DOCSLIB.ORG

Network-Based Metaanalysis Identifies HNF4A and PTBP1 As Longitudinally Dynamic Biomarkers for Parkinson’S Disease

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Network-Based Metaanalysis Identifies HNF4A and PTBP1 As Longitudinally Dynamic Biomarkers for Parkinson’S Disease Network-based metaanalysis identifies HNF4A and PTBP1 as longitudinally dynamic biomarkers for Parkinson’s disease Jose A. Santiago and Judith A. Potashkin1 Cellular and Molecular Pharmacology Department, Chicago Medical School, Rosalind Franklin University of Medicine and Science, North Chicago, IL 60064 Edited by Gregory A. Petsko, Weill Cornell Medical College, New York, NY, and approved January 7, 2015 (received for review December 11, 2014) Environmental and genetic factors are likely to be involved in the associated with PD. We performed a transcriptomic and net- pathogenesis of Parkinson’s disease (PD), the second most preva- work-based metaanalysis to identify key regulators and poten- lent neurodegenerative diseaseamongtheelderly.Network- tial diagnostic biomarkers. This is a powerful approach to in- based metaanalysis of four independent microarray studies iden- tegrate gene expression data and to gain insight into complex tified the hepatocyte nuclear factor 4 alpha (HNF4A), a transcrip- diseases (9). The utility of network biology to identify biolog- tion factor associated with gluconeogenesis and diabetes, as ically relevant biomarkers for neurodegenerative diseases has a central regulatory hub gene up-regulated in blood of PD been demonstrated recently. In this context, network analyses patients. In parallel, the polypyrimidine tract binding protein 1 identified the amyloid precursor protein (APP) and superoxide SOD2 (PTBP1), involved in the stabilization and mRNA translation of in- dismutase 2 ( ) mRNAs as blood biomarkers of PD (10, 11) PTPN1 sulin, was identified as the most down-regulated gene. Quantita- and protein tyrosine phosphatase 1 ( )mRNAasadi- tive PCR assays revealed that HNF4A and PTBP1 mRNAs were up- agnostic tool for progressive supranuclear palsy (12; reviewed and down-regulated, respectively, in blood of 51 PD patients and in ref. 9). In this study, network-based metaanalysis identified hepato- 45 controls nested in the Diagnostic and Prognostic Biomarkers for HNF4A Parkinson’s Disease. These results were confirmed in blood of 50 cyte nuclear factor 4 alpha ( ) and polypyrimidine tract binding protein 1 (PTBP1), previously implicated in diabetes, as PD patients compared with 46 healthy controls nested in the Har- NEUROSCIENCE vard Biomarker Study. Relative abundance of HNF4A mRNA corre- the most significant up- and down-regulated genes in blood of PD patients. These results were confirmed in blood samples lated with the Hoehn and Yahr stage at baseline, suggesting its from two independent clinical trials. Relative abundance of clinical utility to monitor disease severity. Using both markers, PD HNF4A mRNA correlated with disease severity in PD patients. patients were classified with 90% sensitivity and 80% specificity. Moreover, longitudinal analysis of HNF4A and PTBP1 revealed Longitudinal performance analysis demonstrated that relative HNF4A PTBP1 that their relative abundance changed over time, thus suggesting abundance of and mRNAs significantly decreased their potential use in tracking the clinical course of PD patients. and increased, respectively, in PD patients during the 3-y follow- HNF4A PTBP1 HNF4A PTBP1 Further evaluation of and mRNAs in patients at up period. The inverse regulation of and provides risk for PD is warranted. a molecular rationale for the altered insulin signaling observed in PD patients. The longitudinally dynamic biomarkers identified in Results this study may be useful for monitoring disease-modifying thera- Metaanalysis of Blood Microarrays in PD. To identify a common pies for PD. transcriptional signature in blood of PD patients, four microarray Parkinson’s disease | HNF4A | PTBP1 | network analysis | blood biomarkers Significance ubstantial efforts have been devoted to the development of ’ ’ Development of therapeutic strategies for Parkinson s disease Sdiagnostic strategies for Parkinson s disease (PD). In partic- (PD) is hampered by the lack of reliable biomarkers to identify ular, changes in mRNA from