Essential Role of CARD14 in Murine Experimental Psoriasis Mayuri Tanaka, Kouji Kobiyama, Tetsuya Honda, Kozue Uchio-Yamada, Yayoi Natsume-Kitatani, Kenji Mizuguchi, This information is current as Kenji Kabashima and Ken J. Ishii of September 28, 2021. J Immunol published online 17 November 2017 http://www.jimmunol.org/content/early/2017/11/17/jimmun ol.1700995 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2017/11/17/jimmunol.170099 Material 5.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

by guest on September 28, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2017 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published November 17, 2017, doi:10.4049/jimmunol.1700995 The Journal of Immunology

Essential Role of CARD14 in Murine Experimental Psoriasis

Mayuri Tanaka,*,† Kouji Kobiyama,*,†,1 Tetsuya Honda,‡ Kozue Uchio-Yamada,x Yayoi Natsume-Kitatani,{ Kenji Mizuguchi,{ Kenji Kabashima,‡ and Ken J. Ishii*,†

Caspase recruitment domain family member 14 (CARD14) was recently identified as a psoriasis-susceptibility gene, but its immunological role in the pathogenesis of psoriasis in vivo remains unclear. In this study, we examined the role of CARD14 in murine experimental models of psoriasis induced by either imiquimod (IMQ) cream or recombinant IL-23 injection. In all models tested, the psoriasiform skin inflammation was abrogated in Card142/2 mice. Comparison of the early gene signature of the skin between IMQ-cream–treated Card142/2 mice and Tlr72/2Tlr92/2 mice revealed not only their similarity, but also distinct gene sets targeted by IL-23. Cell type–specific analysis of these mice identified skin Langerinhigh Langerhans cells as a potent producer of IL-23, which was dependent on both TLR7 and TLR9 but independent of CARD14, suggesting that CARD14 is acting downstream of IL-23, not TLR7 or TLR9. Instead, a bone marrow chimera study suggested that CARD14 in radio-sensitive hematopoietic cells was required for IMQ-induced psoriasiform skin inflammation, controlling the number of Vg4+ T cells Downloaded from producing IL-17 or IL-22 infiltrating through the dermis to the inflamed epidermis. These data indicate that CARD14 is essential and a potential therapeutic target for psoriasis. The Journal of Immunology, 2018, 200: 000–000.

soriasis is a chronic inflammatory skin disorder that is signaling pathways mediated by multiple TLRs are critical for the predominantly characterized by sharply demarcated development of psoriasis (5). However, no reports have firmly P chronic erythematous plaques (1). Although its etiological demonstrated the dual requirement of both TLR7 and TLR9 by http://www.jimmunol.org/ mechanisms are largely unknown, recent evidence suggests that using doubly deficient mice for TLR7 and TLR9, for example. the topical application of imiquimod (IMQ) cream causes In addition to innate immune recognition and signaling, in- psoriasis-like skin inflammation in humans and mice (2, 3). Al- flammatory cytokines such as IL-17 and IL-23 hold the key though IMQ is an agonist of mouse TLR7, TLR7-deficient mice to understanding the pathogenesis of psoriasis (6). mAbs against display epidermal hyperplasia comparable to that displayed by IL-23p19 (guselkumab and tildrakizumab) showed more clinical wild type (WT) mice in an IMQ-induced psoriasis model (4), benefit than blockage of the IL-12/23p40 subunit in human pa- suggesting that TLR7-independent mechanisms contribute to this tients (6, 7). In an experimental setting, an absence of IL-23p19 pathogenesis. Indeed, accumulating evidence has suggested that in vivo abrogated IMQ-induced psoriasis-like skin inflammation both TLR7 and TLR9 are involved in the activation of dendritic (2). Vice versa, intradermal injections of mouse ears with by guest on September 28, 2021 cells (DCs) in human psoriasis, indicating that the innate immune recombinant IL-23 protein (rIL-23) also reproduced many features of psoriasis, such as the upregulation of IL-22 and epidermal hyperplasia via the activation of STAT3 (8, 9). Overall, the IMQ- *Laboratory of Adjuvant Innovation, Center for Vaccine and Adjuvant Research, and IL-23–induced skin inflammation models in mice tightly National Institutes of Biomedical Innovation, Health and Nutrition, Osaka 567- 0085, Japan; †Laboratory of Vaccine Science, World Premier International Research linked to IL-17 and IL-22 production are useful animal models for Center Initiative Immunology Frontier Research Center, Osaka University, Osaka psoriasis (8–10). 567-0871, Japan; ‡Department of Dermatology, Kyoto University Graduate School x Despite increasing evidence that IL-23p19 plays a crucial role in of Medicine, Kyoto 606-8507, Japan; Laboratory of Animal Models for Human Diseases, National Institutes of Biomedical Innovation, Health and Nutrition, Osaka autoimmune diseases, the cell types involved and the mechanisms of { 567-0085, Japan; and Laboratory of Bioinformatics, National Institutes of Biomed- IL-23p19 production are not fully understood. Langerin2 conven- ical Innovation, Health and Nutrition, Osaka 567-0085, Japan tional DCs have been shown to be the major sources of IL-23p19 in 1Current address: Division of Inflammation Biology, La Jolla Institute for Allergy and Immunology, La Jolla, CA. IMQ-induced psoriasis (11), whereas other reports suggest that + ORCIDs: 0000-0003-3021-7078 (K.M.); 0000-0002-6728-3872 (K.J.I.). Langerin Langerhans cells (LCs) in mice (12) and humans (13) in Received for publication July 24, 2017. Accepted for publication October 19, 2017. psoriasis, as well as epidermal keratinocytes in patients with atopic This work was supported by grants from the Ministry of Education, Culture, Sports, dermatitis (14) or psoriasis (15), are potential sources of IL-23p19. Science and Technology of Japan, the Japan Agency for Medical Research and De- Nevertheless, the secreted IL-23p19 in turn can activate velopment, and the Ministry of Health, Labour, and Welfare Sciences. IL-17– and IL-22–producing gd T cells, critical cell types in the The gene expression microarray data presented in this article have been submitted to pathogenesis of psoriasis (9). IL-23R is highly expressed on gd the Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi? acc=GSE104603) under accession number GSE104603. T cells, and mutations in IL-23R are associated with psoriasis in Address correspondence and reprint requests to Prof. Ken J. Ishii, Laboratory of humans (9, 16). In murine skin, gd T cells exist abundantly as Adjuvant Innovation, Center for Vaccine and Adjuvant Research, National Institutes dendritic epidermal gd T cells (DETCs), which are characterized of Biomedical Innovation, Health and Nutrition, 7-6-8 Saito Asagi, Ibaraki City, Osaka 567- by the expression of the Vg5+ TCR (nomenclature of Heilig and 0085, Japan. E-mail address: [email protected] Tonegawa) and participate in tissue surveillance and wound The online version of this article contains supplemental material. healing (17–19). Vg4+gd T cells are also the main producers of Abbreviations used in this article: BCL10, B cell lymphoma 10; BM, bone marrow; CARD14, caspase recruitment domain family member 14; DC, dendritic cell; DETC, IL-17 in psoriasis models (9, 19). gd T cells are infrequent in dendritic epidermal gd T cells; IMQ, imiquimod; K5, keratin 5; LC, Langerhans cell; human skin compared with the number of DETCs in healthy LN, lymph node; rIL-23, recombinant IL-23; WT, wild type. mouse skin, whereas Vg9Vd2 T cells are reported to be a proin- Copyright Ó 2017 by The American Association of Immunologists, Inc. 0022-1767/17/$35.00 flammatory subset in psoriasis patients (20).

