Netrin and netrin receptor expression in the adult rat spinal cord: Evidence that myelin-associated netrin-l is an inhibitor of neurite extension

Colleen Manitt

Department ofNeurology and Neurosurgery Montreal Neurological Institute, McGill University Montreal, Quebec, Canada

September 14, 2004

A thesis submitted to McGill University in partial fulfillment of the requirements for the degree of Doctor ofPhilosophy

© Colleen Manitt, 2004 Library and Bibliothèque et 1+1 Archives Canada Archives Canada Published Heritage Direction du Branch Patrimoine de l'édition

395 Wellington Street 395, rue Wellington Ottawa ON K1A ON4 Ottawa ON K1A ON4 Canada Canada

Your file Votre référence ISBN: 0-494-12900-X Our file Notre référence ISBN: 0-494-12900-X

NOTICE: AVIS: The author has granted a non­ L'auteur a accordé une licence non exclusive exclusive license allowing Library permettant à la Bibliothèque et Archives and Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par télécommunication ou par l'Internet, prêter, telecommunication or on the Internet, distribuer et vendre des thèses partout dans loan, distribute and sell th es es le monde, à des fins commerciales ou autres, worldwide, for commercial or non­ sur support microforme, papier, électronique commercial purposes, in microform, et/ou autres formats. paper, electronic and/or any other formats.

The author retains copyright L'auteur conserve la propriété du droit d'auteur ownership and moral rights in et des droits moraux qui protège cette thèse. this thesis. Neither the thesis Ni la thèse ni des extraits substantiels de nor substantial extracts from it celle-ci ne doivent être imprimés ou autrement may be printed or otherwise reproduits sans son autorisation. reproduced without the author's permission.

ln compliance with the Canadian Conformément à la loi canadienne Privacy Act some supporting sur la protection de la vie privée, forms may have been removed quelques formulaires secondaires from this thesis. ont été enlevés de cette thèse.

While these forms may be included Bien que ces formulaires in the document page count, aient inclus dans la pagination, their removal does not represent il n'y aura aucun contenu manquant. any loss of content from the thesis. ••• Canada TABLE OF CONTENTS

Acknowledgements ...... 4 Abstract ...... 6 Résumé ...... 8 List of figures ...... 10 List of abbreviations ...... II Contribution of authors ...... 13

CHAPTER 1: LITERATURE REVIEW ...... 15 1. The netrins are guidance cues in the embryonic CNS ...... 15 A. The netrin gene family ...... 16 II. Netrin receptors ...... 18 A. The DCC Family of Netrin Receptors ...... 18 B. The UNC-5 homologue family ofnetrin receptors ...... 19 C. Interaction of netrin family members with identified netrin receptors .... 20 III. Functional interactions between DCC and UNC-5 homologue netrin receptors. 22 IV. Netrin signal transduction and growth cone guidance ...... 23 V. Mechanisms that regulate netrin function ...... 26 A. Regulation by cyc\ic nuc\eotides ...... 26 i. Is the Adenosine A2B Receptor a Netrin-I Receptor? ...... 27 B. Receptor targeting to the ceH surface ...... 28 C. Local protein synthesis in growth con es ...... 28 D. Protease-mediated c\eavage from plasma membrane ...... 29 E. DCC receptor silencing: hierarchical control ofaxon guidance function 29 VI. Short-range functions of netrin ...... 30 A. CNS and PNS ...... 30 B. Non-neural tissues ...... 30 VII. Summary ...... 31 RESEARCH RATIONALE AND OBJECTIVES ...... 32

Preface to chapter 2 ...... 34 CHAPTER 2: WIDESPREAD EXPRESSION OF NETRIN-l BY NEURONS AND OLIGODENDROCYTES IN THE ADULT MAMMALIAN SPINAL CORD ...... 35 1. Summary ...... 36 II. Introduction ...... 37 III. Experimental procedures ...... 39 IV. Results ...... 45 V. Discussion ...... 52

Preface to chapter 3 ...... 72 CHAPTER 3: A DEVELOPMENTAL SHIFT IN EXPRESSION OF NETRIN RECEPTORS IN THE RAT SPINAL CORD: PREDOMINANCE OF UNC-5 HOMOLOGUES IN ADULTHOOD ...... 73 1. Summary ...... 74 II. Introduction ...... 75

2 III. Experimental procedures ...... 77 IV. Results ...... 82 V. Discussion ...... 87

Preface to chapter 4 ...... 102 CHAPTER4: EVIDENCE THAT MYELIN-ASSOCIATED NETRIN-l IS AN INHIBITOR OF NEURITE EXTENSION ...... 104 1. Summary ...... 105 II. Introduction ...... 106 III. Experimental procedures ...... 108 IV. Results ...... 112 V. Discussion ...... 116

CHAPTER 5: GENERAL DISCUSSION ...... 125 1. Netrin expression in the adult spinal cord ...... 125 II. Does netrin in the spinal cord switch from a long-range to a short-range cue with maturation? ...... 126 III. Netrin and netrin receptor expression in adult neurons ...... 128 IV. Changes in netrin and netrin receptor expression in neurons during maturation. 129 V. Potential role of netrin and netrin receptors in neurons ...... 130 VI. Netrin-l is expressed by oligodendrocytes and is enriched in periaxonal myelin 131 VII. Netrin-l is a myelin-associated inhibitor of neurite extension ...... 132 VIII. Intraneuronal cAMP levels determine the response to myelin-associated netrin-l ...... 133 IX. Myelin regulates netrin receptor levels ...... 135 X. Potential mechanisms that regulate the response to myelin-associated netrin-l . 135 XI. Common signaling pathways ...... 137 XII. Role ofmyelin-associated netrin following injury ...... 138

Conclusions & future directions ...... 140 References ...... 141

3 ACKNOWLEDGEMENTS

First, 1 would like to thank my supervisor Dr. Tim Kennedy for providing me with the opportunity to pursue a PhD, and for the guidance he provided throughout my degree. 1 am particularly grateful for the time and effort that he dedicated to helping me develop my scientific ski Ils. 1 would also like to thank the members of my advisory and thesis committees: Drs Phil Barker, David Kaplan, Alan Peterson, Yong Rao, Alyson Fournier, Fiona Bedford, and Peter Grütter. 1 have worked alongside many Kennedy lab members throughout my degree, and ail have been a source of knowledge and inspiration. 1 have learned something from each and every one of you. Thank you. 1 would like to give special thanks to Kate Thompson who collaborated with me on many projects and was an absolute joy to work with. It wouldn 't have been the same without you. 1 also would like to thank Ron Shatzmiller, Danny Baranes, and Mike Colicos who worked with me in the early years ofmy degree. Mike was a tremendous help to me, taking the time to teach me so many things. Ron and Danny, you al ways made the lab a pleasant place to be and 1 am grateful for the friendships we have maintained since. 1 also thank Masoud Shekarabi for being a good colleague and friend. 1 wish to thank Sonia Rodrigues for her skill and dedication. 1 am very grateful for the excellent contributions that you made at the end, and regret that we did not get the opportunity to work together longer. 1 would also like to thank the "Concordia" gang who, in the end, are the scientists 1 have known the best and the longest. Melissa, Owen, Naomi, Rob, Hugo, Heather, Cathy, and Alfonzo, thank you for always helping to put things into perspective and for being so much fun. 1 want to especially thank Melissa and Owen, who mean the world to me, for ail their support and encouragement. It was a great relief to know that you understood. 1 would also like to thank Adèle and Barrie Yates, for being so patient and understanding about ail the get-togethers 1 had to miss, as weil as Seri, Jeff, and Daniella for reminding me about the things that really matter. 1 also want to thank Cecilia Flores. For you energy, your enthusiasm, and for ail your help over the years, 1 am deeply grateful. You have had a major impact on me,

4 scientifically and otherwise. 1 am a better scientist and a stronger pers on today because of you. Thank you. 1 am also extremely grateful to Karine Devantéry, ma soeur, for having been a part of so many important moments. Your individuality and ail the dreams you make a reality have been a tremendous source of inspiration to me. Vou have given me more support than you know. 1 also thank you for helping to translate the thesis abstract. 1 am grateful to my brother Russ who has always expressed an interest in ail things meaningful to me. Your intelligence, humor, and company are among the things 1 cherish most in my life. 1 thank you for constantly making me see things in new ways. To my parents who have al ways supported me in ail my endeavors. Vou have given me a profound respect for knowledge and the drive with which to seek it. 1 thank you for your love, your easy-going ways, and for always being there for me. Your generosity and kindness have known no bounds. 1 cannot express how grateful 1 am to you. It is difficult to put into words how grateful 1 am to my husband, Jodye Yates. It has been a long road in so many ways and you have traveled it with me. Ali your many kindnesses, great and small, over the course of this degree were al ways appreciated, if not al ways acknowledged. 1 am also grateful for your attention and enthusiasm while editing versions of my thesis! 1 thank you for your love, support, and ail the things you mean to me. 1 would not have accomplished ail that 1 have or become the pers on 1 am today were it not for you.

5 ABSTRACT

The netrins are a family of secreted proteins with a weil characterized role in directing migrating cells and axons during embryogenesis. Netrin-I is also expressed in the adult CNS, although its function in the adult is not known. Characterization of netrin-I in the adult spinal cord indicated that it is expressed by neurons and oligodendrocytes and that following its secretion, netrin-I is associated with membranes and extracellular matrix (ECM). Netrin-I attracts or repels different cell types in the developing CNS. The repertoire of netrin receptors expressed exerts a key influence on the response of a cell to netrin-I. Expression of the netrin receptor DCC, required for an attractive response, decreased during spinal cord development, resulting in barely detectable levels in the adult. Conversely, UNC-5 homologues, required for a repellent response, were expressed in the adult at higher levels than during development. These findings suggested that in the adult spinal cord netrin-\ may function predominantly as a short-range cue that inhibits certain forms of plasticity. The mammalian CNS undergoes a dramatic reduction in regenerative capacity with maturation. This correlates with the onset of myelination and is due, in part, to the presence of myelin-associated inhibitors. Subcellular fractionation of myelin demonstrated that netrin-I is present in fractions enriched with periaxonal membranes, suggesting that netrin-\ might be a novel myelin-associated inhibitor of neurite extension. Our results demonstrated that perturbing netrin function in specific neuronal subtypes improved neurite outgrowth on mye\in substrates. Furthermore, myelin was found to promote either the expression or the stability of receptors that mediate a repellent response to netrin-I. The concentration of cytosolic cAMP decreases with maturation, and the ability of myelin inhibitors to exert inhibitory effects on axon extension have been shown to be dependent on reduced levels of cAMP. Furthermore, increasing the levels of cAMP following injury improves regeneration. The response to netrin-\ is also regulated by cAMP, with \ow levels being associated with repulsion and high levels with attraction. We assessed whether myelin-associated netrin-\ contributes to the improvement in neurite outgrowth that is observed wh en the levels of cAMP are increased, by switching its function from repulsion to attraction. Blocking netrin function in neurons treated with the membrane

6 permeable cAMP analogue, db-cAMP, inhibited the growth improving effects normally induced by increasing the levels of cAMP. These findings support the hypothesis that myelin associated netrin-I is an inhibitor of neurite extension that is modulated by the levels of intraneuronal cAMP, and suggest that netrin-I inhibits axonal sprouting in the intact CNS and regeneration following in jury.

7 RÉSUMÉ

Les netrines sont une famille de protéines sécrétées, qui ont un rôle bien caractérisé dans le guidage des cellules migratoires et des axones pendant l'embryogénèse. Netrine-l est aussi présente dans la moelle épinière de l'adulte, mais son rôle n'a pas encore été déterminé. La caractérisation de netrine-l dans la moelle épinière adulte a identifié les neurones et les oligodendrocytes comme étant des cellules qui l'expriment. Des fractionnements cellulaires indiquent que suite à sa sécrétion, netrine-l s'associe aux membranes cellulaires et à la matrice extracellulaire. Netrine-l peut attirer ou repousser différent types de neurones durant le développement du système nerveux. Le répertoire de récepteurs à la netrine-l exprimé par une cellule, influence si son axone sera attirée ou repoussée par netrine. Le niveau d'expression de DCC, un récepteur à la netrine qui est associé a l'attraction, baisse durant la maturation du système nerveux contrairement aux homologues de UNC-S, récepteurs associés à la répulsion, qui eux augmentent avec l'âge. Ces résultats suggèrent, chez l'adulte, que netrine fonctionne de façon prédominante comme un signal à courte distance ayant pour fonction d'inhiber certaines formes de plasticité. La capacité de régénération du système nerveux central mammifère réduit dramatiquement avec sa maturation. Ce changement développemental est en lien avec le début de la myélinisation et est en partie causé par la présence de protéines inhibitrices de la myéline. Le fractionnement de la matière blanche de la moelle épinière adulte a démontré que netrine-l s'associe aux membranes périaxonales, suggérant que netrine-l est un nouveau facteur inhibiteur d'extension axonale associé à la myéline. Nos résultats ont démontrés que la perturbation de la fonction de netrine améliore l'extension axonale sur des substrats de myéline. De plus, nous avons découvert que la myéline favorise l'expression et/ou la stabilité des récepteurs à la netrine-l qui transmettent la répulsion. Les niveaux d'AMPc diminue avec la croissance, et les inhibiteurs associés à la myéline dépendent de cette réduction d'AMPc pour pouvoir exercer leurs influences inhibitrices sur l'extension axonale. De plus, augmenter le niveau d'AMPc après une lésion améliore la régénération. La réaction neuronale à la netrine-l dépend elle aussi des niveaux d'AMPc intraneuronal: des niveaux élevés favorisent l'attraction et des niveaux bas

8 favorisent la répulsion. Nous avons aussi évalué si netrine-I contribue à l'amélioration d'extension axonale sur des substrats de myéline quand les niveaux d'AMPc sont augmentés. La perturbation de la fonction de netrine-I dans des neurones exposés à un analogue d'AMPc lorsqu'elles tentent de croître sur des substrats de myéline, a bloqué les effets positifs habituellement causés par l'augmentation d'AMPc. Ces résultats supportent l 'hypothèse que netrine-I associée à la myél ine est un inhibiteur de croissance neuronal et est modulée par les niveaux d'AMPc. Ceci suggère qu'elle inhibe la plasticité neuronale dans la moelle épinière intacte et la régénération suite a une lésion.

9 LIST OF FIGURES

Figure 1.1 Netrins are homologous to Laminins ...... 16 Figure 1.2 Commissural intemeuron trajectory to the ventral midline of the embryonic neural tube ...... 17 Figure 2.1 Distribution of netrin-l expressing cells in adult rat spinal cord ...... 56 Figure 2.2 Distribution of netrin-l protein in adult rat spinal cord ...... 58 Figure 2.3 Netrin-l expression by neurons ...... 60 Figure 2.4 Netrin-l is not expressed by astrocytes ...... 62 Figure 2.5 Oligodendroctyes express netrin-l in the adult spinal cord ...... 64 Figure 2.6 Postnatal expression and subcellular enrichment of netrin protein ...... 66 Figure 2.7 Netrin-l is enriched in periaxonal myelin ...... 68 *Figure 2.8 Schematic describing the subcellular fractionation used in figure 2.6 ...... 71 Figure 3.1 Northem blot analysis ofnetrin receptor expression ...... 91 Figure 3.2 Developmental shift in expression of DCC and UNC-5 homologue protein 93 Figure 3.3 Distribution of netrin receptor mRNA expression ...... 95 Figure 3.4 DifferentiaI expression ofnetrin receptors in the dorsal hom of the adult spinal Cord ...... 97 Figure 3.5 Altematively spliced netrin receptor mRNA in adult rat spinal cord ...... 99 Figure 3.6 Schematic summarizing the distribution of netrin-1 and netrin receptor expression in the adult spinal cord ...... 101 Figure 4.1 Commissural neuron outgrowth is inhibited by myelin-associated netrin-1 . 121 Figure 4.2 cAMP mediates the direction of outgrowth responses to myelin-associated netrin-1 in cerebellar granule cells ...... 123 Figure 5.1 Netrin-1 mRNA and protein distribution in the embryonic spinal cord ...... 126 Figure 5.2 Models illustrating the possible mechanisms by which a graded distribution ofNetrin-l is formed in the embryonic spinal cord ...... 128 Figure 5.3 Netrin-l is localized to membranes at the periaxonal space ...... 132

Table 1.1 Identified netrin and netrin receptors ...... 21 Table 2.1 Enrichment of netrin-l after subcellular fractionation of adult spinal cord .... 70

*Note that this is a supplemental figure added to the original manuscript.

10 LIST OF ABBREVIA TIONS

3'-UTR 3' untranslated region A2b adenosine-2b BDNF brain-derived neurotrophic factor p-gal beta-galactosidase BiP immunoglobulin binding protein BSA bovine serum albumin cAMP cyclic adenosine monophosphate cDNA recombinant DNA CNP 2',3'-cyclic nucleotide 3'-phosphodiesterase CNS central nervous system cRNA recombinant RNA DAB diaminobenzidene DIG digoxygenin DCC deleted in colorectal cancer DNA deoxyribonucleic acid E(#) embryonic day # ECM extracellular matrix EDTA ethylenediaminetetraacetic acid Ena/VASP enabled/vasodilator-stimulated phosphoprotein EST expressed sequence tags ER endoplasmic reticulum GFAP glial fibrillary acidic protein GPI glycosyl phosphatidyl-inositollipid GST glutathione S-transferase H202 hydrogen peroxyde HSEP High-Salt Extract Pellet HSES High-Salt Extract Supematant HSP High Speed Pellet HSS High Speed Supematant Ig immunoglobul in Kb kilobases kDa kiloDaltons LSP Low Speed Pellet LSS Low Speed Supematant MAG myelin associated glycoprotein MAPK mitogen-activated protein kinase MBP myelin basic protein mRNA messenger RNA MSP Medium Speed Pellet MSS Medium Speed Supematant NaCI sodium chloride NeuN neuronal neuclei NFM neurofi lament NGF nerve growth factor

Il P(#) postnatal day # PAGE polyacrylamide gel electrophoresis PBS phosphate buffered saline PCR polymerase chain reaction PKA protein kinase A PKC protein kinase C PMSF phenyl methyl sulfonyl fluoride PN2 polyclonal netrin antibody #2 PN3 polyclonal netrin antibody #3 POO peroxydase RCM rostral cerebellar malformation RGC retinal ganglion cell RNA ribonucleic acid Robo roundabout SOS Sodium Oodecyl Sulfate TGF Transforming Growth Factor TIMPs tissue inhibitors of metalloproteases Trk-8 tyrosine kinase B TSPI thrombospondin type 1 TSA tyramide signal amplification UNC uncoordinated phenotype UNC5HI,2,3 uncoordinated phenotype 5 homologue l, 2, and 3

12 CONTRIBUTION OF AUTHORS

CHAPTER 1: * Sections of the literature review in Chapter 1 where taken trom: Manitt C. and Kennedy T.E. (2002). Where the rubber meets the road: netrin expression and function in developing and aduIt nervous systems. Prog. Brain Res. 137:425-42.

