM homeobox 2 A_23_P57379 CDC45 -2.6315 2.75E-33 1.51E-31 -20.6872 Down cell division cycle 45 A_23_P13344 EEF1G -2.31974 2.98E-33 1.62E-31 -20.6621 Down eukaryotic translation elongation factor 1 gamma A_23_P53476 LDHB -2.63371 3.1E-33 1.68E-31 -20.6495 Down lactate dehydrogenase B A_33_P3342375 MAGEA6 -5.16102 3.85E-33 2.07E-31 -20.5811 Down MAGE family member A6 A_23_P118722 ASGR1 -2.97009 5.54E-33 2.9E-31 -20.4675 Down asialoglycoprotein receptor 1 A_24_P358164 RPSA -1.95719 6.03E-33 3.15E-31 -20.4409 Down ribosomal protein SA A_23_P96833 SLAMF9 -2.151 7.98E-33 4.1E-31 -20.354 Down SLAM family member 9 A_23_P121064 PTX3 -3.29255 7.98E-33 4.1E-31 -20.3539 Down pentraxin 3 A_23_P86216 PSMA5 -2.51868 8.51E-33 4.36E-31 -20.3339 Down proteasome subunit alpha 5 A_24_P896205 #N/A -2.50593 1.08E-32 5.47E-31 -20.2609 Down NA A_33_P3314579 RAB34 -1.95079 1.19E-32 5.98E-31 -20.231 Down RAB34, member RAS oncogene family A_23_P210482 ADA -2.2746 1.19E-32 5.99E-31 -20.2295 Down adenosine deaminase bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_24_P547010 AC097523.1 -1.96098 1.35E-32 6.76E-31 -20.1896 Down ribosomal protein L15 (RPL15) pseudogene A_23_P41716 RACK1 -2.19993 1.39E-32 6.94E-31 -20.1812 Down receptor for activated C kinase 1 A_23_P210690 TRIB3 -2.32045 1.56E-32 7.73E-31 -20.1458 Down tribblespseudokinase 3 A_23_P28420 OLA1 -2.02122 2.16E-32 1.05E-30 -20.0452 Down Obg like ATPase 1 phosphatidylinositol glycan anchor biosynthesis class A_23_P131653 PIGF -2.02403 2.36E-32 1.14E-30 -20.0189 Down F A_23_P52031 PGM1 -2.24693 2.38E-32 1.15E-30 -20.0154 Down phosphoglucomutase 1 A_33_P3280945 SNHG3 -2.07233 3.96E-32 1.86E-30 -19.8599 Down small nucleolar RNA host gene 3 A_33_P3258702 SEC22C -2.00806 4.84E-32 2.26E-30 -19.7982 Down SEC22 homolog C, vesicle trafficking protein A_32_P190303 LONRF2 -2.50148 5.9E-32 2.73E-30 -19.738 Down LON peptidase N-terminal domain and ring finger 2 A_33_P3284029 CSE1L -2.09718 7.75E-32 3.54E-30 -19.655 Down chromosome segregation 1 like calcium/calmodulin dependent protein kinase II A_33_P3244283 CAMK2N2 -2.71282 7.79E-32 3.55E-30 -19.6535 Down inhibitor 2 A_23_P69431 RPL4 -2.04539 8.69E-32 3.94E-30 -19.62 Down ribosomal protein L4 A_23_P157795 CTNNAL1 -2.44292 1.01E-31 4.54E-30 -19.576 Down catenin alpha like 1 A_32_P70315 TIMP4 -2.39465 1.08E-31 4.87E-30 -19.5536 Down TIMP metallopeptidase inhibitor 4 A_23_P97541 C4BPA -1.95071 1.13E-31 5.08E-30 -19.5402 Down complement component 4 binding protein alpha A_33_P3210160 NAA40 -2.06568 1.2E-31 5.36E-30 -19.5231 Down N(alpha)-acetyltransferase 40, NatD catalytic subunit A_23_P139547 TUBA1A -1.95325 1.24E-31 5.54E-30 -19.5113 Down tubulin alpha 1a A_23_P119254 ASF1B -2.09648 2.38E-31 1.02E-29 -19.3166 Down anti-silencing function 1B histone chaperone A_23_P48835 KIF23 -2.01164 2.83E-31 1.2E-29 -19.2644 Down kinesin family member 23 A_23_P369899 TMEM158 -1.96193 3.02E-31 1.27E-29 -19.2446 Down transmembrane protein 158 (gene/pseudogene) A_23_P32707 ESPL1 -2.21029 3.27E-31 1.38E-29 -19.2208 Down extra spindle pole bodies like 1, separase A_23_P106708 RPS2 -2.54978 3.33E-31 1.4E-29 -19.215 Down ribosomal protein S2 A_33_P3435493 AL390038.1 -2.16563 3.59E-31 1.5E-29 -19.1925 Down novel transcript A_23_P115261 AGT -4.68995 4.15E-31 1.71E-29 -19.1493 Down angiotensinogen A_33_P3258362 HBA2 -4.00539 5.26E-31 2.14E-29 -19.0788 Down hemoglobin subunit alpha 2 A_24_P91140 RPL23A -2.05368 5.8E-31 2.35E-29 -19.0495 Down ribosomal protein L23a A_23_P149200 CDC20 -2.44627 5.97E-31 2.41E-29 -19.0409 Down cell division cycle 20 A_23_P8981 STAR -3.77803 6.03E-31 2.43E-29 -19.0383 Down steroidogenic acute regulatory protein A_23_P26457 HBA2 -3.82045 6.43E-31 2.59E-29 -19.0191 Down hemoglobin subunit alpha 2 A_23_P79043 TMEM147 -2.01636 1.22E-30 4.74E-29 -18.83 Down transmembrane protein 147 A_33_P3352407 FTH1P20 -1.99774 1.46E-30 5.62E-29 -18.7766 Down ferritin heavy chain 1 pseudogene 20 A_23_P254415 RPSA -2.05197 1.57E-30 6E-29 -18.7556 Down ribosomal protein SA A_23_P138541 AKR1C3 -2.81259 1.66E-30 6.36E-29 -18.7383 Down aldo-ketoreductase family 1 member C3 A_19_P00319843 AC002454.1 -2.7668 1.66E-30 6.36E-29 -18.7379 Down NA A_23_P13899 GAPDH -2.77486 1.92E-30 7.32E-29 -18.695 Down glyceraldehyde-3-phosphate dehydrogenase A_24_P418809 GNAS -2.22801 1.96E-30 7.45E-29 -18.6893 Down GNAS complex locus A_23_P19723 BMP5 -2.13124 2.02E-30 7.65E-29 -18.681 Down bone morphogenetic protein 5 A_33_P3363799 NCAM1 -2.02975 2.03E-30 7.7E-29 -18.6788 Down neural cell adhesion molecule 1 A_33_P3287825 CCDC136 -2.06456 2.04E-30 7.7E-29 -18.6781 Down coiled-coil domain containing 136 A_33_P3397763 TNFSF9 -2.10732 2.73E-30 1.02E-28 -18.5927 Down TNF superfamily member 9 A_23_P88740 CENPN -2.4747 3.08E-30 1.15E-28 -18.5567 Down centromere protein N A_23_P76882 CCNB1IP1 -2.21209 3.72E-30 1.37E-28 -18.5018 Down cyclin B1 interacting protein 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

antisense to KCNJ11 and overlapping to a novel A_19_P00329765 AC124798.1 -1.94995 4.56E-30 1.65E-28 -18.4427 Down gene A_23_P19712 GMNN -2.09787 5.13E-30 1.85E-28 -18.4083 Down geminin, DNA replication inhibitor A_33_P3265872 AC002454.1 -2.95035 5.56E-30 2E-28 -18.3848 Down NA A_33_P3293336 GFRA1 -3.62532 6.08E-30 2.18E-28 -18.3585 Down GDNF family receptor alpha 1 A_23_P125265 KPNA2 -2.09743 8.65E-30 3.04E-28 -18.2565 Down karyopherin subunit alpha 2 A_23_P23996 MAT1A -2.02824 9.51E-30 3.31E-28 -18.2291 Down methionine adenosyltransferase 1A A_24_P16340 AL451081.2 -2.44153 1.17E-29 4.03E-28 -18.1682 Down ribosomal protein, large, P0 (RPLP0) pseudogene A_24_P257359 RPL15 -2.04085 1.2E-29 4.12E-28 -18.1607 Down ribosomal protein L15 A_23_P43141 EIF3E -1.99009 1.25E-29 4.25E-28 -18.1511 Down eukaryotic translation initiation factor 3 subunit E A_23_P68610 TPX2 -2.32063 1.31E-29 4.45E-28 -18.1373 Down TPX2, microtubule nucleation factor A_23_P161769 FXYD2 -2.55977 1.66E-29 5.59E-28 -18.0676 Down FXYD domain containing ion transport regulator 2 A_23_P148088 FGG -4.078 2.01E-29 6.68E-28 -18.0139 Down fibrinogen gamma chain A_24_P686965 SH2D5 -2.61591 2.47E-29 8.14E-28 -17.954 Down SH2 domain containing 5 A_19_P00804875 #N/A -2.22741 3E-29 9.79E-28 -17.8981 Down NA A_23_P88331 DLGAP5 -2.15912 3.3E-29 1.07E-27 -17.8709 Down DLG associated protein 5 A_23_P130149 ENO3 -2.16731 4.31E-29 1.39E-27 -17.7949 Down enolase 3 A_32_P8546 LINC00473 -3.7868 4.42E-29 1.42E-27 -17.7879 Down long intergenic non-protein coding RNA 473 A_33_P3312258 TUBB -2.00095 8.69E-29 2.7E-27 -17.5958 Down tubulin beta class I A_23_P89509 SPAG5 -2.39461 8.97E-29 2.78E-27 -17.5868 Down sperm associated antigen 5 A_23_P76538 TESC -2.40318 1.05E-28 3.22E-27 -17.5434 Down tescalcin A_33_P3360341 GATA3 -2.29344 1.35E-28 4.1E-27 -17.4714 Down GATA binding protein 3 A_23_P79591 APOB -2.05611 1.62E-28 4.86E-27 -17.4203 Down apolipoprotein B A_24_P43588 MAD2L1BP -2.02161 1.73E-28 5.18E-27 -17.401 Down MAD2L1 binding protein A_23_P11995 PRDX1 -2.19175 1.77E-28 5.29E-27 -17.3947 Down peroxiredoxin 1 A_23_P257971 AKR1C1 -3.46642 1.92E-28 5.72E-27 -17.3718 Down aldo-ketoreductase family 1 member C1 A_33_P3404411 MIPEP -2.05625 2.53E-28 7.4E-27 -17.2954 Down mitochondrial intermediate peptidase A_19_P00804739 #N/A -2.0651 2.72E-28 7.95E-27 -17.2748 Down NA A_23_P500501 FGFR3 -3.86747 2.74E-28 8E-27 -17.2729 Down fibroblast growth factor receptor 3 A_33_P3256660 #N/A -2.16764 2.95E-28 8.57E-27 -17.2522 Down NA A_33_P3360326 FADS2 -2.31702 3.61E-28 1.04E-26 -17.1955 Down fatty acid desaturase 2 A_23_P215634 IGFBP3 -2.0923 3.69E-28 1.06E-26 -17.1896 Down insulin like growth factor binding protein 3 A_24_P801079 #N/A -2.11896 3.71E-28 1.07E-26 -17.1881 Down NA A_19_P00806947 PCNAP3 -2.08931 4.61E-28 1.31E-26 -17.1277 Down proliferating cell nuclear antigen pseudogene 3 ribosomal modification protein rimK like family A_23_P349406 RIMKLA -2.01051 5.29E-28 1.5E-26 -17.0892 Down member A A_33_P3388491 PQLC2 -2.11095 6.7E-28 1.87E-26 -17.0235 Down PQ loop repeat containing 2 A_23_P52986 VWCE -3.29632 7.63E-28 2.12E-26 -16.9873 Down von Willebrand factor C and EGF domains calcium/calmodulin dependent protein kinase II A_23_P11800 CAMK2N1 -2.01977 1.06E-27 2.9E-26 -16.8977 Down inhibitor 1 A_23_P259692 PSAT1 -2.42466 1.13E-27 3.09E-26 -16.8786 Down phosphoserine aminotransferase 1 A_23_P137057 SLC25A5 -1.94968 1.15E-27 3.13E-26 -16.8749 Down solute carrier family 25 member 5 A_33_P3257279 TMEM145 -2.03149 1.19E-27 3.25E-26 -16.8647 Down transmembrane protein 145 ST6 N-acetylgalactosaminide alpha-2,6- A_23_P54968 ST6GALNAC1 -2.216 1.23E-27 3.35E-26 -16.8551 Down sialyltransferase 1 A_23_P250164 HGD -2.75232 1.29E-27 3.48E-26 -16.843 Down homogentisate 1,2-dioxygenase bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_19_P00326514 AC012065.3 -2.41179 1.75E-27 4.63E-26 -16.7589 Down novel transcript A_23_P104651 CDCA5 -2.14386 1.89E-27 4.98E-26 -16.7375 Down cell division cycle associated 5 A_23_P75790 MYRF -2.18631 2.27E-27 5.92E-26 -16.6865 Down myelin regulatory factor A_33_P3388192 GTSF1 -2.84309 2.98E-27 7.64E-26 -16.6126 Down gametocyte specific factor 1 A_19_P00801649 LINC00659 -2.08537 2.99E-27 7.67E-26 -16.6115 Down long intergenic non-protein coding RNA 659 neural precursor cell expressed, developmentally A_24_P108311 NEDD4L -2.17093 3.26E-27 8.33E-26 -16.5877 Down down-regulated 4-like, E3 ubiquitin protein ligase A_23_P110624 CTNND2 -2.39828 4.92E-27 1.23E-25 -16.4751 Down catenin delta 2 A_23_P379614 OIP5 -1.95649 5.39E-27 1.35E-25 -16.4505 Down Opa interacting protein 5 A_32_P124708 ONECUT2 -2.73043 6.67E-27 1.65E-25 -16.3924 Down one cut homeobox 2 A_33_P3213029 RNF43 -2.3449 6.81E-27 1.68E-25 -16.3868 Down ring finger protein 43 A_23_P57709 PCOLCE2 -2.49886 9.21E-27 2.22E-25 -16.305 Down procollagen C-endopeptidase enhancer 2 A_24_P271696 XAGE1A -1.96324 1.37E-26 3.24E-25 -16.1981 Down X antigen family member 1A A_24_P316074 #N/A -2.06769 1.66E-26 3.9E-25 -16.1458 Down NA A_23_P91590 RANBP1 -1.98388 1.8E-26 4.21E-25 -16.124 Down RAN binding protein 1 A_23_P67042 MOCOS -2.3218 1.83E-26 4.27E-25 -16.1201 Down molybdenum cofactor sulfurase A_23_P203972 FZD10 -1.96511 1.91E-26 4.44E-25 -16.1082 Down frizzled class receptor 10 A_24_P125871 RIPK4 -2.69884 2.08E-26 4.81E-25 -16.0857 Down receptor interacting serine/threonine kinase 4 A_23_P171074 ITM2A -2.12701 2.26E-26 5.21E-25 -16.0629 Down integral membrane protein 2A A_23_P137035 PIR -2.05439 2.57E-26 5.89E-25 -16.0286 Down pirin A_23_P45304 XK -2.57089 3.05E-26 6.93E-25 -15.9825 Down X-linked Kx blood group A_23_P117852 PCLAF -2.42647 3.16E-26 7.17E-25 -15.9731 Down PCNA clamp associated factor A_19_P00802201 CCNB2P1 -2.59757 3.92E-26 8.82E-25 -15.9155 Down cyclin B2 pseudogene 1 A_23_P218111 SERPINA1 -2.83962 5.42E-26 1.2E-24 -15.8291 Down serpin family A member 1 A_33_P3370226 RPL7 -2.00693 5.91E-26 1.31E-24 -15.8059 Down ribosomal protein L7 A_23_P250156 IGF2BP2 -1.98696 7.55E-26 1.65E-24 -15.7408 Down insulin like growth factor 2 mRNA binding protein 2 A_23_P46928 PFKP -2.4446 9.26E-26 2E-24 -15.6865 Down phosphofructokinase, platelet A_33_P3242952 FAM72A -2.28415 1.26E-25 2.67E-24 -15.6058 Down family with sequence similarity 72 member A A_33_P3812038 #N/A -2.12542 2.05E-25 4.26E-24 -15.4767 Down NA A_23_P434890 CARD10 -2.2846 3.01E-25 6.14E-24 -15.3759 Down caspase recruitment domain family member 10 A_19_P00805686 #N/A -2.23011 4.01E-25 8.05E-24 -15.3007 Down NA A_23_P93641 AKR1B10 -1.95856 4.89E-25 9.75E-24 -15.2482 Down aldo-ketoreductase family 1 member B10 A_32_P151544 KRT18 -2.32397 4.98E-25 9.91E-24 -15.2438 Down keratin 18 A_23_P318646 RPS10 -1.9891 5.29E-25 1.05E-23 -15.2278 Down ribosomal protein S10 A_23_P301925 MT-TD -2.06662 6.69E-25 1.31E-23 -15.1669 Down mitochondrially encoded tRNA aspartic acid A_33_P3301709 GNG4 -2.61231 8.81E-25 1.7E-23 -15.0951 Down G protein subunit gamma 4 A_23_P252306 ID1 -2.04779 1.31E-24 2.49E-23 -14.9929 Down inhibitor of DNA binding 1, HLH protein anterior gradient 2, protein disulphide isomerase A_23_P31407 AGR2 -2.626 1.79E-24 3.36E-23 -14.9116 Down family member A_32_P78681 GLP2R -2.51997 1.95E-24 3.64E-23 -14.8897 Down glucagon like peptide 2 receptor A_24_P305784 SPANXB1 -2.17774 2.61E-24 4.8E-23 -14.8142 Down SPANX family member B1 A_23_P30315 TRIM7 -2.34069 4.12E-24 7.42E-23 -14.6967 Down tripartite motif containing 7 A_23_P399255 RNF182 -2.11966 5.38E-24 9.63E-23 -14.6281 Down ring finger protein 182 A_23_P353717 RMI2 -2.05883 8.34E-24 1.46E-22 -14.5163 Down RecQ mediated genome instability 2 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_32_P179746 #N/A -1.97753 8.75E-24 1.53E-22 -14.504 Down NA A_33_P3236177 ANG -2.22622 1.02E-23 1.76E-22 -14.4659 Down angiogenin A_23_P7342 UGT2B10 -2.17474 1.7E-23 2.86E-22 -14.3352 Down UDP glucuronosyltransferase family 2 member B10 A_23_P138655 CYP26A1 -2.56705 2.49E-23 4.14E-22 -14.2384 Down cytochrome P450 family 26 subfamily A member 1 A_33_P3849275 FHL1 -2.27986 3E-23 4.93E-22 -14.1914 Down four and a half LIM domains 1 A_33_P3229953 EEF1A2 -2.61016 3.06E-23 5.01E-22 -14.1866 Down eukaryotic translation elongation factor 1 alpha 2 A_33_P3795649 #N/A -2.19155 3.13E-23 5.12E-22 -14.1808 Down NA A_24_P188377 CD55 -2.00172 4.84E-23 7.74E-22 -14.0708 Down CD55 molecule (Cromer blood group) A_33_P3379406 GREB1 -2.26607 5.71E-23 9.06E-22 -14.0293 Down growth regulating estrogen receptor binding 1 A_23_P359245 MET -2.29999 6.97E-23 1.1E-21 -13.9794 Down MET proto-oncogene, receptor tyrosine kinase A_33_P3323914 LINC00958 -2.4556 7.6E-23 1.19E-21 -13.9576 Down long intergenic non-protein coding RNA 958 A_19_P00319413 AC090204.1 -2.0753 8.48E-23 1.32E-21 -13.9302 Down novel transcript A_23_P74115 RAD54L -2.07426 1.96E-22 2.93E-21 -13.7216 Down RAD54 like A_23_P82503 PEG10 -2.27389 2E-22 2.99E-21 -13.7164 Down paternally expressed 10 A_23_P31073 MYB -2.40442 2.23E-22 3.31E-21 -13.6893 Down MYB proto-oncogene, transcription factor A_23_P391228 MANEAL -2.14472 2.26E-22 3.36E-21 -13.6855 Down mannosidaseendo-alpha like A_23_P106773 SULT1A2 -2.32678 3.08E-22 4.52E-21 -13.6089 Down sulfotransferase family 1A member 2 A_19_P00317550 AC090204.1 -2.04446 4.91E-22 7.04E-21 -13.4937 Down novel transcript A_23_P16252 KLK1 -2.02411 8.04E-22 1.13E-20 -13.372 Down kallikrein 1 A_33_P3330911 BCAS1 -2.22279 3.98E-21 5.18E-20 -12.9806 Down breast carcinoma amplified sequence 1 A_23_P84118 CDH18 -1.99865 4.93E-21 6.36E-20 -12.9286 Down cadherin 18 A_23_P6252 DSCR8 -1.98565 9.15E-21 1.15E-19 -12.7788 Down Down syndrome critical region 8 A_23_P253602 BMX -2.13949 9.16E-21 1.15E-19 -12.7785 Down BMX non-receptor tyrosine kinase A_24_P153456 ZDHHC11 -1.99887 1.42E-20 1.75E-19 -12.6726 Down zinc finger DHHC-type containing 11 A_33_P3260654 IL23A -2.56013 2.06E-20 2.49E-19 -12.5831 Down interleukin 23 subunit alpha A_23_P65757 CCNB2 -2.02755 3.12E-20 3.69E-19 -12.4836 Down cyclin B2 A_23_P374844 GAL -3.43014 3.18E-20 3.77E-19 -12.4787 Down galanin and GMAP prepropeptide A_23_P407565 CX3CR1 -2.26742 3.87E-20 4.54E-19 -12.4322 Down C-X3-C motif chemokine receptor 1 A_24_P567298 #N/A -2.70557 3.79E-19 3.99E-18 -11.8899 Down NA A_24_P105191 HS6ST2 -2.36351 8.4E-19 8.53E-18 -11.7023 Down heparansulfate 6-O-sulfotransferase 2 A_24_P510357 #N/A -3.12876 2.64E-18 2.56E-17 -11.4347 Down NA A_23_P19987 IGF2BP3 -2.77198 2.78E-18 2.69E-17 -11.4223 Down insulin like growth factor 2 mRNA binding protein 3 A_23_P35414 PPP1R3C -2.04389 5.61E-18 5.23E-17 -11.2588 Down protein phosphatase 1 regulatory subunit 3C A_32_P107876 FRAS1 -2.04543 8E-18 7.35E-17 -11.1764 Down Fraser extracellular matrix complex subunit 1 A_23_P52207 BAMBI -2.49918 8.93E-18 8.15E-17 -11.151 Down BMP and activin membrane bound inhibitor A_33_P3234546 CD8B -2.21668 1.26E-17 1.13E-16 -11.0713 Down CD8b molecule A_19_P00332124 #N/A -1.99573 1.53E-17 1.36E-16 -11.0259 Down NA A_33_P3344204 ZDHHC11 -2.07548 5.44E-17 4.57E-16 -10.7338 Down zinc finger DHHC-type containing 11 A_23_P80839 MAP6D1 -1.98314 6.43E-17 5.36E-16 -10.6954 Down MAP6 domain containing 1 A_23_P12343 GSTM3 -2.06968 9.83E-17 8.02E-16 -10.5982 Down glutathione S-transferase mu 3 A_23_P122443 HIST1H1C -2.36647 1.08E-16 8.79E-16 -10.5759 Down histone cluster 1 H1 family member c A_24_P147765 FOXRED2 -1.96886 1.13E-16 9.16E-16 -10.5662 Down FAD dependent oxidoreductase domain containing 2 A_23_P51376 NKAIN1 -2.29128 6.38E-16 4.79E-15 -10.1712 Down sodium/potassium transporting ATPase interacting 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A_23_P53176 FOLR1 -3.27661 1.17E-15 8.55E-15 -10.0329 Down folate receptor 1 A_23_P259071 AREG -1.98937 5.76E-15 3.92E-14 -9.67224 Down amphiregulin A_33_P3364959 IGLV2-23 -2.33766 1.56E-13 9.2E-13 -8.92995 Down immunoglobulin lambda variable 2-23 A_33_P3397865 TNNT1 -2.08149 6.57E-13 3.63E-12 -8.60693 Down troponin T1, slow skeletal type A_33_P3367984 ABCA12 -2.35435 1.27E-12 6.84E-12 -8.45852 Down ATP binding cassette subfamily A member 12 somatomedin B and thrombospondin type 1 domain A_23_P170649 SBSPON -2.33151 1.34E-11 6.43E-11 -7.9302 Down containing A_23_P9485 ORM2 -1.95066 5.23E-11 2.35E-10 -7.62276 Down orosomucoid 2 A_23_P169494 ORM1 -2.28734 1.47E-10 6.33E-10 -7.38838 Down orosomucoid 1