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1700995 2 CARD14 CONTROLS IL-23–MEDIATED gdT17 CELLS

Recently, caspase recruitment domain family member 14 experiment (WT, Ly5.1-B6, or Card142/2) received a lethal dose of x-rays (CARD14, also known as CARMA2 or BIMP2), encoded at the (8.5 Gy), then reconstituted with an i.v. injection of BM cells through the psoriasis susceptibility locus 2 located in human chromosomal orbital sinus. Chimerism in the peripheral blood was measured as the percentage of donor cells (.90%) in the chimeric mice at least 10 wk after region 17q25.3, was shown to have unique gain-of-function mu- reconstitution, after which applications of IMQ cream were commenced. tations associated with psoriasis (21). This finding was confirmed in a genome-wide association study of psoriasis susceptibility Histopathology of ear skin locus 2, which identified several risk-associated variants, includ- The mice were sacrificed on the final day of the experiment. Their ears were ing mutations in CARD14 (16). CARD14, like CARD11, is a collected and fixed in 10 N formalin for subsequent embedding in paraffin. novel membrane-associated guanylate kinase family member, Paraffin tissue sections (4 mm thick) were deparaffinized and stained with a which functions as an upstream activator of B cell lymphoma 10 rabbit polyclonal Abs directed against mouse keratin 5 (K5) (1:400; Covance), or a rabbit mAb directed against mouse Ki67 (Thermo Fisher (BCL10) and NF-kB signaling (22). Although CARD11 is pref- Scientific). Before the primary Ab was added, the sections were treated erentially expressed in hematopoietic cells, CARD14 is expressed with 0.01 M citric acid (adjusted to pH 6) for 10 min at 80˚C. The sec- more ubiquitously in certain tissues such as skin (21). CARD14 ondary Ab was a peroxidase-labeled polymer conjugated to a goat anti- interacts with BCL10 and MALT1, leading to the formation of the rabbit IgG Ab (Dako). For the chromogen, 3,39-diaminobenzidine (Dako) was used, producing a brown-colored stain (29). Slides were visualized CARD14–BCL10–MALT1 complex (23, 24). This complex acti- with an absolute magnification of 310, and 320 using a microscope vates NF-kB through the IkB kinase complex in response to up- (Axioplan2; Carl Zeiss Vision), and images were analyzed using Photo- stream stimuli (23, 24). Current evidence indicates that CARD14 shop Elements (version 6; Adobe). is a key molecule in psoriasis and pityriasis rubra pilaris, but the Cell preparation and culture mechanisms and correlations with the immune responses are un- Downloaded from known (21, 25). Epidermal cell suspensions were prepared by incubating the epidermis with Because little is known about the immunological role of CARD14 trypsin-EDTA for 45 min at 37˚C. A buffer containing 1.6 mg/ml colla- genase IV (Worthington) and 1.2 mg/ml hyaluronidase (Sigma) in com- in psoriasiform skin inflammation in vivo, we evaluated its immu- plete RPMI 1640 medium (Nacalai Tesque) was used to produce dermal nological function in murine psoriasis-like models. In this study, we cell suspensions. The cells were filtered through 70 mm pore-size cell examine the pathophysiological role of CARD14 in IMQ-induced strainers (BD Falcon) to obtain single-cell suspensions (30). In vitro, the 2/2 psoriasiform skin inflammation by generating Card14 mice. cells were cultured with medium alone, or with 100 ng/ml of rIL-1b http://www.jimmunol.org/ (BioLegend) and/or 100 ng/ml of rIL-23 (BioLegend) for 20 h at 37˚C. Materials and Methods RNA extraction and quantitative real-time RT-PCR Mouse strains Both ears with or without IMQ 4 h after application were collected, and The 8–12 wk old Card142/2 (details described below and in Supplemental homogenized by adding 5 mm diameter Zirconium beads (Funakoshi, Fig. 1), Tlr72/2, Tlr92/2, and Tlr72/2Tlr92/2 doubly deficient mice (26) Japan) in RLT buffer (RNeasy kit; Qiagen, Germany) and shaking with a used in this study were bred and maintained under specific pathogen-free MixerMill 300 (Qiagen) at a speed of 20 Hz for 5 min. Total RNA was conditions in our animal facility (National Institutes of Biomedical Inno- isolated using TRIzol reagent (Invitrogen) and purified using RNeasy Mini vation, Health and Nutrition). Rag22/2Il2rg2/2 mice were obtained from Kit (Qiagen), according to the manufacturer’s instructions. For sorted cells, + epidermal and dermal cells were prepared the same as for the FACS Taconic Biosciences. CD45.1 congenic mice on a C57BL/6 background by guest on September 28, 2021 (Ly5.1-B6) were obtained from the RIKEN BioResource Center (Tsukuba, sample preparation, and integrated both tissues as one sample. Cells were Japan). Tcrd2/2 mice were from the Jackson Laboratory. C57BL/6J (WT) stained and sorted by FACSAria II. Sorted cells were directly added in mice were purchased from CLEA Japan. All experiments were conducted TRIzol regent and purified using NH4OAc/ethanol. RNA was then reverse in accordance with the institutional ethical guidelines for the care and use transcribed to cDNA with reverse transcriptase (ReverTra Ace; Toyobo) m of laboratory animals of National Institutes of Biomedical Innovation, and an oligo(dT) primer. The real-time PCR mixture consisted of 10 lof Health and Nutrition. SYBR Green Master Mix (Roche), forward and reverse primers (200 nM), and 2 ml of cDNA sample in a total volume of 20 ml. Primers used Generation of CARD14-deficient mice and genotyping for amplification were: Aqp4,59- AGCAATTGGATTTTCCGTTG-39 (forward), 59- ATGATAACTGCGGGTCCAAA -39 (reverse); Bcl10, Card142/2 mice were purchased from and originally generated by Lexicon 59-AAACTGGAGCACCTCAAAGG-39 (forward) and 59-CGGAATTG- Pharmaceuticals using a targeted vector designed to remove part CACCTAGAGAGG-39 (reverse); Card14,59-TGCATAGCTCCCGTTTCAC- of exon 2 and exon 3 by homologous recombination. PCR was used 39 (forward) and 59-GGAACTTCAGGCTTTCCAGA-39 (reverse); Ccr7, for routine mouse genotyping with the following primers: P1, 59-GTGGTGGCTCTCCTTGTCAT-39 (forward) and 59-AGTCCACCGTGG- 59-GGGTGTTCCTCTGACTCTCCCAGTTGGATG-39 (forward); P2, TATTCTCG-39 (reverse); Cxcl1,59-GACTCCAGCCACACTCCAAC-39 59-GCTGACCGCTTCCTCGTGCTTTACGGTATC-39 (forward); and P3, (forward) and 59-TGACAGCGCAGCTCATTG-39 (reverse); Gapdh, 59-CAGTGACTCAAGGAGGGGCAAACGCCTATG-39 (reverse). Card142/2 59-CAAGATTGTCAGCAATGCATCC-39 (forward) and 59-CCTTCCA- targeted mice were backcrossed at least eight times into the C57BL/6J CAATGCCAAGTTG-39 (reverse); Il23p19,59-CACCTCCCTACTAGGACT- background, and identified using the marker-assisted speed congenic CAGC-39 (forward) and 59-CTGCCACTGCGACAGAAC-39 (reverse); method (27). and Pik3ca, 59-AAGTGTGTGGCTGTGACGAA-39 (forward) and 59-CGG- CAGCTGAGAGTATAGGC-39 (reverse). The PCRs were performed in a Psoriasiform skin inflammation model MicroAmp Optical 384-Well Reaction Plate for 40 cycles (95˚C for 15 s, 60˚C for 1 min) in the LightCycler 480 System II (Roche). The fluorescent signals To induce psoriasiform skin inflammation, both mouse ears were treated as (Δ threshold cycle) detected during the threshold cycle were recorded by the described previously for six consecutive days with a topical dose of 62.5 mg software installed on the machine. To standardize the target gene levels with of Beselna cream (outside Japan, IMQ cream is sold as Aldara; 3M respect to the variability in RNA and cDNA quality, Gapdh was amplified Pharmaceuticals) containing 5% IMQ (purchased from Mochida Pharma- under the same conditions, as an internal control. ceutical) (2). Control mice were not treated with the cream. Intradermal injections of 20 ml of PBS, either alone or containing 500 ng of mouse Microarray experiment recombinant cytokine proteins (rIL-22 or rIL-23) (BioLegend), were given Total RNA was isolated from control and IMQ cream–treated (4 h) whole- in both ears of the anesthetized mice with a 30 gauge needle every other 2/2 2/2 2/2 2/2 2/2 day for 5 d, as described previously (8, 28). Ear measurements were made ear skin from WT, Card14 , Tlr7 , Tlr9 , and Tlr7 Tlr9 mice at the center of the ears using a constant-pressure thickness gauge (PG-16J; using the per-cell normalization method (31). Equal aliquots of total RNA Teclock). The mice were sacrificed and their tissues were collected. from six to eight mice were pooled (total, 10 mg), and treated with DNase with the RNase-Free DNase Set (Qiagen). In brief, 200 ng of total RNA was Generation of bone marrow chimeras labeled with Cy3 using the SurePrint G3 Mouse Gene Expression v2 8 3 60K Microarray Kit (Agilent) at the DNA-chip Development Center for Infectious Bone marrow (BM) cells (5 3 106) were obtained by flushing the femurs Diseases (Research Institute for Microbial Diseases, Osaka University). After and tibias of donor Ly5.1-B6 or WT mice. The 6 wk old mice used for this background subtraction, quartile normalization was performed with the limma The Journal of Immunology 3 Downloaded from http://www.jimmunol.org/