1 wrote the manuscript in collaboration with Dr. Kennedy.

CHAPTER2: Manitt c., Colicos M.A., Thompson KM., Rousselle E., Peterson A.c. & Kennedy T.E. (2001). Widespread expression of netrin-I by neurons and oligodendrocytes in the aduIt rat spinal cord. 1. Neurosci. 21 (II): 3911-3922.

The rational for this project was devised by Dr. Kennedy and myse1f. 1 performed every experiment reported in this paper, as weil as ail peripheral experiments required for their execution with the exception of the c10ning and sequencing of rat netrin-l and netrin-3, which were performed by K. M. Thompson and E. Rousselle. M. Colicos provided training and guidance and performed pilot studies for the netrin-I in situ hybridization experiment. A transgenic mouse was used in one of the experiments which was provided by Dr. Alan Peterson. 1 wrote the manuscript in collaboration with Dr. Kennedy.

Contribution to figures: C.Manitt Figures 2.1,2.2,2.3,2.4,2.5,2.6,2.7

13 CHAPTER3: Manitt c., Thompson K.M., & Kennedy T.E. A developmental shift in expression of netrin receptors in the rat spinal cord: Predominance of UNC-5 homologues in adulthood. 1. Neurosci Res. 77(5) : 690-700.

The rational for this project was devised by Dr. Kennedy and myself in collaboration with K.M Thompson. 1 wrote the manuscript with support from Dr. Kennedy.

Contribution to figures: C. Manitt Figures 3.1,3.2,3.3,3.4,3.6 K. Thompson Figure 3.5

CHAPTER4: Manitt c., Thompson KM., Rodrigues S. & Kennedy TE

The rational for this study was devised by Dr. Kennedy and myself. K.M. Thompson acquired the technique for the cerebellar granule cell cultures and performed the culture preparation in sorne of the experiments. S. Rodrigues aided in microdissecting embryonic spinal cords for the commissural neuron cell cultures. 1 wrote the manuscript with support from Dr. Kennedy.

Contribution to figures: C. Manitt Figures 4.1, 4.2

14 CHAPTER 1: LITERATURE REVIEW

During embryogenesis, axons extend across considerable distances to reach their appropriate target regions where they will eventually form synapses. The growth cone is the sensory apparatus at the leading edge of an extending axon that can detect, integrate and rapidly respond to environmental cues in order to make a pathfinding decision. These guidance cues function either at long-range or short-range (reviewed by Huber et al., 2003). Long-range cues interact with neuronal growth cones at a distance from their source of production in the target region, while short-range cues influence axon growth on the surface of the cell that produced them. These cues have either attractant or repellent activity. In many cases a specific cue can exert both attractant and repellent effects depending on a number of factors. The netrins are a family of guidance cues that have been weil characterized for their role in organizing neural networks in embryogenesis.

1. The Netrins are Guidance Cues in the Embryonic CNS The first netrins found in vertebrates were purified from embryonic brain on the basis of an in vitro functional assay designed to identify proteins that could promote commissural axon outgrowth (Tessier-Lavigne et al., 1988; Serafini et al., 1994). This as say was based on the proposaI and subsequent demonstration that embryonic spinal commissural axons are attracted by a diffusible cue secreted by the floor plate (Ramon y Cajal, 1909; Weber 1938; Tessier-Lavigne et al. 1988; Placzek et al. 1990). Netrin-l is expressed by floor plate cells as commissural axons extend toward the ventral midline (Figure 1.2), and like the floor plate, a source of recombinant netrin-I protein attracts commissural axons (Kennedy et al., 1994). In mice lacking netrin-I function, the corpus callosum, hippocampal commissure, and ventral spinal commissure ail fail to form, indicating that netrin-I is required for the development of multiple commissural projections (Serafini et al., 1996). Although initial studies focused on the ability of netrin- 1 to attract extending axons, Colamarino and Tessier-Lavigne (1 995a) demonstrated that netrin-I also functions as a repellent for other axons. Together, these findings led to the proposaI that a gradient of netrin protein emanating from the floor plate orients the growth of multiple populations of axons as they extend circumferentially toward or away from the

15 ventral midline of the embryonic CNS. Netrins not only guide extending axons, but also direct the migration of neuronal cells, glial precursor cells, and mesodermal cells during embryogenesis (Wadsworth et al., 1996; Ackerman et al., 1997; Yee et al., 1999; Kim et al., 1999; Bloch-Gallego et al., 1999; Alcantara et al., 2000; Su et al., 2000; Sugimoto et al., 2001; Hamasaki et al., 2001; Jarjour at al., 2003; Tsai et al., 2003).

A. The netrin gene family Five members of the netrin gene family have a laminin been identified in mammals: netrin-l, netrin-3, netrin-

G 1, netrin-G2, netrin-4, also called ~netrin (Serafini et al., 1996; Wang et al., 1999; Nakashiba et al., 2000; netrin 4/finetnn netrin 1.2.3.G1 ~ ..... Y 2002; Yin et al., 2000; Koch et al., 2000). Orthologs of III ---N Il VI each ofthese netrin family members have been identified in the human genome (Table 1.1, page 20). Ali encode -65 KDa secreted proteins made up of three domains (VI, V, and C) and an amino terminal signal peptide .~. characteristic of secreted proteins. Domains V and VI of ... Figure 1.1 Netrins are homologous to netrins are homologous to domains V and VI of laminins laminins. Schernatic illustrating the relative size of netrins (-65 kDa) and the heterotrirnenc laminin molecule (-800 kDa; (Figure 1.1). No domain homologous to the netrin C composed of three laminin polypeptides. a, 13. y). Different netrins have greater domain is present in the laminin family; however the amino acid identity with different laminin polypeptides. (Manitt and Kennedy. 2002). netrin C domain has sorne similarity to sequences present in the complement and tissue inhibitors ofmetalloproteases (TIMPs) protein families (lshii et al., 1992; Banyai and Patthy, 1999; Sandoval et al., 2000). The functional significance of this homology is unknown. The netrin C domain binds heparin with high affinity (Kappler et al., 2000) and it is likely that components of the cell surface or extracellular matrix (ECM), such as glycosaminoglycans, may bind to the C domain and influence the ability of netrins to diffuse. This type of interaction may function to concentrate netrin locally, present netrin to netrin receptors and determine if netrin functions as a short-range or a long-range cue in different contexts. Six alternatively spliced variants have been reported for netrin-G 1 (Nakashiba et al., 2000), and 3 have been reported for netrin-G2 (Nakashiba et al., 2002). Unlike other netrins, which are secreted, several of these are

16 bound to the plasma membrane via a glycosyl phosphatidyl-inositol lipid (GPI) anchor linked to the C domain. Netrin family members identified in non-mammalian vertebrate species include chicken netrin-I and netrin-2 (Kennedy et al., 1994), zebrafish netrin-I and netrin-I a (Lauderdale et al., 1997; Strahle et al., 1997; MacDonald et al., 1997), Xenopus netrin-I (de la Torre et al., 1997), and a netrin from P. marinus, the sea lamprey (Shifman and Selzer, 2000b). Netrins have been identified in several invertebrate species including AmphiNetrin from B. floridae, the cephalochordate amphioxus (Shimeld et al., 2000), the ascidian C. intestinalis or sea squirt, also a chordate (Takamura, Genbank BAA94302), H. medicinalis, the medicinal leech (Gan et al., 1999), D. melanogaster (Harris et al., 1996; Mitchell et al., 1996), and C. elegans (Ishii et al., 1992) (Table 1.1, page 20). UNC-6, the first member of the netrin family identified, was discovered using a genetic assay for defects in neural development by examining C. elegans mutants with uncoordinated (unc) phenotypes (Hedgecock et al., 1990; Ishii et al., 1992). Loss ofUNC- 6 function produces defects in the trajectories of axons that normally extend circumferentially toward or away from the ventral midline of the developing nematode. In a pattern reminiscent of netrin expression by floor plate cells D at the ventral midline of the embryonic vertebrate neural tube, unc-6 is expressed by a row of epidermoblasts at the ventral midline of the developing worm (Wadsworth et al., 1996). Two netrins have been identified in D. melanogaster, netrin-A and netrin-B (Harris et al., 1996; Mitchell et al., 1996). Both are expressed by glial cells at the ventral midline of the embryonic D. melanogaster CNS and loss of netrin function causes defects in commissure formation. These findings indicate that netrins perform a highly Figure 1.2. Commissural inlemeuron (eN) trajecory 10 the ventral midline of conserved function, guiding circumferential axon extension the embryonic neural tube. D. dorsal; V. ventral; FP. floor plate (netrin-1 mRNA in deve10ping vertebrate and invertebrate nervous systems expression in red). (Manitt and Kennedy. 2(02). (Figure 1.2).

17 II. Netrin Receptors Candidate netrin receptors were first identified in C. elegans based on the similarity of une-5, une-40, and netrin une-6 mutant phenotypes. Hedgecock et al. (1990) proposed that the phenotypes of these mutants revealed the presence of a circumferential guidance mechanism in the developing nematode. Mutation of une-5 caused defects in ventral to dorsal migration, away from une-6 expressing cells, mutation of une-40 produced defects in dorsal to ventral migration, toward une-6 expressing cells, and mutation of une-6 caused defects in both trajectories. Cloning of une-40 and une-5 indicated that they encode transmembrane members of the Ig superfamily, and both are expressed by neurons as they extend axons during development in C. elegans (Leung­ Hagesteijn et al., 1992; Chan et al., 1996). Homologues of une-40 and une-5 have been identified in many species and make up the DCC and the UNCS homologue families of netrin receptors (Table 1.1, page 20).

A. The DCC family of netrin receptors The DCC family includes DCC and neogenln ln vertebrates, frazzled ln D. melanogaster, and UNC-40 in C. elegans (Fearon et al., 1990; Chuong et al., 1994; Pierceall et al., 1994; Vielmetter et al., 1994, 1997; Cooper et al., 1995; Kolodziej et al., 1996; Keino-Masu et al., 1996; Chan et al., 1996; Keeling et al., 1997; Meyerhardt et al., 1997; Hjorth et al., 2001) (Table 1.1, page 20). The extracellular domain of each of these proteins is composed of four immunoglobulin (Ig) domains followed by six fibronectin type III (FNIII) repeats, a transmembrane domain and an intracellular domain. Strong evidence indicates that DCC is a receptor mediating the chemoattractant response to netrin-I. In the embryonic vertebrate nervous system, spinal commissural neurons express dee as their axons extend toward the floor plate. DCC binds netrin-I (Keino-Masu et al., 1996; Stein et al., 2001) and antibodies that block DCC function block the ability of the floor plate to promote commissural axon outgrowth (Keino-Masu et al. 1996). Furthermore, the phenotype of dee knockout mice (Faze\i et al., 1997) is very similar to that generated by loss of netrin-I (Sera fini et al., 1996). Neogenin, a second member of the DCC family in vertebrates (Vielmetter et al., 1994; Meyerhardt et al., 1997; Keeling et al., 1997) is expressed by neurons and non-

18 neuronal cells in the CNS during embryogenesis (Vielmetter et al., 1994). Dcc expressing embryonic spinal commissural neurons do not express neogenin as they extend their axon toward the floor plate (Keino-Masu et al., 1996). Neogenin binds netrin-I (Keino-Masu et al., 1996) but its function as a netrin receptor in the central nervous system remains unknown. In a non-neuronal system however, netrin-I/neogenin interactions have been shown to mediate a short-range adhesion between epithelial cell layers during mammary gland development (Srinivasan et al., 2003). Interestingly, neogenin has recently been shown to function as the receptor for Repulsive Guidance Molecule (RGM), an axon guidance cue unrelated to netrin that directs the development of retinal cells (Rajagopalan et al., 2004). RecentIy, RGM and neogenin have been implicated in mediating cell survival (Matsunaga et al., 2004). AItematively spliced mRNA transcripts of both neogenin and dcc have been identified but their significance is not known (Vielmetter et al., 1994; Reale et al., 1994; Keeling et al., 1997).

B. The UNC-5 homologue family of netrin receptors UNC-5 and its vertebrate homologues are single-pass transmembrane proteins composed of extracellular Ig-like domains, two thrombospondin type 1 domains, and an intracellular sequence that contains a ZU5 domain and a death domain. The trajectories of axons extending away from a source of the netrin UNC-6 are disrupted in C. elegans unc- 5 mutants, indicating that the chemorepellent response requires UNC-5 (Hedgecock et al., 1990). In D. melanogaster, unc-5 is expressed by a subset of motoneurons whose axons exit the CNS without crossing the midline and th en avoid netrin expressing muscles in the periphery (Keleman and Dickson, 2001). Furthermore, in both C. elegans and D. melanogaster, ectopic expression of unc-5 in neurons that either normally do not respond to netrin or are attracted toward a source of netrin, caused their axons to be repelled by netrin in vivo (Hamelin et al., 1993; Keleman and Dickson, 2001). These findings are consistent with UNC-5 mediating a repellent response to netrin.

Three UNC-5 homologues have been identified In mammals, ail are transmembrane proteins and ail bind netrin-I, suggesting that they function as netrin receptors (Ackerman et al., 1997; Leonardo et al., 1997). Analysis of the unc5H3 mouse mutant (rostral cerebellar malformation, rcm, Ackerman et al., 1997; przyborski et al.,

19 1998) indicates that UNC5H3 is required for the migration of granule cell and Purkinje cell precursors during cerebellar development. The displacement of the neuronal precursors found in the mutant is consistent with UNC5H3 mediating a repellent migratory response to netrin-1. More recently, a role for UNC5H3 in vertebrate axon guidance has been confirmed in the development of the corticospinal tract (Finger et al., 2002).

C. Interaction of netrin family members with identified netrin receptors Although five netrins have now been identified in vertebrate species, it appears that not ail of these interact with known netrin receptors. Evidence has been provided that netrin-I and netrin-3 bind DCC, neogenin, UNC5H 1, UNC5H2, and UNC5H3 (Keino­ Masu et al., 1996; Leonardo et al., 1997; Wang et al., 1999). Netrin-I, netrin-2, and netrin- 3 promote DCC dependent axon outgrowth from multiple neuronal cell types (Keino­ Masu et al., 1996; Deiner et al., 1997; de la Torre et al., 1997; Wang et al., 1999; Hong et al., 1999). Netrin-I and netrin-3 repel the axons of embryonic trochlear motoneurons

(Colamarino and Tessier-Lavigne 1995; Wang et al., 1999). Recombinant netrin-4/~-netrin evokes the outgrowth of axons from explants of embryonic rat olfactory bulb, but it is not known if this response requires DCC or if these neurons express dcc (Koch et al., 2000). Current evidence indicates that none of the known netrin receptors bind netrin-G 1 or netrin-G2. Consistent with this, recombinant netrin-G 1 did not promote the outgrowth of cerebellofugal axons from ex plants of embryonic cerebellar plate (Nakashiba et al., 2000), axons that extend toward a source of netrin-I (Shirasaki et al., 1995). However, netrin-G 1 and netrin-G2 were later reported to promote neurite outgrowth in thalamic and neocortical neurons wh en presented as substrates, suggesting that the netrin-Gs exert contact-mediated effects on process extension (Nakashiba et al., 2002). In summary, these findings indicate that DCC and UNC5 homologues function as receptors for netrin-I, 2, 3, and possibly netrin-4/~-netrin, and suggest that an unidentified receptor or family of netrin receptors mediates the response to the netrin-Gs.