Table 3 The enriched pathway terms of the up regulated differentially expressed genes

BIOCYC Pathway ID Pathway Name LogP Gene Count Genes 142419 phospholipases 1.511326363 3 PLA2G4C,PLCB2,PLD1 782384 resolvin D biosynthesis 1.327894996 1 ALOX5 782387 aspirin-triggered lipoxin biosynthesis 1.327894996 1 ALOX5 782385 aspirin triggered resolvin D biosynthesis 1.327894996 1 ALOX5 782386 aspirin triggered resolvin E biosynthesis 1.327894996 1 ALOX5 KEGG 169642 Toxoplasmosis 10 19 ALOX5,CCR5,CD40LG,HL A-DMA,HLA-DMB,HLA- DOA,HLA-DOB,HLA- DPA1,HLA-DPB1,HLA- DQA1,HLA-DQB1,HLA- DRA,HLA-DRB1,HLA- DRB4,HLA- DRB5,IL10RA,LAMA4,LA MC2,TLR2 83074 Antigen processing and presentation 10 18 CD4,CD8A,CTSB,HLA- B,HLA-C,HLA-DMA,HLA- DMB,HLA-DOA,HLA- DOB,HLA-DPA1,HLA- DPB1,HLA-DQA1,HLA- DQB1,HLA-DRA,HLA- DRB1,HLA-DRB4,HLA- DRB5,HLA-F,IFI30 83069 Cell adhesion molecules (CAMs) 10 29 CD2,CD4,CD40LG,CD8A,C LDN3,CLDN4,CTLA4,HLA- B,HLA-C,HLA-DMA,HLA- DMB,HLA-DOA,HLA- DOB,HLA-DPA1,HLA- DPB1,HLA-DQA1,HLA- DQB1,HLA-DRA,HLA- DRB1,HLA-DRB4,HLA- DRB5,HLA- F,ICOS,ITGB2,PECAM1,PT PRC,SDC1,SELL,VTCN1 377873 Herpes simplex infection 10 24 CCL2,CCL5,DDX58,HLA- B,HLA-C,HLA-DMA,HLA- DMB,HLA-DOA,HLA- DOB,HLA-DPA1,HLA- DPB1,HLA-DQA1,HLA- DQB1,HLA-DRA,HLA- DRB1,HLA-DRB4,HLA- DRB5,HLA- F,IFIT1,IRF7,OAS2,SP100,S TAT2,TLR2 213780 Tuberculosis 10 24 CALML5,CD14,FCER1G,FC GR3A,HLA-DMA,HLA- bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

DMB,HLA-DOA,HLA- DOB,HLA-DPA1,HLA- DPB1,HLA-DQA1,HLA- DQB1,HLA-DRA,HLA- DRB1,HLA-DRB4,HLA- DRB5,IL10RA,ITGAX,ITGB 2,MRC2,PLK3,SPHK1,TCIR G1,TLR2 373901 HTLV-I infection 10 21 ADCY4,EGR2,HLA-B,HLA- C,HLA-DMA,HLA- DMB,HLA-DOA,HLA- DOB,HLA-DPA1,HLA- DPB1,HLA-DQA1,HLA- DQB1,HLA-DRA,HLA- DRB1,HLA-DRB4,HLA- DRB5,HLA- F,ITGB2,JAK3,PDGFRB,TS PO 99051 Chemokine signaling pathway 5.804148634 17 ADCY4,CCL18,CCL19,CCL 2,CCL3,CCL4,CCL5,CCR5,C CR7,CXCL9,CXCR3,FGR,J AK3,NCF1,PLCB2,RASGRP 2,STAT2 83073 Complement and coagulation cascades 5.611386029 11 C1QA,C1QB,C1R,C1S,CFD, CFH,F13A1,ITGAX,ITGB2, VSIG4,VWF 193147 Osteoclast differentiation 4.888167265 13 ACP5,CSF1R,CTSK,FCGR3 A,LCP2,LILRA6,LILRB3,LI LRB4,NCF1,NCF2,SIRPG,S TAT2,TYROBP 692234 PI3K-Akt signaling pathway 2.10820828 16 ANGPT2,COL1A1,COL4A1, COL4A2,COMP,CSF1R,CSF 3R,IL3RA,IL7R,JAK3,LAM A4,LAMC2,OSM,PDGFRB, TLR2,VWF Pathway Interaction Database 137922 IL12-mediated signaling events 5.815327504 10 CCL3,CCL4,CCR5,CD4,CD8 A,GZMA,GZMB,HLA- DRA,HLA-DRB1,IL18RAP 137910 CXCR4-mediated signaling events 4.120521315 9 CD4,FGR,HLA-DRA,HLA- DRB1,MMP9,PLCB2,PTPRC ,RGS1,STAT2 138046 Syndecan-1-mediated signaling events 3.234054923 4 CCL5,MMP7,MMP9,SDC1 169349 Validated transcriptional targets of AP1 family 2.935350413 5 CCL2,DCN,HMOX1,MGP,M members Fra1 and Fra2 MP9 137998 TCR signaling in naive CD4+ T cells 2.533668826 6 CD4,HLA-DRA,HLA- DRB1,LCP2,PTPRC,RASGR P2 137933 IL4-mediated signaling events 2.426729607 6 CD40LG,COL1A1,EGR2,IG HG1,JAK3,THY1 137937 S1P1 pathway 1.949316676 3 PDGFRB,PLCB2,SPHK1 138050 Fc-epsilon receptor I signaling in mast cells 1.88903986 5 FCER1G,HCLS1,LAT2,LCP 2,SPHK1 138055 TCR signaling in naive CD8+ T cells 1.570972409 4 CD8A,LCP2,PTPRC,RASGR P2 137945 amb2 Integrin signaling 1.570972409 4 FGR,ITGB2,MMP9,THY1 REACTOME 1269203 Innate Immune System 10 68 ADA2,ADAM8,ADCY4,AL OX5,ARHGAP9,BST2,C1QA ,C1QB,C1R,C1S,CALML5,C D14,CD300E,CD4,CFD,CFH, CHI3L1,CHIT1,CTSB,CTSH, CTSK,DDX58,DHX58,DOK 3,FCER1G,FCGR3A,FCN1,F GR,FPR1,GNLY,GPR84,HB B,HLA-B,HLA- C,ICOS,IGHG1,IL3RA,IRF7, ITGAX,ITGB2,JAK3,LAIR1, LAT2,LCP2,LILRB3,MMP9, MNDA,NCF1,NCF2,NFAM1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

,NLRP3,PDGFRB,PECAM1, PLD1,PTPRC,RASAL3,RAS GRP2,S100A8,SAA1,SELL,S IGLEC14,SLC2A5,TBC1D10 C,TCIRG1,TLR2,TYROBP,V AMP8,VWF 1270247 Assembly of collagen fibrils and other multimeric 10 11 COL10A1,COL1A1,COL4A1 structures ,COL4A2,COL5A1,COL5A2, COL8A2,CTSB,LAMC2,MM P7,MMP9 1269171 Adaptive Immune System 10 51 CD14,CD300E,CD4,CD40LG ,CD79A,CD8A,CTLA4,CTS B,CTSH,CTSK,FCGR3A,HC ST,HLA-B,HLA-C,HLA- DMA,HLA-DMB,HLA- DOA,HLA-DOB,HLA- DPA1,HLA-DPB1,HLA- DQA1,HLA-DQB1,HLA- DRA,HLA-DRB1,HLA- DRB4,HLA-DRB5,HLA- F,ICOS,IFI30,IFITM1,ITGB2 ,JAML,LAIR1,LCP2,LILRA6 ,LILRB3,LILRB4,MRC2,NC F1,NCF2,PDGFRB,PTPRC,R ASGRP2,RNF144B,SELL,SL AMF7,TLR2,TRAC,TRIM69, TYROBP,VAMP8 1270244 Extracellular matrix organization 10 33 ADAM15,ADAM8,ADAMT S4,COL10A1,COL12A1,COL 16A1,COL1A1,COL4A1,CO L4A2,COL5A1,COL5A2,CO L8A2,COMP,CTSB,CTSK,D CN,EFEMP1,FBLN1,FBLN2, FMOD,HSPG2,ITGAX,ITGB 2,LAMA4,LAMC2,MFAP5, MMP11,MMP14,MMP19,M MP7,MMP9,PECAM1,SDC1 1269310 Cytokine Signaling in Immune system 10 62 ALOX5,BATF,BST2,CCL19, CCL2,CCL3,CCL4,CCL5,CC R5,CD27,CD4,CD40LG,CSF 1R,CSF3R,DDX58,F13A1,FP R1,GBP4,GBP5,HLA- B,HLA-C,HLA-DPA1,HLA- DPB1,HLA-DQA1,HLA- DQB1,HLA-DRA,HLA- DRB1,HLA-DRB4,HLA- DRB5,HLA- F,HMOX1,IFI27,IFI30,IFI6,I FIT1,IFIT2,IFITM1,IGHG1,I L10RA,IL18RAP,IL3RA,IL7 R,IRF5,IRF7,IRF8,ITGAX,IT GB2,JAK3,MMP9,MX1,OAS 2,OASL,OSM,PDGFRB,RAS AL3,RSAD2,SAA1,SP100,S TAT2,TNFRSF4,VWF,XAF1 1457780 Neutrophil degranulation 10 40 ADA2,ADAM8,ALOX5,AR HGAP9,BST2,CALML5,CD1 4,CFD,CHI3L1,CHIT1,CTSB ,CTSH,DOK3,FCER1G,FCN 1,FGR,FPR1,GPR84,HBB,H LA-B,HLA- C,ITGAX,ITGB2,LAIR1,LIL RB3,MMP9,MNDA,NFAM1, PECAM1,PLD1,PTPRC,S100 A8,SELL,SIGLEC14,SLC2A 5,TBC1D10C,TCIRG1,TLR2, TYROBP,VAMP8 1269318 Signaling by Interleukins 4.174314529 28 ALOX5,BATF,CCL19,CCL2, CCL3,CCL4,CCL5,CCR5,CD 4,CSF1R,CSF3R,F13A1,FPR bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1,HMOX1,IGHG1,IL10RA,I L18RAP,IL3RA,IL7R,ITGA X,ITGB2,JAK3,MMP9,OSM, PDGFRB,RASAL3,SAA1,V WF 1269576 G alpha (i) signalling events 3.148226069 15 ADCY4,ADRA2A,CCL19,C CL5,CCR5,CCR7,CXCL9,C XCR3,FPR1,FPR3,RGS1,RG S16,S1PR4,SAA1,TAS2R4 1269340 Hemostasis 2.267749313 26 ADRA2A,ANGPT2,CD2,CF D,F13A1,FCER1G,FGR,GU CY1A1,HBB,IGHA1,IL3RA, IRF7,ISLR,ITGAX,ITGB2,IT IH4,JAK3,JAML,LCP2,MRV I1,PECAM1,RASGRP2,SDC 1,SELL,SIRPG,VWF 1269545 Class A/1 (Rhodopsin-like receptors) 1.991618526 15 ACKR4,ADRA2A,CCL19,C CL5,CCR5,CCR7,CXCL9,C XCR3,FPR1,FPR3,GPR4,GR P,PTGDR,S1PR4,SAA1 Gen MAPP MAP00590 Prostaglandin and leukotriene metabolism 1.131503741 2 ALOX5,PTGDS MAP00600 Sphingoglycolipid metabolism 0.600507295 1 B3GALT4 MAP00030 Pentose phosphate 0.473787718 1 FMNL3 MAP00860 Porphyrin and chlorophyll metabolism 0.453812378 1 HMOX1 MAP00562 Inositol phosphate metabolism 0.435159102 1 PLCB2 MAP00051 Fructose and mannose metabolism 0.357534839 1 FMNL3 MAP00052 Galactose metabolism 0.357534839 1 FMNL3 MAP00361 gamma Hexachlorocyclohexane degradation 0.29867393 1 ACP5 MAP00230 Purine metabolism 0.223759084 2 GUCY1A1,TYMP MAP00240 Pyrimidine metabolism 0.184587976 1 TYMP MSigDB C2 BIOCARTA M5884 Ensemble of genes encoding core extracellular 10 36 AEBP1,CILP,COL10A1,COL matrix including ECM glycoproteins, collagens 12A1,COL16A1,COL1A1,C and proteoglycans OL4A1,COL4A2,COL5A1,C OL5A2,COL8A2,COMP,DC N,DPT,EFEMP1,EGFLAM,E MILIN1,EMILIN2,FBLN1,F BLN2,FMOD,FNDC1,HAPL N3,HSPG2,LAMA4,LAMC2, MFAP5,MGP,NYX,POSTN, SLIT3,SMOC2,SPARCL1,SP ON2,VWA1,VWF M3005 Genes encoding collagen proteins 10 9 COL10A1,COL12A1,COL16 A1,COL1A1,COL4A1,COL4 A2,COL5A1,COL5A2,COL8 A2 M3008 Genes encoding structural ECM glycoproteins 10 22 AEBP1,CILP,COMP,DPT,EF EMP1,EGFLAM,EMILIN1,E MILIN2,FBLN1,FBLN2,FND C1,LAMA4,LAMC2,MFAP5, MGP,POSTN,SLIT3,SMOC2 ,SPARCL1,SPON2,VWA1,V WF M5885 Ensemble of genes encoding ECM-associated 10 42 ADAM15,ADAM19,ADAM8 proteins including ECM-affilaited proteins, ECM ,ADAMTS4,ANGPT2,C1QA, regulators and secreted factors C1QB,C1QTNF5,CCL18,CC L19,CCL2,CCL3,CCL4,CCL 5,CLEC11A,CTSB,CTSH,CT SK,CXCL14,CXCL9,EGFL6, EMCN,F13A1,FAM20A,FCN 1,GREM1,INHBA,ITIH4,LG ALS9C,MMP11,MMP14,MM P19,MMP7,MMP9,OSM,PCS K5,PLXDC1,S100A8,SDC1, SEMA6B,SULF1,TNFSF10 M5889 Ensemble of genes encoding extracellular matrix 10 78 ADAM15,ADAM19,ADAM8 and extracellular matrix-associated proteins ,ADAMTS4,AEBP1,ANGPT 2,C1QA,C1QB,C1QTNF5,C bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

CL18,CCL19,CCL2,CCL3,C CL4,CCL5,CILP,CLEC11A, COL10A1,COL12A1,COL16 A1,COL1A1,COL4A1,COL4 A2,COL5A1,COL5A2,COL8 A2,COMP,CTSB,CTSH,CTS K,CXCL14,CXCL9,DCN,DP T,EFEMP1,EGFL6,EGFLAM ,EMCN,EMILIN1,EMILIN2, F13A1,FAM20A,FBLN1,FB LN2,FCN1,FMOD,FNDC1,G REM1,HAPLN3,HSPG2,INH BA,ITIH4,LAMA4,LAMC2, LGALS9C,MFAP5,MGP,M MP11,MMP14,MMP19,MMP 7,MMP9,NYX,OSM,PCSK5, PLXDC1,POSTN,S100A8,SD C1,SEMA6B,SLIT3,SMOC2, SPARCL1,SPON2,SULF1,T NFSF10,VWA1,VWF M6427 T Helper Cell Surface Molecules 4.909080166 5 CD2,CD4,ITGB2,PTPRC,TH Y1 M3468 Genes encoding enzymes and their regulators 4.262879543 17 ADAM15,ADAM19,ADAM8 involved in the remodeling of the extracellular ,ADAMTS4,CTSB,CTSH,CT matrix SK,F13A1,FAM20A,ITIH4, MMP11,MMP14,MMP19,M MP7,MMP9,PCSK5,SULF1 M5882 Genes encoding proteoglycans 2.876815948 5 DCN,FMOD,HAPLN3,HSPG 2,NYX M3075 Granzyme A mediated Apoptosis Pathway 1.570371615 2 GZMA,GZMB M5883 Genes encoding secreted soluble factors 1.447050498 ANGPT2,CCL18,CCL19,CC L2,CCL3,CCL4,CCL5,CXCL 14,CXCL9,EGFL6,INHBA,O SM,S100A8,TNFSF10 Panther DB P00034 Integrin signalling pathway 4.349842769 14 COL10A1,COL12A1,COL16A1, COL1A1,COL4A1,COL4A2,COL 5A1,COL5A2,COL8A2,ITGAX,IT GB2,LAMA4,LAMC2,LIMS2 P00031 Inflammation mediated by chemokine and 4.290414522 15 ACTA2,CCL18,CCL2,CCL3,CCL4 cytokine signaling pathway ,CCL5,CCR5,CCR7,COL12A1,CX CR3,FPR1,FPR3,MYLK,PLCB2,V WF P00053 T cell activation 2.030124658 6 HLA-DOA,HLA-DPA1,HLA- DQA1,HLA-DRA,LCP2,PTPRC P00005 Angiogenesis 1.57069099 8 ANGPT2,CRYAB,DOK3,HSPB2, PDGFRB,PLA2G4C,PLD1,SPHK 1 P00034 Integrin signalling pathway 4.349842769 14 COL10A1,COL12A1,COL16A1, COL1A1,COL4A1,COL4A2,COL 5A1,COL5A2,COL8A2,ITGAX,IT GB2,LAMA4,LAMC2,LIMS2 Pathway Ontology PW:0000485 eicosanoids metabolic 2.079342976 3 ALOX5,GGT5,PTGDS PW:0000111 gamma-hexachlorocyclohexane degradation 1.650738323 2 ACP5,CYP1B1 PW:0000413 heme catabolic 1.613208299 1 HMOX1 PW:0000346 CADASIL 1.613208299 1 NOTCH3 PW:0000234 innate immune response 1.570371615 2 CD14,TLR2 PW:0000367 altered JAK-STAT signaling 1.327894996 1 JAK3 SMPDB SMP00202 MNGIE (Mitochondrial Neurogastrointestinal 1.613208299 1 TYMP Encephalopathy) SMP00343 Intracellular Signalling Through PGD2 receptor 1.037285188 1 PTGDR and Prostaglandin D2 SMP00046 Pyrimidine Metabolism 0.927107782 2 CMPK2,TYMP SMP00085 Ketoprofen Pathway 0.809529902 1 PTGDS SMP00103 Cyclothiazide Pathway 0.633324773 1 AQP1 SMP00008 Phenylalanine and Tyrosine Metabolism 0.633324773 1 IL4I1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

SMP00045 Amino Sugar Metabolism 0.543441174 1 CHIT1 SMP00024 Porphyrin Metabolism 0.518387558 1 HMOX1 SMP00280 Alteplase Pathway 0.495247973 1 F13A1 SMP00381 Nisoldipine Pathway 0.453812378 1 ACTA2

Table 4 The enriched pathway terms of the down regulated differentially expressed genes

BIOCYC Pathway ID Pathway Name LogP Gene Count Genes 782396 glycolysis 3.382851674 4 ALDOC,ENO2,PFKP,PGK1 142451 lactate fermentation (reoxidation of cytosolic 3.19782503 2 LDHA,LDHB NADH) 142314 methylglyoxal degradation III 2.738991483 2 AKR1B1,AKR1B10 1271888 docosahexaenoate biosynthesis III (mammals) 2.738991483 2 ELOVL2,FADS2 142277 purine nucleotides de novo biosynthesis 2.525185998 5 ADSSL1,ATP5F1A,ATP5F1 B,IMPDH2,PAICS 907942 superpathway of purine nucleotide salvage 2.477484123 5 ADA,ADSSL1,ATP5F1A,AT P5F1B,IMPDH2 782382 gluconeogenesis 2.254174833 3 ALDOC,ENO2,PGK1 142460 pentose phosphate pathway 2.061697376 2 PGD,TKT 1108771 allopregnanolone biosynthesis 2.061697376 2 AKR1C1,AKR1C3 835393 superpathway of conversion of glucose to acetyl 1.925884521 4 ALDOC,ENO2,PFKP,PGK1 CoA and entry into the TCA cycle KEGG 790012 Biosynthesis of amino acids 10 14 ACY1,ALDOC,CPS1,ENO1, ENO2,ENO3,GAPDH,MAT1 A,PFKP,PGAM1,PGK1,PSA T1,TKT,TPI1 814926 Carbon metabolism 10 15 ACAT1,ALDOC,CPS1,ENO1 ,ENO2,ENO3,GAPDH,OGD HL,PFKP,PGAM1,PGD,PGK 1,PSAT1,TKT,TPI1 83054 Cell cycle 5.613988303 14 BUB1B,CCNA2,CCNB1,CC NB2,CDC20,CDC45,CDK1,E SPL1,MCM2,MYC,PCNA,P TTG1,PTTG2,SKP2 83073 Complement and coagulation cascades 5.417738051 11 C4BPA,C8A,CD55,F11,F2,F GG,SERPINA1,SERPINC1,S ERPIND1,TFPI,VTN 83036 Ribosome 4.521098531 14 MRPL10,RPL15,RPL23A,RP L3,RPL4,RPL6,RPL7,RPL7A ,RPLP0,RPS10,RPS2,RPS4Y 1,RPS4Y2,RPSA 132956 Metabolic pathways 3.395437118 51 ACAT1,ACSM3,ACY1,ADA ,ADSSL1,AGMAT,AKR1B1, AKR1B10,AKR1C3,ALAS2, ALDOC,ATP5F1A,ATP5F1B ,COASY,COX4I1,CPS1,CYP 26A1,DCT,DNMT3B,ENO1, ENO2,ENO3,FDFT1,GAPDH ,GDA,HGD,HYAL1,IMPDH 2,LDHA,LDHB,MAT1A,ND UFC2,OGDHL,PAICS,PFKP, PGAM1,PGD,PGK1,PGM1,P IGF,PLA2G4A,PRIM1,PSAT 1,RIMKLA,ST6GALNAC1,T KT,TPI1,TYMS,TYR,TYRP1 ,UGT2B10 835410 Thyroid hormone synthesis 3.311398919 8 ADCY1,ALB,ASGR1,ASGR 2,CGA,FXYD2,GNAS,TTR 83098 Parkinson's disease 1.190335366 7 ATP5F1A,ATP5F1B,COX4I1 ,NDUFC2,SLC25A5,SNCA, UBB 83056 Ubiquitin mediated proteolysis 0.895554513 6 BRCA1,CDC20,NEDD4L,SK P2,TRIM37,UBE2E3 83105 Pathways in cancer 0.727420591 13 ADCY1,EGLN1,FGFR3,FZD 10,FZD5,GNAS,GNG4,HSP9 0AB1,LAMA1,MET,MYC,S bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