cellular whole blood can facilitate patients at early stages of the disease and track the therapeutic the identification of dysregulated processes and diagnostic bio- effect of potential drugs and neuroprotective agents. Readily markers for PD (1, 2). Several molecular signatures in blood accessible biomarkers capable of providing information about have been identified. For example, 22 unique genes were found disease status are expected to accelerate this progress. We iden- differentially expressed in blood of PD patients compared with tified hepatocyte nuclear factor (HNF4A) and polypyrimidine healthy controls (1). Likewise, specific splice variants in blood tract binding protein 1 (PTBP1) mRNAs as promising blood bio- were associated with PD in samples obtained from two in- markers for identifying early stage PD patients with high dependent clinical trials (2, 3). In addition, altered expression of diagnostic accuracy. Furthermore, HNF4A was identified as a the vitamin D receptor (VDR) in blood and reduced plasma potential biomarker to monitor disease severity. Longitudinal levels of 25-hydroxy vitamin D3 have been associated with PD analysis demonstrated that HNF4A and PTBP1 are longitudinally (1, 4). Furthermore, plasma levels of the epidermal growth factor dynamic biomarkers that provide insights into the molecular have been associated with cognitive decline in PD (5). mechanisms underlying the altered insulin signaling in PD pa- Environmental stressors and genetic factors are most likely tients and may enable novel therapeutic strategies. involved in the pathogenesis of PD. Among the genetic factors associated with PD, mutations in the gene encoding leucine-rich Author contributions: J.A.S. and J.A.P. conceived and designed the project; J.A.S. con- repeat kinase 2 (LRRK2) are the most common cause of auto- ducted microarray metaanalysis, network analyses, qPCR experiments, and statistical somal dominant PD (6) and a considerable risk factor in idio- analyses; and J.A.S. and J.A.P. wrote the paper. pathic forms of the disease (7, 8). Given the complex interaction The authors declare no conflict of interest. between environmental and genetic factors in sporadic PD, we This article is a PNAS Direct Submission. integrated four independent microarray studies from patients 1To whom correspondence should be addressed. Email: judy.potashkin@rosalindfranklin. harboring a mutation in the LRRK2 gene (G2019S; glycine-to- edu. serine substitution at amino acid 2019), sporadic patients, and This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. untreated PD patients to identify a universal signature in blood 1073/pnas.1423573112/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1423573112 PNAS Early Edition | 1of6 Downloaded by guest on October 4, 2021 studies (Table S1) were analyzed using Integrative Meta-Analysis and mannose metabolism, T-cell receptor-signaling pathway, of Expression Data (INMEX), a web interface for the integrative mammalian target of rapamycin-signaling pathway, type 2 di- metaanalysis (13). The overall metaanalysis workflow used in this abetes mellitus, and colorectal cancer. The most important hub study is shown in Fig. 1A. Metaanalysis using a Fisher’stest gene in terms of network topology measures of betweeness (BC) identified a total of 2,781 genes differentially expressed consis- and degree of centrality (DC) was HNF4A (BC = 2,213; DC = tently across four microarray studies. Among this group, 680 84) (Fig. 2A). genes were up-regulated and 2,101 were down-regulated in In parallel, down-regulated genes in blood of PD patients were PD compared with healthy controls. The thy-1 cell-surface anti- associated with the KEGG pathways, including protein pro- gen (THY1)andHNF4A were the most significant up-regulated cessing in the endoplasmic reticulum (ER), Epstein–Barr virus genes across the four microarray datasets. The complete list of infection, and several types of cancer including prostate, endo- differentially expressed genes is provided in Dataset S1.There metrial, and lung cancer. The most prominent hub gene in terms were 921 gained genes uniquely identified in the metaanalysis of network topology measures was ubiquitin C (UBC) (BC = that show relatively weak but consistent expression across the 495; DC = 1630), and PTBP1 was the most