20 Table 1.1 Identified netrins and netrin receptors Species Netrin DCCfamily UNCS family C. elegans UNC-61 UNC-40 21 UNC-S 32 (nematode) D. melanogaslor netrin-A _.j 22 33 2 Frazzled DUncS (fruit tly) netrin-B .3 H. medicinalis Leech netrin ~ NIA NIA (medicinalleech) C. intestinalis Ci-NET!' NIA NIA (se a squirt)

B. floridae 6 AmphiNetrin NIA NIA (amphioxus) P. marinus NIA NIA UncS 34 (sea lamprey) X. laevis XDCCa"' netrin-1 7 XUNC-S 38 (Clawed {rof!J XDCCb 23 D. rerio netrin-I" ZDCC2~ NIA (zebrafish) netrin-I a9 lu CDCC z; G.gallus netrin-I NIA (chicken) netrin-2 lO Neogenin 26 netrin-I 39 12 UNCSHI M. musculus netrin-3 27 35 13 14 DCC UNCSH3 . (house mouse) B-netrinl netrin_4 . 39 Neogenin2~ UNCSH4 netrin-G 115 netrin-G2~0 1o jO R. norvegicus netrin-1 DCCL'.jU UNCSHl 16 3O 36 (Norway rat) netrin-3 Neogenin UNCSH2 NTNI'I.' NTN2L I8 (net-3 29 H. Sapiens DCC 37 ortholog) 31 UNCSC (human) 13 19 Neogenin B-netrin INTN4 . netrin-G 120 .. 1. Ishll et al. (1992). ACCESSION: AAA28157. 2. Harns et al. (1996). Netnn-A, ACCESSION: AAB 17547. Netrin-B, ACCESSION: AAB17548. 3. Mitchell et al. (1996). Netrin-A, ACCESSION: AAB17533. Netrin-B, ACCESSION: AAB17534. 4. Gan et a 1.(1 999). ACCESSION: AAC83376. 5. Takamura Direct Submission. (06-OCT-I999). ACCESSION: BAA94302. 6. Shimeld. (2000). ACCESSION: CAB72422. 7. de la Torre et al. (1997) ACCESSION: AAB87983. 8. Strahle et al. (1997). ACCESSION: AAB70266. 9. Lauderdale et al. (1997). ACCESSION: AAC60252. 10. Serafini et al. (1994). Netrin-I, ACCESSION: AAA60369. Netrin-2, ACCESSION: AAA61743. Il. Serafini et al (1996). Mouse, ACCESSION: AAC52971. Human, ACCESSION: NP _004813. 12. Wang et al (1999). ACCESSION: AAD40063. 13. Koch et al (2000). Mouse beta-netrin, ACCESSION: AAG30823. Human beta-netrin, ACCESSION: AAG30822. 14. Yin et al. (2000) ACCESSION: AAF91404. 15. Nakashiba et al (2000). ACCESSION: NP _109624. 16. Manitt et al. (2001). Netrin-I, ACCESSION:AY028417. Netrin-3, ACCESSION: AY028418. 17. Meyerhardt et al. Direct Submission (21-0CT-1996). ACCESSION: AAD09221. 18. Van Raay et al. (1997). ACCESSION: AAC51246. 19. Strausberg. Direct Submission. (04-SEP-2001). ACCESSION: AAH13591. 20. Nakashiba et al. (2000). ACCESSION: NP _055732.21. Chan et al (1996). ACCESSION: AAB 17088.22. Kolodziej et al.( 1996). ACCESSION: AAC47315. 23. Pierceall et al. (1994). XDCCa, ACCESSION: AAA70168. XDCCb, ACCESSION: AAA70167. 24. Hjorth et al. (2001).25. Chuong et al. (1994). 26. Vielmetter et al. (1994). ACCESSION: AAC59662. 27. Cooper et al. (1995) ACCESSION: NP_031857. 28. Keeling et al. (1997). ACCESSION: NP_032710. 29. Fearon et al. (\990). Rat, ACCESSION: 840098. Human, ACCESSION NP _005206. 30. Keino-Masu et al. (1996). DCC, ACCESSION: AA841099. Neogenin, ACCESSION: AAB41Ioo. 31. Meyerhardt (1997). ACCESSION: AABI7263. 32. Leung­ Hagesteijn et al. (1992). ACCESSION: AAB23867. 33. Keleman and Dickson (2000). ACCESSION: AAF74193. 34. Shifman and Selzer (2000a). ACCESSION: AAFOOI03. 35. Ackerman et al (1997). ACCESSION: AAB54103. 36. Leonardo et al. (1997). UNC5HI, ACCESSION: NP _071542, UNC5H2, ACCESSION: NP _071543.37. Ackerman and Knowles (1998). ACCESSION: AAC67491. 38. Anderson and HoIt (2002). ACCESSION: A Y099459. 39. Engelkamp, 2002. UNC5HI ACESSION: AJ487852. UNC5H4 ACESSION: AJ487854. Nakashiba et al., 2002. netrin-G2a ACESSION: AB052336. netrin-G2b ACESSION: AB052337. netrin-G2c ACESSION: ABOS2338 (modified from Manitt and Kennedy, 2002).

21 III. Functional Interactions Between DCC and UNC-5 Homologue Netrin Receptors Many receptors are activated by multimerization. Interestingly, netrin-I causes DCC to multimerize and this appears to be required for the axon guidance function of DCC (Stein et al., 2001). This study demonstrated that isolated cytoplasmic domains of DCC interact spontaneously and that this interaction is repressed in the full-iength receptors in the absence of netrin-I. The presence of netrin-I stimulates DCC multimerization both by promoting an association of DCC extracellular domains and via an allosteric effect that allows the intracellular domains to interact. Long-range repulsion appears to require multimerization of DCCIUNC-5 complexes. Many neurons express members of both the unc-5 and dcc families (Leonardo et al. 1997; Chan et al. 1996). It was noted early on that C. elegans unc-40 mutants contained subtle defects in ventral to dorsal axon migration, the trajectory more c10sely associated with unc-5 function (Hedgecock et al., 1990; McIntire et al., 1992; Colavita & Culotti, 1998). Moreover, biochemical evidence indicates that UNC-5 homologues and DCC can interact directly, forming a netrin receptor complex (Hong et al., 1999). In D. melanogaster. ectopic expression of unc-5 by neurons caused their axons to exhibit a potent repellent response to netrin (Keleman and Dickson, 2001). Interestingly, the short­ range repellent function mediated by unc-5 was independent of frazzled, the D. melanogaster homologue of DCC, but the long-range repellent action of netrin required both unc-5 and frazzled expression. Keleman and Dickson (2001) suggest that UNC-5 alone is sufficient to respond to a high concentration of netrin, while UNC-5 and frazzled are required for the long-range repellent response in the presence of lower concentrations ofnetrin Consistent with the results of ectopie expression of unc-5 in C. elegans and D. melanogaster (Hamelin et al., 1993; Keleman and Dickson, 2001), neurons isolated from the embryonic Xenopus spinal cord engineered to express UNC5H2 switched their response to netrin-I from attraction to repulsion in vitro (Hong et al., 1999). Significantly, both attraction and repulsion were blocked by an antibody against DCC, indicating that DCC participates in both responses in these cells. Consistent with this functional interaction, the cytoplasmic domains of DCC and UNC5H2 were shown to interact spontaneously (Hong et al. 1999). Like the multimerization of DCC described above, DCC

22 and UNC5H2 cytoplasmic domain interactions are repressed in the full-Iength receptors, and netrin-I stimulates multimerization by promoting the association of both extracellular and intracellular domains. These results suggest that the relative number of DCC or UNC- 5 homologue receptors present on the surface of a cell may play a key role in determining how an axon responds to netrin-I.

IV. Netrin Signal Transduction and Growth Cone Guidance As an axon extends, the growth cone encounters cues that may cause it to advance, turn, or retract. Filopodia and lamellipodia are dynamic actin based membrane protrusions found at the edge of neuronal growth cones (reviewed by Bentley and O'Connor, 1994; Tanaka and Sabry, 1995). Contact of the tip of a single filopodium with an appropriate extracellular target is sufficient to change the trajectory of an extending axon (O'Connor et al., 1990; Chien et al., 1993), indicating that the key receptors that internct with guidance cues are present at filopodial tips. Substantial evidence indicates that guidance cues influence motility by remodeling the actin cytoskeleton within the growth cone (reviewed by Suter and Forscher, 1998). In neuronal and non-neuronal cells, the Rho family of small GTPases is a key component of the intracellular signal transduction cascade that regulates the organization of actin. Of particular significance, the Rho family members Cdc42, Rac 1, and RhoA regulate the formation of filopodia, lamellipodia, and stress fibers, respectively (reviewed by Hall, 1998; Dickson, 2001). Expression of DCC has been shown to cause a netrin-I dependent increase in number of filopodia, cell surface area (Shekarabi and Kennedy, 2002), and neurite outgrowth (Li et al., 2002b). These effects required Cdc42 and Rac 1 activation (Shekarabi and Kennedy, 2002; Li et al., 2002b). Furthermore, DCC was shown to cause netrin-I dependent activation of Cdc42 and Rac l, indicating that these proteins are components of the signal transduction cascade downstream of DCC that is activated by netrin-I. The findings presented in these studies suggest that netrin-I and DCC influence motility by activating the Rho GTPases Cdc42 and Rac l, thereby leading to the reorganization of actin. Several studies indicate that protein kinase A (PKA) plays a key role in determining if a neuronal growth cone is attracted or repelled by netrin-I. Elevating the

23 intracellular concentration of cAMP causes PKA activation (reviewed by Naim et al., 1985). Utilizing dissociated neurons from embryonic Xenopus spinal cord, Ming et al., (1997) demonstrated that PKA activation is correlated with chemoattraction to netrin-I, while PKA inhibition switches the response to repulsion. RhoA is inhibited by PKA phosphorylation (Lang et al., 1996). One way that PKA activation may influence growth cone guidance is to tip the balance of Rho GTPase activation toward generating a chemoattractant response to netrin-I (Hall 1998; Mueller 1999; Song and Poo, 1999). PB-kinase activation (Ming et al., 1999) has also been implicated in the tuming response made by neurons in response to netrin-I. Rac 1 is activated by PB-kinase in sorne cells types (reviewed by Hall, 1998), but it remains to be determined if PI-3 kinase is a functional intermediate between DCC and Rac 1. Together, these studies have led to the hypothesis that netrin-l shares signal transduction pathways in the growth cone with other cues that influence axon outgrowth such as mYelin-associated glycoprotein (MAG) and the neurotrophins, NGF and BDNF (reviewed by Song and Poo, 1999). Further genetic analysis has implicated eight gene products in UNC5 function in C. elegans (Colavita & Culotti, 1998). Not surprisingly, these inc\uded netrin/une-6 and the une-6 receptor une-40 (Hedgecock et al., 1987,1990). The screen also identified une-129, une-34 and une-44 (Siddiqui & Culotti, 1991; McIntire et al., 1992; Forrester & Garriga, 1997). Une-129 encodes a TGF-beta growth factor family member expressed by dorsal muscle cells during C. elegans development (Colavita et al., 1998) and loss of UNC-129 function produces a phenotype similar to, but less penetrant than mutation of une-5. Une- 44 encodes ankyrin (Otsuka et al., 1995), a protein that links integral membrane proteins to the actin cytoskeleton (reviewed by Bennett and Chen, 2001). It is not known if UNC-5 interacts directly with ankyrin, but the identification of ankyrin provides one component of what may be a protein complex that links netrin outside the cell to intracellular actin. Interestingly, UNC-34 is homologous to the Ena/V ASP (enabled/vasodilator-stimulated phosphoprotein) protein family, which has also been shown to be required for axon guidance in mouse and D. melanogaster (Lanier et al., 1999; Wills et al., 1999). EnaNASP proteins localize to sites of actin polymerization where they interact with Profilin, a protein that regulates the organization of actin (reviewed by Holt and Koffer, 2001 ).

24 Recently, unc-34/Ena/V ASP was implicated in UNC-40 mediated attraction to netrin as weil (Gitai et al., 2003). In these experiments, UNC-40 gain-of-function, which caused excessive axon outgrowth and branching, was used to identify genes that could suppress these resulting defects. These defects were found to be suppressed by loss-of­ function mutations in ced-IO (a Rac GTPase), unc-34 (an Enabled homolog), and unc-115 (a putative actin binding protein). Additional evidence has implicated EnaIV ASP proteins in netrin-I attractant function by identifying its role in filopodial dynamics. EnaIV ASP was implicated in the formation and elongation of filopodial tips at the growth cone, and netrin-I dependent filopodial formation required EnaIV ASP function (Lebrand et al., 2004). Furthermore, the contribution of EnaIV ASP to filopodial formation was found to be regulated by PKA. Tong et al., (2001) reported that both UNC-40 and UNC-5 homologues are phosphorylated on tyrosine residues. Furthermore, tyrosine phosphorylation of UNC-5 family members is enhanced by netrin in a mammalian cell line and in C. e/egans in vivo. They also demonstrated netrin dependent binding of the tyrosine phosphatase Shp2 to phospho-Tyr568 in the intracellular domain of UNC-5. Although this study did not indicate the functional implication of tryrosine phosphorylation on netrin-dependent attraction or repulsion, it provided the first indication that tyrosine phosphorylation may be involved in netrin signal transduction. More recently, receptor protein tyrosine phosphotases (RPTP) have been implicated in modulating the response to netrin (Chang et al., 2004). Experiments in C. elegans demonstrated that c1r-IIRPTP loss-of-function enhances netrin mediated attraction. Clr-IIRPTP inhibits netrin signaling through UNC-34/Ena/V ASP, an effector downstream ofunc-40lDCC (Gitai et al., 2003), and possibly UNC-5 as weil (Colavita and Culotti, 1998). The type lIa subclass of RPTPs has been shown to inhibit axon regeneration. For example, RPTPa (-/-) mice exhibit enhanced regeneration following facial nerve crush (Thompson et al., 2003), and similar results have been reported in Xenopus with a dominant negative RPTPa homologue (Johnson et al., 2001). Interestingly, the intracellular phosphatase domain of C. elegans c1r-1 is most similar to mammalian type lIa RPTPs. These results raise the possibility that type lIa RPTPs may represent a conserved family of tyrosine phosphatases that act to inhibit axon growth, and

25 that one way this may be accomplished is by inhibiting attraction to netrin or other guidance factors. Chang et al (2004) suggest a model in which tyrosine kinases and tyrosine phosphotases compete in the regulation of netrin-mediated guidance. Therefore, netrin guidance may depend on the tyrosine phosphorylation state of the netrin receptors or their effectors, such as UNC-34/enabled.

V. Mechanisms that Regulate Netrin Function During the organization of the nervous system, axons must extend across considerable distances in order to arrive at their appropriate terminal regions where they will eventually form synapses. This often requires the growth cone to make sequential pathfinding decisions toward a series of intermediate targets. A single growth cone may therefore need to respond to different guidance cues along the way or may need to respond to the same cue in different ways at different points along its path. As such, regulating axon pathfinding during development not only involves the use of a sequence of appropriate guidance cues but it also requires a growth cone to regulate its responsiveness to these guidance cues at the appropriate time. The identification of common mechanisms that regulate a growth cone's response to guidance cues has greatly increased our understanding of how the organization of neural networks is accompli shed. These include protein translation at the growth cone, regulation of receptor expression or trafficking to the plasma membrane, protease c1eavage of receptors on the plasma membrane, and a hierarchy of responses to guidance cues where one cue can silence or override the response to another (reviewed by Yu and Bargmann, 2001). AIl these common processes have been implicated in the modulation of guidance responses to netrin.

A. Regulation by cycIic nucIeotides The concentration of intraneuronal cAMP has been shown to regulate the response to netrin. In the growth cone turning assay, lowering the levels of cAMP causes a switch in response from attraction to repulsion (Ming et al., ) 997). These effects were shown to result from changes in PKA activation. Furthermore it was subsequently demonstrated that activity, which increases the levels of cAMP and activates PKA, promotes an attractive response to netrin (Ming et al., 200). As such, environ mental factors that influence the

26 levels of cAMP may have important implications in detennining a neuron's response to netrin. Retinal ganglion cells that nonnally respond to netrin as an attractant switch their response and are repelled by netrin-I in the presence of Laminin-I, which was shown to decrease the levels of cAMP (Hopker et al., 1999). Additionally, embryonic retinal ganglion cells express DCC and respond to netrin-I as an attractant when exiting the retina. However, when they reach the optic tectum they are repelled by netrin-I. This change in response is associated with a developmentally regulated decrease in the levels of DCC and cAMP that are intrinsic to these neurons (Shewan et al., 2002). Notably, neurons have been shown to lower their intracellular concentration of cAMP with maturation (Cai et al., 2001). Thus, modulation of netrin function by cAMP can be regulated both intrinsically and by environ mental factors.

i. Is the Adenosine A2B Receptor a Netrin-J Receptor? Shewan et al. (2002) reported that expression of the adenosine A2B receptor decreases with maturation of retinal neurons and provided evidence that decreased levels of A2B also contribute to the repellent response to netrin observed in retinal neurons upon reaching the optic tectum. The adenosine A2B receptor, a G-protein coupled receptor that triggers an increase in cAMP wh en bound to adenosine, has been proposed to be a receptor for netrin-I in commissural neurons (Corset et al., 2000). Using a yeast two­ hybrid screen, these authors detected an interaction between the intracellular domains of the A2B receptor and DCC. Co-immunoprecipitation experiments using cells over­ expressing DCC and A2B suggested that the interaction between these receptors requires netrin-I. However, Stein et al. (2001) reported that A2B does not function as a receptor for netrin-I in rat embryonic commissural neurons. They demonstrated that these neurons do not express A2B as they ex tend axons toward the floor plate. Furthennore, phannacological manipulation of adenosine receptor activity in these neurons did not affect commissural axon outgrowth in response to netrin-I protein, a response previously shown to require DCC (Keino-Masu et al., 1996; Fazeli et al., 1997). Similarly, A2B does not contribute to the netrin-I induced tuming response in Xenopus embryonic spinal axons. These findings indicated that A2B is not a netrin-l receptor in these neurons. While the role of the A2B receptor remains controversial these results support the importance of

27 the leve\s of cyclic nucleotides in mediating the response to netrin and further demonstrated how the contribution of intrinsic and extrinsic factors that regulate the Ieve\s of intraneuronal cAMP can modulate the response to netrin.

B. Receptor targeting to the cell surface It was recently reported that activating PKA regulates the insertion of the netrin receptor DCC into the plasma membrane, producing increased axon outgrowth in response to netrin-l (Bouchard et al., 2004). Inhibiting PKA or exocytosis, but not protein synthesis, blocked the PKA induced increase in cell surface DCC, consistent with mobilization of DCC from a pre-existing intracellular vesicular pool. These experiments de scribe a mechanism by which changes in intraneuronal cyclic nucleotides can cause rapid changes in the direction or magnitude of a response to netrin. UNC5H 1 trafficking at the plasma membrane has also been shown to be regulated by a protein kinase. In this case, PKC activation leads to removal of UNC5H 1 trom the membrane surface and inhibits netrin-I dependent collapse in hippocampal growth cones (Williams et al., 2003).

C. Local protein synthesis in growth cones Local protein synthesis in the growth cone has also been implicated in netrin guidance function (Campbell and Holt, 2001). Netrin-I induces local protein synthesis in the growth cones of cultured Xenopus retinal axons, and blocking translation inhibits the turning, but not the growth promoting effects ofnetrin in these axons (Campbell and Holt, 2001). In these experiments, netrin was shown to stimulate phosphorylation of the translation initiation factor eIF4E, and eIF4E activation is required for a turning response. Consistent with these findings, netrin-I has been shown to activate the mitogen-activated kinase (MAPK), ERK-I/2. MAPK signaling regulates the activation of several translation initiation factors, including eIF4E, supporting the evidence that protein synthesis is involved in netrin-mediated guidance (Forcet et al., 2002). It may be the case that protein synthesis in the growth cone functions to maintain a response to netrin-I during axon pathfinding over long distances. Ming et al (2001) have shown that growth cones respond to netrin with a guidance response through a series of desensitization and resensitization

28 steps. The ability of the growth cone to resensitize to netrin is dependent on local protein synthesis. These results suggest the need for renewal of netrin signaling components for sustained guidance.