FIGURE 1. CARD14 is essential for IMQ-induced psoriasiform skin inflammation. Ears from WT and Card142/2 mice (four to six mice per group) were treated with IMQ cream for six consecutive days. (A) Ear thickness was measured daily before IMQ-cream treatment. Data are representative of at least five independent experiments. (B) Representative H&E-, K5-, and Ki67-stained skin from control and IMQ-cream–treated mice on the final day. Data are representative of at least two independent experiments. Bar, 100 mm. (C) Ki67+ cells were quantitated by counting them in three different areas of IMQ- by guest on September 28, 2021 induced psoriasis per mouse. (D and E) Epidermal cell suspensions from WT and Card142/2 mice treated with IMQ were stimulated with PMA and ionomycin and analyzed for intracellular IL-17 and IL-22 expression using flow cytometry. Typical flow plots gated on CD45+ cells are representative of three independent experiments. Data in (A), (C), and (E) show the mean 6 SD. The p values were calculated with a one-way (C) or two-way (A) ANOVA followed by Tukey post hoc tests. *p , 0.05, **p , 0.01. package (32) in R [R Development Core Team (2011)] (33). IL-23 target genes cell-surface Ab for 30 min at 4˚C. To stain intracellular cytokines, cells were were obtained from Sua´rez-Farin˜as et al. (34). We extracted 538 genes that stimulated with 50 ng/ml PMA (Sigma) and 500 ng/ml ionomycin (Sigma), were upregulated by IL-23 treatment (fold change . 3) and were downregu- and treated with GolgiStop (BD Biosciences) for 5 h at 37˚C. For intracel- lated by additional treatment with an antagonist of TLR7 and TLR9 lular staining, cells were fixed and permeabilized with the BD Cytofix/ (IMO-3100) or an antagonist of TLR7, TLR8, and TLR9 (IMO-8400) (fold Cytoperm Fixation/Permeabilization Solution Kit (BD Biosciences), then change ,21.5) as the IL-23– target genes for further analysis. The expression stained with Ab for 30 min at 4˚C. A BD LSR II flow cytometer was used for intensities of these IL-23 target genes in WT, Card142/2, Tlr72/2, Tlr92/2, the analysis. A FACSAria flow cytometer was used for cell sorting. The and Tlr72/2Tlr92/2 mice, treated with or without IMQ cream, were visualized samples were then analyzed with FlowJo software (Tree Star). on a heatmap. The made4 package (35) in R was used to create the heatmap with a dendrogram (method = average, distance = pearson). Gene expression Statistical analysis microarray data were deposited on the Gene Expression Omnibus under Prism software (GraphPad) was used for all statistical analyses. Data were accession number GSE104603 (https://www.ncbi.nlm.nih.gov/geo/query/ compared with an unpaired t test, one-way ANOVA, or two-way ANOVA. acc.cgi?acc=GSE104603). Where significant differences were found, the Tukey–Kramer multiple- Flow cytometric analysis and cell sorting comparisons test was used to identify differences between individual groups. The following Abs were purchased from BD PharMingen or BD Horizon: anti-CD11c (HL3, allophycocyanin), anti-CD19 (1D3, BV510), anti-CD3ε Results (17A2, BV605), anti-CD4 (RM4-5, PE-CF594), anti–MHC class II (2G9, FITC), anti-Vg5 (536, BV421), anti-CD45 (30-F11, PerCP/Cy5.5), anti- CARD14 is indispensable for the skin inflammation in the mouse gd TCR (GL3, PE), and anti–IL-17A (TC11-18H10, PE). The IMQ-induced psoriasis model in vivo following Abs were from BioLegend: anti-CD14 (Sa14-2, BV510), anti- ε To characterize the role of CARD14 in psoriasiform skin in- CD207 (4C7, PE), anti-CD3 (N418, PE/cy7), anti-CD4 (RM4-5, PE/Cy7), 2/2 anti-CD45 (30-F11, PE/Cy7), anti–IL-17A (TC11-18H10.1, Alexa Fluor flammation in vivo, we generated CARD14-deficient (Card14 ) 700), anti-TCRb (H57-597, PerCP/Cy5.5), anti-mouse gd TCR (GL3, Pa- mice in a C57BL/6 background (Supplemental Fig. 1). The cific Blue), anti-Vg1 (211, FITC), and anti-Vg4 (UC3-10A6, PE). The Card142/2 mice were viable and did not show gross anatomical following Abs were purchased from eBioscience: anti-CD19 (1D3; Pacific abnormalities, and display normal skin T cell numbers in both Blue), anti–IL-22 (IL22JOP, allophycocyanin), and anti-TCR gd (GL3, allophycocyanin). Cells were preincubated with purified rat anti-mouse epidermis and dermis in steady state (Supplemental Fig. 2). In CD16/CD32 (BioLegend) and LIVE/DEAD staining (aqua or blue; addition, CARD14 did not influence the migratory and T cell priming 2 2 Thermo Fisher Scientific) for 15 min, and then labeled with the appropriate capacity of cutaneous DCs, as immunization of Card14 / mice with 4 CARD14 CONTROLS IL-23–MEDIATED gdT17 CELLS Downloaded from http://www.jimmunol.org/

FIGURE 2. Both TLR7 and TLR9 are required for IMQ-induced psoriasiform skin inflammation. Both ears from WT, Tlr72/2, Tlr92/2, and Tlr72/2 Tlr92/2 mice (four to six mice per group) were treated with IMQ cream for six consecutive days. (A, E and F) Ear thickness was measured daily before treatment in WT, Tlr72/2, Tlr92/2, and Tlr72/2Tlr92/2 mice. Data are representative of four independent experiments. (B and G) Representative H&E by guest on September 28, 2021 staining of skin from control and IMQ-cream–treated mice in each group on the final day. Bar, 100 mm. (C) Epidermal thickness after IMQ treatment or in the control. (D) Dermal thickness after IMQ-cream treatment of the control. (H) Epidermal cell suspensions from WT or Tlr72/2Tlr92/2 mice treated with IMQ cream were stimulated with PMA and ionomycin and analyzed for intracellular IL-17 and IL-22 expression using flow cytometry. Typical flow plots gated on CD45+ cells are representative of three independent experiments. Data in (A), (C)–(F), and (H) show the mean 6 SD. The p values were calculated with a one-way (C, D, and H) or two-way (A, E, and F) ANOVA followed by Tukey post hoc tests. *p , 0.05, **p , 0.01.