KP2,TCF7 Pathway Interaction Database 137911 FOXA2 and FOXA3 transcription factor 5.96702314 9 AFP,ALB,APOA1,DLK1,F2, networks FOXA2,IGFBP1,TFRC,TTR 138045 HIF-1-alpha transcription factor network 4.512145647 9 BNIP3,EGLN1,ENO1,IGFBP 1,LDHA,NPM1,PGK1,PGM1 ,TFRC 169351 Validated targets of C-MYC transcriptional 3.75160023 9 CCNB1,ENO1,GAPDH,LDH activation A,LIN28B,MYC,NPM1,PEG 10,TFRC 137934 E2F transcription factor network 3.351763768 8 BRCA1,CCNA2,CDK1,MYC ,PRMT5,RANBP1,RBBP4,T YMS 137979 FOXA1 transcription factor network 3.195966961 6 APOB,BRCA1,FOXA2,SERP INA1,TFF1,VTN 137935 FOXM1 transcription factor network 2.677661082 5 CCNB1,CCNB2,CDK1,MYC ,SKP2 137969 Signaling events mediated by PRL 2.63900892 4 AGT,CCNA2,PTP4A1,TUBA 1B 138073 C-MYB transcription factor network 2.490473201 7 ADA,CCNB1,GATA3,H2AF Z,MYB,MYC,SLC25A3 138007 PLK1 signaling events 2.342667928 5 BUB1B,CCNB1,CDC20,CD K1,TPX2 137925 Aurora A signaling 2.156114433 4 AJUBA,BRCA1,DLGAP5,TP X2 REACTOME 1268691 Peptide chain elongation 10 14 EEF1A1,RPL15,RPL23A,RP L3,RPL4,RPL6,RPL7,RPL7A ,RPLP0,RPS10,RPS2,RPS4Y 1,RPS4Y2,RPSA 1269741 Cell Cycle 10 40 AJUBA,BRCA1,BUB1B,CC NA2,CCNB1,CCNB2,CDC20 ,CDC45,CDCA5,CDK1,CEN PH,CENPN,CENPO,ESPL1, GMNN,H2AFZ,HMMR,HSP 90AB1,KIF23,KIF2C,MCM2, MYC,NPM1,OIP5,PCNA,PR IM1,PSMA5,PSMB5,PSMD6 ,PTTG1,RBBP4,RFC5,RMI2, SKP2,SPC25,TPX2,TUBA1A ,TUBB,TYMS,UBB 1270158 Metabolism of amino acids and derivatives 10 25 ACAT1,AGMAT,CGA,CPS1 ,DCT,HGD,IARS,MAT1A,PS AT1,PSMA5,PSMB5,PSMD6 ,RPL15,RPL23A,RPL3,RPL4 ,RPL6,RPL7,RPL7A,RPLP0, RPS10,RPS2,RPS4Y1,RPS4 Y2,RPSA,SLC7A5,TYR,TY RP1 1269056 25 CD8B,HSP90AB1,KPNA2,M ET,NEDD4L,NPM1,PSMA5, PSMB5,PSMD6,RANBP1,RP L15,RPL23A,RPL3,RPL4,RP L6,RPL7,RPL7A,RPLP0,RPS 10,RPS2,RPS4Y1,RPS4Y2,R Infectious disease 4.773562843 PSA,SLC25A5,UBB 1269340 Hemostasis 32 AHSG,ALB,APOA1,APOB, APOH,C1QBP,F11,F2,FGG, GATA3,GNAS,GNG4,HBG1 ,HBG2,IGF2,ITIH3,KIF11,KI F23,KIF2C,KIF4A,MYB,NF E2,OLA1,ORM1,ORM2,PLA 2G4A,SELENOP,SERPINA1, SERPINC1,SERPIND1,SLC7 3.873546873 A5,TFPI 1269810 19 BUB1B,CCNB1,CCNB2,CD C20,CDCA5,CDK1,CENPH, CENPN,CENPO,ESPL1,H2A FZ,KIF23,KIF2C,PSMA5,PS M Phase 3.530864513 MB5,PSMD6,PTTG1,SPC25, bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

UBB 1268854 Disease 38 ALB,CAPNS1,CD8B,FGFR3 ,FGG,FZD5,GPC3,HSP90AB 1,KPNA2,MET,MYC,NEDD 4L,NPM1,PPP1R3C,PRDX1, PSMA5,PSMB5,PSMD6,RA NBP1,RBP4,RNF43,RPL15, RPL23A,RPL3,RPL4,RPL6,R PL7,RPL7A,RPLP0,RPS10,R PS2,RPS4Y1,RPS4Y2,RPSA, SBSPON,SLC25A5,TTR,UB 3.339085713 B 1457780 Neutrophil degranulation 23 AHSG,ALDOC,CCT2,CCT8, CD55,CPNE1,EEF1A1,HP,H SP90AB1,IMPDH2,NDUFC2 ,ORM1,ORM2,PGAM1,PGM 1,PRSS2,PSMA5,PSMD6,PT X3,QPCT,SERPINA1,TTR,T 2.547939784 UBB 1269350 Platelet activation, signaling and aggregation 15 AHSG,ALB,APOA1,APOH,F 2,FGG,GNG4,IGF2,ITIH3,O LA1,ORM1,ORM2,PLA2G4 2.324040181 A,SELENOP,SERPINA1 1268693 Protein folding 07 CCT2,CCT4,CCT6A,CCT8,G 1.800447423 NG4,TUBA1A,TUBA1B Gen MAPP MAP00010 Glycolysis Gluconeogenesis 10 11 ALDOC,ENO1,ENO2,ENO3, LDHA,LDHB,PFKP,PGAM1 ,PGK1,PGM1,TPI1 MAP00030 Pentose phosphate 3.158503602 4 ALDOC,PFKP,PGD,PGM1 MAP00400 Phenylalanine tyrosine and tryptophan 3.107791424 3 ENO1,ENO2,ENO3 biosynthesis MAP00051 Fructose and mannose metabolism 2.568321747 4 AKR1B1,ALDOC,PFKP,TPI 1 MAP00710 Carbon fixation 2.17198705 3 ALDOC,PGK1,TPI1 MAP00620 Pyruvate metabolism 2.156114433 4 ACAT1,AKR1B1,LDHA,LD HB MAP00640 Propanoate metabolism 1.895122052 3 ACAT1,LDHA,LDHB MAP00272 Cysteine metabolism 1.702932606 23 LDHA,LDHB MAP00052 Galactose metabolism 1.677500321 3 AKR1B1,PFKP,PGM1 MAP00230 Purine metabolism 1.234411362 5 ADA,ADCY1,GDA,IMPDH2 ,PAICS MSigDB C2 BIOCARTA M15109 Glycolysis Pathway 5.676126219 5 ENO1,GAPDH,PGAM1,PGK 1,TPI1 M4470 Extrinsic Prothrombin Activation Pathway 3.646553881 4 F2,FGG,SERPINC1,TFPI M3468 Genes encoding enzymes and their regulators 13 AGT,AMBP,EGLN1,F2,HY involved in the remodeling of the extracellular AL1,ITIH2,ITIH3,PRSS2,SE matrix RPINA1,SERPINA6,SERPIN 2.174291006 C1,SERPIND1,TIMP4 M2404 Mechanism of Gene Regulation by Peroxisome 5 APOA1,APOA2,FABP1,MY Proliferators via PPARa(alpha) 1.839491348 C,NR0B2 M5889 Ensemble of genes encoding extracellular matrix 34 AGT,AMBP,AREG,BMP5,E and extracellular matrix-associated proteins GLN1,F2,FGG,FGL1,FRAS1, FST,GDF11,GDF3,GDF6,GP C3,HYAL1,IGF2,IGFBP1,IG FBP3,IL23A,ITIH2,ITIH3,L AMA1,MST1,PCOLCE2,PRS S2,SBSPON,SERPINA1,SER PINA6,SERPINC1,SERPIND 1,TIMP4,TNFSF9,VTN,VW 1.270867332 CE M14532 PI3K Pathway 1.195067703 3 CD55,IARS,IGFBP1 M5885 Ensemble of genes encoding ECM-associated 0.894661997 24 AGT,AMBP,AREG,BMP5,E proteins including ECM-affilaited proteins, ECM GLN1,F2,FST,GDF11,GDF3, regulators and secreted factors GDF6, GPC3,HYAL1,IGF2,IL23A,I TIH2,ITIH3,MST1,PRSS2,SE RPINA1,SERPINA6,SERPIN C1,SERPIND1,TIMP4,TNFS bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

F9 M5884 Ensemble of genes encoding core extracellular 0.825754433 10 FGG,FGL1,FRAS1,IGFBP1,I matrix including ECM glycoproteins, collagens GFBP3,LAMA1,PCOLCE2,S and proteoglycans BSPON,VTN,VWCE M5493 Genes related to Wnt-mediated signal 0.741702844 4 FZD5,GAPDH,MYC,TCF7 transduction M5884 Ensemble of genes encoding core extracellular 10 FGG,FGL1,FRAS1,IGFBP1,I matrix including ECM glycoproteins, collagens GFBP3,LAMA1,PCOLCE2,S and proteoglycans 0.825754433 BSPON,VTN,VWCE Panther DB P00024 Glycolysis 3.538800182 3 ENO1,ENO2,PGK1 P02721 ATP synthesis 2.738991483 2 ATP5F1A,ATP5F1B P00011 Blood coagulation 2.525185998 4 F2,FGG,SERPINA1,SERPIN C1,TFPI P00017 DNA replication 1.229562827 2 PCNA,PRIM1 P00052 TGF-beta signaling pathway 5 BAMBI,BMP5,GDF11,GDF3 1.115856493 ,GDF6 P00042 Muscarinic acetylcholine receptor 1 and 3 3 BCHE,GNG4,KCNQ2 signaling pathway 0.804367224 P00059 p53 pathway 0.502749998 3 CCNB1,CDK1,IGFBP3 P00012 Cadherin signaling pathway 0.440138746 5 CDH18,CELSR2,CTNND2,F ZD10,FZD5 P00057 Wntsignaling pathway 0.30867963 8 ADSSL1,CDH18,CELSR2,C TNNAL1,FZD10,FZD5,GNG 4,MYC P00031 Inflammation mediated by chemokine and 0.285277534 5 CCR9,CX3CR1,GNG4,ITGB cytokine signaling pathway 7,PLA2G4A Pathway Ontology PW:0000025 glycolysis/gluconeogenesis 10 9 ALDOC,ENO1,ENO3,GAPD H,LDHA,LDHB,PGAM1,PG M1,TPI1 PW:0000640 glycolysis pathway 5.046433264 6 ENO1,ENO2,GAPDH,PFKP, PGAM1,PGK1 PW:0000482 lipoprotein metabolic 3.646553881 4 APOA1,APOA2,APOB,APO C3 PW:0000045 pentose phosphate 3.508991551 4 ALDOC,PGD,PGM1,TKT PW:0000049 cysteine metabolic 2.939759903 3 LDHA,LDHB,SULT1A2 PW:0000238 insulin-like growth factor signaling 2.545735602 3 IGF2,IGFBP1,IGFBP3 PW:0000043 pyruvate metabolic 2.207670511 4 ACAT1,AKR1B1,LDHA,LD HB PW:0000041 fructose and mannose metabolic 2.17198705 3 AKR1B1,ALDOC,TPI1 PW:0000048 methionine cycle/metabolic 0.894158285 2 MAT1A,PRMT5 PW:0000662 mismatch repair pathway 0.8662655 2 PCNA,RFC5 SMPDB SMP00040 Glycolysis 4.994745709 5 GAPDH,PGAM1,PGK1,PGM 1,TPI1 SMP00272 Enoxaparin Pathway 3.0578966 4 F11,F2,FGG,SERPINC1 SMP00355 Mitochondrial Electron Transport Chain 2.024431636 3 ATP5F1A,ATP5F1B,GAPDH SMP00102 Bromfenac Pathway 1.804943336 2 AKR1C3,PLA2G4A SMP00006 Tyrosine Metabolism 1.677500321 3 DCT,HGD,TYR SMP00050 Purine Metabolism 1.541235958 3 ADA,ADCY1,PAICS SMP00043 Galactose Metabolism 1.395523398 2 AKR1B1,PGM1 SMP00066 Biotin Metabolism 1.137508658 1 SPCS1 SMP00027 Pantothenate and CoA Biosynthesis 0.926396597 1 COASY SMP00156 Spirapril Pathway 0.683561558 2 AGT,FXYD2

Table 5 The enriched GO terms of the up regulated differentially expressed genes

GO ID CATEGORY GO Name logP Gene Count Genes GO:0006955 BP immune response 10 137 CFH,HLA-B,DDX58,HLA- C,HLA-DMA,HLA- DMB,HLA-DOA,HLA- DOB,HLA-DPA1,HLA- DPB1,HLA-DQA1,HLA- DQB1,HLA-DRA,HLA- bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

DRB1,HLA-DRB4,HLA- DRB5,NCF1,VSIG4,HLA- F,TRAC,HMOX1,CHIT1,ADA M8,TNFRSF4,S100A8,TYRO BP,SAA1,ICOS,FCER1G,FCG R3A,FCGRT,FCN1,SPON2,C XCL9,IFI30,CCL2,CCL3,CCL 4,CCL5,CCR5,CCR7,CMKLR 1,CCL18,CCL19,FGR,MMP7, MNDA,COL1A1,SELL,DHX5 8,LAT2,UBD,BATF,LILRA6,I RF8,IFITM1,CXCL14,ACKR4 ,IFI27,SLAMF1,IFIT2,IFIT1,C RIP1,RSAD2,CSF1R,IGHA1,I GHA2,IGHG1,IGHM,IGKC,M YO1F,OASL,LAMP3,FOXP1, XAF1,CTLA4,FCRL5,SLAMF 7,VAMP8,CTSB,CTSH,CTSK, IFI6,CD300E,MARCO,MX1,I L7R,S1PR4,SP100,TNFSF10, ADAM15,DAPK3,IRF5,NCF2, IRF7,IL18RAP,JAML,ITGB2, STAT2,HCST,JAK3,CFD,SSC 5D,PTPRC,GBP4,GBP5,BST2, C1QA,C1QB,C1R,C1S,IFI44L, LILRB4,LST1,TFEB,LILRB3, VTCN1,LAIR1,SIGLEC14,OA S2,LCP2,NFAM1,RGS1,NLRP 3,OSM,CD4,CD8A,THY1,CD 14,CD27,SUSD2,GZMH,TLR2 ,GZMA,GZMB,CD40LG,CD7 9A

GO:0002682 BP regulation of 10 119 CFH,HLA-B,DDX58,HLA- immune system C,HLA-DMA,HLA- process DMB,HLA-DOA,HLA- DOB,HLA-DPA1,HLA- DPB1,HLA-DQA1,HLA- DQB1,HLA-DRA,HLA- DRB1,HLA- DRB4,PECAM1,HLA- DRB5,VSIG4,HLA- F,TMEM176A,TRAC,HMOX1 ,ADAM8,TNFRSF4,SIRPG,T YROBP,ICOS,FCER1G,FCGR 3A,FCGRT,FCN1,SPON2,CX CL9,CCL2,CCL3,CCL4,ADG RF5,CCL5,CCR7,GPR171,CM KLR1,CCL19,FGR,MMP9,M MP14,MNDA,COL1A1,SELL, DHX58,TMEM176B,LAT2,L MCD1,IFITM1,CXCL14,SLA MF1,IFIT1,RSAD2,CSF1R,RA SAL3,CSF3R,IGHA1,IGHA2,I GHG1,IGHM,IGKC,MYO1F,F OXP1,CTLA4,FCRL5,SLAMF 7,VAMP8,CTSB,CTSH,CTSK, CD300E,MARCO,IL7R,MYL K,INHBA,NBL1,IRF7,CCDC8 8B,JAML,ITGB2,STAT2,HCS T,TBC1D10C,JAK3,CFD,PTP RC,GBP5,BST2,C1QA,C1QB, C1R,C1S,MAFB,LILRB4,LST 1,PLA2G7,LILRB3,CXCR3,T SC22D3,VTCN1,LAIR1,LCP2 ,NFAM1,NLRP3,CD2,CD4,C D8A,THY1,CD14,CD27,TLR2 ,CD40LG,CD79A,GREM1,HC LS1 GO:0048534 BP hematopoietic or 10 53 ACP5,ADAM8,ANGPT2,BAT bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

lymphoid organ F,CCL19,CCL3,CCL5,CCR7,C development D2,CD27,CD4,CD40LG,CD79 A,CD8A,CSF1R,CSF3R,CTL A4,FCER1G,FOXP1,GIMAP1, GPR171,HCLS1,HLA-B,HLA- DMA,HLA-DOA,HLA- DQA1,HLA- DQB1,IL3RA,IL7R,INHBA,IR F7,IRF8,JAK3,KLF2,LILRB3, LILRB4,MAFB,MFAP5,MMP 14,MMP9,NFAM1,NLRP3,PD GFRB,PTPRC,RSAD2,SAMD 9L,SLAMF1,TMEM176A,TM EM176B,TYROBP,UBD,ZFP3 6L2,ZNF683 GO:0007155 BP positive regulation 10 37 ACP5,ADAM8,ADRA2A,AQP of cell motility 1,CCL19,CCL2,CCL3,CCL4,C CL5,CCR5,CCR7,CMKLR1,C OL1A1,CSF1R,CTSH,CXCL1 4,CXCL9,CYP1B1,DAPK3,FB LN1,FGR,FOXP1,GLIPR2,M MP14,MMP9,MYLK,MYO1F, PDGFRB,PECAM1,PLA2G7,P LD1,POSTN,PTPRC,SELL,SE MA6B,SPHK1,TLR2 GO:0016477 BP cell migration 10 78 ABI3,ACP5,ACVRL1,ADAM 15,ADAM8,ADRA2A,ANGPT 2,APOE,AQP1,ARHGAP4,BS T2,CCL18,CCL19,CCL2,CCL 3,CCL4,CCL5,CCR5,CCR7,C D2,CMKLR1,COL1A1,COL5 A1,CSF1R,CSF3R,CTSH,CXC L14,CXCL9,CXCR3,CYP1B1, DAPK3,DCN,DDX58,EFEMP 1,FAP,FAT3,FBLN1,FCER1G, FGR,FMNL3,FOLR2,FOXP1, GLIPR2,GREM1,HMOX1,IFI TM1,ITGAX,ITGB2,JAK3,JA ML,LAMA4,MMP14,MMP9, MYLK,MYO1F,NBL1,PALLD ,PDGFRB,PECAM1,PLA2G7, PLD1,PLEKHO1,POSTN,PTP RC,S100A8,SAA1,SDC1,SEL L,SEMA6B,SIRPG,SLIT3,SO X17,SP100,SPHK1,SULF1,TH Y1,TLR2,TSPO GO:0001817 BP regulation of 10 56 ACP5,ADAM8,ADRA2A,BST cytokine 2,CCDC88B,CCL19,CCL2,CC production L3,CCL4,CCL5,CCR5,CCR7, CD14,CD2,CD27,CD4,CD40L G,CMKLR1,CSF1R,CYP1B1, DDX58,DHX58,FBLN1,FCER 1G,FCN1,FGR,FOXP1,GBP5, HLA-B,HLA-DPA1,HLA- DPB1,HLA-DRB1,HLA- DRB4,HLA- DRB5,HMOX1,INHBA,IRF5,I RF7,IRF8,JAK3,KLF2,NFAM 1,NLRP3,POSTN,RSAD2,SA A1,SLAMF1,SPHK1,SPON2,S SC5D,SULF1,TLR2,TNFRSF4 ,TSPO,VSIG4,VTCN1 GO:0043062 BP extracellular 10 44 ADAM15,ADAM8,ADAMTS structure 4,CAPG,CCDC80,COL10A1,C organization OL12A1,COL16A1,COL1A1, COL4A1,COL4A2,COL5A1,C OL5A2,COL8A2,COMP,CTS K,CYP1B1,DCN,DPT,EGFL6, EGFLAM,EMILIN1,FAP,FBL N1,FMOD,GREM1,HSPG2,IT bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

GAX,ITGB2,LAMA4,LAMC2 ,MFAP5,MMP11,MMP14,MM P19,MMP7,MMP9,OLFML2B, PECAM1,POSTN,SMOC2,SU LF1,VWA1,VWF GO:0009607 BP response to biotic 10 73 ACP5,ACTA2,ADAMTS4,BA stimulus TF,BST2,CCDC88B,CCL18,C CL19,CCL2,CCL3,CCL4,CCL 5,CCR5,CCR7,CD14,CD27,C D4,CD40LG,CD8A,CHIT1,C MPK2,CXCL9,DCN,DDX58, DHX58,FCER1G,FCGR3A,FG R,FOXP1,GBP4,GNLY,GUCY 1A1,HLA-B,HLA- DRB1,HLA-DRB4,HLA- DRB5,IFI44,IFI44L,IFIT1,IFIT 2,IFITM1,IGHA1,IGHA2,IGH G1,IGHM,IGKC,IL10RA,IRF5 ,IRF7,IRF8,ITGAX,LMCD1,M MP7,MX1,MYLK,MYO1F,NC F1,NCF2,NLRP3,OAS2,OASL ,PLD1,PTPRC,RSAD2,S100A 8,SLAMF8,SPON2,SSC5D,ST AT2,TLR2,TNFRSF4,TSPO,V TCN1 GO:0051707 BP response to other 10 71 HLA-B,DDX58,HLA- organism DRB1,ACP5,HLA- DRB4,HLA- DRB5,NCF1,ACTA2,CHIT1,T NFRSF4,S100A8,FCER1G,FC GR3A,SPON2,CXCL9,CCL2, CCL3,CCL4,CCL5,CCR5,CC R7,PLD1,CCL19,FGR,MMP7, DHX58,ADAMTS4,BATF,LM CD1,IFI44,IRF8,IFITM1,GNL Y,IFIT2,IFIT1,RSAD2,IGHA1, IGHA2,IGHG1,IGHM,IGKC, MYO1F,OASL,FOXP1,MX1,S LAMF8,IL10RA,MYLK,CMP K2,IRF5,NCF2,IRF7,DCN,CC DC88B,ITGAX,STAT2,SSC5 D,PTPRC,GBP4,BST2,TSPO,I FI44L,VTCN1,OAS2,NLRP3, CD4,CD8A,CD14,GUCY1A1, CD27,TLR2 GO:0040011 BP locomotion 10 96 ABI3,DDX58,PDGFRB,HLA- DRB1,ACP5,PECAM1,HMOX 1,ACVRL1,ADAM8,TNFRSF 4,SIRPG,S100A8,FAP,FBLN1, SAA1,ADRA2A,EFEMP1,FC ER1G,FCN1,SPON2,CXCL9, CCL2,CCL3,CCL4,CCL5,CCR 5,CCR7,CMKLR1,PLD1,CCL 18,CCL19,FGR,MMP9,MMP1 4,SDC1,COL1A1,SELL,SEM A6B,COL5A1,FMOD,ANGPT 2,FOLR2,FAT3,FPR1,FPR3,IF ITM1,CXCL14,CCDC80,APO E,ACKR4,AQP1,SLAMF1,PO STN,ARHGAP4,CSF1R,CSF3 R,SLIT3,MYO1F,LAMP3,GLI PR2,FOXP1,VAMP8,CTSB,C TSH,PALLD,CYP1B1,SP100, MYLK,ADAM15,NBL1,DAP K3,DCN,ITGAX,JAML,ITGB 2,JAK3,PTPRC,BST2,SULF1, SPHK1,TSPO,NECTIN4,SLC5 2A2,PLA2G7,CXCR3,SOX17, LAMA4,TYMP,FMNL3,CD2, CD4,THY1,EGR2,TLR2,GRE bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