D. Protease-mediated cleavage from plasma membrane The response to netrin is also regulated by post-translational modifications of DCC at the membrane surface. Evidence has indicated that metalloproteases c\eave DCC, resulting in ectodomain shedding (Ga\co and Tessier-Lavigne, 2000) Furthermore, inhibiting metalloprotease activity blocks proteolytic processing of DCC, and potentiates netrin-mediated axon outgrowth by commissural neurons in vitro. Notably, the netrin C­ domain shares homology with the tissue inhibitors of metalloproteases (TIMPs) family (lshii et al., 1992; Banyai and Patthy, 1999; Sandoval et al., 2000). This raises the possibility that netrin may also stabilize DCC at the plasma membrane surface by inhibiting metalloproteases.

E. DCC receptor silencing: hierarchical control ofaxon guidance function Netrin-mediated axon guidance by DCC can be silenced by the guidance factor Slit (Stein and Tessier-Lavigne, 2001). Commissural axons in the developing neural tube must first grow toward the ventral floor plate where they cross the midline, but once they have crossed to the contralateral si de commissural axons must permanently leave the ventral midline and change direction in order to navigate toward their next intermediate target. Thus, it would appear that commissural growth cones are required to switch their response to netrin-I at the ventral midline after they cross. During initial axon pathfinding to the ventral midline, commissural axons are attracted by netrin (Kennedy et al., 1994; Serafini et al., 1994) and are insensitive to the midline repellent Slit (Brose et al., 1999; Zou et al., 2000). Conversely, after crossing, these axons become unresponsive to netrin-mediated guidance (Shirasaki et al., 1998) and are repelled by Slit (Zou et al., 2000). Consistent with this, Stein and Tessier-Lavigne (2001) have shown that Slit function is implicated in this loss of Xenopus spinal neuron responsiveness to netrin. Slit signais through its receptor roundabout (Robo), and Slit-Robo interactions influence netrin function by forming a complex with DCC (Stein and Tessier-Lavigne, 2001). When DCC becomes

29 complexed with Robo, slit activity abolishes the guidance response to netrin but not its outgrowth promoting effects.

VI. Short-Range Functions of Netrin Netrins have also been shown to function as short-range cues during embryogenesis. Short-range functions of netrin have been identified in central and peripheral nervous systems as weil as in non-neural tissues. In these systems, short-range actions of netrin have been characterized as either playing a role in contact-mediated guidance decisions at axonal choice points or in adhesive interactions.

A. CNS and PNS A target derived short-range function for netrin has been proposed to contribute to the development of nerve-muscle synapses in D. melanogaster (Mitchell et al., 1996; Winberg et al., 1998). In this case, netrin is not required for motor axon pathfinding to the muscle, rather its function is required for synapse formation. Netrin-I expressed by cells at the optic disc appears to function as a short-range cue for retinal ganglion cell axons as they exit the retina during mouse embryogenesis (Diener et al., 1997). Similar to the phenotype observed in Drosophila, RGC axons do not require netrin to reach the optic disc but appear to fail to recognize it as a choice point where a change in direction is required. RGC axons in these mutants simply grow past their appropriate target, the optic disco

B. Non-neural tissues Netrin mediates adhesive interactions during mammary gland organogenesls (Srinivasan et al., 2003). In the terminal end buds (TEBs), preluminal cells express netrin- 1 and cells of the adjacent cap cell layer express neogenin. Netrin or neogenin loss-of­ function leads to defects in the organization of these cell layers in TEBs. These phenotypes suggested that netrin function may be required for cell-cell adhesions important for maintaining the cellular architecture of TEBs. Cell aggregation assays confirmed that neogenin is required for netrin-dependent cell clustering. These results

30 provide evidence that netrin-l and its receptor neogenin provide an adhesive, but not a guidance, function during mammary gland development. Netrin has also been implicated in pancreatic development. In this case, netrin was found to interact with integrins in mediating adhesive interactions and migration (Yebra et al., 2003). a6~4 integrin was found to mediate pancreatic cell adhesion and spreading on a netrin-l substrate, and a6~4 and a3 ~ 1 together mediated migration of pancreatic progenitors in vitro. In vivo, netrin-l and these integrins are expressed in fetal pancreatic epithelium, and netrin is associated to ECM. These results not only provide evidence of an additional system in which netrin functions as a contact mediated cue but also identify the integrins, which are weIl characterized receptors for extracellular matrix proteins (reviewed by Rosso et al., 2004), as a new putative family ofnetrin receptor.

VII. Summary The netrins are a family of proteins involved in embryonic development that have been identified as cues that direct cell and axon migration. They have also been implicated in mediating Drosophila nerve-muscle synaptogenesis and non-neural cell adhesions. Thus, netrins function as either short-range or long-range cues, in sorne circumstances acting close to the surface of the cells that produced them and in other cases at a distance. They are bifunctional cu es, attracting sorne cell types and repelling others. This duality of function is mediated by the repertoire of netrin receptors expressed by the responding cell and by the intracellular state of the cell. Two classes of receptors mediate the response to netrin-l, the deleted in colorectal cancer (DCC) family, which is associated with attraction, and the UNC-5 homologue family, which is associated with repulsion. Netrin function is modulated by a number of mechanisms that are now emerging as common strategies for regulating axon guidance.

Sections of the literature review in Chapter 1 were reprinted from: Progress in Brain Research, volume 137, Manitt C. and Kennedy T.E. Where the rubber meets the road: netrin expression and function in developing and adult nervous systems. Pages 425-42. © Copyright 2002, with permission from Elsevier.

31 RESEARCH RA TIONALE AND OBJECTIVES

Axon guidance molecules: Life after embryogenesis The formation of functional neural circuits is orchestrated by an ordered series of guidance decisions made by extending neuronal processes during embryogenesis. These processes find their appropriate targets, where they will eventually form synapses, by responding to attractive and repulsive guidance molecules. The growth cone response to these cues depends on the cue as weil as on the internaI state of the neuron, which is regulated by intrinsic and environmental factors. The expression of a number of guidance cues persists in the adult nervous system (reviewed by Koeberle and Bahr, 2004). Neuronal plasticity, which refers to the ability of a neuron to change its properties either by sprouting new processes, making new synapses or altering existing synapses, is vital to neural function throughout life. It is reasonable to hypothesize that the dynamic nature of aduIt neural fun ct ion also makes use of attractant and repellent guidance cues. In recent years, a number of guidance cues have been implicated in neural pl asti city in the aduIt nervous system and in neuronal regeneration following injury (reviewed by Koeberle and Bahr, 2004; de Witt and Verhaagen, 2003; Klein, 2001). 1 therefore hypothesized that netrin in the adult spinal cord may be involved in regeneration following injury, either as an inhibitor or a promoter ofaxon growth. Although netrin function has been extensively studied in the embryonic nervous system, netrin expression and function in the adult CNS was unknown when 1 began my Doctoral studies. Evidence obtained from other guidance molecules supported a role for these cues in aduIt neural function. As such, the principle objective of the studies described in this thesis was to characterize netrin expression in the aduIt spinal cord and to identifY potential functions for netrin in the aduIt CNS. The specifie aims of the research presented here were: 1) To characterize netrin expression in the aduIt spinal cord by assessing its level of expression in the aduIt CNS relative to the embryonic CNS and by identifYing the cells types that express netrin (Chapter 2). These studies found that netrin-I, but not netrin-3, is expressed in the aduIt rat spinal cord at a level similar to that found in the embryonic

32 CNS. Furthermore, these studies demonstrated that netrin-l is expressed by neurons and mature myelinating oligodendrocytes in the adult CNS. 2) To identify the subcellular distribution of netrin-l protein in order to gain insight into its mechanism of action, namely whether it is likely to function as a short-range or a long­ range cue in the adult spinal cord (Chapter 2). These studies indicated that netrin-l protein is not freely soluble, but is bound to cell surfaces and extracellular matrix. Furthermore, netrin protein was typically dosely associated with netrin-I expressing ceIls, suggesting a short-range action. 3) To characterize netrin receptors in the adult spinal cord by determining the levels and distributions of their expression (Chapter 3). These studies indicated that UNC-5 homologue expression is upregulated, and DCC expression downregulated, in the adult spinal cord relative to the embryo. This finding suggested that UNC-5 homologues constitute the major mode of netrin signal transduction in the adult spinal cord. 4) The results of the studies described above indicated that netrin is expressed by myelinating oligodendrocytes, and that UNC-5 homologues are the predominant netrin receptors expressed in the adult spinal cord. This raised the possibility that netrin might be a myelin-associated inhibitor ofaxon extension that inhibits regeneration. The final aim addressed the contribution of netrin-l to the inhibitory effects of myelin on neurite outgrowth (Chapter 4), and provided evidence that netrin-l is a myelin-associated inhibitor ofaxon extension.

33 PREFACE TO CHAPTER 2

The netrins are a family of bifunctional molecules that are required in a number of developmental processes during embryogenesis. The role of netrin-l in deve\opment has been the subject of intense study, but a role for netrin in adult neural function has yet to be reported. When 1 began my Doctoral studies very little was known about netrin in the adult CNS. Thus, as a tirst step toward investigating a role for netrin-l in the adult nervous system, 1 characterized netrin expression in the adult spinal cord.

The ai ms of the present study were to: 1) Determine the distribution of netrin expression in the adult spinal cord and identify the cells involved in order to identify the systems in which netrin might play a role 2) Determine the subcellular distribution of netrin in order to gain sorne insights into its mechanism of action.

This work was published in the Journal ofNeuroscience (Manitt et al., 2001)

34 I. SUMMARY

Netrins are a family of secreted proteins that function as chemotropic axon guidance cues during neural development. Here we demonstrate that netrin-I continues to be expressed in the adult rat spinal cord at a level similar to that in the embryonic CNS. In contrast, netrin-3, which is also expressed in the embryonic spinal cord, was not detected in the adult. In situ hybridization analysis demonstrated that cells in the white matter and the gray matter of the adult spinal cord express netrin-l. Colocalization studies using the neuronal marker NeuN revealed that netrin-I is expressed by multiple classes of spinal interneurons and motoneurons. Markers identifying glial cell types indicated that netrin-I is expressed by most, if not ail, oligodendrocytes but not by astrocytes. During neural development, netrin-l has been proposed to function as a diffusible long-range cue for growing axons. We show that in the adult spinal cord the majority of netrin-l protein is not freely soluble but is associated with membranes or the extracellular matrix. Fractionation of adult spinal cord white matter demonstrated that netrin-l was absent from fractions enriched for compact myelin but was enriched in fractions containing periaxonal myelin and axolemma, indicating that netrin-l protein may be localized to the periaxonal space. These findings suggest that in addition to its role as a long-range guidance cue for developing axons, netrin may have a short-range function associated with the cell surface that contributes to the maintenance of appropriate neuronal and axon-oligodendroglial interactions in the mature nervous system.

36 II. INTRODUCTION

Netrin-l is a secreted protein produced by axonal targets during neural development. Appropriate expression of netrin-l in vivo is essential for certain types of axons, such as those of embryonic spinal commissural neurons, to grow toward a netrin­ expressing target (Serafini et al., 1996). Studies examining netrin function in vitro have demonstrated that netrin-l is diffusible and can orient axon growth at a distance trom the source of netrin protein. These findings suggest that netrin-l acts as a long-range chemotropic axon guidance cue during development (Kennedy et al., 1994; Colamarino and Tessier-Lavigne, 1995a; Shirasaki et al, 1996; Varela-Echavarria et al., 1997). Netrins are versatile cues, attracting the growth cones of sorne axons and repelling others. That netrin might be a bifunctional axon guidance cue was first suggested by the phenotype of Caenorhabditis elegans mutants lacking UNC-6, the C. elegans homo log of netrin. In une- 6 mutants, the trajectories of axons growing toward or away from cells expressing une-6 were disrupted (Hedgecock et al., 1990; Ishii et al., 1992). Two other mutations, une-40 and une-5, produce re\ated axon guidance phenotypes. Both encode transmembrane members of the Ig superfamily, and both are expressed by neurons as they extend axons (Leung-Hagesteijn et al., 1992; Chan et al., 1996). UNC-40 is homologous to mammalian deleted in colorectal cancer (DCC) (Chan et al., 1996; Keino-Masu et al., 1996), and three mammalian UNC-5 homologues have now been identified (Ackerman et al., 1997; Leonardo et al., 1997). Both genetic and biochemical evidence suggest that DCC and UNC-5 family members interact to form a netrin receptor complex mediating the response to netrin-l (Hedgecock et al., 1990; McIntire et al., 1992; Colavita and Culotti, 1998; Hong et al., 1999). In addition to their function as long-range axon guidance cues, evidence derived from genetic analysis in Drosophila melanogaster supports a short-range role for netrin protein expressed by muscle cells at sorne developing nerve-muscle synapses (Winberg et al., 1998). Like the long-range chemoattractant function of netrin-I, this short-range action is also dependent on neuronal expression of frazzled, the D. melanogaster homologue of DCC. The mechanisms underlying the similarities and differences between the short-range and long-range functions of netrins are not c1ear; however, these results

37 raised the intriguing possibility that netrins mediate short-range cell-cell interactions (reviewed by Kennedy, 2000). Here we address the expression and distribution of netrin-I in the adult mammalian CNS. We show that netrin-I is constitutively expressed by neurons and oligodendrocytes in the adult rat spinal cord and that the majority of the netrin-I protein present is not freely soluble but associated with membranes or extracellular matrix (ECM). Furthermore, fractionation of adult spinal cord white matter indicates that netrin-I is enriched in periaxonal myelin, suggesting that netrin-I protein is concentrated at the interface between axons and oligodendrocytes. These findings suggest that, like the role of netrin at nerve-+ muscle synapses in D. melanogaster, netrin-l may have a short-range function that mediates neuronal and axon-oligodendroglial interactions in the adult CNS.

38 III. EXPERIMENTAL PROCEDURES

Animais. Adult male Sprague Dawley rats (250-400 gm) were obtained from Charles River Canada. A transgenic mouse line in which a lacZ reporter gene replaces exon 1 of the myelin basic protein (MB?) gene was used to mark the oligodendrocyte lineage (Bachnou et al., 1997). Ali procedures with animaIs were performed in accordance with the Canadian Council on Animal Care guidelines for the use of animaIs in research.

Cloning rat netrin-l and rat netrin-3. Total RNA was isolated from aduIt rat spinal cord or embryonic day 18 (E 18) rat brain using Trizol (Life Technologies, Gaithersburg, MD) and poly(A +) RNA purified using the Oligotex mRNA mini kit (Qiagen). Rat netrin-I and rat netrin-3 cDNAs were amplified from randomly primed cDNA and c10ned using primers derived from nucleotide sequences conserved between human and mouse netrins (Serafini et al., 1996; van Raay et al., 1997; Meyerhardt et al., 1999; Wang et al., 1999). Multiple cDNAs derived trom at least three independent amplifications of each clone were generated using the Pfu high-fidelity thermostable polymerase (Stratagene, La Jolla, CA) and were sequenced (Bio S&T) to identify potential errors that might have been introduced during amplification. No sequence discrepancies between independent clones were found. For rat netrin-l the primer sequences used were as follows: GCGTGGTGAGCGAGCGTGGTGAAG CTAGGCCTTCTTGCACTTGCCCTTCT For rat netrin-3 the primer sequences used were the following: TCTGCCGACCCCTGCTATGATGA GCGGCGGCCAGACAGTCGGTAGAG. Primers were annealed at 68°C, and 30 cycles of amplification were performed. Sequence alignments were performed using Align analysis software (DNAstar). Additional sequence for rat netrin-l was obtained from ESTs A W251519, AA859374, and AI50250 1, and for rat netrin-3 from EST A 10724 \3. EST cDNAs were obtained from Research Genetics.