T dependent Ag (OVA) with or without IMQ cream as an adjuvant contrary, IL-17– and IL-22–producing gd T cells were signifi- displayed comparable OVA-specific B, ab CD4 T, and CD8 T cell cantly reduced in Card142/2 mice in the IMQ-induced psoriasis responses (Supplemental Fig. 3). We used and examined these mice model (Fig. 1D, 1E). These results suggest that CARD14 is es- in a well-defined IMQ-induced psoriasis-like model (2, 8). Consis- sential for the formation of the psoriasiform skin inflammation tently, psoriasiform skin inflammation was induced by the topical induced by IMQ cream. application of Beselna cream containing IMQ, a TLR7 ligand, to both ears of mice for 6 d, which resulted in around 2-fold increased ear Both TLR7 and TLR9, not TLR7 or TLR9 alone, are required thickness in WT mice (Fig. 1A). In sharp contrast, Card142/2 mice for IMQ-induced psoriasiform skin inflammation showed significantly less thickness of the IMQ-treated skin over 6 d As CARD14 has recently been reported to interact with BCL10 and (Fig. 1A). The significant changes in skin inflammation were con- MALT1 to form a complex that activates NF-kB (23, 24), we firmed by the histochemical analysis, showing that the numbers of hypothesized that CARD14 is involved in the innate immune proliferating keratinocytes, which are K5- and Ki67-positive cells in activation signaling downstream of TLRs. To clarify the require- the ear skin of Card142/2 mice at day 6, were significantly less than ment of TLR signaling in IMQ-induced psoriasiform skin, we those in the WT mice, even though both received IMQ cream examined TLR7-deficient (Tlr72/2), TLR9-deficient (Tlr92/2), (Fig. 1B, 1C). and TLR7 and TLR9 double-deficient (Tlr72/2Tlr92/2) mice in To examine whether Card142/2 mice are defective in the ef- the same experimental setting as described above. Consistent with fector function of IMQ-induced psoriasiform skin inflammation, a previous report (4), Tlr72/2 mice developed psoriasiform skin we measured the numbers and function of IL-17–producing gd inflammation characterized by the increased epidermal thickening T cells in the skin, as previous studies have shown that gd T cells (including parakeratosis) similar to that in WT mice (Fig. 2A–D), are major IL-17 producers in psoriasis (9). Although WT and although the cream contains 5% of the TLR7 agonist, IMQ. Card142/2 mice show similar numbers of ab+ and gd+ T cells in As MyD88-deficient mice display no IMQ-mediated skin in- the epidermis and dermis (Supplemental Fig. 2), the IL-17– and flammation (11), we then examined the other potential TLRs, such IL-22–producing cells collected from the epidermal sheets of WT as TLR9, in addition to TLR7. Plasmacytoid DCs are known to mice were significantly increased in IMQ-treated mice. On the express both TLR7 and TLR9, which respond to nucleic acids The Journal of Immunology 5 Downloaded from http://www.jimmunol.org/ by guest on September 28, 2021

FIGURE 3. IL-23 target genes were quite similar among Tlr72/2Tlr92/2 and Card142/2 mice. (A) Mouse Il23p19 mRNA expression was measured with quantitative PCR. Pooled data from three experiments are reported. Mice were treated with IMQ cream (n = 3–4). (B) Il23p19 mRNA expression was measured with quantitative PCR. WT (n = 8), Tlr72/2 (n = 7–8), Tlr92/2 (n = 6), Tlr72/2Tlr92/2 (n = 6–8), and Card142/2 mice (n = 6–7) were treated with IMQ cream and their mRNA collected 4 h later. (C) The x-axis represents the experimental conditions (WT, Card142/2, Tlr72/2, Tlr92/2, or Tlr72/2 Tlr92/2 mice with or without IMQ-cream treatment) and the y-axis represents all genes in the analysis. The expression intensities were scaled by row and the order of the genes on the y-axis. Experimental conditions on the x-axis reflect the results of hierarchical clustering (group average method, Pearson correlation coefficient). The warm color indicates the expression intensity was relatively high. (D) The x-axis represents the experimental conditions (WT, Card142/2, Tlr72/2, Tlr92/2, or Tlr72/2Tlr92/2 mice with or without IMQ-cream treatment) and the y-axis represents the IL-23 target genes, obtained from Sua´rez-Farin˜as et al. (see Materials and Methods). (E) Heat map showing 17 genes differentially expressed in 10 groups. Data in (A) and (B) show the mean 6 SD. The p values were calculated with a one-way (A) or two-way (B) ANOVA followed by Tukey post hoc tests. *p , 0.05, **p , 0.01. from self especially when the aggregation of self-DNA forms IMQ-treated Tlr72/2Tlr92/2 mice (Fig. 2H). Although speculated complexes with LL37 (5). Therefore, we used Tlr92/2 mice to by previous reports (4, 10), our results clearly show, to our examine the pathway involved in skin inflammation. TLR9- knowledge for the first time, that IMQ-induced psoriasiform skin deficient mice displayed an identical phenotype to that of WT inflammation requires both TLR7 and TLR9 signaling pathways mice (Fig. 2E). By contrast, like the Card142/2 mice, when we in mice in vivo. Although CARD14 may well be downstream of examined the Tlr72/2Tlr92/2 mice we found significantly less ear TLR7, TLR9, or both, the question of how this dual TLR acti- thickness (epidermal hyperplasia) and less dermal cell infiltration vation occurs still needs to be answered. than in WT mice on the last 3 d of treatment (Fig. 2F, 2G). We high also examined IL-17– and IL-22–producing cells from the ears of Presence of IL-23p19–producing Langerin LCs distinguishes WT and Tlr72/2Tlr92/2 mice that had received IMQ cream and CARD14 signaling from both TLR7 and TLR9 signaling found that gd T cells producing IL-17 and IL-22, which markedly To link between TLR7- and TLR9-mediated and CARD14- increased in the IMQ-treated WT mice, were reduced in the mediated immune signaling in vivo, we next focused on IL-23, 6 CARD14 CONTROLS IL-23–MEDIATED gdT17 CELLS

treatment in Card142/2, Tlr72/2, Tlr92/2, and Tlr72/2Tlr92/2 mice, and found that relative Il23p19 mRNA expressions were significantly downregulated in Card142/2 and Tlr72/2Tlr92/2 mice (Fig. 3B), whereas CARD14 deficiency does not affect the secretion of IL-12p40 and IL-23p19 by DCs stimulated by a TLR7 or TLR9 ligand in vitro (Supplemental Fig. 4). Because Il23p19 mRNA expressions at 4 h after IMQ-cream treatment coincided with the phenotype of Card142/2 and Tlr72/2 Tlr92/2 mice (Figs. 1A, 2F), we further analyzed the gene- expression profile of the treated skin at 4 h after IMQ-cream treat- ment by microarray, and found that the gene expression profiles of the Card142/2 and Tlr72/2Tlr92/2 mice were similar, but distinct from other control groups such as WT, Tlr72/2,orTlr92/2 mice (Fig. 3C). When the microarray gene expression patterns were fur- ther sorted with a previously described set of genes targeted by IL-23 (34), the profiles in both the Card142/2 and Tlr72/2Tlr92/2 mice revealed that most of the sorted genes show a similar trend. How- ever, there are 17 unique psoriasis-related genes, which were dif- 2 2 ferentially expressed in responses to IL-23 in the Card14 / or Downloaded from Tlr72/2Tlr92/2 mice (Fig. 3D, 3E). Among groups that are treated with IMQ-cream, Aqp4, Bcl10, Ccr7, Cxcl1,andPi3kca,allof which are relevant to inflammation, cell activation and maturation of DCs and T cells, were remarkably downregulated in Card142/2 mice compared with those in WT mice, but not in Tlr72/2Tlr92/2