M1,PLEKHO1 GO:0009986 CC cell surface 10 74 RAMP1,HLA-B,HLA-C,HLA- DMA,PDGFRB,HLA- DPA1,HLA-DPB1,HLA- DQA1,HLA-DQB1,HLA- DRA,HLA-DRB1,HLA- DRB4,PECAM1,HLA- DRB5,HLA- F,ACVRL1,ADAM8,TNFRSF 4,TYROBP,FAP,ICOS,FCER1 G,FCGR3A,FCN1,CXCL9,AD GRF5,CCR5,CCR7,CCL19,M MP7,SDC1,SELL,VWF,FOLR 2,APOE,SLAMF1,CRYAB,CS F1R,GPIHBP1,IGHA1,IGHA2, IGHG1,IGHM,IGKC,CTLA4,S LAMF7,VAMP8,CTSB,IL7R, ADAM19,MYLK,ADAM15,IT GAX,ITGB2,HCST,GGTA1P, GGT5,PTPRC,BST2,SULF1,M RC2,CXCR3,VTCN1,NFAM1, CD2,CD4,CD8A,THY1,CD14, CD27,TLR2,CD40LG,CD79A, GREM1 GO:0098552 CC side of membrane 10 57 HLA-B,HLA-C,HLA- DPA1,HLA-DPB1,HLA- DQA1,HLA-DQB1,HLA- DRA,HLA-DRB1,HLA- DRB4,PECAM1,HLA- DRB5,HLA- F,TNFRSF4,ICOS,FCER1G,F CGR3A,FCN1,CXCL9,CCR5, CCR7,CCL19,FGR,SDC1,SEL L,VWF,FOLR2,APOE,SLAM F1,GPIHBP1,RASAL3,IGHA1 ,IGHA2,IGHG1,IGHM,IGKC, CTLA4,SLAMF7,CTSB,IL7R, ADAM19,ITGAX,GGTA1P,G GT5,JAK3,PTPRC,CXCR3,VT CN1,RGS1,CD2,CD4,CD8A,T HY1,CD14,CD27,TLR2,CD40 LG,CD79A GO:0031012 CC extracellular 10 49 EMILIN2,NYX,CHI3L1,FBLN matrix 1,FBLN2,EFEMP1,MGP,AEB P1,SPON2,SPARCL1,MMP7, MMP9,MMP11,MMP14,MMP 19,COL1A1,COL4A1,COL4A 2,COL5A1,COL5A2,HSPG2,C OL8A2,COL10A1,COL12A1, VWF,FMOD,COL16A1,COM P,ADAMTS4,CILP,LMCD1,O LFML2B,CCDC80,VWA1,AP OE,EGFL6,POSTN,SLIT3,HA PLN3,EGFLAM,SMOC2,DCN ,SSC5D,DPT,CPXM2,LAMA4 ,LAMC2,EMILIN1,MFAP5 GO:0005615 CC extracellular space 10 86 CFH,PCSK5,RAMP1,ACP5,P ECAM1,HLA- DRB5,ACTA2,HMOX1,CHI3 L1,CHIT1,F13A1,S100A8,FA P,FBLN1,SAA1,EFEMP1,MG P,AEBP1,CLEC11A,SPON2,C XCL9,CCL2,CCL3,CCL4,CCL 5,SPARCL1,C1QTNF5,CCL18 ,CCL19,MMP7,MMP9,ALOX 5,COL1A1,HSPG2,AMY1C,C OL12A1,FMOD,ANGPT2,CO MP,ADAMTS4,CILP,LMCD1, CXCL14,GNLY,VWA1,APOE ,EGFL6,POSTN,GPIHBP1,IG bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

HA1,IGHA2,IGHG1,ASIP,IG HM,SLIT3,IGKC,HAPLN3,CT SB,CTSH,CTSK,PRSS8,TNFS F10,INHBA,NBL1,DCN,PTG DS,ADA2,ITIH4,CFD,SSC5D, SULF1,C1QA,C1QB,C1R,C1S ,PLA2G7,DPT,CPXM2,PLXD C1,LAMC2,GRP,OSM,CD14, CD40LG,GREM1,HBB GO:0009897 CC external side of 10 47 HLA-DQA1,HLA- plasma membrane DQB1,HLA-DRB1,HLA- DRB4,PECAM1,HLA- DRB5,TNFRSF4,ICOS,FCER1 G,FCGR3A,FCN1,CXCL9,CC R5,CCR7,CCL19,SDC1,SELL, VWF,FOLR2,APOE,SLAMF1, GPIHBP1,IGHA1,IGHA2,IGH G1,IGHM,IGKC,CTLA4,SLA MF7,CTSB,IL7R,ADAM19,IT GAX,GGTA1P,GGT5,PTPRC, CXCR3,VTCN1,CD2,CD4,CD 8A,THY1,CD14,CD27,TLR2, CD40LG,CD79A GO:0000323 CC lytic vacuole 10 35 HLA-DMA,HLA-DMB,HLA- DOA,PDGFRB,HLA- DOB,HLA-DPA1,HLA- DPB1,HLA-DQA1,HLA- DQB1,HLA-DRA,HLA- DRB1,ACP5,HLA- DRB4,HLA- DRB5,NCF1,TCIRG1,CHIT1, SLC15A3,ADAM8,IFI30,PLD 1,IL4I1,SDC1,HSPG2,FMOD, LAT2,APOE,LAMP3,VAMP8, CTSB,CTSH,CTSK,NCF2,DC N,STARD3 GO:0031226 CC intrinsic 10 66 CD52,RAMP1,HLA-B,HLA- component of C,PDGFRB,HLA-DPA1,HLA- plasma membrane DQA1,HLA-DRA,HLA- DRB1,HLA- DRB4,NCF1,TCIRG1,ACVRL 1,ADAM8,CD163,TNFRSF4,T YROBP,ADRA2A,ICOS,FCE R1G,CCR5,GPR171,CMKLR1 ,MMP14,SDC1,SELL,SEMA6 B,FOLR2,CLDN4,CLDN3,AC KR4,AQP1,SLC2A5,CSF1R,G PIHBP1,RASAL3,CSF3R,CTL A4,MARCO,S1PR4,PRSS8,T NFSF10,GPR84,NCF2,ITGAX ,ITGB2,GGTA1P,GGT5,GJA4, PTPRC,BST2,NECTIN4,NKG 7,SLC52A2,NOTCH3,GPR4,L ILRB3,CXCR3,CD2,CD8A,T HY1,CD14,CD27,TLR2,CD40 LG,CD79A GO:0098589 CC membrane region 2.6084150 41 DDX58,PDGFRB,PECAM1,T 87 CIRG1,HMOX1,FAP,ADRA2 A,FCER1G,C1QTNF5,PLD1,F GR,LAT2,CLDN4,CLDN3,AQ P1,SLC2A5,CRYAB,GPIHBP 1,VAMP8,CTSB,KCTD12,PR SS8,DAPK3,ITGB2,TBC1D10 C,TAS2R4,PTPRC,BST2,SUL F1,CAVIN3,LCP2,NFAM1,R GS16,CD2,CD4,THY1,CD14, TLR2,CD79A,PLEKHO1,RAS GRP2 GO:0044431 CC Golgi apparatus 2.2826325 31 PCSK5,HLA-B,HLA-C,HLA- part 73 DPA1,HLA-DPB1,HLA- bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

DQA1,HLA-DQB1, HLA- DRA,HLA-DRB1,HLA- DRB4,HLA-DRB5,HLA- F,PLD1,MMP11,MMP14,SDC 1,PLK3,HSPG2,FMOD,POST N,GLIPR2,CYTH4,B3GALT4, GIMAP1,DCN,GGTA1P,GBP 4,GBP5,SULF1,NOTCH3,LST 1 GO:0044432 CC endoplasmic 1.5686376 34 HLA-B,HLA-C,HLA- reticulum part 42 DPA1,HLA-DPB1,HLA- DQA1,HLA-DQB1,HLA- DRA,HLA-DRB1,HLA- DRB4,HLA-DRB5,HLA- F,HMOX1,MRVI1,DERL3,OS BPL5,PLD1,COL1A1,COL4A 1,COL4A2,COL5A1,COL5A2, COL8A2,COL10A1,COL12A1 ,COL16A1,RSAD2,PLA2G4C, MX1,CYP1B1,GIMAP1,PTGD S,NOTCH3,TMEM119,CD4 GO:0008236 MF serine-type 10 26 PCSK5,ADAM8,FAP,AEBP1, peptidase activity FCN1,MMP7,MMP9,MMP11, MMP14,MMP19,IGHG1,IGK C,CTSB,CTSH,CTSK,PRSS8, CFD,C1QA,C1QB,C1R,C1S,C PXM2,GZMH,GZMA,GZMB, GZMK GO:0003823 MF antigen binding 10 26 HLA-B,HLA-C,HLA- DMA,HLA-DMB,HLA- DOA,HLA-DOB,HLA- DPA1,HLA-DPB1,HLA- DQA1,HLA-DQB1,HLA- DRA,HLA-DRB1,HLA- DRB4,HLA-DRB5,HLA- F,FCGRT,SPON2,SLAMF1,IG HA1,IGHA2,IGHG1,IGHM,IG KC,IL7R,LILRB4,CD2 GO:0005102 MF signaling receptor 10 67 RAMP1,HLA- binding B,PDGFRB,DOK3,HLA- F,ADAM8,S100A8,TYROBP, FAP,FBLN1,SAA1,ADRA2A, EFEMP1,FCN1,CLEC11A,SP ON2,CXCL9,CCL2,CCL3,CC L4,CCL5,CCL18,CCL19,FGR, MMP14,SEMA6B,COL5A1,V WF,FMOD,COL16A1,ANGPT 2,FPR1,CXCL14,APOE,AQP1, EGFL6,IGHA1,IGHA2,IGHG1 ,ASIP,IGHM,SLIT3,IGKC,OA SL,FOXP1,SP100,TNFSF10,I NHBA,ADAM15,JAML,ADA 2,RTP4,HCST,JAK3,NECTIN 4,VTCN1,LAMA4,TYMP,GR P,OSM,CD2,CD4,CD8A,THY 1,TLR2,CD40LG,GREM1 GO:0060089 MF molecular 10 68 RAMP1,HLA- transducer activity DOA,PDGFRB,HLA- DOB,HLA-DPA1,HLA- DQA1,HLA-DQB1,HLA- DRA,HLA-DRB1,HLA- DRB4,ACVRL1,CD163,TNFR SF4,ADRA2A,EFEMP1,FCER 1G,FCGRT,FCN1,ADGRF5,C CR5,CCR7,GPR171,CMKLR1 ,FOLR2,FPR1,FPR3,CLDN4,C LDN3,ACKR4,AQP1,SLAMF 1,CSF1R,CSF3R,IL21R,CTSH, IL3RA,MARCO,IL7R,S1PR4,I L10RA,GPR84,PTGDR,ITGA bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

X,IL18RAP,ITGB2,ADGRL4, SSC5D,TAS2R4,PTPRC,SPH K1,TSPO,NECTIN4,SLC52A2 ,NOTCH3,LILRB4,GPR4,LIL RB3,CXCR3,NFAM1,CD2,CD 4,CD8A,CD14,GUCY1A1,CD 27,SUSD2,TLR2,CD79A GO:0038023 MF signaling receptor 5.7593451 56 RAMP1,HLA- activity 36 DOA,PDGFRB,HLA- DOB,HLA-DPA1,HLA- DQA1,HLA-DQB1,HLA- DRA,HLA-DRB1,HLA- DRB4,ACVRL1,TNFRSF4,AD RA2A,EFEMP1,FCER1G,FCG RT,FCN1,ADGRF5,CCR5,CC R7,GPR171,CMKLR1,FPR1,F PR3,CLDN4,CLDN3,ACKR4, SLAMF1,CSF1R,CSF3R,IL21 R,CTSH,IL3RA,MARCO,IL7 R,S1PR4,IL10RA,GPR84,PTG DR,IL18RAP,ITGB2,ADGRL4 ,TAS2R4,PTPRC,SPHK1,TSP O,GPR4,LILRB3,CXCR3,NFA M1,CD4,CD8A,CD14,CD27,T LR2,CD79A GO:0008233 MF peptidase activity, 4.8384712 31 PCSK5,ADAM8,FAP,AEBP1, acting on L-amino 29 FCN1,MMP7,MMP9,MMP11, acid peptides MMP14, MMP19,ADAMTS4,IGHG1,I GKC,CTSB,CTSH,CTSK,PRS S8,ADAM19, ADAM15,GGT5,CFD,C1QA, C1QB,C1R,C1S,CPXM2,RNP EPL1,GZMH, GZMA,GZMB,GZMK GO:0005509 MF calcium ion 3.1967433 28 ADAM8,S100A8,FBLN1,FBL binding 38 N2,EFEMP1,MGP,PLCB2,SP ARCL1,MMP11,MMP14,MM P19,HSPG2,COMP,FAT3,EGF L6,SLIT3,EGFLAM,SMOC2, CALML5,ITIH4,ADGRL4,SU LF1,C1R,C1S,NOTCH3,CDH7 ,CDH11,RASGRP2 GO:0008289 MF lipid binding 2.3195154 25 NCF1,S100A8,SPON2,OSBPL 87 5,PLCB2,PLD1,SELL,COMP, APOE,WDFY4,PLA2G4C,GPI HBP1,IGHM,CYTH4,S1PR4, ADAP2,PTGDS,TSPO,STAR D3,PLA2G7,ARHGAP9,THY1 ,CD14,TLR2,RASGRP2 GO:0042802 MF identical protein 1.9362866 40 DDX58,HMOX1,TYROBP,FA binding 6 P,FBLN1,ADRA2A,CCL3,CC L4,CCL5,C1QTNF5,MMP9,C OL1A1,VWF,OLFML2B,CLD N4,CLDN3,VWA1,APOE,CR YAB,CSF1R,GLIPR2,SP100,I NHBA,NBL1,DAPK3,JAML, ADA2,STAT2,GBP5,BST2,NE CTIN4,C1QB,C1S,EMILIN1, HEYL,CD2,CD4,CD8A,MAP1 S,GZMA GO:0046983 MF protein 1.2056972 35 HLA-DQA1,HLA- dimerization 93 DQB1,HMOX1,FAP,ADRA2A activity ,CCL5,TFEC,VWF,OLFML2B ,APOE,CRYAB,CSF1R,ASCL 2,GLIPR2,H2AFJ,SP100,INH BA,NBL1,DAPK3,JAML,AD A2,ITGB2,ADGRL4,BST2,NE CTIN4,C1QB,TFEB,SOX17,H EYL,CD2,CD4,CD8A,GUCY1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A1,TLR2,GZMA Biological Process(BP), Cellular Component(CC) and Molecular Functions (MF)

Table 6 The enriched GO terms of the down regulated differentially expressed genes

GO ID CATEGORY GO Name logP Gene Count Genes GO:0019752 BP 59 HGD,ACAT1,MAT1A,PFKP,A CY1,PGAM1,PGD,PGK1,PGM 1,FABP1,TYMS,TYR,TYRP1,A CSM3,AGT,UGT2B10,FADS2, PLA2G4A,ALDOC,PLP1,PSAT 1,FOLR1,IARS,ERO1A,EGLN1 ,APOA1,APOA2,APOC3,CPS1, SLC7A2,TRIB3,AKR1C3,OGD HL,SNCA,SLC37A4,MYC,CYP 2F1,GAPDH,PSMA5,CYP26A1 ,PSMB5,GATA3,DCT,AKR1C1 ,ELOVL2,STAR,PSMD6,BRCA 1,DNMT3B,ADSSL1,LDHA,L carboxylic acid DHB,FADS1,AGMAT,SLC7A5 metabolic process 10 ,ENO1,ENO2,ENO3,TPI1 GO:0043436 BP 62 HGD,ACAT1,MAT1A,HS6ST2, PFKP,ACY1,PGAM1,PGD,PG K1,PGM1,FABP1,TYMS,TYR, TYRP1,ACSM3,AGT,UGT2B1 0,FADS2,PLA2G4A,ALDOC,P LP1,PSAT1,FOLR1,HYAL1,IA RS,ERO1A,EGLN1,APOA1,AP OA2,APOC3,CPS1,SLC7A2,TR IB3,AKR1C3,OGDHL,SNCA,S LC37A4,MYC,CYP2F1,GAPD H,PSMA5,CYP26A1,PSMB5,G ATA3,DCT,AKR1C1,ELOVL2, STAR,PSMD6,SULT1A2,BRC A1,DNMT3B,ADSSL1,LDHA, oxoacid metabolic LDHB,FADS1,AGMAT,SLC7A process 10 5,ENO1,ENO2,ENO3,TPI1 GO:0051248 BP 58 PTTG1,F2,FABP1,MET,SERPI NA1,UBB,CAMK2N1,RACK1, AGT,AHSG,ITM2A,HSP90AB1 ,AMBP,VIL1,VTN,ANG,LIN28 B,POU5F1,MAD2L1BP,IGF2B P3,IGF2BP2,IGFBP3,TRIB3,FA M72A,SERPINC1,SNCA,MAG EA2B,PTTG2,MYC,GAPDH,PS MA5,PSMB5,EIF3E,PBK,CD55 ,ITIH2,ITIH3,APOM,PPP1R26, PSMD6,GPC3,BRCA1,PTX3,B UB1B,C4BPA,TESC,DNMT3B, negative regulation of NPM1,TFPI2,CAMK2N2,SERP protein metabolic INA6,CCNB1,TFPI,TIMP4,CD process 10 K1,CDC20,AJUBA,SERPIND1 GO:0030162 BP 43 PTTG1,PHB2,F2,FABP1,SERPI NA1,UBB,RACK1,AGT,AHSG, HSP90AB1,AMBP,VIL1,VTN, MAD2L1BP,TRIB3,SERPINC1, SNCA,ESPL1,PTTG2,SOX2,M YC,PSMA5,DLGAP5,PSMB5,P BK,CD55,ITIH2,ITIH3,PSMD6, GPC3,BUB1B,C1QBP,C4BPA, C8A,TFPI2,SERPINA6,CCNB1, regulation of TFPI,TIMP4,PCOLCE2,CDK1, proteolysis 10 CDC20,SERPIND1 GO:1901700 BP response to oxygen- 10 70 TRIML2,NANOG,MBP,FOXA2 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

containing compound ,ADA,ADCY1,REPIN1,FABP1, GLP2R,TYMS,TYR,MET,SERP INA1,RACK1,HP,AGT,AHSG, PLA2G4A,ABCC2,AKR1B1,N R0B2,FOLR1,HYAL1,ERO1A, EGLN1,ID1,APOA2,APOB,PO U5F1,APOC3,CPS1,APOH,AR EG,IGF2,IGFBP1,TRIB3,AKR1 C3,SNCA,CX3CR1,GABRB1,S OX2,GATA3,CD55,NCAM1,B CHE,AKR1C1,STAR,APOM,B NIP3,UTS2,BRCA1,TRIM63,T ESC,GNAS,GNG4,DNMT3B,R ANBP1,RBP4,LDHA,TFF1,CC NA2,CCNB1,TFRC,GAL,TIMP 4,PRDX1,H2AFZ,FZD10,CDK1 ,HBA2 GO:0055114 BP 50 HGD,KDM5D,PFKP,PGAM1,P GD,PGK1,PGM1,FABP1,TYR, TYRP1,UBB,FOXRED2,FDFT1 ,FADS2,ALDOC,AKR1B1,CO X4I1,ERO1A,EGLN1,APOA1, APOA2,CPS1,PIR,PPP1R3C,IG F2,AKR1C3,OGDHL,SNCA,SL C37A4,MYC,IMPDH2,CYP2F1 ,GAPDH,CYP26A1,DCT,AKR1 C1,NDUFC2,APOM,BNIP3,AK R1B10,GNAS,LDHA,LDHB,FA oxidation-reduction DS1,PRDX1,ENO1,ENO2,ENO process 10 3,HCCS,TPI1 GO:1903047 BP 47 PTTG1,SPC25,PHB2,MCM2,OI P5,HMMR,CDC45,TYMS,MET ,UBB,PRMT5,FGFR3,FHL1,KI F23,SLF1,TUBB,SKP2,MAD2L 1BP,SPAG5,IGF2,CENPH,PRI M1,TPX2,ESPL1,CDCA5,MYB ,CENPN,PSMA5,DLGAP5,PSM B5,PBK,KIF4A,PSMD6,TUBA 1A,BUB1B,KIF11,KIF2C,NPM 1,RANBP1,CCNA2,CCNB1,H mitotic cell cycle MGA2,CCNB2,CDK1,CDC20, process 10 AJUBA,PCNA GO:0043086 BP 45 PTTG1,FOXA2,FABP1,SERPI NA1,UBB,CAMK2N1,RACK1, HP,AGT,AHSG,AMBP,VIL1,V TN,EGLN1,APOA1,APOA2,AP OC3,TRIB3,FAM72A,SERPIN C1,SNCA,PTTG2,PHACTR1,P SMA5,PSMB5,ITIH2,ITIH3,PP P1R26,PSMD6,GPC3,PTX3,BU B1B,TESC,NPM1,TFPI2,CAM K2N2,SERPINA6,CCNB1,TFPI negative regulation of ,TIMP4,FZD10,CDK1,CDC20, catalytic activity 10 AJUBA,SERPIND1 GO:1901566 BP 61 RPL23A,RPLP0,RPS2,MAT1A, RPS4Y1,HS6ST2,RPS10,MRPL 10,ADA,ADCY1,SLC25A3,TY MS,RACK1,PLA2G4A,ALAS2, PSAT1,ANG,SLC25A5,LIN28B ,HYAL1,IARS,APOA1,APOA2, POU5F1,CPS1,PAICS,IGF2BP3 ,IGF2BP2,COA1,COASY,EIF3I ,SNCA,ATP5F1A,ATP5F1B,ST 6GALNAC1,MYC,IMPDH2,GA PDH,EIF3E,GATA3,SULT1A2, GPC3,C1QBP,GNAS,MOCOS, ADSSL1,RPS4Y2,NPM1,RPSA, organonitrogen EEF1A1,EEF1A2,GSTM3,EEF1 compound G,AGMAT,AJUBA,RPL3,RPL4 biosynthetic process 10 ,RPL6,RPL7,RPL7A,RPL15 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