39 Antibodies, immunohistoehemistry, and Western b/ot ana/ysis. Netrin immunoreactivity was detected using rabbit polyclonal antibodies PN2 and PN3. PN2 was raised against an 18 amino acid peptide (# 11760, RFNMEL YKLSGRKSGGVC) present in rat netrin-I. This sequence is 100% conserved in netrin-I of human, mouse, chick, and frog (Serafini et al., 1994, 1996; de la Torre et al., 1997; Meyerhardt et al., 1999). PN3 was raised against domains V and VI of chick netrin-I that have >90% amino acid identity between the species listed above. To prevent nonspecific binding, antibodies were affinity purified and preadsorbed against acetone-extracted chicken liver protein. No netrin family members have been detected in extracts of chicken liver (Kennedy et al., 1994). LaeZ expression was visualized using a mouse monoclonal antibody against 3_ galactosidase (J-gal; dilution, 1: 1000; Promega, Madison, WI). A mouse monoclonal antibody against the oligodendrocyte marker 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNP) was used at a dilution of 1: 1000 (Sternberger Monoclonals), and a mouse monoclonal antibody against the astrocyte marker glial fibrillary acidic protein (GF AP) was used at a dilution of 1:500 (Sigma). A mouse monoclonal antibody against the neuronal marker NeuN was used at a dilution of 1:25 (gift from Dr. Richard Mullen). For immunohistochemical analyses, adult rats and mice were anesthetized with sodium pentobarbital (Somnotol; 65 mg/kg, i.p.; MTC Pharmaceuticals) and perfused transcardially with PBS containing heparin (1 U/ml; Fisher Scientific), followed by 4% paraformaldehyde (Fisher Scientific) and 15% picric acid (Sigma) in PBS, pH 8.5, at 37°C. Spinal cords were dissected and post-fixed in the same fixative at 4°C overnight and equilibrated in 30% sucrose, 4% paraformaldehyde, and 15% picric acid at pH 8.5. Spinal cords were th en embedded in optimal cutting temperature compound (Tissue Tek; Sakura

Finetek), and 25 ~m sections were cut using a cryostat. Free-floating sections were rinsed in PBS for 5 min, and endogenous peroxidase activity was quenched by incubation in 70% methanol and 1% H20 2 (Fisher Scientific). Netrin antigenicity was enhanced by gradually heating the sections to 95°C in a 10-fold dilution of PBS in water. Sections were th en returned to PBS. Tissue sections were incubated for 1 hr at room temperature in blocking solution: 2% bovine serum albumin (lCN Biomedicals, Cleveland, OH), 2% heat­ inactivated normal goat serum (Life Technologies), and 0.2% Triton X-IOO (Fisher Scientific) in PBS. Sections were incubated with netrin primary antibodies in blocking

40 solution overnight at 4°C, followed by goat anti-rabbit peroxidase-conjugated secondary antibody (1 :400 dilution; Life Technologies). Immunoreactivity was visualized using a diaminobenzidene (DAB) detection kit with nickel chloride enhancement (Vector Laboratories). For immunofluorescence analysis, primary antibodies were visualized using secondary antibodies coupled to indocarbocyanine (Cy3) or FITC (Jackson ImmunoResearch, West Grove, PA). Autofluorescence was reduced using 0.1 % sodium borohydride solution (Fisher Scientific) as described previously (Clancy and Cauller, 1998). Slides were mounted using Elvanol (DuPont NEN, Wilmington, DE) with 2.5% 1,4-diazabicyc\0[2,2,2]octane (Sigma). For Western blots, netrin antibodies PN2 and PN3 were used at concentrations of 1.0 and 0.7 Jlg/ml, respectively. We used the following rabbit polyclonal antibodies raised against the endoplasmic reticulum (ER) integral membrane protein calnexin (gift of Dr. John M. Bergeron) at a dilution of 1:2000, the ER resident protein BiP (gift of Dr. Linda Hendershot) at a dilution of 1: 1000 (Hendershot et al., 1995), the 160 kDa membrane sialoglycoprotein (MG-160) of the medial cisternae of the Golgi apparatus (gift of Dr. N. K. Gonatas) at a dilution of 1: 1000 (Croul et al., 1990), and the plasma membrane protein trk-B (gift of Dr. Louis Reichardt) at a dilution of 1:2000. The following mouse monoclonal antibodies were used: anti-CNP at a dilution of 1: 100,000 (Sternberger Monoclonals), anti-MBP at a dilution of 1:500 (Chemicon International, Temecula, CA), anti-neurofilament-145 (NFM) at a dilution of 1:50,000 (Chemicon International), and anti-myelin-associated glycoprotein (MAG) at a dilution of 1: 100,000 (gift of Dr. Peter E. Braun). Protein homogenates were separated usmg 10% PAGE and transferred to immobilon (Millipore, Bedford, MA) or nitrocellulose membrane (Amersham Pharmacia Biotech). Membranes were incubated in 5% milk powder, 1% glycine (Fisher Scientific), 0.1 % Tween 20 (Fisher Scientific), 3% heat-inactivated normal goat serum (Life Technologies), and 0.1 % SOS (Fisher Scientific) for 1 hr at room temperature, followed by incubation with primary antibodies overnight m blocking solution at 4°C. Immunoreactivity was visualized using peroxidase-conjugated donkey anti-rabbit or donkey anti-mouse secondary antibodies (1 :4000; Jackson ImmunoResearch) and the Chemiluminescence Reagent Plus protein detection kit (NEN). Densitometry and

41 quantification of the relative level of netrin protein were performed on scanned images of immunoblots (Epson ES 1200C) using NIH Image software (National Institutes ofHealth).

In situ hybridization. Sense and antisense cRNA probe pairs corresponding to 933 bases of rat netrin-I, nucleotides 882-1815, were used. A shorter antisense transcript corresponding to nucleotides 852-1046 in rat netrin-I produced a pattern of hybridization identical to that of the antisense probe described above (data not shown). For probe synthesis, cONA templates were isolated from aga rose gels, and cRNA transcription was performed using polymerases T7 (New England Biolabs, Beverly, MA) or T3 (Promega) and digoxigenin (OIG) RNA labeling mix (Roche Products). After transcardial perfusion with 150 ml of PBS, pH 7.5, and heparin (1 U/ml) at 37°C, spinal cords were rapidly dissected and frozen by immersion in 2-methylbutane (Fisher Scientific) chilled in liquid nitrogen. Five micrometer cryostat sections were mounted onto slides (Superfrost Plus; Fisher Scientific) and fixed by immersion in 4% paraformaldehyde and 15% picric acid, pH 8.5, in PBS for 45 min at room temperature. Sections were then rinsed in 2x SSC, equilibrated for 5 min in 10 mM triethanolamine (Fisher Scientific), and incubated in 0.25% acetic anhydride (Sigma) in 10 mM triethanolamine for 10 min at room temperature. In situ hybridization was performed as described previously (Braissant and Wahli, 1998) using DlG-labeled probes. Sections were transferred to prehybridization solution (50% formamide, 5x SSC, 5x Oenhardt's, 1% SOS, and 40 Ilg/ml single-stranded salmon sperm ONA) for 20 min at room temperature. Hybridization was performed in 100 III of solution containing 200 ng of probe in 50% formamide, 5x SSC, and 40 Ilg/ml single-stranded salmon sperm ONA, overnight at 57°C. Sections were then washed in 2x SSC at room temperature followed by a wash in 2x SSC for 1 hr at 65°C. Hybridization was detected using a peroxidase-coupled antibody against OIG (Roche Products), amplified using the TSA-Indirect (lSH) Tyramide Signal Amplification kit (NEN), and visualized with peroxidase/OAB detection (Vector Laboratories ).

Northem blot analysis. Poly(A -) RNA was isolated from spinal cord, the cervical through thoracic region. [:x.-p32]dCTP was incorporated into a 462 base pair rat netrin-I cONA

42 probe by PCR (5' pnmer, GCGTGCGCGACCGAGACGACAGT; 3' prImer, TGGGGGAGCGGCTCTGCTGGTAGC), and the probe was purified using a NucTrap column (Stratagene). Two micrograms of poly(A+) RNA were separated on a 1% formaldehyde-agarose gel, capillary blotted to Hybond N membrane (Amersham Pharmacia Biotech), and probed using standard methods (Ausubel et al., 1990).

Subcel/u/ar fractionation. Subcellular fractionation of protein derived from total adult rat spinal cords was performed essentially as described for embryonic chick brain (Serafini et al., 1994). Spinal cords were homogenized in a glass-glass Potter-Elvehjem homogenizer on ice using 5 ml ofhomogenization buffer [320 mM suc rose, 10 mM HEPES, pH 7.5, and protease inhibitors (1 mM EDT A, 2 J.lglml leupeptin, 2 J.lglml aprotinin, 1 J.lglml pepstatin, and 2 mM PMSF)]. Homogenization consisted oftwo sets of 15 strokes with a 5 min pause between the sets. Crude homogenates were centrifuged at 1000 x g at 4°C for 10 min (low­ speed spin). The low-speed pellet (LSP) and an aliquot of the low-speed supernatant (LSS) were stored at -80°e. The remainder of the LSS was centrifuged at 10,000 x g at 4°C for 10 min (medium-speed spin). The medium-speed supernatant 1 (MSS 1) was stored on ice, and the first medium-speed pellet (MSP 1) was resuspended in resuspension buffer (RB;

10 mM HEPES, pH 7.5, and protease inhibitors) and centrifuged again at 10,000 x g at 4°C for 10 min. The final MSP was resuspended in RB and stored at -80°C; the second medium-speed supernatant (MSS2) was pooled with the first (MSS 1), and an aliquot of the medium-speed supernatant (MSS) was stored at -80°e. The remainderofthe pooled MSS was centrifuged at 230,000 x g at 4°C for 35 min (high-speed spin). The high-speed supernatant (HSS) containing soluble prote in was stored at -80°e. The high-speed pellet (HSP) was resuspended in high-salt extraction buffer (HSEB; 1.5 M NaCI, 10 mM HEPES, pH 7.5, and protease inhibitors); an aliquot was stored at -80°C, and the remainder was incubated for 1 hr rotating at 4°e. High-salt extract was then centrifuged at

100,000 x g for 2 hr yielding the high-salt extract pellet (HSEP) and high-salt extract supernatant (HSES).

Mye/in fractionation. Myelin fractionation was performed on the basis of a protocol described by Detskey et al. (1988) as modified by Sapirstein et al. (1992). Spinal cords

43 were dissected from 10 adult rats (350-400 gm). Ali homogenizations were perfonned using a Dounce homogenizer (Fisher Scientific). The initial homogenization consisted of six strokes with a loose pestle, followed by four strokes with a tight pestle, in ice-cold buffer containing 0.9M sucrose, 150 mM NaCl, and \0 mM HEPES, pH 7.5. The volume was brought to 2 \0 ml, and protease inhibitors were added (5 mM EDTA, 2 Jlg/ml leupeptin,2 Jlg/ml aprotinin, 1 Jlg/ml pepstatin, and 2 mM PMSF). Homogenates (fraction

1) were th en centrifuged at 82,500 x g for 25 min at 4°C. The crude myelin fraction was isolated as a pellet floating at the top of the sucrose solution (fraction 2). The crude gray matter fraction pelleted at the bottom of the tube (fraction 3). Crude myelin pellets were then rehomogenized with six strokes of a loose pestle, followed by four strokes with a tight pestle, in 210 ml of ice-cold 0.85 M sucrose containing protease inhibitors. The homogenate was then spun at 82,500 x g for 25 min at 4°C. The resulting floating pellets were rehomogenized in osmotic shock buffer containing 10 mM HEP ES, pH 7.4, 5 mM EDT A, and protease inhibitors to separate myelin from crude periaxolemma. Homogenates were gently rotated for 1.5 hr at 4°C, layered onto a discontinuous sucrose gradient composed of 15, 24, 28, 32, and 37% suc rose, and then centrifuged at 82,500 x g for 13 hr at 4°C. The myelin fraction (fraction 4) was collected from the 15-24% interface, and the crude periaxolemmal fraction (fraction 5) was from the 28-32% interface. To remove residual non-myelin microsomal contaminants, the myelin fraction was osmotic shocked twice in ddH20 and sedimented at 12,000 x g. After the second sedimentation the pellet was resuspended in ddH20, layered over a 0.75 M suc rose solution, and centrifuged at 75,000 x g for 1.5 hr at 4°C. The purified myelin fraction (fraction 6) was collected from the ddH20-O.75 M interface. The crude periaxolemmal fraction was Iysed for 30 min in 5 mM Tris-HC\, pH 8.3, 5 mM EDT A, and protease inhibitors. After Iysis, one-quarter of the volume of 40% sucrose was added and then layered over a sucrose gradient composed of 0.65, 0.8, and 1.0 M sucrose and centrifuged at 75,000 x g for 1.5 hr. The periaxonal myelin fraction (fraction 7) was collected from the 0.65-0.8 M interface, and the axolemma fraction (fraction 8) was collected from the 0.8-1.0 M interface. Protein content was quantified using the BCA protein assay kit (Pierce, Rockford, IL), and the fractions were assayed using PAGE and Western blot analysis.

44 IV.RESULTS

Netrin-t is expressed in the adult mammalian spinal cord Identical 1.6 kb rat netrin-I cDNAs were amplified from adult rat spinal cord and brain poly(A +) RNA. Additional 5' sequence was obtained from ESTs A W251519 and AI50250 1 (Bonaldo et al., 1996). The sequence obtained encodes a full-Iength open­ reading frame 98% identical to the predicted amino acid sequence of mouse netrin-I (Serafini et al., 1996) but only 52% like that of mouse netrin-3 (Wang et al., 1999). A previously identified rat cDNA sequence [163 nuc\eotides (Livesey and Hunt, 1997)] homologous to netrin-I was contained within this sequence. We were unable to amplify a rat netrin-3 from adult rat spinal cord, but we were able to amplify a rat netrin-3 cDNA from E 18 rat brain poly(A +) RNA. Additional 5' sequence of rat netrin-3, inc\uding the translation start site, was obtained from EST AI072413 (Bonaldo et al., 1996). The sequence of amino acids encoded by the 1030 base pair cDNA is >96% identical to the predicted amino acid sequence ofmouse netrin-3 (Wang et al., 1999). Northern blot analysis of poly(A +) RNA derived from E 14 rat brain and adult rat spinal cord revealed a single -6 kb mRNA corresponding to netrin-I (Figure 2.1 B). The amount of mRNA detected indicates that netrin-l is expressed at similar levels in the adult and embryonic CNS. In agreement with our inability to amplify a rat netrin-3 cDNA from adult spinal cord mRNA, Northern blot analysis of rat netrin-3 expression in E 14 brain and adult spinal cord mRNA produced a detectable signal only in the E 14 sample (Figure 2.1 B). We conc\ude that members of the netrin family are ditTerentially expressed in the embryonic and adult CNS with netrin-I expressed at readily detectable leve\s in the adult. To characterize the expression of netrin prote in we perforrned Western blot analysis of adult spinal cord homogenates using affinity-purified polyc\onal antibodies raised against two ditTerent netrin-I antigens. Antibody PN2 was raised against a peptide epitope conserved in ail mammalian orthologs of netrin-I identified to date (Serafini et al., 1996; Meyerhardt et al., 1999). However, two conservative amino acid substitutions are present in the corresponding 19 amino acid sequence in human, rat, and mouse orthologs of netrin-3 (van Raay et al., 1997; Wang et al., 1999). Antibody PN3 was raised against purified recombinant protein corresponding to domains V and VI of chick netrin-I, an

45 ~430 amino acid sequence highly conserved in ail identified vertebrate netrin-I orthologs. Western blot analysis demonstrated that in addition to netrin-I, both PN2 and PN3 bind recombinant mouse netrin-3 (data not shown). Analysis of adult rat spinal cord homogenates using antibodies PN2 and PN3 revealed the presence of an ~ 75 kDa band consistent with the molecular weight of netrin-I (Figure 2.1 B). In addition, preadsorption of PN2 or PN3 with a molar excess of recombinant netrin-I protein abolished ail staining on Western blots or tissue sections (data not shown). Because of the absence of detectable netrin-3 expression in the adult spinal cord, the high leve\ of netrin-I expression, and the molecular weight of the immunoreactive band, we conc\ude that immunoreactivity detected by antibodies PN2 and PN3 in homogenates of aduIt spinal cord corresponds to netrin-I. Recently, two additional members of the netrin family have been identified in mammals: netrin-4 (Koch et al., 2000; Yin et al., 2000) and netrin-G 1 (Nakashiba et al., 2000). Netrin-4 is more c\osely related to the ~ chain of laminin than it is to netrin-I and netrin-3, which are more c\osely related to the J chain oflaminin. In mouse netrin-4, 7 of 18 amino acids are conserved in the sequence used to generate antibody PN2. This sequence is absent from mouse netrin-G 1. The poor conservation of this epitope indicates that it is unlikely that antibody PN2 recognizes these netrins.

Neurons and oligodendroglia express netrin-l in adult spinal cord To identify the cell types that express netrin-I in the adult rat spinal cord, the distribution of netrin-I mRNA was investigated using in situ hybridization analysis. An antisense netrin-I riboprobe (933 nuc\eotides) detected positive\y hybridizing cells in ail laminas of the gray matter and throughout the white matter (Figure 2.1 C-G). A second netrin-I antisense riboprobe (196 nuc\eotides) detected an identical pattern of hybridization (data not shown). Corresponding sense probes produced no signal (Figure 2.1 C, inset). The morphology and distribution of many positive cells suggested that they were neurons (Figure. 1E,F); however, the presence of netrin-I-expressing cells in the white matter indicated that certain glia may also constitutively express netrin-I (Figure 2.IG).

46 The distribution of netrin protein in the adult spinal cord was assessed using the affinity-purified antibody PN2. Netrin-immunoreactive cells were present in the white matter and ail laminas of the spinal cord (Figure 2.2). These results are consistent with the distribution of netrin-I-expressing cells detected using in situ hybridization (Figure 2.1). Particularly high levels of immunoreactivity were found in the dorsal homo Strongly labeled cells with the morphological characteristics of spinal intemeurons were present in the most superficial laminas (Figure 2.2A,C) and in the neck of the dorsal hom (Figure 2.2A,D). In addition to cell body staining, significant immunoreactivity was also detected in the neuropil. Much of this staining was fibrous, suggesting an association between netrin protein and neurites (Figure 2.2A,C,D). Although present throughout the gray matter of the spinal cord, this pattern of staining was particularly c1ear in the lateral spinal nucleus and lateral cervical nucleus. These nuclei contained a web of netrin-immunoreactive processes with morphological characteristics of dendrites and larger immunopositive neurites with a beads-on-a-string appearance characteristic of synaptic varicosities (Figure 2.2F). Cell bodies and processes of motor neurons in the ventral horn were also c1early netrin immunoreactive. This staining included neurites within the gray matter with dendritic morphology and immunopositive axons projecting out of the gray matter (Figure 2.2B,E). Sections of rat spinal cord were then double-Iabeled with antibodies against netrin and immunohistochemical markers for neuronal or glial cells. Double labeling using a monoclonal antibody against the neuronal-specific antigen NeuN and the polyclonal netrin antibody PN2 confirmed that many of the immunopositive cells in the adult spinal cord gray matter were neurons (Figure 2.3). However, a subset of small netrin-positive, NeuN­ negative cells in the gray matter were morphologically similar to the netrin-I-expressing cells present in white matter. Immunohistochemical markers that differentiate between glial cell types were used to identify the netrin-I-expressing cells in the spinal white matter. No colabeling was found between netrin-I-positive cells and GF AP-positive astrocytes (Figure 2.4). In contrast, an antibody against the oligodendroglial marker CNP (Vogel and Thompson, 1988) labeled ail of the netrin-immunoreactive cells observed in the white matter of the adult rat spinal cord (Figure 2.5F-H).