down-regulated gene four datasets. A total of 491 genes were classified as lost genes across the four microarray datasets (Fig. 2B and Dataset S1). (i.e., genes identified as differentially expressed genes in in- dividual datasets but not in the metaanalysis). A Venn diagram of Network-Based Metaanalysis. HNF4A was confirmed as potential metaanalysis results is shown in Fig. 1B, and a heat map visuali- key hub gene in blood of PD by network-based metaanalysis zation of the top 20 genes across the different studies is displayed implemented in NetworkAnalyst (14). The most highly ranked in Fig. 1C. node across the four datasets based on network topology mea- sures was HNF4A (BC = 329; DC = 35) followed by GATA1 Biological and Functional Analysis. To identify the overrepresented (BC = 10.5; DC = 8). The resulting zero-order interaction net- biological processes dysregulated in blood of PD patients, we work contained 76 nodes and 81 edges (Fig. S1). In addition, performed a gene pathway analysis using NetworkAnalyst (14). network-based metaanalysis identified the aberrant expression of Pathway analysis was performed using the set of up- and down- several splicing factors
Load more

Recommended publications
  • SF3B3) and Sin3a Associated Protein 130 (SAP130
    cells Communication Ambiguity about Splicing Factor 3b Subunit 3 (SF3B3) and Sin3A Associated Protein 130 (SAP130) Paula I. Metselaar 1,* , Celine Hos 1, Olaf Welting 1, Jos A. Bosch 2,3, Aletta D. Kraneveld 4 , Wouter J. de Jonge 1 and Anje A. Te Velde 1 1 Tytgat Institute for Liver and Intestinal Research, AGEM, Amsterdam UMC, University of Amsterdam, 1105BK Amsterdam, The Netherlands; [email protected] (C.H.); [email protected] (O.W.); [email protected] (W.J.d.J.); [email protected] (A.A.T.V.) 2 Department of Psychology, University of Amsterdam, 1018WS Amsterdam, The Netherlands; [email protected] 3 Department of Medical Psychology, Amsterdam UMC, University of Amsterdam, 1001NK Amsterdam, The Netherlands 4 Division of Pharmacology, Utrecht Institute for Pharmaceutical Sciences, Faculty of Science, Utrecht University, 3584CG Utrecht, The Netherlands; [email protected] * Correspondence: [email protected] Abstract: In 2020, three articles were published on a protein that can activate the immune system by binding to macrophage-inducible C-type lectin receptor (Mincle). In the articles, the protein was referred to as ‘SAP130, a subunit of the histone deacetylase complex.’ However, the Mincle ligand the authors aimed to investigate is splicing factor 3b subunit 3 (SF3B3). This splicing factor is unrelated to SAP130 (Sin3A associated protein 130, a subunit of the histone deacetylase-dependent Sin3A corepressor complex). The conclusions in the three articles were formulated for SF3B3, Citation: Metselaar, P.I.; Hos, C.; while the researchers used qPCR primers and antibodies against SAP130.
    [Show full text]
  • Coupling of Spliceosome Complexity to Intron Diversity
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.19.436190; this version posted March 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Coupling of spliceosome complexity to intron diversity Jade Sales-Lee1, Daniela S. Perry1, Bradley A. Bowser2, Jolene K. Diedrich3, Beiduo Rao1, Irene Beusch1, John R. Yates III3, Scott W. Roy4,6, and Hiten D. Madhani1,6,7 1Dept. of Biochemistry and Biophysics University of California – San Francisco San Francisco, CA 94158 2Dept. of Molecular and Cellular Biology University of California - Merced Merced, CA 95343 3Department of Molecular Medicine The Scripps Research Institute, La Jolla, CA 92037 4Dept. of Biology San Francisco State University San Francisco, CA 94132 5Chan-Zuckerberg Biohub San Francisco, CA 94158 6Corresponding authors: [email protected], [email protected] 7Lead Contact 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.19.436190; this version posted March 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. SUMMARY We determined that over 40 spliceosomal proteins are conserved between many fungal species and humans but were lost during the evolution of S. cerevisiae, an intron-poor yeast with unusually rigid splicing signals. We analyzed null mutations in a subset of these factors, most of which had not been investigated previously, in the intron-rich yeast Cryptococcus neoformans.