GO:1901575 BP 74 RPL23A,HGD,PTTG1,RPLP0,A CAT1,RPS2,RPS4Y1,RPS10,H MMR,PFKP,ADA,PGAM1,PG K1,PGM1,FABP1,UBB,FOXRE D2,RACK1,PLA2G4A,ALDOC, HSP90AB1,AMBP,LIN28B,HY AL1,EGLN1,APOA1,APOA2,A POB,APOC3,CPS1,APOH,SKP 2,MAD2L1BP,GDA,IGFBP3,T RIB3,AKR1C3,OGDHL,ESPL1, MAGEA2B,MYC,GAPDH,PSM A5,CYP26A1,DLGAP5,PSMB5 ,EIF3E,PBK,RNF43,PSMD6,BN IP3,GPC3,AKR1B10,BUB1B,T RIM63,C4BPA,RANBP1,NEDD 4L,RPSA,LDHA,CCNB1,TIMP 4,CDK1,CDC20,ENO1,ENO2,R organic substance PL3,ENO3,RPL4,RPL6,RPL7,R catabolic process 10 PL7A,RPL15,TPI1 GO:0005615 CC extracellular space 76 GDF6,F2,ADA,TTR,F11,MET,S ERPINA1,UBB,HP,AFP,HPR,A GT,AHSG,ALB,FGG,FGL1,AK R1B1,AMBP,SELENOP,VTN,A NG,HYAL1,AGR2,APOA1,AP OA2,APOB,APOC3,APOH,GD F3,IL23A,AREG,MST1,IGF2,I GFBP1,IGFBP3,ASIP,SERPINC 1,SNCA,PRSS2,SAAL1,TNFSF 9,LAMA1,BCHE,DLK1,ITIH2, GFRA1,APOM,BMP5,GPC3,U TS2,PTX3,RBMX,C1QBP,TAC 3,C4BPA,C8A,RBP4,SERPINA 6,TFF1,TFPI,EEF1A1,TFRC,G AL,ORM1,ORM2,INA,TIMP4,P RDX1,HBA2,ENO1,HBG2,EN O2,ENO3,GDF11,SERPIND1,T 10 PI1 GO:0044445 CC cytosolic part 27 CCT2,CCT4,CCT6A,CCT8,CO A1,ENO1,ENO2,ENO3,HBA2, HBG1,HBG2,HBZ,PFKP,REPI N1,RPL15,RPL23A,RPL3,RPL4 ,RPL6,RPL7,RPL7A,RPLP0,RP S10,RPS2,RPS4Y1,RPS4Y2,RP 10 SA GO:0015630 CC microtubule 41 TBC1D7,MAP6D1,MCM2,OLA cytoskeleton 1,CDC45,TUBA1B,KIF23,SLF1 ,SLC25A5,TUBB,ID1,CCT4,CC T2,MAD2L1BP,SPAG5,TPX2, CCT8,ESPL1,MYC,GAPDH,DL GAP5,PSMB5,KIF4A,PTP4A1, BRCA1,TUBA1A,BUB1B,TRI M63,KIF11,KIF2C,NPM1,RAN BP1,KRT18,CAMK2N2,CCNB 3.58292386 1,CCT6A,CCNB2,CDK1,CDC2 7 0,AJUBA,PCNA GO:0044427 CC chromosomal part 33 SPC25,MCM2,OIP5,REPIN1,C DC45,SLF1,CENPO,POU5F1,S PAG5,IGFBP3,ASF1B,CENPH, PRIM1,CCNB1IP1,CDCA5,MY C,CENPN,EIF3E,GATA3,RBM X,BUB1B,KIF2C,DNMT3B,TC F7,RBBP4,RFC5,CCNB1,HMG 3.55065578 A2,PRDX1,HIST1H1C,H2AFZ, 3 CDK1,PCNA GO:0005694 CC chromosome 35 SPC25,MCM2,OIP5,REPIN1,C DC45,SLF1,CENPO,POU5F1,S PAG5,IGFBP3,ASF1B,CENPH, PRIM1,CCNB1IP1,CDCA5,MY 3.28667676 C,CENPN,EIF3E,GATA3,KIF4 8 A,BRCA1,RBMX,BUB1B,KIF2 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

C,DNMT3B,TCF7,RBBP4,RFC 5,CCNB1,HMGA2,PRDX1,HIS T1H1C,H2AFZ,CDK1,PCNA GO:0031410 CC cytoplasmic vesicle 44 TBC1D7,MAP6D1,ADA,TYR,T YRP1,SERPINA1,UBB,HP,AH SG,PLA2G4A,ALB,FGFR3,FG G,SEC23B,HSP90AB1,MLANA ,SELENOP,ANG,FOLR1,HYA L1,APOA1,CCT4,APOB,PMEL, APOH,AREG,IGF2,SNCA,ABC A12,CD55,DCT,ITIH3,FZD5,G NAS,NPTX1,TFRC,GAL,CCT6 2.97476074 A,ORM1,ORM2,PDIA6,RAB34 3 ,PRDX1,HBA2 GO:0031975 CC envelope 32 ACAT1,MRPL10,PHB2,REPIN 1,SLC25A3,TYMS,MAVS,PLA 2G4A,ALAS2,SLC25A5,COX4I 1,TUBB,CPS1,CSE1L,COA1,C OASY,SNCA,ATP5F1A,ATP5F 1B,GABRB1,GAPDH,ABCA12, BCHE,NDUFC2,RNF43,STAR, 1.20844229 BNIP3,TMEM97,KPNA2,RAN 6 BP1,INA,HCCS GO:0044432 CC endoplasmic reticulum 31 F2,SERPINA1,FOXRED2,PIGF part ,FDFT1,TMEM147,UGT2B10,F ADS2,PLA2G4A,SEC23B,MLA NA,VTN,SPCS1,FOLR1,ERO1 A,APOA1,APOA2,APOB,PME L,AREG,SLC37A4,CYP2F1,CY P26A1,BCHE,RNF43,ELOVL2, 1.03655791 MYRF,PDIA6,FADS1,SEC22C, 1 TKT GO:0005783 CC endoplasmic reticulum 43 MAL,F2,SERPINA1,FOXRED2 ,PIGF,HP,FDFT1,TMEM147,U GT2B10,FADS2,PLA2G4A,AL B,FGFR3,SEC23B,MLANA,VT N,SPCS1,FOLR1,ERO1A,AGR 2,APOA1,APOA2,APOB,PMEL ,AREG,SNCA,SLC37A4,CYP2 F1,CYP26A1,BCHE,RNF43,EL OVL2,PTP4A1,BNIP3,TMEM9 1.03414957 7,MYRF,TFPI,EEF1G,PDIA6,F 4 ADS1,SEC22C,TKT,ZDHHC11 GO:0005739 CC mitochondrion 43 ACAT1,MRPL10,PHB2,SLC25 A3,TYMS,UBB,ACSM3,RACK 1,MAVS,MIPEP,PLA2G4A,AL AS2,ALDOC,CCDC136,HSP90 AB1,SLC25A5,COX4I1,AGR2, CPS1,FAM72A,COA1,OGDHL, COASY,SNCA,ATP5F1A,ATP5 F1B,MYC,GAPDH,ABCA12,N DUFC2,STAR,BNIP3,BRCA1, C1QBP,NPTX1,LDHA,LDHB,T 1.00677139 FRC,FADS1,PRDX1,AGMAT, 3 CDK1,HCCS GO:0004857 MF enzyme inhibitor 10 29 PTTG1,SERPINA1,CAMK2N1, activity RACK1,AGT,AHSG,AMBP,VI L1,APOA1,APOA2,APOC3,TRI B3,SERPINC1,SNCA,PTTG2,P HACTR1,CD55,ITIH2,ITIH3,P PP1R26,GPC3,TESC,NPM1,TF PI2,CAMK2N2,SERPINA6,TFP I,TIMP4,SERPIND1 GO:0044877 MF protein-containing 10 63 PTTG1,RPS2,NANOG,MAP6D complex binding 1,OLA1,PFKP,FABP1,CDC45,S LC25A3,MET,LHX2,PRMT5,F ST,NR0B2,HSP90AB1,AMBP, VIL1,KIF23,VTN,SLF1,SPCS1, TUBB,ID1,APOA1,APOA2,PO U5F1,CPS1,SPAG5,IGF2,CENP bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

H,SNCA,CDCA5,TRIM37,SOX 2,MYC,CTNNAL1,GAPDH,PC LAF,GATA3,KIF4A,GFRA1,B RCA1,RBMX,C1QBP,DLX2,G NAS,C8A,KIF11,KIF2C,DNMT 3B,ADSSL1,NPM1,RBBP4,RPS A,CCNB1,HMGA2,HIST1H1C, H2AFZ,PCOLCE2,CDK1,CDC2 0,AJUBA,PCNA GO:0019899 MF enzyme binding 10 69 CARHSP1,ACAT1,RPS2,TBC1 D7,MBP,MCM2,FOXA2,PGA M1,TUBA1B,MET,SERPINA1, CAMK2N1,RACK1,MAVS,PL A2G4A,ALB,HSP90AB1,SLF1, SLC25A5,IARS,EGLN1,TUBB, APOA1,CCT2,APOB,POU5F1, GDF3,PPP1R3C,MST1,CSE1L, TRIB3,TPX2,SERPINC1,EIF3I, SNCA,TRIM37,MAGEA2B,PH ACTR1,MYC,NCAM1,BCHE,P PP1R26,BNIP3,BRCA1,FZD5,C 1QBP,NKAIN1,KIF11,DNMT3 B,KPNA2,NPM1,RANBP1,RB BP4,CAMK2N2,RFC5,LDHA,L DHB,GMNN,CCNA2,CCNB1,E EF1A1,EEF1A2,GSTM3,RAB3 4,TIMP4,CDC20,ENO1,PCNA, TPI1 GO:0030234 MF enzyme regulator 3.94934927 40 PTTG1,MAL,TBC1D7,SERPIN activity A1,CAMK2N1,RACK1,AGT,A HSG,HSP90AB1,AMBP,VIL1, APOA1,APOA2,APOC3,APOH, PPP1R3C,IGF2,IGFBP3,TRIB3, SERPINC1,SNCA,PTTG2,PHA CTR1,CD55,ITIH2,ITIH3,PPP1 R26,GPC3,TESC,NPM1,RANB P1,TFPI2,CAMK2N2,SERPINA 6,TFPI,TIMP4,PCOLCE2,CDC2 0,SERPIND1,PCNA GO:0005198 MF structural molecule 3.80066505 32 RPL23A,MAL,RPLP0,RPS2,RP activity 7 S4Y1,MBP,RPS10,MRPL10,CA RD10,KRT80,SLC25A3,TUBA 1B,RACK1,FGG,PLP1,SLC25A 5,TUBB,COA1,LAMA1,NCR3 LG1,TUBA1A,RPS4Y2,KRT18, TFPI2,RPSA,INA,RPL3,RPL4, RPL6,RPL7,RPL7A,RPL15 GO:0042802 MF identical protein 3.3167162 47 ACAT1,MAT1A,GDF6,TTR,T binding YMS,TYR,TYRP1,SERPINA1, RACK1,HP,ALB,NR0B2,AMB P,VIL1,VTN,ANG,AGR2,ID1,A POA1,APOA2,BCAS1,APOH,S KP2,PAICS,ASGR1,SNCA,TRI M37,GAPDH,NCAM1,BCHE,B NIP3,PVALB,CPNE1,TESC,AD SSL1,NPM1,LDHA,LDHB,TFR C,GSTM3,TKT,PRDX1,ENO1, ENO2,ENO3,RPL7,PCNA GO:0042803 MF protein 3.19033041 32 ACAT1,ADSSL1,AGR2,AMBP, homodimerization 2 ANG,APOA2,ASGR1,BCAS1,B activity NIP3,CPNE1,ENO1,ENO2,ENO 3,GDF6,GSTM3,HP,ID1,MAT1 A,NPM1,NR0B2,PRDX1,PVAL B,RACK1,RPL7,TESC,TFRC,T KT,TRIM37,TYMS,TYR,TYRP 1,VIL1 GO:0046983 MF protein dimerization 2.93570438 44 ACAT1,MAT1A,GDF6,TTR,T activity 8 YMS,TYR,MET,TYRP1,RACK 1,HP,PRMT5,NR0B2,AMBP,VI L1,ANG,AGR2,ID1,APOA2,PO bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

U5F1,BCAS1,ASGR1,TRIM37, SOX2,MYC,GATA3,BNIP3,PV ALB,CPNE1,TESC,ABCG5,AD SSL1,NPM1,CAPNS1,RBP4,TF RC,GSTM3,INA,TKT,PRDX1, H2AFZ,ENO1,ENO2,ENO3,RP L7 GO:0016818 MF hydrolase activity, 2.57283400 30 MCM2,OLA1,CDC45,TUBA1B acting on acid 5 ,ABCC2,RAD54L,KIF23,TUBB anhydrides, in ,PRIM1,CCT8,FXYD2,ATP5F1 phosphorus-containing A,ATP5F1B,ABCA12,KIF4A,P anhydrides SMD6,TUBA1A,GNAS,GNG4, ABCG5,KIF11,KIF2C,ADSSL1, RBBP4,RFC5,EEF1A1,EEF1A2 ,RAB34,LONRF2,DDX21 GO:0098772 MF molecular function 2.39262784 45 AGT,AHSG,AMBP,APOA1,AP regulator OA2,APOC3,APOH,CAMK2N1 ,CAMK2N2,CD55,CDC20,FGF R3,FXYD2,GFRA1,GPC3,HSP9 0AB1,IGF2,IGFBP3,ITIH2,ITIH 3,MAL,NCAM1,NEDD4L,NPM 1,PCNA,PCOLCE2,PHACTR1, PPP1R26,PPP1R3C,PTTG1,PTT G2,RACK1,RANBP1,SERPINA 1,SERPINA6,SERPINC1,SERPI ND1,SNCA,TBC1D7,TESC,TF PI,TFPI2,TIMP4,TRIB3,VIL1 Biological Process(BP), Cellular Component(CC) and Molecular Functions (MF)