47 To contirm the identity of these cells, we used a line of mice carrying a transgene that marks the oligodendrocyte lineage. These mice contain a laeZ reporter gene that has been "knocked in" and replaces the tirst exon of the MBP gene (Bachnou et al., 1997). LaeZ expression is driven by the endogenous MBP promoter, and :tgal accumulation serves as a sensitive marker to identify oligodendrocytes. AIthough the interrupted locus is null for MBP and mice lacking MBP have the shiverer phenotype because of myelin deticiency (Roach et al., 1985), heterozygous knock-in mice are normal and were used for our analysis. Netrin-I immunoreactivity colocalized with 3_gal immunoreactivity in both the white (Figure 2.5C-E) and the gray matter (data not shown) of the spinal cord. In both adult rats and the MBP-lacZ transgenic mice, extensive analysis of colabeling along the full rostrocaudal extent of the spinal cord showed no discordance between the coexpression of oligodendrocyte markers and netrin, indicating that most, if not ail, oligodendrocytes in the aduIt spinal cord constitutively express netrin-I.

Time course of postnatal netrin expression We performed a developmental time course of postnatal netrin-I protein expression in the rat spinal cord using Western blot analysis (Figure 2.6A). Similar amounts of full-Iength netrin-I protein were detected in the newborn [postnatal day 0 (PO)] through to adulthood. A small but distinct shift (-80 to -75 kDa) in the mobility ofnetrin- 1 protein occurs at approximately P14. We have found no evidence that netrin-I mRNA is aIternatively spliced in either the developing or aduIt CNS, raising the possibility that netrin-l may undergo different post-translational processing in the embryo compared with the adult, possibly by limited proteolysis or differential glycosylation. Several potential N­ linked glycosylation sites are conserved in mammalian netrin-l sequences. AIthough the -75 kDa band is the predominant species found in the aduIt, the enrichment produced by subcellular fractionation (described below) revealed the presence of both immunoreactive bands in the aduIt nervous system (Figure 2.6B, lane 8). It may be the case that both variants are produced in the adult CNS or aIternatively that the higher molecular weight protein corresponds to protein produced earlier in development that persists in the adult. Currently, little is known about the half-life of netrin-l protein in any context.

48 Netrin-l protein is membrane-associated in the adult spinal cord *Consult supplemental figure 2.8 for a schematic summarizing this fractionation The subcellular distribution of netrin-1 protein was identified using fractionation by differential centrifugation of adult rat spinal cord homogenates (Figure 2.6B). We followed the initial steps of a netrin purification protocol that was developed to isolate membranes derived from embryonic day 10 chick brains (Serafini et al., 1994). Although a secreted protein, netrin-1 was isolated from the membrane-associated fraction of the embryonic CNS (Serafini et al., 1994). To what extent netrin-I protein is soluble or membrane-associated in the embryo has not yet been determined. The fractionation of adult rat spinal cord homogenates reported here indicates that the majority of netrin-1 in the adult CNS is not freely soluble. The results are consistent with much of the netrin-I protein being membrane-associated or incorporated into an insoluble component of the extracellular matrix. After homogenization, full-Iength netrin-I was detected in the LSP (Figure 2.6B, lane 1) that contains a heterogeneous mixture of nuclei, intact cells, large cellular debris, and extracellular matrix. After the high-speed spin that separates membranous microsomes from soluble proteins, an immunoreactive band corresponding to the molecular weight of full-Iength netrin-I (-75 kDa) was enriched in the HSP (Figure 2.6B, lane 5) relative to the HSS (Figure 2.6B, lane 6). The microsomes in the HSP fraction are derived from a mixture of cellular membranes that include the plasma membrane, endoplasmic reticulum, and Golgi apparatus. Calnexin and MG-160 are integral membrane proteins of the ER and Golgi apparatus, respectively (Gonatas et al., 1989; Wada et al., 1991), and were appropriately enriched in the HSP (Figure 2.6B, lane 5). TrkB, a tyrosine kinase that functions as a neurotrophin receptor at the plasma membrane (Klein et al., 1991) was similarly enriched in the HSP fraction. After high-salt extraction of the HSP to solubilize membrane-associated proteins, these transmembrane proteins ail partitioned into the HSEP fraction (Figure 2.6B, lane 7), appropriately remaining with the membranes. BiP, a soluble ER resident protein (Munro and Pelham, 1986), was also enriched in the HSP and HSEP fractions, indicating that proteins contained within the lumen of the ER largely remain associated with the membrane fraction. This suggests that most ER microsomes reform to retain their contents and are not Iysed by either homogenization or high-salt extraction. After high-salt extraction of the

49 HSP, the majority of netrin-I protein was stripped from the membranes and partitioned into the HSES (Figure 2.6B, lane 8). Densitometric analysis indicated that netrin-I is enriched -25-fold in the HSES fraction compared with the HSP and -140-fold in the HSES compared with the homogenate (Table 2.1). A small amount of netrin-I protein remained associated with the microsomal membranes in the HSEP. This may correspond to netrin-I in vesicles that had not yet been secreted from the cell, to netrin-I inside an endosomal compartment of the cell, or to netrin-I within vesicles derived from plasma membrane that resealed in an outside-in configuration after homogenization. The presence of sorne netrin-I protein within an intracellular membrane-bound compartment is consistent with the results shown in Figure 2.2, iIIustrating the presence of netrin-I immunoreactivity in the cytoplasm of many cells. In summary, the fractionation results obtained are consistent with the majority of netrin-I protein in the adult spinal cord being associated with the exterior surface of cellular plasma membranes or the ECM.

Netrin-l protein is associated with periaxonal myelin To characterize the distribution of netrin-I in the white matter, we performed myelin fractionation experiments. Following a series of steps described schematically in Figure 2.7 A, we produced final fractions enriched for compact mye\in, periaxonal mye\in, and axolemma following a protocol described by Sapirstein et al. (1992). Fractions enriched for crude gray matter and crude myelin were generated tirst (Figure 2.7B, lanes 2,3). From the crude myelin, fractions enriched for myelin and crude periaxolemma were produced (Figure 2.7B, lanes 4,5). The myelin fraction was further processed to yield the puritied mye\in fraction (Figure 2.7B, lane 6) that is highly enriched for compact myelin. The crude periaxolemmal fraction (Figure 2.7B, lane 5) is the precursor to fractions enriched for periaxonal mye\in and axolemma (Figure 2.7B, lanes 7,8). The periaxonal mye\in fraction is enriched for oligodendrocyte membranes apposed to the periaxonal spa ce, whereas the axolemmal fraction is enriched for axonal membranes derived from myelinated axons. MBP was used as a marker for fractions containing compact myelin (Yin et al., 1997). MBP was appropriate\y enriched in the puritied myelin fraction (Figure 2.7B, lane 6). MAG, a transmembrane protein, and CNP, a cytoplasmic plasma membrane­ associated enzyme, were used as markers enriched in periaxonal myelin (Trapp et al.,

50 1988; Bartsch et al., 1989), and NFM was used as a marker for axons (Lee and Cleveland, 1996). Here, CNP and MAG were appropriately enriched in the periaxonal myelin fraction and NFM in the axolemmal fraction (Figure 2.7B, lanes 7,8), confirming that components of these fractions partitioned as expected. After fractionation of crude myelin into the myelin and crude periaxolemmal fractions, netrin-I was enriched in the latter fraction (Figure 2.7B, lane 5) with barely detectable levels present in the myelin fraction (Figure 2.7B, lane 4). After further purification, netrin-I was not detected in the purified myelin fraction (Figure 2.7B, lane 6). Consistent with this result, we did not detect netrin-I protein in preparations ofpurified compact myelin prepared using an alternative method described by Norton and Poduslo (1973) (data not shown). Netrin-I protein could be detected in both the axolemmal and periaxonal myelin membrane fractions (Figure 2.7B, lanes 7,8) after further fractionation of cru de periaxolemma. The distribution found after fractionation is consistent with the netrin-I staining detected in the white matter immunohistochemically (Figure 2.5B). In agreement with the results of fractionation, compact myelin did not stain. However, many small immunoreactive dots and, more rarely, thin linear positive profiles were detected throughout the white matter, consistent with the presence of netrin-I within the proximal processes of oligodendrocyte arms and the periaxonal space (Figure 2.5B). Although ultrastructural analysis using immunoelectron microscopy will have to be performed to determine the precise subcellular localization of netrin-I protein, the findings presented here demonstrate that full-Iength netrin-I protein is excluded from compact myelin and suggest that netrin-I is present in the periaxonal space associated with the membrane surfaces of oligodendrocytes and axons.

51 v. DISCUSSION

Netrins: secreted proteins with long-range and short-range actions Netrins are bifunctional cues, attracting the growth of sorne axons and repelling that of others. Netrin-I protein secreted by the floor plate has been proposed to form a gradient that orients the growth of circumferentially extending axons in the developing neural tube (Kennedy et al., 1994; Colamarino and Tessier-Lavigne, 1995a). In support of this, netrin-I secreted by cells in vitro acts as a long-range cue to attract or repel the axons of different types of neurons (Kennedy et aL, 1994; Colamarino and Tessier-Lavigne, 1995a; Shirasaki et aL, 1996; Deiner et aL, 1997; Metin et aL, 1997; Varela-Echavarria et aL, 1997; Wang et al., 1999). These assays suggest that netrin-I protein can diffuse at least 250/lm from the source of netrin-I synthesis (Placzek et aL, 1990; Kennedy et aL, 1994). Consistent with this, loss of netrin-I or DCC function in vivo disrupts the normal establishment of long-distance axonal projections, including those that grow to the floor plate and pioneer the ventral commissure of the spinal cord (Serafini et aL, 1996; Fazeli et aL, 1997). Here we describe widespread constitutive expression of netrin-I by neurons and oligodendrocytes in the adult mammalian spinal cord. Furthermore, the level of netrin-I mRNA detected was similar to that found in the embryonic CNS. However, subcellular fractionation indicated that the majority of netrin-I protein present in the adult CNS is not freely soluble. In the adult, newly synthesized netrin-I protein may be extemalized already bound to a component of the cell surface, or altematively, it may be diffusible immediately after secretion but then captured by a component of the ECM or the cell surface. In either case, these results suggest that much of the netrin-I prote in present is bound to either the surface of the cell secreting the protein or the surface of a nearby celL By definition, this distribution suggests a short-range tùnction for netrin-I in the adult CNS. As such, this may have more in corn mon with the short-range role of netrin regulating the development of neuromuscular synapses in D. melanogaster (Winberg et aL, 1998) th an with the function of netrin as a long-range axon guidance cue in the embryonic spinal cord (Kennedy et aL, 1994; Serafini et al., 1996). In the study by Winberg et al. (1998), netrin was found to act as a short-range target-derived cue regulating the formation of nerve-

52 muscle synapses in a concentration-dependent manner. The distribution described here suggests that a major function of netrin-I in the adult mammalian CNS may be to similarly regulate cell-cell interactions, including synaptic connections and axon-glial interactions. For netrin-I to function as a short-range cue, netrin receptors must be expressed by nearby cells. DCC expression has been reported in the adult human spinal cord, although the specific cell types involved were not identified (Hedrick et al., 1994). Consistent with this observation, we have found that dcc and the netrin receptors neogenin, unc5hl, and unc5h2 are ail constitutivelyexpressed in the adult rat spinal cord (our unpublished data).

Neurons in the adult spinal cord express netrin-l

Our findings indicate that many neurons ln the adult spinal cord, including motoneurons and multiple classes of interneurons, express readily detectable levels of netrin-I. Embryonic commissural neurons express DCC and require netrin-I to extend their axons to the floor plate (Serafini et al., 1996). In the adult rat, these commissural neurons are thought to become spinothalamic, spinoreticular, and spinocerebellar neurons (Altman and Bayer, 1984; reviewed by Colamarino and Tessier-Lavigne, 1995b). AIthough embryonic commissural neurons do not express netrin-I as their axons extend to the floor plate, our resuIts suggest that these and man y other classes of spinal interneurons express netrin-I in the adult. During development in C. elegans, sorne pioneer neurons that extend an axon in response to a distant source of netrinlUNC-6 later express unc-6 themselves, and it has been suggested that this neuronal source of UNC-6 may influence the growth of other axons (Wadsworth et al., 1996). Furthermore, analysis of the distribution of netrin prote in found in the developing CNS of D. melanogaster indicates that frazzled, the fly homolog of DCC, can capture netrin and present it locally along the surface of an axon. This results in a restricted distribution of netrin that functions to guide later-extending axons (Hiramoto et al., 2000). These results indicate that netrin on the surface of a neuron can affect the behavior of an adjacent cel\. They also raise the possibility that in the mammalian CNS, the distribution of netrin protein may be influenced by the distribution of receptors, such as DCC and neogenin, that may function to localize and present netrin to nearby cells.

53 Netrin-l is expressed by oligodendrocytes and enriched in periaxonal myelin In addition to being expressed by neurons, we report that most, if not ail, oligodendrocytes in the adult spinal cord express netrin-I. Furthermore, fractionation of aduIt spinal cord white matter indicated that full-Iength netrin-I protein is exc\uded trom compact myelin but may be localized to the periaxonal space, the interface between axons and 01 igodendroglia. The intimate apposition between oligodendrocytes and axons constitutes one of the most extensive intercellular specializations in the CNS. The membranes associated with myelinated axons can be divided into at least three types: compact myelin, periaxonal myelin, and axolemma. Compact myelin is a specialized, but enzymatically inactive, structure. In contrast, the oligodendrocyte membrane facing the periaxonal space is specifically enriched with proteins such as CNP and MAG, proteins that appear to be required for the maintenance of interactions between axonal and oligodendroglial membranes (Yin et al., 1997; Schachner and Bartsch, 2000). Immediately before myelination begins, the interaction between the axon and its ensheathing oligodendrocyte must involve both surface recognition and adhesive affinity. The expression of netrin-I by adult oligodendrocytes suggests that it may regulate oligodendrocyte motility during deve\opment or influence myelination. Understanding this role of netrin-I may provide insight into the development of strategies that promote remye\ination in diseases such as multiple sc\erosis. The presence of netrin-l in the CNS may also influence the ability of axons to regenerate after injury. Although many CNS neurons have the capacity to regenerate a severed axon (David and Aguayo, 1981), the onset of myelination in the mammalian CNS coincides with a dramatic drop in the ability of injured axons to regenerate. Substantial evidence indicates that CNS white matter contains factors that inhibit axon outgrowth (reviewed by Schwab et al., 1993), and multiple inhibitory components of myelin have been identified (McKerracher et al., 1994; Mukhopadhyay et al., 1994; Chen et al., 2000; GrandPre et al., 2000; Prinjha et al., 2000). Interestingly, two of these inhibitors, MAG and Nogo, are constitutively expressed by oligodendrocytes in the adult CNS and enriched in periaxonal mye\in (Bartsch et al., 1989; Chen et al., 2000). The expression of netrin-l by mature oligodendrocytes and its presence in periaxonal myelin suggest that myelin­ associated netrin-l may restrict axonal sprouting in the aduIt CNS, perhaps via a

54 mechanism analogous to axonal chemorepulsion during development. Such a function in the normal CNS may translate into inhibition of regeneration after injury.

Netrin: a role at the cell surface mediating cell-cell interactions? Here we have identified the cell types that express netrin-I in the adult spinal cord; however, both netrin-I and DCC are also expressed outside the nervous system (Hedrick et al., 1994; Kennedy et al., 1994; Reale et al., 1994; Meyerhardt et al., 1999; Wang et al., 1999). DCC was first identified as a candidate tumor suppressor deleted in sorne forms of colorectal cancer (Fearon et al., 1990; Hedrick et al., 1994). Loss of DCC expression occurs with the progression of multiple types of cancer, including glial carcinomas (Scheck and Coons, 1993; Ekstrand et al., 1995; reviewed by Cho and Fearon, 1995; Reyes­ Mugica et al., 1997). Furthermore, mutation or strongly reduced expression of netrin-I has been found in sorne human glioblastomas and neuroblastomas (Meyerhardt et al., 1999), and although controversial, recent findings continue to support a role for DCC as a tumor suppressor (Hilgers et al., 2000). As such, the short-range function for netrin-I emphasized here, mediating neuron-neuron and neuron-glial interactions in the aduIt CNS, may be representative of a wider role for netrin-DCC interactions regulating cell-cell contact in multiple tissue types.

55 Figure 2.1. Distribution of netrin-l-expressing ce Ils in adult rat spinal cord. A, Illustration of a hemisection of an adult rat spinal cord [adapted from Paxinos (1995)] is shown. The boxes correspond to the regions displayed in the micrographs of dorsal spinal cord (C, top box in A) and ventral spinal cord (D, bottom box in A). B, Northem blot analysis of E 14 rat brain and adult rat spinal cord poly(A+) RNA (2 J.1g of RNA) identified a single -6 kb mRNA transcript encoding netrin-I, and for netrin-3 identified a major transcript at -9 kb and several minor transcripts only in the E 14 brain. Netrin-3 is not expressed at detectable levels in the adult spinal cord. RNA size standards correspond to 9.49, 7.46,4.40,2.37, 1.35, and 0.24 kb (Bio-Rad, Hercules, CA). Western blot analyses of protein present in a high-salt extract of the membrane fraction of adult rat spinal cord homogenate using antibodies PN2 or PN3 are shown. Both antibodies reveal an -75 kDa immunoreactive band, consistent with the molecular weight of netrin-I. The additional minor lower-molecular weight immunoreactive bands may be proteolytic fragments of full-Iength netrin protein. Protein size standards correspond to 116,97.4,66.2,45, and 31 kDa (Bio-Rad). C-G, In situ hybridization analysis identified netrin-I-expressing cells in ail laminas and the white matter of dorsal (C) and ventral (D) hemisections of C5 spinal cord. E illustrates the morphology of netrin-I-expressing cells in lamina IV of the dorsal homo Hybridization was detected in the cytoplasm and the proximal portion of neurites. Large neurons in the ventral hom with the morphological characteristics of motoneurons express netrin-I (D. F). Netrin-I-positive cells were also detected throughout the white matter (C. D). G illustrates the morphology of netrin-I-positive cells located in ventral C5 white matter. Like the neurons in E and F, positive hybridization was detected in the cytoplasm and proximal processes of these glial cells. The small inset in C illustrates the absence of hybridization using the corresponding sense cRNA probe. C-G, DifferentiaI interference contrast (DIC) optics, digoxigenin-Iabeled probe visualized with a POD­ conjugated secondary antibody against digoxigenin and the diaminobenzidine substrate, is shown. Objective magnification: C. D, lOx; E. F, 40x; G, 100x. Scale bars: C. D, 150 J.1m; E. F, 50 J.1m; G, 25 J.1m. GAPDH, Glyceraldehyde-3-phosphate dehydrogenase.