mice (Fig. 4A–E). This indicates that the distinct intra- or intercel- http://www.jimmunol.org/ lular signaling pathway(s) and subsequent gene regulations between TLR7, TLR9, and CARD14 exist. To better understand the cell-specific relation between TLR7, TLR9, and CARD14 in terms of Il23p19 mRNA expression during IMQ-induced psoriasis in vivo, we sorted the potential IL-23p19– producing cells that include keratinocytes, gd T cells, Langerinhigh LCs, and Langerinlow DCs from the ear skin of mice after IMQ- cream treatment for 4 h. Whereas Card14 mRNA expression has been shown in the skin (25), keratinocytes and Langerinhigh LCs by guest on September 28, 2021 showed higher expression of Card14 mRNA than its residual level of gd T cells and almost no level in Langerinlow DCs (Fig. 4F). Card14 mRNA expressions were not up- or downregulated after IMQ-cream treatment in most cell types, but Langerinhigh LCs were downregulated (Fig. 4F). Consistent with the previous find- ing that Langerin+ LCs are potential IL-23 producers in psoriatic FIGURE 4. Presence of IL-23p19–producing Langerinhigh LCs distin- A E mice (12, 13), we observed a significant increase in Il23p19 guishes CARD14 signaling from both TLR7 and TLR9 signaling. ( – ) high Expression levels of Aqp4, Bcl10, Ccr7, Cxcl1, and Pik3ca in whole-ear mRNA expression in Langerin LCs in the control treatment RNA from WT, Card142/2, Tlr72/2, Tlr92/2, and Tlr72/2Tlr92/2 mice, group and significantly upregulated by IMQ-cream treatment treated with or without IMQ cream. (F) Keratinocytes (CD452), gd T cells (Fig. 4G). Furthermore, when the highly upregulated Il23p19 2 high (CD45+CD3+gd T), Langerinhigh cells (CD45+CD3 IA/IE+CD11c+ Lan- mRNA expressions by Langerin LCs were compared between 2 2 2 2 2 2 gerinhigh), and Langerinlow (CD45+CD32IA/IE+CD11c+ Langerinlow) cells WT, Card14 / , and Tlr7 / Tlr9 / mice, the levels of Il23p19 from WT mice were treated with or without IMQ cream and sorted, and mRNA expression were significantly reduced in Tlr72/2Tlr92/2 Card14 mRNA expression was measured with quantitative PCR. (G and H) mice, but not in Card142/2 mice (Fig. 4H). Collectively, these high 2/2 2/2 2/2 Sorted Langerin cells from WT, Card14 , and Tlr7 Tlr9 mice data indicate that IL-23p19–producing Langerin+ LCs are char- treated with or without IMQ cream were collected, and their mRNA pu- acteristic of psoriasis, but their levels differ in the early responses rified 4 h later, then Il23p19 mRNA expression was measured with 2 2 2 2 2 2 between Card14 / and Tlr7 / Tlr9 / mice, although their quantitative PCR. Data in (A)–(H) show the mean 6 SD. The p values were calculated with a one-way (F–H) or two-way (A–E) ANOVA followed by whole-skin Il23p19 mRNA expression is similar. , , Tukey post hoc tests. *p 0.05, **p 0.01. CARD14 plays a critical role in the recruitment of skin Vg4+ one of the important key factors for pathogenesis of psoriasis. We T cells and their production of IL-17 and IL-22 examined whether IL-23p19 production or characteristic gene Because it has been known that IL-23 acts directly on T cells, we signatures induced by IL-23 are affected in Card142/2 and Tlr72/2 next examined whether Tlr72/2Tlr92/2 and Card142/2 mice are Tlr92/2 mice by IMQ treatment. We collected total RNA from the sensitive to another established model of psoriasiform dermatitis, whole-ear skin of WT mice at various time points after IMQ induced with rIL-23 (8). Consistent with a previous report (8), rIL- treatment (0, 2, 4, 8, 24, and 36 h), and determined the Il23p19 23 injection on days 0, 2, and 4 caused a significant increase in ear mRNA levels with quantitative real-time reverse transcription thickness, with epidermal acanthosis and dermal inflammatory PCR. Expression of Il23p19 was upregulated at 2 h and peaked at cell infiltration on day 5. These changes were independent of both 4 h, then waned by 36 h after IMQ treatment (Fig. 3A). We then TLR7 and TLR9 (Fig. 5A), and the number of gd T cells producing measured the expression of Il23p19 mRNA at 4 h after IMQ IL-17 and IL-22 was not different between WT and Tlr72/2Tlr92/2 The Journal of Immunology 7

FIGURE 5. CARD14 is potentially related to adaptive immune cells in an IL-23–induced psoriasis model. Ears of WT and Card142/2, Tlr72/2Tlr92/2 mice (n = 4 mice per group) were injected with rIL-23 every other day for 5 d. (A and C) Ear thickness was measured daily before injection. Data are representative of at least four independent experi- ments. (B) Epidermal cell suspensions from WT or Tlr72/2 Tlr92/2 mice treated with rIL-23 were stimulated with PMA and ionomycin and analyzed for intracellular IL-17 and IL- 22 expression using flow cytometry. Typical flow plots gated + on CD45 cells are representative of three independent ex- Downloaded from periments. (D) Representative H&E, K5, and Ki67 staining of the skin of control mice and IMQ-cream–treated mice on the final day. Data are representative of at least two inde- pendent experiments. Scale bar, 100 mm. (E) Ki67+ cells were quantified by counting them in three different areas of IMQ-induced psoriasis per mouse. Data in (A)–(C) and (E) show the mean 6 SD. The p values were calculated with a http://www.jimmunol.org/ one-way (B and E) or two-way (A and C) ANOVA followed by Tukey post hoc tests. *p , 0.05, **p , 0.01. by guest on September 28, 2021

mice (Fig. 5B). These results demonstrate that both TLR7 and no significant difference in epidermal Vg5+ T cells and their se- TLR9 are required for the full development of IMQ-induced psor- cretion of IL-17 and IL-22 between WT and Card142/2 mice iasiform dermatitis, whereas in the IL-23–induced model does not treated with IMQ cream (Fig. 6C). Therefore, CARD14 contrib- require a TLR7- and TLR9-mediated innate immune signaling utes to the increased numbers of IL-17+ and/or IL-22+ Vg4+ cells pathway. In sharp contrast, IL-23–induced ear swelling was sig- that migrate into the skin being distributed in the both the dermis nificantly suppressed in the Card142/2 mice at day 2, 4, and 5 d and epidermis during the IMQ-induced inflammatory response. after the first rIL-23 injection (Fig. 5C). Consistently, immunohis- It has been reported that epidermal CCR6+ gd T cells are re- tochemical analysis revealed that K5- and Ki67-positive hyper- sponsible for psoriasis in mouse skin (37), but IL-17–producing proliferative cells, and both epidermal hyperplasia and dermal skin dermal gd T cells have also been implicated (9, 36). This dis- inflammation (indicated by infiltrating cells stained with H&E) did crepancy has been discussed and it has been suggested that dermal not occur in the rIL-23–injected Card142/2 mice (Fig. 5D, 5E). The gd T cells migrate into the epidermis during inflammation (38). data above suggest that CARD14 is essential for IL-23–induced We have confirmed this proposition and found that the number of psoriasiform skin inflammation, potentially acting downstream Vg4+ T cells producing IL-17 and IL-22 in the IMQ-cream– under IL-23R on certain effector cells such as gd T cells secreting treated skin were increased predominantly in the epidermis, IL-17 and IL-22 to develop psoriasis. which, importantly, is prevented in Card142/2 mice (Fig. 6A, 6B). We then went on identifying the subsets of effector gd T cells Although our results suggest that CARD14 is necessary for the that produce IL-17 and IL-22 in the epidermis and dermis of these IMQ-mediated production of IL-17 and IL-22 by gd T cells mice at 6 d after IMQ-cream treatment. Consistent with a previous (Figs. 1E, 6A, 6B), further studies are required to clarify how report, which found that Vg4+ T cells are the main source of IL-17 CARD14 is involved in these intracellular signaling pathways of rather than DETCs (also known as Vg5+ T cells) in psoriatic skin such cell types. (36), the frequencies of both epidermal and dermal Vg4+ T cells were significantly increased in the IMQ-cream–treated WT mice CARD14 in radio-sensitive hematopoietic cells plays a critical than untreated controls (Fig. 6A, 6B, left panel). Importantly, role in psoriasiform skin inflammation those increased Vg4+ T cells secrete IL-17 and IL-22, both of As it has been shown that CARD14 is involved in the innate which were significantly reduced in the Card142/2 mice treated immune activation of keratinocytes (21, 25), we examined whether with IMQ cream (Fig. 6A, 6B, right panel). In contrast, there was Card142/2 mice are protected from IL-22–induced psoriasis, in 8 CARD14 CONTROLS IL-23–MEDIATED gdT17 CELLS

reciprocal BM chimeras. BM cells from Ly5.1-B6 or Card142/2 mice were transplanted into x-ray–irradiated Card142/2, Ly5.1-B6, or WT mice. After 10 wk, both ears of the transplanted mice were treated with IMQ cream for six consecutive days. Chimerism was confirmed as the CD45.1+/CD45.2+ population ratio in the periph- eral blood. The donor-derived cell population exceeded 90% in all groups 10 wk after reconstitution (Fig. 7C). Chimerism of the skin, in contrast, was unique where the remaining radio-resistant CD45.2+ cells were over 80% in the epidermis and around 40% in the dermis (Fig. 7D). After IMQ-cream treatment, numbers of CD45.1+ cells from the donor BM in the epidermis were significantly increased compared to those in the control, but not in the dermis or lymph nodes (LN) (Fig. 7D). Although the total number of CD45.1+ cells in the dermis was increased, the ratio between CD45.1+ and CD45.2+ was not altered (Fig. 7D). These data strongly suggest that radio-sensitive CD45.1+ cells moving into the epidermal area are originally from the BM, rather than radio-resistant skin-resident cells, and play a major role in psoriasiform skin inflammation.