Table 7 Topology table for up and down regulated genes

Clustering Regulation Node Degree Betweenness Stress Closeness Coefficient Up UBD 502 0.302275 16950660 0.384045 4.61E-04 Up HLA-B 281 0.164738 9465596 0.368372 0.001525 Up IL7R 199 0.107848 14949930 0.341804 4.57E-04 Up CD4 76 0.042133 3911440 0.330125 0.001404 Up PDGFRB 74 0.040256 2681424 0.334145 0.005183 Up IRF8 73 0.038659 2565812 0.335945 0.003805 Up IRF7 66 0.0331 1989330 0.331681 0.020047 Up APOE 62 0.035788 2025952 0.327798 0 Up DDX58 56 0.024544 2061120 0.324043 6.49E-04 Up IRF5 56 0.023574 1548406 0.330284 0.025325 Up ACTA2 55 0.029533 2038742 0.325852 0 Up PTPRC 53 0.027721 1213282 0.332929 0.01016 Up RNF144B 53 0.030673 1603846 0.315439 0 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Up TLR2 52 0.029312 2006014 0.312173 0.003771 Up IFIT1 49 0.013024 1408454 0.296681 0.027211 Up IFIT2 49 0.009994 1218310 0.294959 0.026361 Up CRYAB 46 0.02525 1470644 0.32328 9.66E-04 Up S100A8 45 0.021005 1360014 0.322217 0.00303 Up ITGB2 45 0.022099 1371900 0.318477 0.00303 Up STAT2 45 0.021537 1232394 0.334838 0.051515 Up UPF2 44 0.022875 1150530 0.313028 0.005285 Up LCP2 40 0.012169 2067080 0.288175 0 Up NCF1 40 0.015369 661004 0.298002 0.010256 Up KRT5 39 0.014715 1367672 0.321575 0 Up GZMB 38 0.01355 602118 0.290925 0 Up PDE4DIP 37 0.019054 1056154 0.315729 0 Up SP100 37 0.017696 646020 0.320261 0.004505 Up COL1A1 36 0.01797 1077814 0.32165 0.001587 Up HLA-DRA 35 0.01681 871340 0.322634 0.045378 Up CCL5 35 0.013092 726240 0.29499 0.030252 Up JAK3 35 0.013511 614458 0.329056 0.011765 Up ADAM15 31 0.012973 902560 0.313314 0 Up CCR5 31 0.014936 419342 0.295212 0.021505 Up CSF1R 30 0.011451 1285278 0.323738 0 Up CCL2 29 0.009028 456566 0.298943 0.039409 Up FBLN1 29 0.011988 450122 0.27706 0 Up TSC22D3 29 0.01097 1029688 0.320149 0 Up MMP9 27 0.01006 1963768 0.263289 0 Up CTSB 26 0.01367 733408 0.320823 0.003077 Up TNFSF10 24 0.006552 280408 0.295562 0.018116 Up NCF2 23 0.015009 561080 0.319255 0.055336 Up C1QA 23 0.010035 510722 0.271093 0.027668 Up EGR2 23 0.011552 535974 0.313887 0.003953 Up FGR 22 0.009047 727656 0.32199 0.008658 Up HMOX1 22 0.008782 728174 0.318145 0 Up THY1 22 0.008748 501966 0.31157 0 Up VAMP8 22 0.011723 568706 0.312849 0 Up TRAF3IP3 22 0.011978 547354 0.311889 0 Up HCLS1 22 0.006302 236634 0.28655 0.008658 Up LAMA4 21 0.00523 726394 0.266072 0 Up KCTD12 21 0.009889 427674 0.327173 0.004762 Up GZMA 21 0.006168 895510 0.263416 0 Up MAFB 20 0.009604 296158 0.263669 0.021053 Up CSF3R 20 0.008479 713904 0.317225 0 Up HBB 20 0.006616 387328 0.313779 0.026316 Up BATF 20 0.007018 778768 0.244476 0 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Up CD14 20 0.012001 854950 0.251974 0.005263 Up KRT6B 19 0.005782 496980 0.311288 0 Up MMP14 19 0.011862 460210 0.309392 0 Up SPRY1 19 0.004879 621564 0.274977 0 Up HLA-C 18 0.006045 356646 0.314607 0.013072 Up CCL19 18 0.00516 306414 0.323967 0.130719 Up CD2 18 0.00815 407412 0.315947 0.019608 Up TAGLN 18 0.007256 390648 0.309323 0 Up HLA-DRB1 18 0.004263 508188 0.315765 0.091503 Up CD8A 18 0.008187 250414 0.327603 0.039216 Up DAPK3 18 0.005695 515936 0.31562 0 Up HSPG2 18 0.005625 647004 0.257943 0.026144 Up NOTCH3 18 0.011172 384008 0.315947 0 Up PLD1 18 0.006783 350082 0.309776 0 Up DHX58 17 0.016559 484556 0.314535 0.014706 Up VWF 17 0.00802 288034 0.318551 0.007353 Up DCN 17 0.007617 400960 0.255565 0.014706 Up COL4A1 16 0.005724 315884 0.316494 0.025 Up ITGAX 16 0.003956 195814 0.269178 0.025 Up HEYL 16 0.007673 481602 0.316238 0 Up SLA 16 0.00585 357650 0.318773 0.033333 Up MX1 16 0.007186 401100 0.319255 0.016667 Up PLK3 16 0.006652 279404 0.316238 0.008333 Up SDC1 16 0.009469 410180 0.319963 0.008333 Up TCIRG1 16 0.006859 359880 0.309602 0 Up CFH 15 0.00445 244882 0.295117 0.009524 Up ABI3 15 0.007402 731014 0.219889 0 Up SELL 15 0.007166 346972 0.316567 0.009524 Up ALOX5 15 0.007838 873370 0.267316 0 Up ACVRL1 15 0.008005 1719772 0.223235 0 Up MAP1S 15 0.005764 334716 0.309288 0 Up PLEKHO1 14 0.006138 280456 0.309288 0 Up MYLK 14 0.005342 544002 0.315693 0 Up EFEMP1 14 0.004205 276612 0.311995 0 Up COL4A2 14 0.002731 112746 0.270318 0.032967 Up CD40LG 14 0.005908 269538 0.318366 0.010989 Up FCER1G 13 0.005848 305260 0.31504 0 Up PALLD 13 0.005071 298560 0.308939 0 Up RARRES3 13 0.00331 406516 0.313493 0 Up RGS16 13 0.004116 729950 0.23737 0 Up SPHK1 13 0.004949 342988 0.320261 0.012821 Up CTLA4 13 0.002854 347870 0.271119 0 Up F13A1 13 0.003164 212990 0.272682 0.025641 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Up NLRP3 12 0.004585 826154 0.232582 0 Up PTGDS 12 0.004022 505956 0.231953 0 Up CD79A 12 0.004848 216848 0.317519 0.030303 Up CALML5 12 0.004267 221012 0.310162 0 Up FBLN2 12 0.00218 194722 0.23836 0.060606 Up TYROBP 12 0.006573 767160 0.228876 0 Up CXCR3 11 0.00241 88198 0.239944 0.018182 Up HLA-DQA1 11 0.003891 239548 0.310021 0 Up CCL3 11 5.10E-04 52576 0.236531 0.163636 Up PYCR2 11 0.00456 302658 0.3136 0 Up C1S 11 0.003338 264818 0.244085 0.072727 Up EMILIN1 11 0.005448 372612 0.223617 0 Up CCL4 10 8.16E-04 80812 0.247185 0.2 Up MMP7 10 0.003914 319190 0.213308 0 Up KRT7 10 0.004334 239098 0.312635 0 Up KLF2 10 0.004907 265400 0.312422 0 Up GZMK 10 0.001459 241170 0.244346 0 Up HLA-DRB5 10 0.001276 222656 0.313779 0.2 Up BST2 10 0.00352 149770 0.308905 0 Up IFITM1 10 0.002258 145372 0.315838 0.111111 Up FOXP1 10 0.003912 432154 0.254924 0 Up ACP5 10 0.005474 165884 0.312493 0.022222 Up C1QB 9 0.001965 127342 0.250685 0.111111 Up LAMC2 9 0.003181 154346 0.309183 0 Up CXCL9 9 0.00301 229902 0.263289 0 Up ARID5A 9 0.005318 173402 0.330842 0.027778 Up NUPR1 9 0.002524 298524 0.246585 0 Up CCL18 8 0.001778 235150 0.243998 0 Up PARP10 8 0.002967 169404 0.309079 0 Up CNN1 8 0.002758 130418 0.309253 0 Up CHI3L1 8 6.77E-04 76426 0.25 0 Up PLCB2 8 0.002583 109656 0.309288 0 Up INHBA 8 0.002491 346390 0.172124 0 Up ANGPT2 8 0.001319 89508 0.310197 0 Up ARL6IP4 8 0.002341 184198 0.310724 0 Up IL21R 8 0.001037 140942 0.244934 0 Up ASCL2 8 0.001824 174586 0.260119 0 Up IFI6 8 0.001077 201080 0.301572 0.178571 Up PLA2G4C 8 9.57E-04 110798 0.256737 0 Up CLDN3 8 0.004348 386516 0.317152 0 Up HOPX 8 0.00371 810748 0.221935 0 Up CD27 8 0.003403 725650 0.232286 0 Up CTSK 7 0.002827 418038 0.212072 0 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Up AQP1 7 0.002949 207146 0.21137 0 Up COL5A1 7 0.005883 223714 0.308592 0.047619 Up ADAMTS4 7 0.002492 142124 0.309288 0 Up RAPH1 7 0.002642 158114 0.3088 0 Up LST1 7 0.001581 36596 0.259603 0 Up VSIG4 7 0.001821 226500 0.243543 0 Up ARHGAP9 7 0.002225 279174 0.313815 0 Up XAF1 7 0.002586 312004 0.271253 0 Up OSM 7 0.003147 352934 0.236858 0 Up RSAD2 7 2.78E-04 34162 0.259186 0 Up SLAMF1 7 0.001708 53706 0.263922 0 Up TNFRSF4 7 0.001983 164224 0.21882 0 Up ITIH4 7 0.001022 122020 0.25509 0 Up HLA-DPA1 6 0.001024 54710 0.307073 0 Up HLA-DPB1 6 9.69E-04 111958 0.230608 0 Up HLA-DMB 6 0.003785 69950 0.265506 0.133333 Up LAT2 6 0.002505 169848 0.31097 0 Up IL10RA 6 0.001329 67330 0.307244 0 Up UBTD1 6 0.003009 101750 0.307073 0 Up LMCD1 6 0.0023 312490 0.23403 0 Up RGS1 6 0.002401 302054 0.22947 0 Up ADRA2A 6 0.002926 126184 0.212746 0 Up TYMP 6 0.002067 209918 0.312173 0 Up ADAP2 6 3.68E-04 36340 0.252554 0 Up C1R 6 9.13E-04 64610 0.248528 0.266667 Up SPARCL1 6 0.00209 117824 0.311041 0 Up TRIM69 6 0.001202 148848 0.232267 0 Up SLAMF7 5 0.002243 139618 0.2084 0 Up PCSK5 5 0.001951 113638 0.309148 0 Up CRIP1 5 0.002988 93620 0.307073 0 Up FCN1 5 0.00151 64158 0.201173 0 Up FCGRT 5 9.49E-04 119148 0.261458 0 Up TMEM176A 5 0.001809 192988 0.227642 0 Up COL5A2 5 0.003641 112224 0.236063 0.1 Up IFI27 5 2.46E-04 36552 0.314139 0.3 Up ADAM19 5 0.001837 81484 0.308038 0 Up LAIR1 5 0.001064 201568 0.314859 0 Up RASGRP2 5 0.00168 171754 0.312493 0 Up ANKRD13D 5 0.001988 282066 0.316457 0 Up TFEC 5 0.002391 253672 0.202794 0 Up OSBPL5 5 0.001471 182202 0.312493 0 Up GLIPR2 4 0.001552 87224 0.308453 0 Up VGLL1 4 0.002186 36318 0.173594 0 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Up COL16A1 4 1.74E-04 11634 0.266046 0 Up ARHGAP4 4 0.002186 66450 0.306935 0 Up CDH11 4 1.14E-04 9298 0.232345 0 Up ZBTB22 4 0.002186 128490 0.197084 0 Up SAG 4 0.001492 129474 0.210996 0 Up B3GALT4 4 0.002186 133788 0.213641 0 Up FAP 4 7.48E-04 102422 0.210947 0 Up MYO1F 4 5.58E-04 46160 0.307727 0 Up DOK3 4 1.51E-04 8916 0.2249 0 Up SAA1 4 0.001101 164528 0.229777 0 Up HLA-F 4 4.18E-04 68162 0.308488 0 Up ADAM8 4 0.001983 39306 0.186514 0 Up HCST 4 9.06E-04 82848 0.311217 0 Up OAS2 4 9.28E-04 194354 0.314607 0 Up FCGR3A 4 0.001544 184974 0.227907 0 Up CYP1B1 4 5.56E-04 70438 0.308488 0 Up COL12A1 4 0.001193 72386 0.307485 0 Up FMNL3 4 0.001288 174096 0.312422 0 Up FPR1 4 7.79E-04 53162 0.239986 0 Up GZMH 4 5.50E-05 4868 0.210139 0 Up H2AFJ 3 1.16E-04 19544 0.307073 0 Up ZGPAT 3 3.84E-05 3118 0.229355 0 Up RASAL3 3 1.12E-04 19378 0.237494 0 Up NCCRP1 3 1.57E-04 45650 0.308384 0 Up PLA2G7 3 3.16E-04 70568 0.31228 0 Up COL10A1 3 0.001457 166646 0.203199 0 Up ZFP36L2 3 9.25E-05 15144 0.307451 0 Up SLC2A5 3 2.76E-05 1624 0.241061 0.333333 Up CTSH 3 3.51E-04 16788 0.306866 0 Up TNRC18 3 1.79E-04 47338 0.30887 0 Up CCDC80 3 1.95E-05 2102 0.216866 0 Up MGP 3 7.32E-04 41846 0.207737 0 Up OASL 3 8.88E-04 34710 0.306866 0 Up CFD 3 7.62E-04 32594 0.307313 0 Up MRVI1 3 7.40E-04 53206 0.201468 0 Up LIMS2 3 7.78E-04 98670 0.228267 0 Up PTGDR 3 0.001457 181566 0.22719 0 Up FOXS1 3 7.53E-04 101218 0.22719 0 Up IL18RAP 3 7.60E-04 102434 0.232306 0 Up CCDC107 3 2.43E-04 15402 0.24236 0 Up TSPO 3 9.03E-04 45462 0.307451 0 Up CCR7 3 7.29E-04 18830 0.246607 0.333333 Up DERL3 3 1 6 1 0 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Up IGFLR1 3 1 6 1 0 Up MRC2 2 7.29E-04 22152 0.306798 0 Up RNPEPL1 2 2.21E-04 49220 0.308349 0 Up ZNF418 2 6.13E-04 75602 0.308211 0 Up IFI44 2 1.96E-04 30040 0.307348 0 Up LILRB4 2 1.14E-06 194 0.211126 0 Up ANKRD35 2 1.01E-05 1834 0.237967 0 Up ERICH1 2 9.17E-05 23458 0.307692 0 Up EGFLAM 2 1.09E-04 10200 0.306798 0 Up PRSS8 2 7.29E-04 40016 0.217243 0 Up CHIT1 2 2.68E-05 1942 0.210526 0 Up NBL1 2 9.17E-05 6794 0.222402 0 Up HLA-DOB 2 3.24E-06 238 0.202092 0 Up EMILIN2 2 3.05E-05 472 0.20403 0 Up EGFL6 2 1.44E-05 848 0.202749 0 Up TFEB 2 4.31E-05 4334 0.230569 0 Up CYTH4 2 7.29E-04 22152 0.306798 0 Up SIRPG 2 7.29E-04 22152 0.306798 0 Up STAC2 2 7.81E-06 490 0.205343 0 Up CCDC88B 2 7.29E-04 22450 0.16043 0 Up MS4A7 2 7.29E-04 20644 0.192413 0 Up SOX17 2 6.16E-05 6626 0.233532 0 Up CDH7 2 7.29E-04 48342 0.207643 0 Up EMCN 2 1.77E-05 356 0.241954 0 Up RNASE1 2 4.75E-05 2714 0.224018 0 Up SUSD2 2 7.29E-04 108014 0.211777 0 Up IL3RA 2 7.29E-04 101316 0.215199 0 Up CXCL14 2 4.30E-05 1800 0.229643 0 Up SULF1 2 3.47E-05 5820 0.230356 0 Up GIMAP4 2 4.39E-04 130270 0.31228 0 Up CLDN4 2 9.08E-06 508 0.200175 0 Up FAT3 2 7.29E-04 35266 0.212236 0 Up S1PR4 2 7.29E-04 185770 0.158677 0 Up RAMP1 2 1 2 1 0 Up MARCO 2 1 2 1 0 Up ICOS 2 1 2 1 0 Up CLEC11A 1 0 0 0.306729 0 Up CPNE5 1 0 0 0.306729 0 Up SMOC2 1 0 0 0.21217 0 Up GIMAP1 1 0 0 0.306729 0 Up ADCY4 1 0 0 0.306729 0 Up SLC15A3 1 0 0 0.164696 0 Up PLXDC1 1 0 0 0.306729 0 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Up WDFY4 1 0 0 0.306729 0 Up MEI1 1 0 0 0.195762 0 Up CMPK2 1 0 0 0.306729 0 Up SIGLEC14 1 0 0 0.186261 0 Up DPT 1 0 0 0.222366 0 Up FMOD 1 0 0 0.181818 0 Up ARHGAP25 1 0 0 0.306729 0 Up CAPG 1 0 0 0.306729 0 Up CD52 1 0 0 0.228781 0 Up HLA-DOA 1 0 0 0.306729 0 Up CILP 1 0 0 0.181818 0 Up SLIT3 1 0 0 0.196393 0 Up CD163 1 0 0 0.200864 0 Up AEBP1 1 0 0 0.222709 0 Up RTP4 1 0 0 0.208447 0 Up TMEM176B 1 0 0 0.223708 0 Up ZNF524 1 0 0 0.2047 0 Up TBC1D10C 1 0 0 0.227115 0 Up GIMAP6 1 0 0 0.227115 0 Up GNLY 1 0 0 0.227115 0 Down MYC 713 0.205435 87315356 0.42433 0.002565 Down HSP90AB1 563 0.150517 90042474 0.396225 0.003654 Down BRCA1 403 0.097657 34462280 0.40416 0.00537 Down EEF1A1 283 0.050657 28627038 0.37761 0.015488 Down HNRNPA1 237 0.04436 23745104 0.378339 0.00708 Down PCNA 228 0.039118 25588738 0.362138 0.006994 Down NPM1 203 0.029258 23118776 0.364496 0.008974 Down GAPDH 183 0.03126 13310882 0.386265 0.02462 Down TUBB 173 0.0226 13312300 0.383805 0.019089 Down RPS2 156 0.010184 6684826 0.367143 0.079239 Down ALB 153 0.043375 14319068 0.347267 0.003612 Down RPSA 152 0.017762 6529218 0.386709 0.07642 Down NEDD4L 147 0.035604 15156786 0.340774 2.80E-04 Down CDK1 146 0.020478 10576650 0.359453 0.014077 Down RPL6 144 0.01277 6222386 0.384559 0.092852 Down RBBP4 141 0.022261 13515558 0.35396 0.004965 Down RPL23A 140 0.007195 5887530 0.353826 0.085098 Down SNCA 140 0.029059 10160206 0.355216 0.005755 Down RPL4 136 0.006183 5067606 0.355512 0.093682 Down TUBA1A 133 0.015507 8639510 0.365403 0.016632 Down RPL7 129 0.005207 4435368 0.360279 0.098595 Down C1QBP 128 0.025126 11254578 0.364553 0.006029 Down KPNA2 127 0.024291 8493838 0.383868 0.012123 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Down PRMT5 126 0.017703 13494440 0.341417 8.89E-04 Down RPLP0 124 0.006228 5001824 0.360334 0.095463 Down UBB 123 0.0168 9698826 0.368495 0.007464 Down EEF1G 122 0.021689 9177548 0.3689 0.011245 Down RPL7A 116 0.005444 3815738 0.364807 0.117091 Down RPL3 112 0.008048 4666876 0.374572 0.094916 Down CCT2 111 0.011227 6217422 0.374214 0.044717 Down RPL15 110 0.002252 2856172 0.351289 0.13161 Down RPS10 109 0.007854 6158830 0.346168 0.033639 Down SKP2 105 0.01603 5513256 0.380482 0.022711 Down PSMA5 100 0.011632 6978802 0.359948 0.024646 Down SLC25A5 98 0.004847 4657438 0.346551 0.072586 Down CCNB1 98 0.011903 3857234 0.374006 0.042499 Down ENO1 96 0.0154 5859714 0.385853 0.036842 Down MYB 92 0.018296 4267036 0.360003 0.010511 Down UBE2E3 90 0.019166 4652570 0.358986 0.007241 Down DDX21 90 0.007728 4881518 0.348891 0.026217 Down CDC20 89 0.012468 4329128 0.343688 0.028345 Down CCT4 89 0.00519 4277996 0.360666 0.052094 Down KRT18 89 0.013561 8188838 0.34179 0.002554 Down TRIM63 88 0.017034 4536234 0.340799 0.00627 Down PRDX1 88 0.012588 6795082 0.362669 0.015152 Down CCT8 85 0.004891 4403926 0.358931 0.054342 Down EIF3E 85 0.01015 3943706 0.36365 0.028291 Down MCM2 84 0.011649 5324180 0.351999 0.012622 Down PSMD6 84 0.006594 3711384 0.337061 0.022662 Down RBMX 83 0.009945 5139612 0.350086 0.021746 Down APOA1 83 0.019519 4233830 0.333807 0.016456 Down CCT6A 80 0.005059 3370390 0.360472 0.062025 Down EIF3I 79 0.00966 4532448 0.355351 0.011035 Down VTN 78 0.013278 4330074 0.326732 0.001665 Down CSE1L 78 0.00907 4428662 0.358712 0.018648 Down PHB2 77 0.011294 5386698 0.351814 0.007177 Down CCNA2 77 0.005002 2685430 0.355835 0.053999 Down PSMB5 77 0.009234 3457918 0.370499 0.042379 Down DNMT3B 75 0.01232 3955286 0.35428 0.011892 Down MAVS 74 0.01191 4009030 0.336819 0.001111 Down SLC25A3 71 0.012487 4850904 0.35372 0.005634 Down TUBA1B 69 0.005616 3262686 0.345608 0.036658 Down IARS 68 0.004923 3192328 0.342462 0.035119 Down LDHA 66 0.005682 3384634 0.355916 0.041492 Down POU5F1 63 0.009683 2709306 0.351867 0.011265 Down SOX2 63 0.011281 2027862 0.334519 0.016385 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Down NR0B2 60 0.007839 3384446 0.342886 0.001695 Down CAPNS1 59 0.008438 3550596 0.341145 0.009351 Down LDHB 59 0.003764 3344120 0.33545 0.021625 Down IGF2BP3 57 0.007333 2298220 0.360003 0.039474 Down HIST1H1C 55 0.004697 3059682 0.338419 0.016162 Down PAICS 55 0.006134 3579222 0.333901 0.002694 Down BUB1B 53 0.007217 1568390 0.340281 0.032656 Down PDIA6 52 0.006665 4090230 0.337812 0.010558 Down MBP 51 0.005193 1684416 0.327415 0.001569 Down MET 51 0.010548 3284818 0.333192 0 Down TTR 49 0.008087 1488760 0.334448 0.010204 Down TNNT1 49 0.010948 1536610 0.350425 0.008503 Down EEF1A2 48 0.002097 1982718 0.332932 0 Down ABCC2 48 0.010493 1568726 0.341269 0.005319 Down PGK1 47 0.004818 1903066 0.356969 0.07123 Down TRIM37 46 0.007518 1753190 0.348632 0.007729 Down FHL1 45 0.006795 2104596 0.33533 0.00404 Down TFRC 45 0.006068 3188390 0.333475 0 Down RHOXF2 43 0.011517 1750118 0.274457 0 Down APOB 43 0.006945 2271724 0.33786 0.009967 Down PFKP 42 0.003266 1640188 0.339544 0.00813 Down ENO2 42 0.0052 2675544 0.332956 0.003484 Down H2AFZ 42 0.005388 1884076 0.329757 0.001161 Down TKT 41 0.003583 1462950 0.353401 0.028049 Down MAGEA6 40 0.005724 1721840 0.329687 0 Down GATA3 40 0.008796 1432218 0.349669 0.014103 Down ACAT1 40 0.004855 2293968 0.332086 0.00641 Down TYMS 40 0.007021 1967804 0.337279 0.007692 Down PGD 38 0.00319 1432784 0.331454 0.036984 Down TPI1 37 0.003586 1296678 0.345862 0.09009 Down IMPDH2 36 0.002276 1522866 0.335426 0.01746 Down FGFR3 36 0.007363 1436054 0.317103 0.007937 Down PTTG1 36 0.002181 635618 0.337545 0.053968 Down ASF1B 36 0.004296 935530 0.336001 0.02381 Down RFC5 35 0.003115 1013766 0.36147 0.055462 Down PLA2G4A 35 0.003901 1353946 0.331664 0 Down GNAS 33 0.006431 1316640 0.330964 0.007576 Down TRIB3 33 0.00524 1451550 0.340084 0.011364 Down CDC45 33 0.002712 1142452 0.338468 0.034091 Down BMX 33 0.004466 1042152 0.34915 0.017045 Down SERPINA1 32 0.005464 1480486 0.334305 0 Down TPX2 32 0.003838 1028888 0.344545 0.016129 Down RANBP1 31 0.002458 1306090 0.332979 0 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Down KIF23 28 0.002728 1417572 0.327825 0 Down ID1 27 0.003239 771330 0.332438 0.008547 Down OLA1 27 0.003068 727676 0.338956 0.031339 Down SEC23B 26 0.004471 1519614 0.329872 0 Down IGF2BP2 26 0.001427 660150 0.355324 0.058462 Down ENO3 25 0.002857 559136 0.343262 0.066667 Down IGFBP3 25 0.002823 1764080 0.31355 0.003333 Down F2 24 0.004813 1568314 0.291651 0.043478 Down NFE2 24 0.003738 2099820 0.285091 0 Down GMNN 24 0.002113 741708 0.332508 0.028986 Down PSAT1 24 0.003089 738494 0.3484 0.021739 Down EGLN1 23 0.003385 798698 0.328146 0 Down PGM1 23 0.00253 753590 0.333357 0.007905 Down CD55 22 0.004056 696952 0.33129 0 Down FOXA2 21 0.004992 872700 0.281405 0.019048 Down PBK 21 0.00267 546972 0.354386 0.047619 Down AJUBA 21 0.001964 617438 0.335833 0.02381 Down HP 20 0.001845 455036 0.314221 0.031579 Down TFF1 20 0.002374 1520442 0.305285 0 Down BEGAIN 20 0.004469 651432 0.330452 0 Down GDA 20 0.00349 588498 0.329826 0.036842 Down MAD2L1BP 19 0.002165 392308 0.339912 0.052632 Down KIF11 19 0.001601 423324 0.333475 0.011696 Down HBG1 19 0.00152 803574 0.311845 0 Down CPS1 19 0.001046 359790 0.348013 0.05848 Down ITGB7 19 0.004777 992014 0.329226 0 Down AMBP 18 0.003475 642842 0.320956 0.045752 Down MRPL10 18 0.003042 444244 0.334162 0.03268 Down CGA 18 0.003848 592198 0.306479 0.006536 Down AFP 18 0.001988 422106 0.2893 0 Down IGFBP1 18 0.001208 551500 0.288927 0.006536 Down CENPO 18 0.002863 489612 0.350922 0.091503 Down CENPH 17 0.001891 359996 0.330777 0.095588 Down CDCA5 17 0.001718 456258 0.330801 0 Down PGAM1 17 0.00118 280570 0.342487 0.080882 Down IGF2 17 0.003588 782808 0.275486 0.014706 Down AKR1B1 17 0.001528 523568 0.331664 0 Down FDFT1 17 0.002414 651582 0.330243 0 Down HBG2 17 0.001113 334894 0.320671 0.066176 Down HMMR 17 0.00107 246928 0.340379 0.058824 Down AHSG 17 0.002005 497564 0.313258 0.022059 Down APOA2 16 5.79E-04 137538 0.29176 0.1 Down APOH 15 0.00198 1212586 0.297576 0 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Down KIF2C 15 0.001078 393602 0.331617 0.009524 Down RNF43 15 0.001084 220414 0.334495 0.047619 Down ALDOC 15 0.001343 400682 0.329387 0.009524 Down APOC3 14 0.001271 431288 0.33803 0.087912 Down CPNE1 14 0.001438 530794 0.329549 0 Down HMGA2 14 0.001654 271978 0.334757 0.032967 Down ASGR1 14 9.33E-04 506086 0.294852 0 Down DPPA4 14 9.72E-04 483504 0.281321 0 Down AGR2 14 0.002379 249434 0.30724 0 Down PEG10 14 0.001408 303552 0.327323 0 Down ADA 14 0.002493 415608 0.332414 0.032967 Down CENPN 13 0.001246 216110 0.32918 0.179487 Down BNIP3 13 0.002082 358706 0.327917 0 Down PIR 13 0.0018 907788 0.277077 0 Down PRIM1 13 3.21E-04 124150 0.327437 0 Down HBZ 13 0.001144 489382 0.315211 0 Down COX4I1 13 0.002122 373360 0.330847 0 Down TFPI 13 9.35E-04 374928 0.288697 0 Down FGG 13 0.001136 470062 0.282114 0.038462 Down FST 13 0.002668 735238 0.272738 0 Down LAMA1 13 0.002341 300044 0.328375 0 Down COASY 13 0.00221 434498 0.333664 0.038462 Down QPCT 12 1.58E-05 41260 0.327711 0 Down CTNNAL1 12 0.002284 342522 0.328077 0 Down STAR 12 0.001173 546324 0.287338 0 Down NCAM1 12 6.47E-04 190710 0.334257 0.030303 Down CCNB2 12 2.10E-04 97062 0.334424 0.151515 Down HLF 12 0.001817 256830 0.288572 0 Down PTP4A1 12 0.002403 431426 0.3315 0 Down GSTM3 12 3.03E-04 186268 0.328123 0 Down ASGR2 12 4.32E-04 277066 0.270432 0 Down CTNND2 12 0.001233 215538 0.331547 0 Down CARHSP1 12 7.10E-04 191384 0.327757 0 Down INA 11 1.07E-04 136268 0.328558 0 Down ESPL1 11 0.001031 164318 0.3315 0.090909 Down KIF4A 11 9.35E-04 224848 0.332273 0.036364 Down SPC25 11 0.001423 244986 0.327734 0 Down REPIN1 11 2.04E-04 68744 0.302516 0.054545 Down TCF7 11 0.001496 290812 0.327643 0 Down AGMAT 10 0.001337 920392 0.276052 0 Down BAMBI 10 0.001928 278690 0.326914 0 Down AGT 10 6.54E-04 346990 0.294778 0 Down ANG 10 0.001664 579520 0.291995 0 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Down TBC1D7 10 8.03E-04 167126 0.334662 0.022222 Down ACY1 10 3.04E-04 182552 0.338225 0.044444 Down OIP5 10 0.001463 256898 0.326619 0 Down TAC3 10 0.001551 205706 0.327232 0 Down PTX3 10 0.002565 1004098 0.227512 0 Down C4BPA 9 0.001339 472358 0.266327 0 Down ORM1 9 0.00101 549272 0.270634 0 Down RMI2 9 0.002581 293792 0.327096 0 Down SERPINC1 9 9.68E-04 241966 0.289158 0.111111 Down AKR1C3 9 4.82E-04 211076 0.330684 0 Down PPP1R3C 9 5.97E-04 244542 0.332744 0 Down SAAL1 9 0.001925 225340 0.327118 0 Down MAGEC1 9 0.001886 221860 0.327688 0.027778 Down MAL 9 1.21E-04 32686 0.277045 0 Down CELSR2 8 6.27E-04 152870 0.327141 0 Down DLX2 8 0.00179 236210 0.326959 0 Down FZD5 8 9.48E-04 155326 0.326505 0 Down CCDC136 8 4.60E-04 192812 0.263167 0 Down IL23A 8 0.001304 477832 0.260167 0 Down HGD 8 7.64E-04 393294 0.278522 0 Down ALAS2 8 5.41E-04 228948 0.278258 0 Down TYRP1 8 0.001307 605734 0.270339 0 Down NPTX1 8 0.001488 278684 0.327073 0 Down DLGAP5 8 5.16E-04 103456 0.335139 0.142857 Down GNG4 7 0.00132 384244 0.258849 0 Down RBP4 7 1.27E-04 36580 0.295389 0 Down TRIM7 7 4.98E-04 91946 0.308814 0.047619 Down EPHB6 7 5.70E-04 124884 0.303668 0.047619 Down CCNB1IP1 7 4.58E-04 83072 0.335258 0.238095 Down AREG 7 0.001309 192106 0.330104 0 Down FOXRED2 7 5.95E-04 132040 0.326528 0 Down FOLR1 7 5.33E-04 101898 0.328146 0.095238 Down SPAG5 7 9.69E-04 105098 0.332179 0.047619 Down VIL1 6 4.50E-04 233426 0.274297 0 Down MIPEP 6 1.47E-04 64910 0.326664 0 Down MST1 6 8.72E-04 564148 0.261179 0 Down SOX3 6 2.61E-05 23258 0.292486 0 Down TESC 6 0.001863 181202 0.32655 0 Down NANOG 6 0.003614 321302 0.328513 0 Down TMEM147 6 0.001022 145542 0.326369 0 Down ORM2 5 4.70E-04 298836 0.258735 0 Down GABRB1 5 8.64E-04 130460 0.326482 0 Down GFRA1 5 8.53E-04 697882 0.244616 0 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Down EPS8L3 5 8.87E-04 307116 0.254162 0 Down TYR 5 2.18E-04 103128 0.3268 0 Down RNF182 5 4.70E-04 84816 0.326936 0 Down MLANA 5 5.45E-04 118846 0.326914 0 Down SLC7A5 5 8.06E-05 59374 0.327825 0 Down HIC2 5 4.48E-04 177072 0.280599 0 Down LHX2 5 8.66E-04 103008 0.236365 0 Down PTPRH 4 4.46E-04 238256 0.262535 0 Down RAD54L 4 8.58E-04 93666 0.326165 0 Down PLP1 4 4.52E-04 105346 0.248902 0 Down GPC3 4 2.27E-04 90714 0.32826 0 Down APOM 4 4.43E-04 365960 0.252714 0 Down TNFSF9 4 4.35E-04 55354 0.326165 0 Down CX3CR1 4 8.51E-04 696212 0.22759 0 Down FABP1 4 2.03E-04 38604 0.256282 0 Down MAT1A 4 5.34E-04 74956 0.326165 0 Down ABCG5 4 1.07E-04 78982 0.259765 0 Down CDH18 4 4.91E-04 88100 0.326392 0 Down TFPI2 4 1.62E-05 6890 0.254575 0 Down TMEM97 4 4.65E-05 62730 0.330173 0 Down DPCD 4 2.98E-05 30284 0.330173 0 Down F11 4 6.78E-05 20816 0.25463 0 Down KCNQ2 4 4.36E-04 124824 0.257714 0 Down CARD10 4 8.52E-04 100582 0.326324 0 Down NAA40 3 4.79E-04 56384 0.32612 0 Down AKR1C1 3 4.27E-04 194386 0.296937 0 Down XK 3 4.26E-04 291070 0.274169 0 Down NDUFC2 3 4.36E-04 66938 0.3268 0 Down TMEM45B 3 8.51E-04 629030 0.208459 0 Down KDM5D 3 3.94E-05 21036 0.32612 0 Down NMU 3 8.51E-04 108454 0.199635 0 Down AKR1B10 3 1.77E-05 13768 0.264098 0 Down BEX1 3 4.29E-04 48934 0.32612 0 Down MOCOS 3 2.35E-04 96724 0.333688 0.333333 Down ITIH2 3 4.28E-04 256524 0.240807 0 Down FADS1 3 5.00E-04 63558 0.32612 0 Down KRT80 3 9.19E-06 14894 0.328375 0 Down RAB34 3 4.33E-04 51810 0.326505 0 Down FAM57A 3 6.22E-05 25536 0.32612 0 Down CSAG1 3 2.16E-05 10552 0.274746 0 Down SERPIND1 3 4.86E-05 24834 0.273547 0.333333 Down PMEL 3 2.91E-05 11556 0.250413 0 Down DCT 3 9.41E-06 4328 0.242109 0 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Down FGL1 3 4.30E-04 429502 0.234222 0 Down ADSSL1 3 5.63E-05 10700 0.274505 0 Down GDF6 3 3.75E-05 7180 0.247578 0 Down C8A 3 1 6 1 0 Down OGDHL 2 8.69E-06 10524 0.326959 0 Down AJAP1 2 3.70E-07 498 0.267585 0 Down PHACTR1 2 1.50E-06 1436 0.255335 0 Down CAMK2N1 2 1.67E-06 1268 0.26021 0 Down SH2D5 2 7.10E-07 384 0.264961 0 Down LIN28B 2 3.66E-06 3450 0.261994 0 Down PPP1R26 2 4.25E-04 274936 0.245164 0 Down HYAL1 2 4.25E-04 41178 0.326075 0 Down ITIH3 2 4.70E-06 6466 0.267691 0 Down HCCS 2 1.05E-05 19668 0.326755 0 Down SULT1A2 2 0 0 0.34627 1 Down CD8B 2 4.08E-06 2652 0.257616 0 Down HPR 2 1.33E-06 218 0.20844 0 Down BCAS1 2 7.50E-07 916 0.251041 0 Down LONRF2 2 4.25E-04 41178 0.326075 0 Down FAM178B 2 3.49E-06 1036 0.224546 0 Down CYP2F1 2 1.09E-06 670 0.26559 0 Down GLP2R 2 9.00E-06 6666 0.326324 0 Down RPS4Y1 2 9.00E-06 6666 0.326324 0 Down DLK1 2 4.25E-04 234974 0.205894 0 Down KISS1R 2 4.25E-04 315046 0.231022 0 Down FADS2 2 4.25E-04 41178 0.326075 0 Down KLK1 2 7.31E-06 1102 0.21277 0 Down DCDC2 2 6.64E-06 1740 0.272185 0 Down PTTG2 2 2.46E-05 7724 0.269332 0 Down GREB1 2 3.97E-06 3266 0.283219 0 Down GDF11 2 1 2 1 0 Down SPCS1 1 0 0 0.32603 0 Down FZD10 1 0 0 0.246552 0 Down ELOVL2 1 0 0 0.279349 0 Down ST6GALNAC1 1 0 0 0.32603 0 Down SPANXB1 1 0 0 0.283629 0 Down WDR54 1 0 0 0.32603 0 Down SEC22C 1 0 0 0.32603 0 Down CAMK2N2 1 0 0 0.231045 0 Down GTSF1 1 0 0 0.32603 0 Down RPS4Y2 1 0 0 0.32603 0 Down RIMKLA 1 0 0 0.32603 0 Down ABCA12 1 0 0 0.32603 0 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Down SP5 1 0 0 0.218099 0 Down FAM72A 1 0 0 0.32603 0 Down L1TD1 1 0 0 0.197854 0 Down SAPCD1 1 0 0 0.231045 0 Down MNX1 1 0 0 0.261964 0 Down GAL 1 0 0 0.257432 0 Down BMP5 1 0 0 0.248783 0 Down UTS2 1 0 0 0.282335 0 Down ZIC3 1 0 0 0.20046 0 Down ITM2A 1 0 0 0.32603 0 Down ONECUT2 1 0 0 0.234362 0 Down ACSM3 1 0 0 0.235241 0 Down UGT2B10 1 0 0 0.229724 0 Down TRIML2 1 0 0 0.283629 0 Down ERI2 1 0 0 0.248783 0 Down SLC7A2 1 0 0 0.32603 0