56 Netrin-1 Netrin-3 PN2 PN3 A B E14 A E14 A -- i -

GAPDH ..

. ~ ff'" _."-. - ••• : .&

.' .

;.-" ,.-f", r: _- .'

·~t~~-~!' -:-'! . '-f~ '.: r,~

'.

57 Figure 2.2. Distribution of netrin-l protein in adult rat spinal cord. A, B, Distribution of netrin-l immunoreactivity in dorsal (A) and ventral (B) C7 aduIt rat spinal cord is shown. Netrin-l immunoreactivity was associated with a heterogeneous population of cell bodies throughout the spinal gray matter and a uniform population in the white matter. C, D, F, Fibrous and punctate immunoreactivity was detected in the neuropil (C, D), including immunoreactivity associated with fine processes and with larger neurites that have a beads-on-a-string morphology characteristic of synaptic varicosities (F; cervical nucleus and lateral spinal nucleus at C7). E, In the ventral hom of the gray matter, netrin­ immunoreactive cell bodies and processes characteristic of motoneurons were detected. A, B, In the white matter, a uniform population of small cell bodies and their processes were netrin-l positive. Bright-field optics, visualized with a POD-conjugated secondary antibody and diaminobenzidine substrate, is shown. Objective magnification: A, B, 1Ox; C-F, 40x. Scale bars: A, B, 100 !lm; C-E, 50 !lm; F, 30 !lm.

58 A

"

B

" '-l .• ... • ~ ,.; " ...

59 Figure 2.3. Netrin-l expression by neurons. Coimmunolabeling for netrin (PN2) and the neuronal marker NeuN illustrates a close association of netrin prote in with neurons in ail laminas of the adult spinal cord. Hemisections of C7 rat dorsal spinal cord (A, B) and ventral spinal cord (C, D) are double immunolabeled for netrin (A, C) and the neuronal­ specifie marker NeuN (B, D). In the gray matter, many NeuN-positive neurons are netrin positive; however NeuN-negative, netrin-positive cells are also present throughout the gray and the white matter. Confocal microscopy, with Cy3- and FITC-coupled secondary antibodies, is shown. Objective magnification, 10x. Scale bars, 250 /lm.

60 61 Figure 2.4. Netrin-l is not expressed by astrocytes. Double immunolabeling for netrin and the astrocytic marker GF AP indicates that netrin is not expressed by astrocytes. A, The distribution of netrin protein (red) in the ventral spinal cord of an adult rat. The dashed fine delineates the border between the gray matter of the ventral horn (above) and the spinal white matter. B, The distribution of astrocytes indicated by GF AP immunoreactivity (green). C, The absence of colabeling between netrin-immunoreactive cells in spinal white matter and GF AP-positive astrocytes. D, A magnification of the central portion of C, illustrating that although the GF AP-positive and netrin-I-positive processes are often intertwined, they are distinctly separate. Confocal microscopy, with Cy3- and FITC­ coupled secondary antibodies, is shown. Objective magnification, 20x. Scale bar, 100 ).lm.

62 63 Figure 2.5. Oligodendrocytes express netrin-l in the adult spinal cord. A, In situ hybridization showing the distribution of netrin-I-expressing cells in white matter at the ventral edge of the adult rat cervical spinal cord. B, Distribution of netrin immunoreactivity in a similar section of cervical spinal cord. A and B are visualized with POO and DAB. C-E, A transgenic mouse line that marks the oligodendroglial lineage by expression of laeZ used to determine the relationship between netrin-l expression and oligodendrocytes. D, Confocal analysis of netrin-l immunoreactivity (red, Cy3-conjugated secondary antibody). E, 3-Gal immunoreactivity marking oligodendrocytes (green, FITC­ conjugated secondary antibody). C, Superimposition of D and E showing netrin-l­ immunoreactive oligodendrocytes. F-H, Confocal image analysis of double-Iabeled immunoreactivity in the adult rat spinal cord of netrin and the oligodendrocyte marker CNP. G, Netrin-l immunoreactivity (red, Cy3-conjugated secondary antibody). H, Distribution of CNP immunoreactivity (green, FITC-conjugated secondary antibody). A, DIC optics. B, Bright-field optics, POD-conjugated secondary antibody and DAB. C-H, Confocal microscopy. Objective magnification: A, B, 40x; C-H, 100x. Scale bars: A, B, 50 !lm; C-H, 25 !lm.

64 A B

65 Figure 2.6. Postnatal expression and subcellular enrichment of netrin protein. A, Western blot analysis of total spinal cord homogenates illustrates a developmental time course of netrin protein expression in postnatal and adult rat spinal cord. Lane 1 is derived from newborn rat spinal cord; lanes 2-4 are from P7, P14, and adult spinal cord, respectively. A small but distinct shift in the mobility of netrin occurs at approximately PI4 (-80 to -75 kDa). PAGE (10%) was used to separate -30 Ilg of total prote in loaded per lane. B, After homogenization of adult rat spinal cords, the low-speed spin yields an LSP (lane 1) and an LSS (lane 2). The medium-speed spin of the LSS yields an MSP (lane 3) and an MSS (lane 4). The high-speed spin of MSS yields the HSP (lane 5) containing microsomes and an HSS (lane 6) containing soluble proteins. High-salt extraction of the HSP and high-speed centrifugation yields the HSEP containing stripped microsomes, transmembrane proteins, and the microsomal contents (lane 7) and the HSES containing solubilized membrane-associated proteins (lane 8). PAGE (10%) was used to separate -20 Ilg of total protein loaded per lane. The same nitrocellulose membrane was reprobed multiple times to visualize the different markers shown. Below the immunoreactivity for netrin and each of the markers, the same blot is shown stained with Ponceau S, illustrating that comparable amounts of protein are present in each lane. The arrow indicates the approximate molecular weight of netrin-I. Molecular weight markers correspond to 116,97.4,66.2,45, and 31 kDa.

66 A 2 3 4

B 2 3 4 5 6 7 8 - -

Calnexin ______.. _- ...

Bip ...... ___ ... - __

MG160 trkB -- -- ... :;

---,.--.~ 'F ..;...:...--. -".. L ~ ---=------1=~ .

67 Figure 2.7. Netrin-l is enriched in periaxonal myelin. A, The flow chart illustrates the origin of the fractions containing purified myelin, periaxonal myelin, and axolemma. Each step is labeled with the number corresponding to the lane on the gel in B containing that fraction. B, The proteins MBP (-14 kOa), CNP (-46 kOa), MAG (-100 kOa), and NFM (-145 kOa) were used as markers for the enrichment ofpurified myelin (compact myelin), periaxonal myelin, and axolemmal membranes, respectively. Full-Iength netrin-I protein partitioned between the crude myelin (lane 2) and crude gray matter (lane 3) fractions. After separation of the crude white matter fraction into myelin (lane 4) and cru de periaxolemma (lane 5), netrin-I (-75 kOa) was enriched in the crude periaxolemmal fraction. No netrin immunoreactivity was detected in the purified myelin fraction containing compact myelin (lane 6). After further fractionation of the crude periaxolemmal myelin, full-Iength netrin-I partitioned between the fractions enriched for periaxonal myelin (lane 7) and axolemma (lane 8). A 10% and a 12% acrylamide gel were used to separate -20 Jlg of total prote in loaded per lane to visualize the different markers shown. Below the immunoblots, a 12% gel containing these fractions is shown stained with Coomassie blue, illustrating the distribution of proteins in each fraction and that comparable amounts of protein are present in each lane. Molecular weight markers correspond to 116, 97.4, 66.2, 45, 31, and 21 kOa.

68 A B 1 2 3 4 5 6 7 8 Netrin-1 ...... c;;r. NFM ---.------CNP --- - • MAG ... _ MBP ------

... --- ~---~ -lJiSJ·~ -

69 Fraction Volume (ml) Total protein (mg) 00 units (OD/mg) -Fold enrichment

Homogenate 6 62.0 [8500] 137 LSP 10 21.5 20850 970 7.1 LSS 5 42.2 1898 45 0.3 MSP 6.5 28.5 5401 189 1.4

MSS 8.5 18.1 2599 143 1.0 HSP 4 5.0 3809 756 5.5 HSS 7.25 12.4 1756 142 1.0 HSEP 2.6 2336 882 6.4 HSES 4 1.4 28234 18949 138

Table 2.1. Enrichment of netrin-l after subcellular fractionation of adult spinal cord

The table illustrates the relative enrichment of netrin-I protein in the fractions shown in each of the lanes in Figure 2.6. For each fraction, the total volume, the mass of total prote in, the optical density (00) of the netrin-I-immunoreactive band, the calculated netrin-I OD/mg, and the approximate fold enrichment of netrin-I are listed. The 00 for the total protein homogenate was estimated, indicated by brackets, by summing the 00 units measured for the LSP and LSS.

70 membrane-associated membrane microsomes protein trom different cellular compartments lane/~.,.

transmembrane / 'r ., 'r~ High Speed Spin protein . l' "'soluble protein separates microsomes trom soluble proteins Lanes".-:. ~ ~L:ne6 High salt extract Lane7 1 \ Lane8 -performed on Lane 5 \. -solubilizes membrane-associated . protein .:. "lI High Speed Spin -transmembrane proteins pellet with microsomes in Lane 7 -solubilized membrane-asociated proteins remain in supematant in Lane 8

Figure 2.8 (supplemental). Schematic of the subcellular fractionation used in Figure 2.6.

71 PREFACE TO CHAPTER 3

The prevlOus study reported that netrin-l is expressed by multiple neuronal subtypes and mature myelinating oligodendrocytes in the adult spinal cord (Manitt et al., 2001). Crude membrane fractionations indicated that netrin-l protein is enriched in ECM and on the surface of membranes, and subcellular fractionation of white matter localized netrin to periaxonal membranes. These findings suggested that netrin-l might function as a short-range cue that mediates neural and axon-oligodendrocyte interactions in the adult CNS. ln order for netrin to function as a short-range cue, netrin receptors must be expressed in regions of netrin expression. Two families of netrin receptors have been identified: the DCC family, and the UNC-5 homologue family. Evidence indicates that DCC is required for an attractant response. A repellent response is either mediated by UNC-5 homologue al one or by a complex of DCC and an UNC-5 homologue depending on the circumstances. In this study 1 characterized netrin receptor expression in the adult spinal cord in order to gain further insight into the potential roles of netrin in adult neural function. The specific experiments that were performed aimed to 1) determine the distribution of netrin receptor expression and assess whether this distribution is consistent with evidence that netrin functions as a short range cue in the adult spinal cord and 2) examine the levels of the two netrin receptor families in the adult spinal cord in order to determine if netrin is more likely to exert repellent or attractant efTects in the adult CNS.

This work was published in the Journal ofNeuroscience Research (Manitt et al., 2004).

72 I. SUMMARY

Netrins are a family of secreted proteins that are required for normal neural development. Netrin-l is expressed at similar levels in the adult rat spinal cord and the embryonic CNS suggesting that it contributes to adult CNS function. Here we show that the netrin receptors dcc, neogenin, unc5hl, unc5h2, and unc5h3 are also expressed in the adult rat spinal cord. Lower levels of DCC and neogenin were detected in the adult relative to the embryonic CNS. Conversely, the adult spinal cord contains increased levels of UNC-5 homologues in comparison to the embryo. Multiple mRNA transcripts detected by northem blot analysis suggested that netrin receptors might be encoded by altematively spliced mRNAs. We have identified a novel altematively spliced mRNA encoding UNC5H 1, UNC5H l "'TSP 1, which lacks the first of the two extracellular thrombospondin domains. This novel splice variant is the major transcript detected in the early embryonic CNS, while both splice variants are expressed in the adult. Previously identified altematively spliced mRNAs encoding DCC and neogenin were also detected. Dcc, neogenin, unc5hl, unc5h2, and unc5h3 are expressed by subsets of neurons. Robust expression of unc5h2 was found in glia. These findings suggest that unc-5 homologues constitute a major mode of netrin-l signal transduction in the adult spinal cord and may be involved in phenomena analogous to axon repulsion such as inhibiting process extension and collateral sprouting.

74 II. INTRODUCTION

Netrins are a family of secreted proteins that are essential for normal neural development. They direct migrating cells and axons (reviewed by Dickson & Keleman, 2002), regulate nerve-muscle synaptogenesis in D. melanogaster (Mitchell et al., 1996; Winberg et al., 1998), and mediate adhesive interactions between cells in non-neural tissue (Srinivasan et al., 2003). We have reported that netrin-l is expressed in the adult rat spinal cord by neurons and mature myelinating oligodendrocytes (Manitt et al., 2001), although its role in the adult is not known. During development, netrin-I attracts the growth of sorne axons, while repelling others. The response made by an axonal growth cone to netrin-l is intluenced by the repertoire of netrin receptors expressed by the responding cell (Hong et al., 1999), the level of activation of protein kinase A (Ming et al., 1997), and the regulated presentation ofreceptors on the growth cone plasma membrane (Williams et al., 2003; Bouchard et al., 2004). In mammals, several families of netrin receptors have been identified: the DCC family, including DCC and neogenin (Fearon et al., 1990; Cooper et al., 1995; Keino­ Masu et al., 1996; Keeling et al., 1997; Meyerhardt et al., 1997), and the UNC-5 homologue family (Ackerman et al., 1997; Leonardo et al., 1997; Ackerman et al., 1998; Engelkamp, 2002; Komatsuzaki et al., 2002). Recently, members of the integrin family of receptors have also been found to bind netrin-l (Yebra et al., 2003). DCC is required for cell and axon migration toward sources of netrin-l (Hedgecock et. al., 1990; Keino-Masu et al., 1996; Deiner & Stretavan, 1999; Yee et al., 1999; Anderson 2000; Braisted et al., 2000; Funato et al., 2000; Barrallobre et al., 2000; Schwarting et al., 2001; Deiner et al., 1997; de la Torre et al., 1997). Netrin mediated repulsion requires UNC-5 function both during axonal pathfinding (Hedgecock et. al., 1990; Keleman and Dickson, 200 1, Finger et al., 2002) and cell migration (Leung­ Hagesteijn et al., 1992; Ackerman et al., 1997; przyborski et al., 1998). Receptor multimerization also appears to be required for netrin signal transduction. DCC receptor complexes transduce an attractant response in Xenopus spinal neurons in vitro (Stein et al., 2001). Repellent responses to netrin often require a complex that inc\udes DCC and an UNC-5 homologue (Hedgecock et al., 1990; Colavita & Culotti, 1998; Keleman and

75 Dickson, 2001; Hong et al., 1999; Jarjour et al., 2003). However, evidence obtained trom D. melanogaster suggests that UNC-5 homologues, acting in the absence of DCC, can transduce a repellent response to netrin (Keleman and Dickson, 2001). In this case, UNC-5 without DCC does not appear to signal tuming away trom a source of netrin but instead signais the axon to stop. Much of the netrin-I protein in the adult rat spinal cord appears to be either close to or associated with the surface of netrin-I expressing cells (Manitt et al., 2001). This distribution suggests that netrin-I may function at the cell surface and contribute to the maintenance of appropriate neuronal and axon-oligodendroglial interactions in the mature nervous system. To further investigate netrin function in the adult CNS, we characterized the expression of netrin receptors in the adult spinal cord. We show that the netrin receptors dcc, neogenin. unc5hl. unc5h2. and unc5h3 are constitutively expressed in the adult rat spinal cord. DCC family members are expressed at substantially lower levels in the adult, compared to embryonic CNS. In contrast, unc-5 homologue expression increases, suggesting that these receptors constitute a major mode of netrin-I signal transduction in the adult spinal cord.

76 III. EXPERIMENTAL PROCEDURES

Animais. Adult male Sprague-Dawley rats between 300-350g and Sprague-Dawley rat pups were obtained from Charles River Canada (PQ). Ali procedures with animaIs were performed in accordance with the "Canadian Council on Animal Care" guidelines for the use of animaIs in research.

Northern and western blot analysis. Total RNA was obtained from embryonic day 14 (EI4) rat brain and adult rat spinal cord. To obtain embryonic rat brains, an E14 staged pregnant rat was anesthetized with sodium pentobarbital (somnitol, 65mg/kg) and the embryos surgically removed, decapitated, and the brains dissected. To obtain adult rat spinal cord tissue, rats were anesthetized with sodium pentobarbitol (somnitol, 65 mg/kg), decapitated, and the cervical to thoracic spinal cord rapidly dissected. Tissue was immediately homogenized in Trizol reagent (Life Technology, MD). Poly (A)+ RNA was purified from total RNA using the Oligotex mRNA mini kit (Qiagen, ON). ap32-dCTP was incorporated into cDNA by random priming with the Prime-a-gene labeling kit (Promega, WI) for the dcc (3786-4639), neogenin (3391-4109), unc5hl, and unc5h2 probes. The unc5hl random primed cDNA probe was transcribed from an -0.8 kb fragment spanning the region between position 2483 and a Xho 1 site in the 3' untranslated region (Leonardo et al., 1997). The unc5h2 random primed cDNA probe was transcribed from an -0.8 kb fragment of unc5h2 spanning the region between position 2595 and a Xho 1 site in the 3' untranslated region (Leonardo et al., 1997). For the unc5h3 probe (2217-2582), ap32_ dCTP was incorporated into a 366 base pair (bp) cDNA by PCR (S'primer, ACC TGC GCC TGT CT A TTC AT; 3 'primer, GGG CCA GCA TCC TCC AGT CA). Probes were purified using ProbeQuant G-50 micro columns (Amersham Biosciences, NJ). Poly (A)+ RNA (1-2 flg) was separated using a 1% formaldehyde-agarose gel and blotted to Hybond­ N (Amersham Biosciences, NJ) using standard methods (Ausubel et al., 1990). Membranes were analyzed by phosphor-image analysis (Amersham Biosciences, NJ). The following antibodies were used for western blot analysis: rabbit polyclonal anti-netrin PN3 (0.7flg/ml) (Manitt et al., 2001), monoclonal anti-DCC (1:1000; G97-449, BD Biosciences Pharmingen, On), goat polyclonal anti-neogenin (1 :500; Santa Cruz

77 Biotech., CA), and rabbit polyc1onal pan-UNC-5 homologue antiserum (1 :6000; provided by Dr. Tony Pawson, University of Toronto, Tong et al., 2001). Protein homogenates were separated using 7.5% PAGE and transferred to nitrocellulose membrane (Amersham Biosciences, NJ). For DCC and UNC-5 homologue immunoreactivity, membranes were pre-incubated in 2% BSA, 0.1 % Tween-20 in PBS, and for netrin and neogenin immunoreactivity, membranes were incubated in 5% milk powder, 0.1 % Tween 20 (Fisher Scientific, On), 3% heat-inactivated normal goal serum (Life Technology, MD), and 0.1 % SOS (Fisher Scientific, On), for 1 hr at room temperature. Membranes were incubated overnight at 4°C in primary antibodies diluted in their respective blocking solutions. Immunoreactivity was visualized using peroxidase-conjugated donkey anti-rabbit, donkey anti-mouse, or donkey anti-goat secondary antibodies (1 :5000; Jackson ImmunoResearch Laboratories, PA) and the Chemi/uminescence Reagent Plus protein detection kit (PerkinElmer Biosignal, Qc).