Psoriasiform skin inflammation was induced in WT mice Downloaded from transplanted with BM from Ly5.1-B6 mice, and partially induced in Card142/2 mice transplanted with BM from Ly5.1-B6 mice. On the contrary, irradiated Ly5.1-B6 mice transplanted with Card142/2 BM showed significantly suppressed swelling (Fig. 7E), suggesting that CARD14 expressed in radio-sensitive, hematopoietic BM-

derived cells is essential for the pathogenesis of psoriasis in our http://www.jimmunol.org/ IMQ-induced model. Although the possibility cannot be excluded that in radio-resistant, nonhematopoietic cells, including keratino- cytes, CARD14 plays a role in psoriasiform skin inflammation, this experiment suggests that CARD14 in BM-derived cells, potentially gd T cells, is necessary for the development of IMQ-induced psoriasiform skin inflammation. Finally, we examined the role of CARD14 from donor BM in the induction of IL-17+ gd T cell subsets in the skin. As it has pre- viously been shown that IMQ cream–activated Vg4+ T cells leave by guest on September 28, 2021 FIGURE 6. CARD14 controls the number of IL-17–producing epider- + the LN and accumulate in inflamed skin (39), we demonstrated the mal Vg4 T cells in an IMQ-induced psoriasis model. Ears of WT and + + + 2/2 presence of an IL-17 gd T cell subset in LNs. Donor IL-17 Vg4 Card14 mice (n = 4 mice per group) were injected with rIL-23 every other day for 5 d. Ears of WT and Card142/2 mice (n = 4 per group) were T cells derived from Ly5.1-B6 mice accumulated strongly in the + + treated with IMQ cream for six consecutive days. (A–C) Epidermal and IMQ-cream–treated LN at higher frequencies than in IL-17 Vg1 + + dermal cell suspensions from the WT and Card142/2 mouse ears were and IL-17 Vg5 T cells (Fig. 7F). In contrast, in the control mice, 2 2 stimulated with or without PMA plus ionomycin and analyzed for gd the frequency of IL-17+Vg4+ T cells derived from Card14 / T cell subsets (Vg4andVg5), IL-17, and IL-22 with flow cytometry. Typical mice was significantly reduced (Fig. 7F). Cells that express flow plots gated on CD45+ cells are representative of at least two independent IL-23R must play an important role in the CARD14-mediated experiments. Data show the mean 6 SD. The p values were calculated with a pathogenesis of psoriasiform skin inflammation downstream , , one-way ANOVA followed by Tukey post hoc tests. *p 0.05, **p 0.01. from the signaling pathway initiated by IL-23. It is unclear which cells express IL-23R, but most cells that express IL-23R are gd which IL-22 activates and proliferates keratinocytes to develop T cells, together with some CD11c+ cells (40). We then cultured psoriasiform skin inflammation (8). WT mice displayed ear IL-17–producing cells with IL-1b and/or IL-23 (Fig. 7G). The swelling by rIL-22 injection, however, the swelling in Card142/2 IL-17+ gd/T cell ratio in the Card142/2 mice was more strongly mice was significantly reduced at day 4 and 5 after rIL-22 injection reduced than the ratio in the control when the cells were cultured (Fig. 7A), suggesting that CARD14 may directly be associated with with IL-23 rather than with IL-1b plus IL-23. keratinocytes acting as effector cell types to develop psoriasis. To understand the other cell types involved in the effector phase Discussion of psoriasis, we examined IMQ-induced psoriasis in TCR d–de- The above results demonstrate that CARD14 is required for the ficient (Tcrd2/2) mice, which lack gd T cells, and in Rag22/2 optimal production of IL-17 and IL-22 by Vg4+ T cells, when mice Il2rg2/2 mice, which lack T cells, NK cells, NKT cells, and innate are treated by either IMQ cream or rIL-23. To our knowledge, this lymphoid cells. Consistent with a previous report (10), Tcrd2/2 is the first report that CARD14 is solely responsible for the and Rag22/2Il2rg2/2 mice showed significantly less skin swelling pathogenesis of psoriasis-like dermatitis in a murine experimental than WT mice after the application of IMQ cream (Fig. 7B). These model, whereas human mutations in Card14 have been reported data suggest that gd T cells are essential in IMQ-induced psor- to regulate NF-kB signaling and are strongly correlated in the iasiform skin inflammation. skin in psoriasis and pityriasis rubra pilaris (21, 25). It has also Overall, our data indicate a potential role for CARD14 in in- been reported that CARD14 is expressed in the epithelial cells of duction and effector function of IL-17+Vg4+ cells during psor- skin lesions in psoriasis patients (41). We therefore hypothesized iasiform skin inflammation. To further examine whether CARD14 initially that CARD14 would be a downstream signaling molecule is critical in keratinocytes or other hematopoietic cells, we generated for TLR7-mediated NF-kB activation in the epithelial stromal The Journal of Immunology 9 Downloaded from http://www.jimmunol.org/ by guest on September 28, 2021