Table 8 miRNA - target gene interaction table

Regulation Target Genes Degree MicroRNA Regulation Target Genes Degree MicroRNA Up CCDC80 135 hsa-mir-6499-3p Down PEG10 139 hsa-mir-4443 Up MYO1F 104 hsa-mir-6882-3p Down HNRNPA1 139 hsa-mir-6504-5p Up Down hsa-mir-548aq- CDH7 88 hsa-mir-7845-5p PTP4A1 132 5p Up KLF2 85 hsa-mir-548as-3p Down SLC7A5 130 hsa-mir-4434 Up FPR1 85 hsa-mir-4722-3p Down MYC 103 hsa-mir-6507-3p Up HEYL 83 hsa-mir-4763-3p Down HIC2 103 hsa-mir-4712-5p Up ADAMTS4 72 hsa-mir-6780a-5p Down PRIM1 98 hsa-mir-4252 Up SIGLEC14 68 hsa-mir-3121-5p Down MAVS 85 hsa-mir-6733-5p Up FMNL3 68 hsa-mir-548bb-3p Down RBBP4 84 hsa-mir-3122 Up FOXP1 57 hsa-mir-4480 Down KPNA2 83 hsa-mir-548v Up EMCN 54 hsa-mir-8055 Down PSAT1 78 hsa-mir-4465 Up RAPH1 53 hsa-mir-208a-5p Down BAMBI 76 hsa-mir-5692a Up CCL5 48 hsa-mir-5589-5p Down CENPN 75 hsa-mir-6840-3p Up STAT2 47 hsa-mir-4266 Down AGMAT 74 hsa-mir-4517 Up HMOX1 47 hsa-mir-3135b Down CD55 71 hsa-mir-4776-3p Up hsa-mir-4520-2- Down CMKLR1 45 3p CCNB1 71 hsa-mir-3160-3p Up STAC2 45 hsa-mir-6821-3p Down TRIM37 71 hsa-mir-5702 Up HLA-B 44 hsa-mir-6895-3p Down FOLR1 70 hsa-mir-4632-5p Up FAT3 44 hsa-mir-7977 Down LONRF2 70 hsa-mir-2114-3p Up SPRY1 42 hsa-mir-4477b Down KIF2C 69 hsa-mir-4739 Up COL4A1 41 hsa-mir-5682 Down HMGA2 69 hsa-mir-4257 Up RNF144B 41 hsa-mir-4700-5p Down NPTX1 69 hsa-mir-4719 Up CD300E 40 hsa-mir-6873-3p Down FOXRED2 69 hsa-mir-6506-5p Up NFAM1 40 hsa-mir-4251 Down GNAS 68 hsa-mir-888-3p Up INHBA 40 hsa-mir-548am-5p Down MANEAL 68 hsa-mir-6890-5p Up SLC2A5 38 hsa-mir-1827 Down TFRC 67 hsa-mir-6079 Up TMEM119 37 hsa-mir-6750-5p Down PSMB5 66 hsa-mir-5193 Up ASCL2 37 hsa-mir-4441 Down GLP2R 65 hsa-mir-5692a Up IL21R 37 hsa-mir-6810-5p Down PHB2 65 hsa-mir-4270 Up GIMAP4 37 hsa-mir-5692c Down TM4SF5 63 hsa-mir-4668-5p Up CYP1B1 36 hsa-mir-4314 Down SPC25 63 hsa-mir-548ar-5p Up TSC22D3 35 hsa-mir-3924 Down EEF1A1 62 hsa-mir-7150 Up KCTD12 35 hsa-mir-4659b-3p Down GABRB1 61 hsa-mir-4438 Up SAMD9L 34 hsa-mir-2110 Down FADS1 60 hsa-mir-6087 Up CCR5 33 hsa-mir-6800-3p Down KIF23 60 hsa-mir-6874-3p bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Up ZBTB22 33 hsa-mir-4268 Down PGK1 60 hsa-mir-4744 Up GBP4 33 hsa-mir-1976 Down CSE1L 60 hsa-mir-548k Up PLEKHO1 33 hsa-mir-5692a Down AJAP1 60 hsa-mir-4313 Up PDE4DIP 33 hsa-mir-5193 Down LIN28B 59 hsa-mir-3133 Up ZFP36L2 32 hsa-mir-2355-5p Down TFPI 59 hsa-mir-4701-3p Up UBD 31 hsa-mir-582-5p Down PAICS 58 hsa-mir-6086 Up EMILIN2 31 hsa-mir-302f Down CPS1 57 hsa-mir-4255 Up VWA1 30 hsa-mir-3158-5p Down TNFSF9 55 hsa-mir-4780 Up CD40LG 30 hsa-mir-4499 Down SEC23B 54 hsa-mir-4430 Up MYLK 30 hsa-mir-4691-3p Down GDF11 52 hsa-mir-3926 Up Down hsa-mir-548ap- HLA-DOA 29 hsa-mir-6809-3p CDK1 52 3p Up MRVI1 29 hsa-mir-6770-5p Down CARHSP1 51 hsa-mir-588 Up ARL6IP4 29 hsa-mir-1909-3p Down PLCXD1 51 hsa-mir-6516-5p Up CPNE5 29 hsa-mir-4271 Down OLA1 51 hsa-mir-548ax Up COL5A1 29 hsa-mir-6799-5p Down KRT80 50 hsa-mir-4441 Up COL12A1 29 hsa-mir-548g-5p Down IGF2BP3 49 hsa-mir-7162-3p Up TAGLN 28 hsa-mir-3714 Down PDIA6 49 hsa-mir-548z Up CD4 27 hsa-mir-3916 Down BEND4 47 hsa-mir-4777-5p Up STARD3 26 hsa-mir-4419a Down FZD5 47 hsa-mir-3611 Up VAMP8 26 hsa-mir-4768-5p Down F2 46 hsa-mir-4674 Up SAA1 24 hsa-mir-4701-3p Down GNG4 46 hsa-mir-6779-5p Up PALLD 24 hsa-mir-6869-5p Down IGF2 45 hsa-mir-4429 Up FBLN2 24 hsa-mir-548aa Down SLC7A2 45 hsa-mir-1206 Up SMOC2 23 hsa-mir-5002-3p Down ANG 44 hsa-mir-4534 Up POPDC2 23 hsa-mir-5689 Down LDHA 43 hsa-mir-4670-3p Up LAT2 22 hsa-mir-660-3p Down MAT1A 43 hsa-mir-4510 Up LAIR1 22 hsa-mir-6778-3p Down OIP5 42 hsa-mir-6080 Up CTSB 22 hsa-mir-4310 Down APOH 42 hsa-mir-6791-3p Up IL7R 22 hsa-mir-6842-3p Down UBB 42 hsa-mir-3187-5p Up SOX17 21 hsa-mir-6828-5p Down DDX21 40 hsa-mir-548at-5p Up THY1 21 hsa-mir-6729-5p Down TUBA1B 40 hsa-mir-140-3p Up MEI1 20 hsa-mir-4436b-5p Down ASGR2 40 hsa-mir-5695 Up ADAM19 20 hsa-mir-4469 Down REPIN1 40 hsa-mir-3665 Up PLXDC1 20 hsa-mir-4524a-3p Down SPCS1 40 hsa-mir-520e Up Down hsa-mir-6769b- MFAP5 20 hsa-mir-5011-5p CAMK2N1 40 3p Up HLA-DRB5 20 hsa-mir-4434 Down TRIB3 39 hsa-mir-4516 Up FAM167B 20 hsa-mir-7111-3p Down CCT4 38 hsa-mir-208a-5p Up SLAMF1 20 hsa-mir-3620-3p Down PFKP 37 hsa-mir-5590-3p Up IFI44L 19 hsa-mir-1248 Down NPM1 37 hsa-mir-3173-3p Up OAS2 19 hsa-mir-4531 Down APOC3 37 hsa-mir-5699-3p Up IFITM1 19 hsa-mir-548av-3p Down CCNA2 36 hsa-mir-548aj-5p Up Down hsa-mir-548az- IFIT1 19 hsa-mir-6868-3p RPLP0 36 3p Up PLA2G7 18 hsa-mir-7702 Down RAB34 35 hsa-mir-301a-3p Up HLA-DRB1 18 hsa-mir-6124 Down PLA2G4A 35 hsa-mir-4478 Up ZSWIM4 17 hsa-mir-5197-3p Down ESPL1 34 hsa-mir-4458 Up GREM1 17 hsa-mir-4666a-3p Down TUBB 34 hsa-mir-1180-3p Up EGFLAM 16 hsa-mir-1233-5p Down AKR1B10 34 hsa-mir-1244 Up RTP4 16 hsa-mir-892c-3p Down GREB1 34 hsa-mir-7977 Up HOPX 15 hsa-mir-8069 Down COASY 32 hsa-mir-4422 Up SDC1 15 hsa-mir-6732-3p Down SERPINC1 32 hsa-mir-7974 Up SP100 15 hsa-mir-3606-5p Down SEC22C 32 hsa-mir-8070 Up Down hsa-mir-1273g- CPXM2 14 hsa-mir-6877-3p TMEM145 32 3p Up HLA-DRA 14 hsa-mir-4496 Down CARD10 31 hsa-mir-4481 Up GPIHBP1 13 hsa-mir-8071 Down GFRA1 31 hsa-mir-6760-5p Up ACVRL1 13 hsa-mir-6724-5p Down MET 30 hsa-mir-449b-5p Up LAMA4 13 hsa-mir-6854-5p Down NEDD4L 30 hsa-mir-665 Up RGS16 13 hsa-mir-548aw Down HSP90AB1 30 hsa-mir-4489 Up Down hsa-mir-6780a- COL1A1 12 hsa-mir-4800-5p TYRP1 30 3p Up ADAP2 12 hsa-mir-3199 Down NAA40 29 hsa-mir-1972 Up COL4A2 12 hsa-mir-147b Down TPI1 29 sa-mir-1266-3p Up HLA-C 12 hsa-mir-3672 Down CCT6A 29 hsa-mir-5100 Up NBL1 12 hsa-mir-4270 Down C8A 29 hsa-mir-4539 Up Down hsa-mir-1185-2- JAK3 11 hsa-mir-1273g-3p DLX2 29 3p Up GIMAP1 10 hsa-mir-3689e Down RPL4 27 hsa-mir-7151-3p bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Up OSBPL5 9 hsa-mir-1539 Down GAPDH 27 hsa-mir-1229-3p Up HLA-DOB 9 hsa-mir-1260a Down PCNA 27 hsa-mir-5580-5p Up TAS2R4 9 hsa-mir-6780a-3p Down ONECUT2 26 hsa-mir-539-5p Up LIMS2 9 hsa-mir-128-1-5p Down RPS2 25 hsa-mir-3943 Up Down hsa-mir-548az- IL10RA 9 hsa-mir-3160-3p EGLN1 25 5p Up MAFB 9 hsa-mir-199a-5p Down TTR 23 hsa-mir-5010-3p Up MMP9 9 hsa-mir-491-5p Down PGD 22 hsa-mir-206 Up LAMC2 9 hsa-mir-29a-3p Down HIST1H1C 22 hsa-mir-5693 Up C1R 8 hsa-mir-518c-5p Down BRCA1 22 hsa-mir-99b-3p Up SSC5D 8 hsa-mir-5096 Down MYB 22 hsa-mir-200a-3p Up TNRC18 8 hsa-mir-455-3p Down H2AFZ 22 hsa-mir-1200 Up PDGFRB 8 hsa-mir-29b-3p Down MOCOS 22 hsa-mir-377-5p Up LAMP3 8 hsa-mir-6771-3p Down FAM57A 21 hsa-mir-519d-3p Up GIMAP6 7 hsa-mir-5003-5p Down MRPL10 21 hsa-mir-711 Up PTPRC 7 hsa-mir-4309 Down TMEM97 21 hsa-mir-6077 Up Down hsa-mir-6780b- SUSD2 7 hsa-mir-4707-5p FGG 21 3p Up C1S 7 hsa-mir-588 Down RPL15 21 hsa-mir-659-3p Up KRT7 7 hsa-mir-133a-3p Down ACY1 21 hsa-mir-3189-3p Up COL5A2 7 hsa-mir-29c-3p Down DLGAP5 21 hsa-mir-520b Up EGR2 7 hsa-mir-100-5p Down HLF 21 hsa-mir-5004-3p Up Down hsa-mir-3150b- TLR2 7 hsa-mir-106b-5p CELSR2 21 3p Up IFIT2 7 hsa-let-7c-3p Down RFC5 20 hsa-mir-6729-3p Up SIRPG 6 hsa-mir-1909-3p Down TRIM63 20 hsa-mir-6734-3p Up TFEC 6 hsa-mir-769-5p Down GSTM3 20 hsa-mir-4284 Up NOTCH3 6 hsa-mir-512-5p Down RPL7 19 hsa-mir-4477a Up CTLA4 6 hsa-mir-1277-5p Down ALDOC 19 hsa-mir-6734-5p Up ZNF418 6 hsa-mir-5093 Down ABCA12 18 hsa-mir-4287 Up CCL2 6 hsa-mir-155-5p Down RPL3 17 hsa-mir-423-3p Up PTGDR 5 hsa-mir-7856-5p Down CENPO 17 hsa-mir-181b-5p Up COL10A1 5 hsa-mir-767-5p Down PLP1 17 hsa-mir-4666b Up NYX 5 hsa-mir-520d-5p Down ASGR1 16 hsa-mir-4755-5p Up LMCD1 5 hsa-mir-181b-5p Down SH2D5 16 hsa-mir-6071 Up MMP14 5 hsa-mir-181a-5p Down IGDCC3 16 hsa-mir-6862-5p Up SEMA6B 5 hsa-mir-129-2-3p Down DCDC2 16 hsa-mir-7106-3p Up HLA-DQA1 4 hsa-mir-6798-3p Down KIF11 15 hsa-mir-4495 Up H2AFJ 4 hsa-mir-6834-3p Down SOX2 15 hsa-mir-340-5p Up MMP7 4 hsa-mir-126-3p Down RANBP1 15 hsa-mir-3662 Up SLC52A2 4 hsa-mir-103a-3p Down CCNB1IP1 15 hsa-mir-6510-3p Up IFI27 4 hsa-let-7c-5p Down ITM2A 15 hsa-mir-5700 Up OASL 4 hsa-mir-146a-5p Down MNX1 15 hsa-mir-548u Up MRC2 4 hsa-mir-10a-5p Down PPP1R26 15 hsa-mir-4679 Up IFI44 4 hsa-mir-1-1 Down APOA1 15 hsa-mir-4747-5p Up CAPG 4 hsa-let-7b-5p Down CDC20 14 hsa-let-7c-3p Up FPR3 4 hsa-mir-718 Down CAPNS1 14 hsa-mir-769-5p Up CCDC107 3 hsa-mir-660-3p Down NDUFC2 14 hsa-mir-4793-3p Up MAP1S 3 hsa-mir-339-5p Down SLC37A4 14 hsa-mir-7974 Up CCL19 3 hsa-mir-9-5p Down IARS 13 hsa-mir-412-3p Up PARP10 3 hsa-mir-132-3p Down RPSA 13 hsa-mir-3200-3p Up SULF1 3 hsa-mir-516a-3p Down PGAM1 13 hsa-mir-589-5p Up NUPR1 3 hsa-mir-615-3p Down RPL7A 13 hsa-mir-940 Up CDH11 3 hsa-mir-200c-3p Down LDHB 13 hsa-mir-20a-5p Up HSPG2 3 hsa-mir-663a Down TMEM45B 13 hsa-mir-3183 Up PLA2G4C 3 hsa-mir-181a-5p Down MCM2 12 hsa-mir-500a-5p Up APOE 3 hsa-mir-199a-5p Down IMPDH2 12 hsa-mir-33b-5p Up TNFSF10 3 hsa-mir-221-3p Down ENO1 12 hsa-mir-3177-3p Up ITGB2 3 hsa-mir-146a-5p Down POU5F1 12 hsa-mir-642a-5p Up CXCL9 3 hsa-mir-34a-5p Down RPL23A 12 hsa-mir-892c-5p Up S100A8 3 hsa-mir-98-5p Down PQLC2 12 hsa-mir-664a-5p Up CSF1R 3 hsa-mir-22-3p Down C1QBP 11 hsa-mir-301a-3p Up ADAM15 3 hsa-mir-363-3p Down TYMS 11 hsa-mir-433-3p Up IFI30 3 hsa-mir-149-5p Down RPS4Y1 11 hsa-mir-499a-5p Up CCR7 3 hsa-let-7a-5p Down CAMK2N2 11 hsa-mir-3621 Up IL18RAP 2 hsa-mir-8485 Down DNMT3B 11 hsa-mir-200c-3p Up ARHGAP9 2 hsa-mir-2681-5p Down ERI2 11 hsa-mir-5094 Up IRF8 2 hsa-mir-4686 Down IGFBP3 11 hsa-mir-1909-5p Up GGT5 2 hsa-mir-346 Down ST6GALNAC1 11 hsa-mir-3155a Up CD8A 2 hsa-mir-196b-5p Down GDF6 11 hsa-mir-548as-5p bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Up ANKRD13D 2 hsa-mir-505-3p Down TKT 10 hsa-mir-331-3p Up SAG 2 hsa-mir-148b-3p Down RPS10 10 hsa-mir-20a-5p Up GPR171 2 hsa-mir-607 Down SLC25A5 10 hsa-mir-10a-5p Up IFI6 2 hsa-mir-1225-3p Down RIPK4 10 hsa-mir-5003-5p Up CALML5 2 hsa-mir-9-5p Down NANOG 10 hsa-mir-302a-3p Up ANGPT2 2 hsa-mir-542-3p Down CCT2 10 hsa-mir-5680 Up SPHK1 2 hsa-mir-484 Down STAR 10 hsa-mir-6504-3p Up GLIPR2 2 hsa-mir-155-5p Down LRRC38 10 hsa-mir-361-3p Up Down hsa-mir-4436b- COL8A2 2 hsa-mir-124-3p HPR 10 5p Up Down hsa-mir-548bb- CLEC11A 2 hsa-mir-122-5p TMEM158 10 3p Up DDX58 2 hsa-mir-10b-5p Down APOB 10 hsa-mir-500b-3p Up HLA-DMB 2 hsa-mir-7-5p Down IGF2BP2 9 hsa-mir-18a-5p Up KRT5 2 hsa-mir-196a-5p Down CPNE1 9 hsa-mir-532-5p Up NLRP3 2 hsa-mir-193b-3p Down TUBA1A 9 hsa-mir-412-3p Up HLA-F 2 hsa-mir-93-5p Down FGFR3 9 hsa-mir-8064 Up UPF2 2 hsa-mir-92a-3p Down ASF1B 9 hsa-mir-3677-5p Up PYCR2 2 hsa-mir-30a-5p Down RIMKLA 9 hsa-mir-8073 Up KRT6B 2 hsa-mir-155-5p Down UGT2B10 9 hsa-mir-6804-3p Up TFEB 2 hsa-mir-124-3p Down BCAS1 9 hsa-mir-3650 Up RSAD2 2 hsa-mir-146a-5p Down FADS2 8 hsa-mir-218-5p Up PLCB2 2 hsa-mir-4762-5p Down ID1 8 hsa-mir-381-3p Up PECAM1 2 sa-mir-26b-5p Down SLC25A3 8 hsa-mir-1260b Up MGP 2 hsa-mir-335-5p Down SKP2 8 hsa-mir-548c-3p Up FOLR2 2 hsa-mir-26b-5p Down PRDX1 8 hsa-mir-23b-3p Up FMOD 2 hsa-mir-21-5p Down IGFBP1 8 hsa-mir-5580-3p Up RNASE1 2 hsa-mir-19b-3p Down FXYD2 8 hsa-mir-4999-5p Up DAPK3 2 hsa-mir-17-5p Down GAL 8 hsa-mir-889-5p Up CLDN4 2 hsa-let-7e-5p Down CENPH 8 hsa-mir-4470 Up LILRB4 2 hsa-let-7a-5p Down PTTG1 7 hsa-mir-17-5p Up FCER1G 1 hsa-mir-1225-3p Down PRMT5 7 hsa-mir-32-5p Up LYNX1 1 hsa-mir-744-5p Down EIF3I 7 hsa-mir-191-5p Up Down hsa-mir-4524b- ABI3 1 hsa-mir-744-5p HCCS 7 3p Up CTSK 1 hsa-mir-296-3p Down EEF1A2 7 hsa-mir-155-5p Up RASAL3 1 hsa-mir-615-3p Down TRIML2 7 hsa-mir-520f-3p Up ERICH1 1 hsa-mir-92b-3p Down MLANA 7 hsa-mir-562 Up TMEM204 1 hsa-mir-193b-3p Down QPCT 7 hsa-mir-6745 Up HCLS1 1 hsa-mir-484 Down ABCG5 7 hsa-mir-3191-5p Up ACTA2 1 hsa-mir-484 Down BMP5 7 hsa-mir-3667-3p Up LINC00487 1 hsa-mir-335-5p Down GATA3 6 hsa-mir-10b-5p Up XAF1 1 hsa-mir-335-5p Down CCNB2 6 hsa-let-7f-5p Up WDFY4 1 hsa-mir-335-5p Down EIF3E 6 hsa-mir-16-5p Up VTCN1 1 hsa-mir-335-5p Down XK 6 hsa-mir-31-3p Up VMO1 1 hsa-mir-335-5p Down FZD10 6 hsa-mir-548aa Up TRIM69 1 hsa-mir-335-5p Down PSMA5 6 hsa-mir-6800-3p Up PTGDS 1 hsa-mir-335-5p Down UBE2E3 6 hsa-mir-3662 Up PRSS8 1 hsa-mir-335-5p Down RMI2 6 hsa-mir-548at-5p Up PLK3 1 hsa-mir-335-5p Down KIF4A 5 hsa-mir-222-3p Up ODF3B 1 hsa-mir-335-5p Down FDFT1 5 hsa-mir-760 Up NKG7 1 hsa-mir-335-5p Down GMNN 5 hsa-mir-449a Up LGALS9C 1 hsa-mir-335-5p Down SOX3 5 hsa-mir-548as-3p Up KLHDC7B 1 hsa-mir-335-5p Down BNIP3 5 hsa-mir-210-3p Up HLA-DMA 1 hsa-mir-335-5p Down HMMR 5 hsa-mir-106b-5p Up HCST 1 hsa-mir-335-5p Down INA 5 hsa-mir-376a-3p Up GZMK 1 hsa-mir-335-5p Down PSMD6 5 hsa-mir-219a-5p Up FNDC1 1 hsa-mir-335-5p Down ADCY1 4 hsa-mir-423-3p Up FCGRT 1 hsa-mir-335-5p Down CCT8 4 hsa-mir-301a-3p Up CD79A 1 hsa-mir-335-5p Down CDCA5 4 hsa-mir-18b-5p Up CD27 1 hsa-mir-335-5p Down ACAT1 4 hsa-mir-1260b Up CD14 1 hsa-mir-335-5p Down BUB1B 4 hsa-mir-22-3p Up C1QA 1 hsa-mir-335-5p Down PCOLCE2 4 hsa-mir-182-5p Up AMY1C 1 hsa-mir-335-5p Down TBC1D7 4 hsa-mir-181c-5p Up ADAM8 1 hsa-mir-335-5p Down NCAM1 4 hsa-mir-200c-3p Up ARID5A 1 hsa-mir-324-5p Down SPAG5 4 hsa-mir-769-5p Up CYTH4 1 hsa-mir-331-3p Down PBK 4 hsa-mir-216b-3p Up DPT 1 hsa-mir-148b-3p Down VIL1 4 hsa-mir-2054 Up ITIH4 1 hsa-mir-375 Down PGM1 3 hsa-mir-30a-5p Up CCDC88B 1 hsa-mir-375 Down HS6ST2 3 hsa-let-7e-5p bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Up RGS1 1 hsa-mir-374a-5p Down ELOVL2 3 hsa-mir-17-3p Up RARRES3 1 hsa-mir-30e-3p Down TMEM147 3 hsa-mir-877-5p Up HLA-DPA1 1 hsa-mir-155-5p Down BEX1 3 hsa-mir-15b-5p Up DOK3 1 hsa-mir-320a Down NR0B2 3 hsa-mir-141-3p Up AQP1 1 hsa-mir-320a Down KCNQ2 3 hsa-mir-375 Up CCL4 1 hsa-mir-195-5p Down RNF182 3 hsa-mir-128-3p Up IRF7 1 hsa-mir-146a-5p Down ADA 3 hsa-mir-140-5p Up CFH 1 hsa-mir-146a-5p Down MAGEA2 3 hsa-mir-9-5p Up MMP11 1 hsa-mir-125a-5p Down RBMX 3 hsa-mir-126-3p Up SPON2 1 hsa-mir-9-5p Down AJUBA 3 hsa-mir-196b-5p Up NCF2 1 hsa-mir-124-3p Down AKR1B1 3 hsa-mir-1226-3p Up MMP19 1 hsa-mir-124-3p Down AREG 3 hsa-mir-200a-3p Up CTSH 1 hsa-mir-124-3p Down TFF1 3 hsa-mir-504-5p Up CCDC3 1 hsa-mir-124-3p Down GPC3 3 hsa-mir-520c-3p Up OLFML2B 1 hsa-mir-30b-5p Down CSAG1 3 hsa-mir-222-3p Up XIST 1 hsa-mir-210-3p Down CCR9 3 hsa-mir-155-5p Up COL16A1 1 hsa-mir-181a-5p Down ENO2 3 hsa-mir-382-3p Up Down hsa-mir-1185-1- TRAF3IP3 1 hsa-mir-192-5p FOXA2 3 3p Up CMPK2 1 hsa-mir-192-5p Down PIR 2 hsa-mir-1-3p Up SPARCL1 1 hsa-mir-98-5p Down EEF1G 2 hsa-mir-16-5p Up TYMP 1 hsa-mir-92a-3p Down RPL6 2 hsa-mir-26b-5p Up HBB 1 hsa-mir-92a-3p Down PTX3 2 hsa-mir-224-5p Up FBLN1 1 hsa-mir-30a-3p Down BCHE 2 hsa-mir-26b-5p Up MNDA 1 hsa-mir-26b-5p Down CYP2F1 2 hsa-mir-335-5p Up ITGAX 1 hsa-mir-26b-5p Down HGD 2 hsa-mir-26b-5p Up IGFLR1 1 hsa-mir-26b-5p Down KDM5D 2 hsa-mir-335-5p Up C1QB 1 hsa-mir-26b-5p Down KRT18 2 hsa-mir-122-5p Up BATF 1 hsa-mir-26b-5p Down VTN 2 hsa-mir-26b-5p Up ADRA2A 1 hsa-mir-26b-5p Down AKR1C3 2 hsa-mir-98-5p Up IRF5 1 hsa-mir-22-3p Down MAGEA6 2 hsa-mir-34a-5p Up PLD1 1 hsa-mir-21-5p Down MAP6D1 2 hsa-mir-215-5p Up HSPB2 1 hsa-mir-17-5p Down NMU 2 hsa-mir-192-5p Down TCF7 2 hsa-mir-215-5p Down AGR2 2 hsa-mir-197-3p Down SNCA 2 hsa-mir-7-5p Down CTNNAL1 2 hsa-mir-320a Down GDA 2 hsa-mir-492 Down LHX2 2 hsa-mir-196b-5p Down PIGF 2 hsa-mir-145-5p Down CYP26A1 2 hsa-mir-132-3p Down ZDHHC11 2 hsa-mir-375 Down UTS2 2 hsa-mir-148b-3p Down OGDHL 2 hsa-mir-130b-5p Down CDC45 2 hsa-mir-455-3p Down MAD2L1BP 2 hsa-mir-151a-5p Down MIPEP 1 hsa-let-7b-5p Down CDH18 1 hsa-let-7e-5p Down DLK1 1 hsa-mir-15a-5p Down HYAL1 1 hsa-mir-25-3p Down AGT 1 hsa-mir-26b-5p Down DPPA4 1 hsa-mir-26b-5p Down PVALB 1 hsa-mir-26b-5p Down RAD54L 1 hsa-mir-26b-5p Down TAC3 1 hsa-mir-26b-5p Down COX4I1 1 hsa-mir-92a-3p Down MST1 1 hsa-mir-34a-5p Down DSCR8 1 hsa-mir-181a-5p Down WDR54 1 hsa-mir-23b-3p Down FRAS1 1 hsa-mir-124-3p Down LAMA1 1 hsa-mir-124-3p Down TRIM7 1 hsa-mir-124-3p Down ZIC3 1 hsa-mir-155-5p Down AFP 1 hsa-mir-106b-5p Down ADSSL1 1 hsa-mir-335-5p Down CA14 1 hsa-mir-335-5p Down CGA 1 hsa-mir-335-5p Down FABP1 1 hsa-mir-335-5p Down FHL1 1 hsa-mir-335-5p Down NKAIN1 1 hsa-mir-335-5p bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Down OR51B5 1 hsa-mir-335-5p Down ORM2 1 hsa-mir-335-5p Down PMEL 1 hsa-mir-335-5p Down PPP1R3C 1 hsa-mir-335-5p Down PTPRH 1 hsa-mir-335-5p Down RNF43 1 hsa-mir-335-5p Down SERPINA1 1 hsa-mir-335-5p Down SERPIND1 1 hsa-mir-335-5p Down CCDC136 1 hsa-mir-484 Down ALB 1 hsa-mir-492 Down TPX2 1 hsa-mir-193b-3p Down MBP 1 hsa-mir-127-5p Down L1TD1 1 hsa-mir-1303 Degree – No of miRNA interact with target gene. We taken any one miRNA in table.