    [Show full text]
  • SF3B2-Mediated RNA Splicing Drives Human Prostate Cancer Progression
    Published OnlineFirst August 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3965 Cancer Molecular Cell Biology Research SF3B2-Mediated RNA Splicing Drives Human Prostate Cancer Progression Norihiko Kawamura1,2, Keisuke Nimura1, Kotaro Saga1, Airi Ishibashi1, Koji Kitamura1,3, Hiromichi Nagano1, Yusuke Yoshikawa4, Kyoso Ishida1,5, Norio Nonomura2, Mitsuhiro Arisawa4, Jun Luo6, and Yasufumi Kaneda1 Abstract Androgen receptor splice variant-7 (AR-V7) is a General RNA splicing SF3B2 complex-mediated alternative RNA splicing constitutively active AR variant implicated in U2 castration-resistant prostate cancers. Here, we show U2 snRNA that the RNA splicing factor SF3B2, identified by 3’ 3’ in silico and CRISPR/Cas9 analyses, is a critical 5’ 3’ splice site 5’ SF3B7 AR-V7 5’ A U2AF2 AGA Exon ? determinant of expression and is correlated SF3B6(p14) SF3B4 SF3B1 SF3B4 SF3B1 with aggressive cancer phenotypes. Transcriptome SF3B5 SF3B2 SF3B3 SF3B2 SF3B3 and PAR-CLIP analyses revealed that SF3B2 con- SF3A3 SF3B2 complex SF3A3 SF3A1 SF3A1 SF3b complex trols the splicing of target genes, including AR, to AR pre-mRNA drive aggressive phenotypes. SF3B2-mediated CE3 aggressive phenotypes in vivo were reversed by AR-V7 mRNA AR mRNA AR-V7 knockout. Pladienolide B, an inhibitor of CE3 a splicing modulator of the SF3b complex, sup- Drive malignancy pressed the growth of tumors addicted to high While the SF3b complex is critical for general RNA splicing, SF3B2 promotes inclusion of the target exon through recognizing a specific RNA motif. SF3B2 expression. These findings support the idea © 2019 American Association for Cancer Research that alteration of the splicing pattern by high SF3B2 expression is one mechanism underlying prostate cancer progression and therapeutic resistance.
    [Show full text]
  • Supplementary Files for Understanding the Functional Impact of Copy Number Alterations in Breast Cancers Using a Network Modeling Approach
    Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is © The Royal Society of Chemistry 2016 Supplementary files for Understanding the functional impact of copy number alterations in breast cancers using a network modeling approach Sriganesh Srihari1#, Murugan Kalimutho2#, Samir Lal3, Jitin Singla4, Dhaval Patel4, Peter T. Simpson3,5, Kum Kum Khanna2 and Mark A. Ragan1* 1Institute for Molecular Bioscience, The University of Queensland, St. Lucia, QLD 4072, Australia 2 QIMR-Berghofer Medical Research Institute, Brisbane, QLD 4006, Australia 3 The University of Queensland, UQ Centre for Clinical Research, Brisbane, QLD 4029, Australia 4 Indian Institute of Technology Roorkee, Roorkee, Uttarakhand 247667, India 5 The University of Queensland, School of Medicine, Brisbane, QLD 4006, Australia Supplementary website: http://bioinformatics.org.au/tools-data/ under NetStrat Section 4.1 of main text (Materials and Methods) Choosing cut-off A pair of genes (proteins) could be co-expressed due to a number of reasons – for example, by being co- regulated by the same transcription factor or due to co-functioning in a complex via direct interactions. To identify trans-associated genes we are only interested in gene pairs (i.e. interactions in the network) whose co- expression associates with the CNA of one or both genes. In Equation 2 (main manuscript), since we compute the weighted sum of CNAs, those gene pairs which do not exhibit any CNAs (zero or low CNAs) would be assigned zero or low weights and hence will not be accounted for. In addition, we would also like to discount gene pairs from the network that show low co-expression values, by using an cut-off on the co-expression.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • Open Data for Differential Network Analysis in Glioma
    International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes.