FIGURE 7. CARD14 in radio-sensitive hematopoietic cells plays a critical role in psoriasis. (A) Both ears of WT and Card142/2 mice (n = 4 mice per group) were injected with 500 ng of rIL-22 every other day for 5 d. Ear thickness was measured daily before injection. Data are representative of three independent experiments. (B) Ears of WT, Rag22/2, Rag2 2/2 Il2rg2/2, and Tcrd2/2 mice (n = 4 mice per group) were treated with or without IMQ cream for six consecutive days. Ear thickness was measured daily before treatment. Data are representative of three independent experiments. (C) Reconstituted BM chimeras: Ly5.1-B6 BM → WT mice (Ly5.1-B6 → WT), Ly5.1-B6 BM → Card142/2 mice (Ly5.1-B6 → Card142/2), and Card142/2 BM → Ly5.1-B6 mice (Card142/2→ Ly5.1-B6) (n = 4–6 mice per group). Typical dot plots of CD45.1+ and CD45.2+ cells from peripheral blood at 10 wk after BM transplantation are shown among four similar independent results in the upper panel. Percentages of chimerism are shown in the lower panel. (D) Degree of chimerism in epidermis, dermis, and the draining LN cells obtained 10 wk after reconstitution [n = 4–5 per group; chimeras generated as described in (C)]. (E) Reconstituted BM chimeras Ly5.1-B6 BM → WT mice (Ly5.1-B6 → WT), Ly5.1-B6 BM → Card142/2 mice (Ly5.1-B6 → Card142/2), and Card142/2 BM → Ly5.1-B6 mice (Card142/2→ Ly5.1-B6) (n = 4–6 mice/group) were treated with IMQ cream. Ear thickness was monitored daily. Data are rep- resentative of three independent experiments. (F) LN cells from Ly5.1-B6 → WT, Ly5.1-B6 → Card142/2, and Card142/2 → Ly5.1-B6 mice were stimulated with or without PMA plus ionomycin, and analyzed for gd T cell subsets (Vg1, Vg4, and Vg5) and IL-17 with flow cytometry. Typical flow plots gated on CD45+ cells are representative of at least two independent experiments. (G) Ear cells from WT and Card142/2 mice (n = 4 mice per group) were cultured with medium only or IL-1b and/or IL-23 for 20 h, and stained for intracellular IL-17 of gd T cells. Data in (A)–(G) show the mean 6 SD. The p values were calculated with a one-way (F and G) or two-way (A–E) ANOVA followed by Tukey post hoc tests. *p , 0.05, **p , 0.01. cells, such as keratinocytes. However, our initial hypothesis is not for IL-23–induced, psoriasiform skin inflammation (Figs. 2F, 5A). incorrect, and instead the results imply that CARD14 acts Although CARD14 is expressed in epithelial keratinocytes as well as downstream of the IL-23–mediated immune signaling pathway Langerinhigh LCs, it was also expressed in gd T cells in the psoriasis- and is important for the initiation and amplification of inflam- like skin rash induced in our models (Fig. 4F). Although our data mation, as CARD14 was essential for both IMQ- and IL-23– suggest that CARD14 is critical for cells that express IL-23R to re- induced psoriasiform skin inflammation (Figs. 1A, 5C), whereas spond to IL-23 such as gd T cells (Figs. 1E, 6) to produce IL-17 and TLR7, together with TLR9, was required for IMQ-induced, but IL-22 in vivo after IMQ or rIL-23 treatment, as well as in vitro culture 10 CARD14 CONTROLS IL-23–MEDIATED gdT17 CELLS with rIL-23 (Fig. 7G), further studies are required to clarify how M. Lelliott, Reiko Fukui, Takahiro Nagatake, and Teruki Dainichi for sup- CARD14 mediates these intracellular signaling pathways at a mo- port and insightful comments. lecular level. Keratinocytes that express CARD14 are also involved in skin Disclosures inflammation, but require IL-22 because IL-22R is predominantly The authors have no financial conflicts of interest. expressed on keratinocytes but not leukocytes. Consistent with a previous report (9), our data suggest that Card14 expressed in keratinocytes is involved in IMQ-induced as well as rIL-23– References induced psoriasiform skin inflammation via IL-22, which is predomi- 1. Scho¨n, M. P., and W. H. Boehncke. 2005. Psoriasis. N. Engl. J. Med. 352: + 1899–1912. nantly secreted by CARD14 gd T cells. Based on the above-mentioned 2. van der Fits, L., S. Mourits, J. S. Voerman, M. Kant, L. Boon, J. D. Laman, experiments, we clearly demonstrated the relative contribution of F. Cornelissen, A. M. Mus, E. Florencia, E. P. Prens, and E. Lubberts. 2009. CARD14 in gd T cells and keratinocytes to skin inflammation. Imiquimod-induced psoriasis-like skin inflammation in mice is mediated via the IL-23/IL-17 axis. J. Immunol. 182: 5836–5845. Even though the experimental conditions differ between human 3. Gilliet, M., C. Conrad, M. Geiges, A. Cozzio, W. Thurlimann,€ G. Burg, patients and experimental mouse models, numbers of gd T cells F. O. Nestle, and R. Dummer. 2004. Psoriasis triggered by toll-like receptor 7 agonist imiquimod in the presence of dermal plasmacytoid dendritic cell pre- are known to differ in humans and mice (9, 19). Therefore, it is cursors. Arch. Dermatol. 140: 1490–1495. possible that the roles of CARD14 in humans and mice diverge 4. Walter, A., M. Scha¨fer, V. Cecconi, C. Matter, M. Urosevic-Maiwald, B. Belloni, according to the CARD14-expressing cell types or the experi- N. Scho¨newolf, R. Dummer, W. Bloch, S. Werner, et al. 2013. Aldara activates TLR7-independent immune defence. Nat. Commun. 4: 1560. mental conditions, including differences in animal resources. 5. Ganguly, D., G. Chamilos, R. Lande, J. Gregorio, S. Meller, V. Facchinetti, Further studies are required to clarify the role of CARD14 in B. Homey, F. J. Barrat, T. Zal, and M. Gilliet. 2009. Self-RNA-antimicrobial Downloaded from human gd T cells during psoriasis. peptide complexes activate human dendritic cells through TLR7 and TLR8. J. Exp. Med. 206: 1983–1994. IMQ cream is used as a topical treatment of nonmelanoma skin 6. Johnson-Huang, L. M., M. A. Lowes, and J. G. Krueger. 2012. Putting together cancer, and is known to cause side effects such as psoriasis-like skin the psoriasis puzzle: an update on developing targeted therapies. Dis. Model. Mech. 5: 423–433. inflammation (4). It is conceivable that TLR7 activation by IMQ 7. Sofen, H., S. Smith, R. T. Matheson, C. L. Leonardi, C. Calderon, cream and certain stimuli within it leads to cell death and release C. Brodmerkel, K. Li, K. Campbell, S. J. Marciniak, Jr., Y. Wasfi, et al. 2014. Guselkumab (an IL-23-specific mAb) demonstrates clinical and molecular re- of DNA by resident keratinocytes, or recruitment of more spe- http://www.jimmunol.org/ sponse in patients with moderate-to-severe psoriasis. J. Allergy Clin. Immunol. cialized immune cells, such as neutrophils to undergo neutrophil 133: 1032–1040. extracellular traps associated with cell death to release DNA as a 8. Zheng, Y., D. M. Danilenko, P. Valdez, I. Kasman, J. Eastham-Anderson, J. Wu, TLR9 agonist (42). It is also possible that the skin microbiome– and W. Ouyang. 2007. Interleukin-22, a T(H)17 cytokine, mediates IL-23- induced dermal inflammation and acanthosis. Nature 445: 648–651. related nucleic acids play a role in this unique TLR9 involvement 9. Cai, Y., X. Shen, C. Ding, C. Qi, K. Li, X. Li, V. R. Jala, H. G. Zhang, T. Wang, during IMQ-cream–mediated psoriasiform skin inflammation J. Zheng, and J. Yan. 2011. Pivotal role of dermal IL-17-producing gd T cells in skin inflammation. Immunity 35: 596–610. (43), although further studies seem required. 10. Pantelyushin, S., S. Haak, B. Ingold, P. Kulig, F. L. Heppner, A. A. Navarini, and Skin APCs are a highly heterogeneous population with func- B. Becher. 2012. Rorgt+ innate lymphocytes and gd T cells initiate psoriasiform tionally specialized subsets; single functional markers that plaque formation in mice. J. Clin. Invest. 122: 2252–2256. 11. Wohn, C., J. L. Ober-Blo¨baum, S. Haak, S. Pantelyushin, C. Cheong, by guest on September 28, 2021 uniquely define individual subsets of cells are absent (44). S. P. Zahner, S. Onderwater, M. Kant, H. Weighardt, B. Holzmann, et al. Consistent with a previous study focused on IL-23–producing 2013. Langerin(neg) conventional dendritic cells produce IL-23 to cells in resident LCs in psoriasis (13), we selectively detected drive psoriatic plaqueformationinmice.Proc. Natl. Acad. Sci. USA 110: 10723–10728. upregulation of Il23p19 in LCs. Although we demonstrated 12. Yoshiki, R., K. Kabashima, T. Honda, S. Nakamizo, Y. Sawada, K. Sugita, sorting against four major populations in the skin (keratinocytes, H. Yoshioka, S. Ohmori, B. Malissen, Y. Tokura, and M. Nakamura. 2014. IL-23 gd T cells, LCs, and DCs), there may have been a lack of other from Langerhans cells is required for the development of imiquimod-induced 2 psoriasis-like dermatitis by induction of IL-17A-producing gd T cells. J. Invest. potential IL-23p19–producing APC subsets, especially CD11b Dermatol. 134: 1912–1921. populations including dermal cDC1 (CD11b2XCR1+)and 13. Martini, E., M. Wike´n, S. Cheuk, I. Gallais Se´re´zal, F. Baharom, M. Stahle,˚ 2 2 A. Smed-So¨rensen, and L. Eidsmo. 2017. Dynamic changes in resident and double-negative DC (CD11b XCR1 ). Overall, Il23p19 ex- infiltrating epidermal dendritic cells in active and resolved psoriasis. J. Invest. pression was higher in LCs than DCs in our data, whereas the Dermatol. 137: 865–873. discrepancy in the reported IL-23p19–producing cells may result 14. Yoon, J., J. M. Leyva-Castillo, G. Wang, C. Galand, M. K. Oyoshi, L. Kumar, S. Hoff, R. He, A. Chervonsky, J. J. Oppenheim, et al. 2016. IL-23 induced in from the use of different markers and determination of accurate keratinocytes by endogenous TLR4 ligands polarizes dendritic cells to drive target cells. It should also be noted that we used different IL-22 responses to skin immunization. J. Exp. Med. 213: 2147–2166. 15.Piskin,G.,R.M.Sylva-Steenland,J.D.Bos,andM.B.Teunissen.2006. methods for RNA purification for skin tissue and cells that were In vitro and in situ expression of IL-23 by keratinocytes in healthy skin and sorted, and demonstrated that sorting using a high electric charge psoriasis lesions: enhanced expression in psoriatic skin. J. Immunol. 176: might cause cell damage. It is conceivable that original immu- 1908–1915. 16. Wellcome Trust Case Control Consortium 2. 2012. Identification of 15 new nological responses were lost and there may be other endoge- psoriasis susceptibility loci highlights the role of innate immunity. Nat. Genet. nous factors involved that are not currently known. These 44: 1341–1348. reasons could explain the data discrepancy that requires further 17. Papotto, P. H., J. C. Ribot, and B. Silva-Santos. 2017. IL-17(+) gd T cells as kick-starters of inflammation. Nat. Immunol. 18: 604–611. clarification in the future. 18. Carding, S. R., and P. J. Egan. 2002. Gammadelta T cells: functional plasticity CARD14 may be a good target for reducing the pathogenesis of and heterogeneity. Nat. Rev. Immunol. 2: 336–345. 19. Pasparakis, M., I. Haase, and F. O. Nestle. 2014. Mechanisms regulating skin psoriasiform dermatitis. The immunological significance of the immunity and inflammation. Nat. Rev. Immunol. 14: 289–301. CARD14-mediated innate and adaptive immune responses should 20. Laggner, U., P. Di Meglio, G. K. Perera, C. Hundhausen, K. E. Lacy, N. Ali, be investigated, because gd T cells play an important role in C. H. Smith, A. C. Hayday, B. J. Nickoloff, and F. O. Nestle. 2011. Identification of a novel proinflammatory human skin-homing Vg9Vd2 T cell subset with a various immune disorders, including multiple sclerosis, and in- potential role in psoriasis. J. Immunol. 187: 2783–2793. fectious diseases (17, 18). 21. Jordan, C. T., L. Cao, E. D. Roberson, K. C. Pierson, C. F. Yang, C. E. Joyce, C. Ryan, S. Duan, C. A. Helms, Y. Liu, et al. 2012. PSORS2 is due to mutations in CARD14. Am. J. Hum. Genet. 90: 784–795. Acknowledgments 22. Bertin, J., L. Wang, Y. Guo, M. D. Jacobson, J. L. Poyet, S. M. Srinivasula, We thank all members of the Laboratory of Adjuvant Innovation, National S. Merriam, P. S. DiStefano, and E. S. Alnemri. 2001. CARD11 and CARD14 are novel caspase recruitment domain (CARD)/membrane-associated guanylate Institutes of Biomedical Innovation, Health and Nutrition for helpful dis- kinase (MAGUK) family members that interact with BCL10 and activate cussions. We particularly thank Drs. Cevayir Coban, Jun Kunisawa, Patrick NF-kappa B. J. Biol. Chem. 276: 11877–11882. The Journal of Immunology 11