Table 9 TF - target gene interaction table

Regulation TF Degree Target Gene Regulation TF Degree Target Gene Up FOXC1 218 HOPX Down FOXC1 207 CCNA2 Up GATA2 163 NYX Down GATA2 167 NR0B2 Up YY1 110 CXCL9 Down YY1 109 CPS1 Up FOXL1 100 ACTA2 Down FOXL1 93 CCNB2 Up PPARG 91 CYP1B1 Down E2F1 87 STAR Up NFKB1 90 IL3RA Down NFIC 84 CDK1 Up NFIC 79 CCL3 Down PPARG 84 SERPINC1 Up SRF 76 HLA-DOB Down NFKB1 80 MLANA Up RELA 74 SP100 Down TFAP2A 79 SP5 Up USF2 73 ERICH1 Down JUN 76 KIF2C Up TFAP2A 70 DAPK3 Down CREB1 74 UBB Up JUN 69 MX1 Down USF2 68 KLK1 Up STAT3 68 HLA-DRB1 Down HINFP 61 BUB1B Up POU2F2 63 TSC22D3 Down SRF 59 RBMX Up HINFP 62 ANKRD13D Down STAT3 59 BRCA1 Up E2F1 61 SPARCL1 Down TP53 59 F11 Up TP53 60 CMPK2 Down RELA 55 GNAS Up SREBF1 60 VSIG4 Down POU2F2 54 FOXRED2 Up CREB1 55 RNF144B Down HNF4A 54 APOM Up MEF2A 47 FAP Down HOXA5 50 HYAL1 Up HOXA5 45 SELL Down NFYA 50 DPCD Up HNF4A 45 KCTD12 Down SREBF1 50 KRT80 Up NFYA 43 GZMA Down MEF2A 49 NCAM1 Up GATA3 43 GBP4 Down ESR1 43 RBBP4 Up RUNX2 40 FGR Down MAX 42 RHOXF2 Up TEAD1 37 VMO1 Down SP1 40 GNG4 Up TFAP2C 37 MYO1F Down ELK1 39 HNRNPA1 Up FOS 36 MMP19 Down STAT1 38 MOCOS Up TP63 34 CD300E Down KLF5 36 RPL7 Up CEBPB 33 TYROBP Down SREBF2 36 EEF1A2 Up NR3C1 33 NCF2 Down IRF2 35 ELOVL2 Up ARID3A 32 DPT Down ARID3A 34 PSAT1 Up JUND 32 CFH Down PRRX2 34 LIN28B Up PAX2 30 LILRB3 Down TFAP2C 33 MYC Up USF1 27 UPF2 Down FOXA1 32 RPL4 Up SREBF2 27 PDGFRB Down NRF1 31 TTR Up NR2F1 26 APOE Down NR2F1 30 TRIM37 Up BRCA1 26 CCL4 Down JUND 30 ANG Up MAX 26 CCDC107 Down USF1 29 CYP26A1 Up STAT1 26 HMOX1 Down TEAD1 29 BMX Up IRF2 26 CCL19 Down PRDM1 29 ABCA12 Up ESR1 26 CCL18 Down CEBPB 28 F2 Up PRRX2 25 TFEC Down RUNX2 28 CPNE1 Up FOXA1 25 GIMAP6 Down ZNF354C 27 RPS4Y1 Up ELK1 24 FOXP1 Down E2F6 27 NPTX1 Up PRDM1 23 DDX58 Down FOS 26 MAGEA2B Up FOXF2 23 JAK3 Down ELK4 26 PGK1 Up SP1 20 HSPG2 Down TP63 26 COASY bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Up EN1 19 HLA-DQA1 Down NR3C1 25 TKT Up ZNF354C 18 FCN1 Down FOXF2 22 HBZ Up NKX3-2 18 FMOD Down SPIB 18 POU5F1 Up KLF5 18 GPIHBP1 Down NKX3-2 18 GATA3 Up ELK4 17 ODF3B Down PAX2 18 INA Up E2F6 16 SMOC2 Down EN1 16 NEDD4L Up SPIB 15 COMP Down EGR1 15 HIST1H1C Up PDX1 13 WDFY4 Down PDX1 12 ENO2 Up SRY 12 HLA-C Down SOX10 12 RIPK4 Up EGR1 12 RASGRP2 Down SOX17 12 DCDC2 Up REL 10 IFI6 Down SOX5 11 KDM5D Up NRF1 8 ZNF524 Down ELF5 11 BEND4 Up SOX10 8 CLDN4 Down E2F4 8 PAICS Up NKX2-5 7 ACP5 Down SRY 7 NPM1 Up SOX5 7 ITGAX Down NKX3-1 6 TFF1 Up FOXI1 6 PYCR2 Down NKX2-5 6 MYB Up FOXD1 5 SPON2 Down FEV 5 CCNB1IP1 Up NFATC2 5 HEYL Down REL 5 DLGAP5 Up ELF5 5 COL10A1 Down NR2E3 4 CYP2F1 Up FEV 4 PTGDR Down HNF1B 4 SPANXA1 Up NOBOX 4 S100A8 Down NFYB 4 ID1 Up FOXO3 3 UBTD1 Down FOXI1 3 WDR54 Up NKX3-1 3 DCN Down NOBOX 3 GDA Up NR4A2 2 IL21R Down FOXD1 2 IGF2BP3 Up E2F4 2 ALOX5 Down ARNT 2 RPS4Y2 Up NR2C2 2 MMP11 Down GATA1 2 FHL1 Up ZFX 2 THY1 Down NFIL3 1 CX3CR1 Up NR2E3 2 CLDN3 Down NR4A2 1 MANEAL Up GATA1 2 UBD Down NR2C2 1 CARD10 Up MYB 2 S1PR4 Down RUNX1 1 OLA1 Up SOX9 1 GIMAP6 Down KLF4 1 FXYD2 Up ESRRB 1 MRVI1 Up SPZ1 1 NCF2 Up TFCP2L1 1 LCP2 Up HNF1B 1 C1R Up NFYB 1 COL1A1 Degree – No of TF interact with target gene. We taken any one TF in table Figures

Fig. 1. Box plots of the gene expression data before normalization (A) and after normalization (B). Horizontal axis represents the sample symbol and the vertical axis represents the gene expression values. The black line in the box bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

plot represents the median value of gene expression. (A1 - A38 = TNBC (tumor stroma) samples; B1 - B38 = normal tissue (normal stroma) samples)

Fig. 2. Volcano plot of differentially expressed genes. Genes with a significant change of more than two-fold were selected. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Fig. 3. Heat map of up regulated differentially expressed genes. Legend on the top left indicate log fold change of genes. (A1 - A38 = TNBC (tumor stroma) samples; B1 - B38 = normal tissue (normal stroma) samples)

Fig. 4. Heat map of down regulated differentially expressed genes. Legend on the top left indicate log fold change of genes. (A1 - A38 = TNBC (tumor stroma) samples; B1 - B38 = normal tissue (normal stroma) samples)

Fig. 5. Protein–protein interaction network of up regulated genes. Green nodes denotes up regulated genes.

Fig. 6. Scatter plot for up regulated genes. (A- Node degree; B- Betweenness centrality; C- Stress centrality ; D- Closeness centrality; E- Clustering coefficient)

Fig. 7. Protein–protein interaction network of down regulated genes. Red nodes denotes down regulated genes.

Fig. 8. Scatter plot for down regulated genes. (A- Node degree; B- Betweenness centrality; C- Stress centrality ; D- Closeness centrality; E- Clustering coefficient)

Fig. 9. Modules in PPI network. The green nodes denote the up regulated genes

Fig. 10. Modules in PPI network. The red nodes denote the down regulated genes.

Fig. 11. The network of up regulated genes and their related miRNAs. The green circles nodes are the up regulated DEGs, and gray diamond nodes are the miRNAs

Fig. 12. The network of down regulated genes and their related miRNAs. The red circles nodes are the down regulated DEGs, and blue diamond nodes are the miRNAs

Fig. 13. TF‐gene network of predicted target up regulated genes. (Lavender triangle - TFs and green circles- target up regulated genes)

Fig. 14. TF‐gene network of predicted target down regulated genes. (Blue triangle - TFs and red circles- target up regulated genes)

Fig. 15. Overall survival analysis of hub genes . Overall survival analyses were performed using the UALCAN online platform. Red indicates - high expression group; Blue indicates – low expression group A) ADAM15 B) BATF C) NOTCH3 D) SDC1 E) RBMX F) ABCC2

Fig. 16. Overall survival analysis of hub genes. Overall survival analyses were performed using the UALCAN online platform. Red indicates - high expression group; Blue indicates – low expression group A) ITGAX B) RPL4 C) EEF1G D) RPL3 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Fig. 17. Box plots (expression analysis) hub genes (up regulated genes) were produced using the UALCAN platform. A) ADAM15 B) BATF C) NOTCH3 D ) ITGAX E) SDC1

Fig. 18. Box plots (expression analysis) hub genes (down regulated genes) were produced using the UALCAN platform. A) RPL4 B) EEF1G C) RPL3 D) RBMX E) ABCC2

Fig. 19. Box plots (stage analysis) of hub genes (up regulated) were produced using the UALCAN platform. A) ADAM15 B) BATF C) NOTCH3 D ) ITGAX E) SDC1

Fig. 20. Box plots (stage analysis) of hub genes (down regulated) were produced using the UALCAN platform. A) RPL4 B) EEF1G C) RPL3 D) RBMX E) ABCC2

Fig. 21. Mutation analyses of hub genes were produced using the CbioPortal online platform

Fig. 22 Immune histochemical analyses of hub genes were produced using the human protein atlas (HPA) online platform. A) ADAM15 B) BATF C) NOTCH3 D ) ITGAX E) SDC1 F) RPL4 G) EEF1G H) RPL3 I) RBMX J) ABCC2 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423796; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Fig. 23. ROC curve validated the sensitivity, specificity of hub genes as a predictive biomarker for TNBC prognosis. A) ADAM15 B) BATF C) NOTCH3 D ) ITGAX E) SDC1 F) RPL4 G) EEF1G H) RPL3 I) RBMX J) ABCC2

Fig. 24. Validation of microarray data by quantitative PCR. A) ADAM15 B) BATF C) NOTCH3 D ) ITGAX E) SDC1 F) RPL4 G) EEF1G H) RPL3 I) RBMX J) ABCC2

Fig. 25. Scatter plot for Immune infiltration of A) ADAM15 B) BATF C) NOTCH3 D ) ITGAX E) SDC1 F) RPL4 G) EEF1G H) RPL3 I) RBMX J) ABCC2 in breast cancer