    [Show full text]
  • WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T (51) International Patent Classification: David [US/US]; 13539 N . 95th Way, Scottsdale, AZ C12Q 1/68 (2006.01) 85260 (US). (21) International Application Number: (74) Agent: AKHAVAN, Ramin; Caris Science, Inc., 6655 N . PCT/US20 12/0425 19 Macarthur Blvd., Irving, TX 75039 (US). (22) International Filing Date: (81) Designated States (unless otherwise indicated, for every 14 June 2012 (14.06.2012) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, English (25) Filing Language: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, Publication Language: English DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, KR, (30) Priority Data: KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, 61/497,895 16 June 201 1 (16.06.201 1) US MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 61/499,138 20 June 201 1 (20.06.201 1) US OM, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, SD, 61/501,680 27 June 201 1 (27.06.201 1) u s SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, 61/506,019 8 July 201 1(08.07.201 1) u s TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.
    [Show full text]
  • Mutations in Splicing Factor Genes in Myeloid Malignancies: Significance and Impact on Clinical Features
    cancers Review Mutations in Splicing Factor Genes in Myeloid Malignancies: Significance and Impact on Clinical Features Valeria Visconte 1, Megan O. Nakashima 2 and Heesun J. Rogers 2,* 1 Department of Translational Hematology and Oncology Research, Taussig Cancer Institute, Cleveland Clinic, Cleveland, OH 44195, USA; [email protected] 2 Department of Laboratory Medicine, Cleveland Clinic, Cleveland, OH 44195, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-216-445-2719 Received: 15 October 2019; Accepted: 19 November 2019; Published: 22 November 2019 Abstract: Components of the pre-messenger RNA splicing machinery are frequently mutated in myeloid malignancies. Mutations in LUC7L2, PRPF8, SF3B1, SRSF2, U2AF1, and ZRSR2 genes occur at various frequencies ranging between 40% and 85% in different subtypes of myelodysplastic syndrome (MDS) and 5% and 10% of acute myeloid leukemia (AML) and myeloproliferative neoplasms (MPNs). In some instances, splicing factor (SF) mutations have provided diagnostic utility and information on clinical outcomes as exemplified by SF3B1 mutations associated with increased ring sideroblasts (RS) in MDS-RS or MDS/MPN-RS with thrombocytosis. SF3B1 mutations are associated with better survival outcomes, while SRSF2 mutations are associated with a shorter survival time and increased AML progression, and U2AF1 mutations with a lower remission rate and shorter survival time. Beside the presence of mutations, transcriptomics technologies have shown that one third of genes in AML patients are differentially expressed, leading to altered transcript stability, interruption of protein function, and improper translation compared to those of healthy individuals. The detection of SF mutations demonstrates the importance of splicing abnormalities in the hematopoiesis of MDS and AML patients given the fact that abnormal splicing regulates the function of several transcriptional factors (PU.1, RUNX1, etc.) crucial in hematopoietic function.