23. Afonina, I. S., E. Van Nuffel, G. Baudelet, Y. Driege, M. Kreike, J. Staal, and 33. Dean, C. B., and J. D. Nielsen. 2007. Generalized linear mixed models: a review R. Beyaert. 2016. The paracaspase MALT1 mediates CARD14-induced signal- and some extensions. Lifetime Data Anal. 13: 497–512. ing in keratinocytes. EMBO Rep. 17: 914–927. 34. Sua´rez-Farin˜as, M., R. Arbeit, W. Jiang, F. S. Ortenzio, T. Sullivan, and 24. Howes, A., P. A. O’Sullivan, F. Breyer, A. Ghose, L. Cao, D. Krappmann, J. G. Krueger. 2013. Suppression of molecular inflammatory pathways by Toll- A. M. Bowcock, and S. C. Ley. 2016. Psoriasis mutations disrupt CARD14 like receptor 7, 8, and 9 antagonists in a model of IL-23-induced skin inflam- autoinhibition promoting BCL10-MALT1-dependent NF-kB activation. mation. PLoS One 8: e84634. Biochem. J. 473: 1759–1768. 35. Culhane, A. C., J. Thioulouse, G. Perrie`re, and D. G. Higgins. 2005. MADE4: an 25. Fuchs-Telem, D., O. Sarig, M. A. van Steensel, O. Isakov, S. Israeli, J. Nousbeck, R package for multivariate analysis of gene expression data. Bioinformatics 21: K. Richard, V. Winnepenninckx, M. Vernooij, N. Shomron, et al. 2012. Familial 2789–2790. pityriasis rubra pilaris is caused by mutations in CARD14. Am. J. Hum. Genet. 36. Cai, Y., F. Xue, C. Fleming, J. Yang, C. Ding, Y. Ma, M. Liu, H. G. Zhang, 91: 163–170. J. Zheng, N. Xiong, and J. Yan. 2014. Differential developmental requirement 26. Onishi, M., K. Ozasa, K. Kobiyama, K. Ohata, M. Kitano, K. Taniguchi, and peripheral regulation for dermal Vg4 and Vg6T17 cells in health and in- T. Homma, M. Kobayashi, A. Sato, Y. Katakai, et al. 2015. Hydroxypropyl- flammation. Nat. Commun. 5: 3986. b-cyclodextrin spikes local inflammation that induces Th2 cell and T follicular 37. Mabuchi, T., T. Takekoshi, and S. T. Hwang. 2011. Epidermal CCR6+ gd T cells helper cell responses to the coadministered antigen. J. Immunol. 194: are major producers of IL-22 and IL-17 in a murine model of psoriasiform 2673–2682. dermatitis. J. Immunol. 187: 5026–5031. 27. Markel, P., P. Shu, C. Ebeling, G. A. Carlson, D. L. Nagle, J. S. Smutko, and 38. Cai, Y., C. Fleming, and J. Yan. 2012. New insights of T cells in the pathogenesis K. J. Moore. 1997. Theoretical and empirical issues for marker-assisted breeding of psoriasis. Cell. Mol. Immunol. 9: 302–309. of congenic mouse strains. Nat. Genet. 17: 280–284. 39. Ramı´rez-Valle, F., E. E. Gray, and J. G. Cyster. 2015. Inflammation induces 28. Hedrick, M. N., A. S. Lonsdorf, A. K. Shirakawa, C. C. Richard Lee, F. Liao, dermal Vg4+ gdT17 memory-like cells that travel to distant skin and accelerate S. P. Singh, H. H. Zhang, A. Grinberg, P. E. Love, S. T. Hwang, and J. M. Farber. secondary IL-17-driven responses. Proc. Natl. Acad. Sci. USA 112: 8046–8051. 2009. CCR6 is required for IL-23-induced psoriasis-like inflammation in mice. 40. Awasthi, A., L. Riol-Blanco, A. Ja¨ger, T. Korn, C. Pot, G. Galileos, E. Bettelli, J. Clin. Invest. 119: 2317–2329. V. K. Kuchroo, and M. Oukka. 2009. Cutting edge: IL-23 receptor gfp reporter 29. Uchio, K., B. Tuchweber, N. Manabe, G. Gabbiani, J. Rosenbaum, and mice reveal distinct populations of IL-17-producing cells. J. Immunol. 182: A. Desmoulie`re. 2002. Cellular retinol-binding protein-1 expression and mod- 5904–5908. ulation during in vivo and in vitro myofibroblastic differentiation of rat hepatic 41. Harden, J. L., S. M. Lewis, K. C. Pierson, M. Sua´rez-Farin˜as, T. Lentini, Downloaded from stellate cells and portal fibroblasts. Lab. Invest. 82: 619–628. F. S. Ortenzio, L. C. Zaba, R. Goldbach-Mansky, A. M. Bowcock, and 30. Nakashima, C., A. Otsuka, A. Kitoh, T. Honda, G. Egawa, S. Nakajima, M. A. Lowes. 2014. CARD14 expression in dermal endothelial cells in psoriasis. S. Nakamizo, M. Arita, M. Kubo, Y. Miyachi, and K. Kabashima. 2014. Baso- PLoS One 9: e111255. phils regulate the recruitment of eosinophils in a murine model of irritant contact 42. Suzuki, E., E. Maverakis, R. Sarin, L. Bouchareychas, V. K. Kuchroo, dermatitis. J. Allergy Clin. Immunol. 134: 100–107. F. O. Nestle, and I. E. Adamopoulos. 2016. T cell-independent mechanisms 31. Kanno, J., K. Aisaki, K. Igarashi, N. Nakatsu, A. Ono, Y. Kodama, and T. Nagao. associated with neutrophil extracellular trap formation and selective autophagy 2006. “Per cell” normalization method for mRNA measurement by quantitative in IL-17A-mediated epidermal hyperplasia. J. Immunol. 197: 4403–4412.

PCR and microarrays. BMC Genomics 7: 64. 43. Belkaid, Y., and S. Tamoutounour. 2016. The influence of skin microorganisms http://www.jimmunol.org/ 32. Ritchie, M. E., B. Phipson, D. Wu, Y. Hu, C. W. Law, W. Shi, and G. K. Smyth. on cutaneous immunity. Nat. Rev. Immunol. 16: 353–366. 2015. limma powers differential expression analyses for RNA-sequencing and 44. Kashem, S. W., M. Haniffa, and D. H. Kaplan. 2017. Antigen-presenting cells in microarray studies. Nucleic Acids Res. 43: e47. the skin. Annu. Rev. Immunol. 35: 469–499. by guest on September 28, 2021