    [Show full text]
  • Splicing Factors Sf3a2 and Prp31 Have Direct Roles in Mitotic Chromosome Segregation
    RESEARCH ARTICLE Splicing factors Sf3A2 and Prp31 have direct roles in mitotic chromosome segregation Claudia Pellacani1†, Elisabetta Bucciarelli1†, Fioranna Renda2‡, Daniel Hayward3, Antonella Palena1, Jack Chen3, Silvia Bonaccorsi2, James G Wakefield3, Maurizio Gatti1,2*, Maria Patrizia Somma1* 1Istituto di Biologia e Patologia Molecolari del CNR, Sapienza Universita` di Roma, Roma, Italy; 2Dipartimento di Biologia e Biotecnologie “C. Darwin”, Sapienza Universita` di Roma, Roma, Italy; 3Biosciences/Living Systems Institute, College of Life and Environmental Sciences, University of Exeter, Exeter, United Kingdom Abstract Several studies have shown that RNAi-mediated depletion of splicing factors (SFs) results in mitotic abnormalities. However, it is currently unclear whether these abnormalities reflect defective splicing of specific pre-mRNAs or a direct role of the SFs in mitosis. Here, we show that two highly conserved SFs, Sf3A2 and Prp31, are required for chromosome segregation in both Drosophila and human cells. Injections of anti-Sf3A2 and anti-Prp31 antibodies into Drosophila *For correspondence: embryos disrupt mitotic division within 1 min, arguing strongly against a splicing-related mitotic [email protected] (MG); function of these factors. We demonstrate that both SFs bind spindle microtubules (MTs) and the [email protected] Ndc80 complex, which in Sf3A2- and Prp31-depleted cells is not tightly associated with the (MPS) kinetochores; in HeLa cells the Ndc80/HEC1-SF interaction is restricted to the M phase.
    [Show full text]
  • Download From
    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.02.279679; this version posted September 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. A high-throughput CRISPR interference screen for dissecting functional regulators of GPCR/cAMP signaling Khairunnisa Mentari Semesta1, Ruilin Tian2,3,4, Martin Kampmann2,3, Mark von Zastrow5,6 and Nikoleta G. Tsvetanova1* 1 Department of Pharmacology and Cancer Biology, Duke University, Durham, NC 27710, USA 2 Insitute for Neurodegenerative Diseases, Department of Biochemistry and Biophysics, University of California, San Francisco, CA 94158, USA 3 Chen-Zuckerberg Biohub, San Francisco, CA 94158, USA 4 Biophysics Graduate Program, University of California, San Francisco, CA 94158, USA 5 Department of Psychiatry, University of California, San Francisco, CA 94158, USA 6 Department of Cellular & Molecular Pharmacology, University of California, San Francisco, CA 94158, USA * Correspondence: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.02.279679; this version posted September 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Abstract 2 G protein-coupled receptors (GPCRs) allow cells to respond to chemical and sensory 3 stimuli through generation of second messengers, such as cyclic AMP (cAMP), which in 4 turn mediate a myriad of processes, including cell survival, proliferation, and 5 differentiation.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name splicing factor 3b, subunit 3, 130kDa Gene Symbol SF3B3 Organism Human Gene Summary This gene encodes subunit 3 of the splicing factor 3b protein complex. Splicing factor 3b together with splicing factor 3a and a 12S RNA unit forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 3 has also been identified as a component of the STAGA (SPT3-TAF(II)31-GCN5L acetylase) transcription coactivator-HAT (histone acetyltransferase) complex and the TFTC (TATA-binding-protein-free TAF(II)-containing complex). These complexes may function in chromatin modification transcription splicing and DNA repair. Gene Aliases KIAA0017, RSE1, SAP130, SF3b130, STAF130 RefSeq Accession No. NC_000016.9, NG_027529.1, NT_010498.15 UniGene ID Hs.514435 Ensembl Gene ID ENSG00000189091 Entrez Gene ID 23450 Assay Information Unique Assay ID qHsaCIP0030454 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000302516, ENST00000310750 Amplicon Context Sequence GAGCCACTGGCATCAGCTTTGCCATTCATGGAAACTTTTCTGGAACCAAACAACA AGAAATTGTTGTTTCCCGTGGGAAGATCTTGGAGCTGCTTCGCCCAGACCCCAA CACTGGCAAAGTACATACCCTACTCACTGTGGAAGTATTCGGTGTTATCCGGTCA CTCATGGCCTTT Amplicon Length (bp) 146 Chromosome Location 16:70560588-70562909 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9986 Page 1/5 PrimePCR™Assay Validation Report cDNA Cq 18.72 cDNA Tm (Celsius) 83 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report.
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]