GST-fusion proteins. The cytoplasmic domains of UNC5H l, UNC5H2 and UNC5H3 were expressed in Escherichia coli as glutathione S-transferase (GST) fusion proteins. cDNA fragments of the cytoplasmic domains of UNC5H l, UNC5H2 and UNC5H3 were amplified using PCR and subc10ned into pGEX-2T (Amersham Biosciences, NJ). The primer pairs used for amplification and their corresponding location within the DNA sequence are as follows: Rat unc5h 1: Expected product of 1512 bp Forward primer: 5' GAC TCG TCC ATC CTC ACC 3' 1186-1205 bp Reverse primer: 5' TCA ACA CTC GGC CTC CG 3' 2680-2697 bp Rat unc5h2: Expected product is 1575 bp Forward primer: 5' CAC CCC GTC AAC TTC AAG 3' 1264-1281 Reverse primer: 5' TCA GCA ATC GCC ATC AGT 3' 2821-2838 Rat unc5h3: Expected product of 1577 bp Forward primer: 5'GTG ACT TIG AGT CTG ACA 3' 1216-1233 Reverse primer: 5' TCA ATA CTG TCC TTC TGC 3' 2774-2792 Fusion protein expression was induced with 0.1 M isopropyl-P-D-thiogalactoside (IPTG) at 37°C for 3 hours. Bacteria were collected, suspended in solubilizing buffer (PBS with

78 1% Triton-X 100, EDTA, PMSF, pepstatin, leupeptin, and aprotinin), and Iysed by sonication. Bacterial debris were removed by centrifugation and the Iysate washed with PBS with 0.1 % Triton-X 100 with protease inhibitors. The Iysate was incubated with glutathione-Sepharose 4B (Amersham Biosciences, NJ) beads for 30 minutes at 4°C.

RT-PCR, cloning, and sequence analysis. Poly (A+) RNA from EI4 embryonic rat brain and adult rat spinal cord was obtained as described for northern analysis. First strand cDNA was synthesized using superscript reverse transcriptase (lnvitrogen, On) and cDNA PCR amplified using the primer pairs listed below. Primers were annealed at 6rC for 30 cycles. The size and corresponding coding sequence of the predicted amplification products are indicated below: rat DCC: portion ofintracellular domain of DCC, (3640-4573; 934 bp). Forward primer: 5' CCG CTC GAG TGG TCA CCG TGG GCG TTC TCA 3' Reverse primer: 5' GGC TGG A TC CTC TGT TGG CIT GTG 3' rat neogenin: a portion of the intracellular domain, transmembrane domain, and a small portion of the extracellular domain, (3064-3976; 913 bp). Forward primer: 5'AAC TGC AGA AAG CGG ACT CCT CTG ATA AAATG 3' Reverse primer: 5' TCC CCG CGG CCG GCT CCT TCC T AA A 3' rat unc5hl: a portion of the intracellular domain domain, transmembrane domain, and a portion of the extracellular domain, (575-1481; 907 bp). Forward primer: 5' GGA ATT CCC TCC CTC GAT CCC AAT GTG T 3' Reverse primer: 5' TCC CCG CGG GGC AGG GAA CGA AAG TAG T 3' rat UNC5hl(DD): 837 bp of the intracellular domain and 170 bp of the 3'untranslated region. This sequence includes the death domain (DO) of UNC5H 1. ( 1861-2867 (or 170 bp into 3' UTR); 1007 bp Forward primer: 5' GCC GGG GCC TGC TAT GTC TTC A 3' Reverse primer: 5' A TC AGG GAG GAG CCG TCA GGT GTC 3' rat UNC5H2: (339-1106; 768 bp) Forward primer: 5' GCT CTA GAG TCG CGG CAG CAG GTG GAG GAA 3' Reverse primer: 5' GGA A TT CAG GGG GCG GCT TIT AGG GTC GTT 3' rat UNC5H3: (2217-2582; 366 bp)

79 Forward primer: 5' ACC TGC GCC TGT CTA TTC AT 3' Reverse primer: 5' GGG CCA GCA TCC TCC AGT CA 3' RT-PCR amplification products were separated by agarose gel electrophoresis and purified using the Qiagen Gel C/ean Kit (Qiagen, ON). Dcc amplification products were subc\oned into the Xho I-BamH 1 sites of pBluescript II KS (Stratagene, CA). The neogenin, unc5hl, unc5h2, and unc5h3 amplification products were subc\oned into pCRII­ TOPO (Invitrogen, On).

In Situ Hybridization. Digoxygenin (DlG)-labeled (PerkinElmer, Biosignal, Qc) sense and antisense cRNA probe pairs were used. Probes were made from the same templates used to make cDNA probes for northem analysis of dcc, neogenin, and unc5hI expression. The unc5h2 cRNA probe was transcribed from a 787 bp fragment spanning nuc\eotides 1380 to 2166 that was subc\oned from a cDNA encoding full-Iength UNC5H2 (Leonardo et al, 1997). The unc5h3 probe was transcribed from a 479 bp sequence spanning nuc\eotides 6776 to 7255 in the 3'-UTR of rat unc5h3 (Karumoto et al., 2004; NCBI accession # AB 118026). In situ hybridization experiments were carried out as described (Manitt et. al., 2001). Briefly, adult male rats (250-350g) were anesthetized with Somnotol (65 mglkg i.p.) and perfused transcardially with ISO ml of PBS pH=7.5, and 1unit/ml of heparin at 4°C. Spinal cords were rapidly dissected and immediately frozen by immersion in isopentane (2-methyl butane, Fisher Scientific, On) chilled in liquid nitrogen. Six Ilm sections were cut with a cryostat, briefly dried onto Superfrost Plus slides (Fisher Scientific, On) and immediately fixed by immersion in 4% paraformaldehyde/15% picric acid (pH 8.5) in PBS for 1 hour at room temperature. In situ hybridization was performed as described (Braissant and Wahli, 1998). Sections were incubated in pre-hybridization solution for 30 min (50% formamide, 5X SSC, 5X Denhardt's, 1% SDS, 40 Ilglml single­ stranded salmon sperm DNA). Digoxygenin-Iabeled probe (100 ng) was added to 100 III of hybridization solution (50% formamide, 5X SSC, 40 Ilg/ml single-stranded salmon sperm DNA). For each probe, conditions were identified in which hybridization was detected using the antisense probe, and there was a complete absence of hybridization using sense strand probes un der identical conditions. For dcc and unc5h3, optimal hybridization and wash conditions were 57°C and 65°C (2x SSC), respectively. Neogenin,

80 unc5h l, and unc5h2 probes were hybridized at 60°C and washes carried out at 65°C (2X SSC). Hybridization was detected us mg a peroxidase-coupled antibody against digoxigenin (Roche, QC), amplified usmg the TSA-Indirect (ISH) Tyramide Signal Amplification kit (New England Biolabs, On), and visualized with peroxidaselDAB detection (Vector Laboratories, On).

81 IV.RESULTS

Dcc, Neogenin, Unc5hl, Unc5hl, and Unc5h3 are expressed in the adult rat spinal cord To further investigate the role of netrin-I in the aduIt CNS, we characterized netrin receptor expression in the adult rat spinal cord. Northern blot analysis detected expression of dcc, neogenin, unc5hl, unc5h2, and unc5h3. A dcc probe detected a ~ 10 kb transcript in aduIt rat spinal cord and EI4 rat brain poly(A+) RNA (Figure 3.1); however, dcc mRNA was present at nearly undetectable levels in the adult. Three major transcripts, ~9.5 kb, -7.5 kb, and. ~5.5 kb, hybridizing to a neogenin probe were detected in the embryonic and aduIt CNS (Figure 3.1). Hybridization for unc5hl or unc5h2 detected ~.5 kb and ~6 kb transcripts, respectively (Figure 3.1). An unc5h3 probe detected ~ 12 kb and ~ 10 kb transcripts (Figure 3.1). To our knowledge, this is the first report of the size of the mRNA encoding UNC5H2 in rat, and of northern blot analysis of unc5hl in any species. Northern blot analysis of unc5h2 expression in human tissues has been described (Komatsuzaki et al., 2002) and unc5h3 expression examined in mouse, rat, and human (unc5c) tissues (Ackerman et al., 1997; Ackerman et al., 1998; Kuramoto et al., 2004). Northern blot analyses of DCC family members have been reported in a variety of species, including rat for dcc (Fearon et al., 1990; Cooper et al., 1995; Keeling et al., 1997; Meyerhardt et al., 1997 Livesey & Hunt, 1997; Shen et al., 2002; Vielmetter et al., 1994; 1997). Northern blot analysis of neogenin expression in rat has not previously been reported.

A developmental shift in the relative levels of DCC, neogenin, UNC5Hl, UNC5Hl, and UNC5H3 in the rat spinal cord To determine if netrin receptor expression might be developmentally regulated in the spinal cord, we carried out a developmental time course using western blot analysis of protein homogenates derived from E 14, postnatal days l, 7, and 14, and adult spinal cord.

A monoclonal DCC antibody detected a single ~ 180 kDa immunoreactive band in spinal cord homogenates (Figure 3.2), consistent with the apparent molecular weight of DCC protein previously reported (Reale et al., 1994; Bouchard et al., 2004). H igh levels of DCC protein were detected in embryonic spinal cord, but the relative amount of DCC protein

82 decreased gradually during maturation. At P14, DCC was bare1y detectable. In order to visualize DCC protein in the adult spinal cord, we ran a second western that compared E 14 spinal cord to adult spinal cord homogenates, but loaded twice the amount of protein in the adult spinal cord lane (Figure 3.2). With this amount of protein loaded, DCC was detected in the adult spinal cord, while demonstrating that substantially less DCC protein is present in the adult compared to the embryonic spinal cord. A polyclonal antiserum against neogenin detected an immunoreactive band at -190 kDa in homogenates of spinal cord (Figure 3.2), consistent with the apparent molecular weight of neogenin protein previously reported in chicken (Vielmetter et al., 1994) and human (Meyerhardt et al., 1996). The amount of neogenin protein also decreased gradua Il y during maturation, and was weakly detectable in the adult spinal cord. In addition to the expected -190 kDa band corresponding to full-Iength neogenin protein, a -120 kDa immunoreactive band was also detected (Figure 3.2). The -120 kDa band may be non-specific antibody cross-reactivity. Altemative1y, the band may correspond to an isoform of neogenin generated by alternative splicing, differential glycosylation, or proteolysis. Interestingly, DCC is inactivated by metalloprotease c1eavage of its extracellular domain (Galko and Tessier-Lavigne, 2000). Further analysis will be required to determine ifneogenin is similarly regulated. A polyclonal antiserum raised against a portion of the intracellular domain of UNC5H3 (Tong et al., 2001) was used to examine UNC-5 homologue protein. The 272 amino acid peptide antigen used shares -60% amino acid identity with the corresponding sequence in mammalian UNC5HI and UNC5H2. We therefore characterized the specificity of the antisera using recombinant proteins composed of GST fused to the intracellular domains ofUNC5HI, UNC5H2 or UNC5H3. Western blot analysis indicated that the antiserum recognized ail three UNC-5 homologues (Figure 3.2), suggesting that this antiserum will detect pan-UNC-5 homologue immunoreactivity. Western blot analysis of spinal cord homogenates detected a band of -130 kDa. The predicted mo1ecular weights of full-Iength UNC-5 homologue family members are very similar, which may explain the absence of multiple bands of different molecular weights. Furthermore, the molecular weight of the band detected is consistent with previous western blot analysis of recombinant epitope tagged C. elegans UNC-5 and endogenous mouse UNC-5

83 homologues (Tong et al., 2001). Our results detect an increase in the amount of UNC-5 homologue protein in the adult relative to embryonic spinal cord (Figure 3.2).

Expression of netrin receptors by neurons and glia in the adult spinal cord To characterize the cells expressing netrin receptors, in situ hybridization was carried out on sections of C5-C8 cervical spinal cord with DlG-labeled cRNA probes and tyramide amplification detection. Dcc, neogenin, unc5hl, unc5h2, and unc5h3 were ail expressed by subpopulations ofneurons (Figure 3.3). No signal was detected using control sense probes run in parallel using identical hybridization conditions (Figure 3.3). We have previously reported that netrin-l is expressed by multiple neuronal cell types in ail laminae of the grey matter in the adult spinal cord (Manitt et al., 2001). The distribution of netrin receptor expressing cells described here suggests that netrin-l and subsets of netrin receptors are expressed by the same neurons. Mature myelinating oligodendrocytes express netrin-l in the adult spinal cord (Manitt et al., 2001). Unc5h2 exhibited robust staining in the white matter indicating that this receptor is also expressed by glia. Faint hybridization signaIs for the other netrin receptors analyzed were detected in the white matter, suggesting that glia may express additional netrin receptors, but at substantially lower levels than unc5h2. The overlapping distributions of netrin receptor expression by neurons and glia suggest that many cells in the adult spinal cord co-express two or more netrin receptors.

Distribution of netrin receptor expression in spinal grey matter In situ hybridization identified robust expression of ail the netrin receptors in the ventral grey matter of the adult spinal. Conversely, differences in the distribution and intensity of expression were observed in the more superficial layers of the dorsal hom (Iaminae I-IV). Faint hybridization of dcc and neogenin probes labeled a sparse distribution of cells (Figures 3.3, 3.4) throughout the superficiallayers of the dorsal hom, while unc5hllabe\ing was almost completely absent (Figures 3.3, 3.4). The distribution of unc5h3 hybridization was similar (Figure 3.3). However, rather than the re\atively ev en distribution of dcc and neogenin positive cells found in ail superficial laminae of the dorsal hom, unc5h3 hybridizing cells were predominantly detected in lamina l, outer

84 lamina II, and lamina IV (Figure 3.4). In contrast to ail other netrin receptors, strong labeling for unc5h2 was detected throughout the entire grey matter of the adult spinal cord (Figures 3.3, 3.4), a distribution reminiscent of the expression pattern of netrin-J (Manitt et al., 2001). Sections used for in situ hybridization analysis of neogenin, unc5hJ, unc5h2, and unc5h3, included attached dorsal roots. Notably, no hybridization for any of the receptors was detected in this portion of the peripheral nerve. This is particularly interesting in the case of unc5h2, which appears to be so robustly expressed by CNS glia (Figure 3.3).

Alternatively spliced mRNA transcripts encoding dcc, neogenin, and unc5hl For several netrin receptors, northern blot analysis identified multiple hybridizing transcripts, suggesting that these receptors might be encoded by alternatively spliced mRNAs. RT-PCR was used to screen for alternative splicing in portions of the coding sequence of each of the receptors. cDNAs were synthesized from mRNA isolated from adult rat spinal cord and E 14 rat brain. Alternative splicing was detected within the amino acid coding sequences of dcc, neogenin, and unc5h J. Alternative splicing within the non­ coding 3' UTR ofunc5hJ was also detected. The PCR amplification product obtained us mg the dcc pnmers matched the predicted fragment length of 938 bp (Figure 3.5A). However, sequence analysis of the product revealed the presence of two dcc mRNA isoforms in adult rat spinal cord poly(A+) RNA. The two isoforms differ by a deletion of 6 bp in the sequence encoding the DCC intracellular domain that results in the loss of two codons and an amino acid substitution at a third codon (RSQSV > R--TV) (Figure 3.5B). Expression of this alternatively spliced dcc variant has been previously detected in a neuroblastoma cell line (Reale et al., 1994). In addition to the predicted 914 bp product amplified using the neogenin primers, a 1073 bp fragment was also generated (Figure 3.5A). Sequence analysis identified a 159 bp alternatively spliced exon in the cytoplasmic domain of neogenin in adult rat spinal cord poly(A+) RNA (Figure 3.5B). This alternatively spliced variant has been previously identified and reported to be expressed in several tissues, including the nervous system, in mouse, chicken, and human (Keeling et al., 1997; Vielmetter et al., 1994; 1997). Keeling

85 et al. (1997) detected three addition al alternatively spliced exons in the sequence encoding the extracellular domain of neogenin in mou se and reported that the splicing was developmentally regulated. Although our primer set spans one of the additional alternatively spliced exons, we did not detect this splice variant in mRNA derived from E 14 rat brain or adult rat spinal cord. RT-PCR using primers predicted to amplify nucleotides 575-1481 of the UNC5HI coding sequence unexpectedly revealed a shorter amplification product in addition to the expected 907 bp band in the adult spinal cord (Figure 3.5A). Sequencing the 907 bp band indicates that it corresponds to the rat unc5hl sequence described by Leonardo et al. (1997; NCBI accession # NM_022206). Sequencing the 739 bp product identified a novel unc5hl splice variant that we have named UNC5HI"'TSPI, as it is missing a 168 bp sequence that encodes the first thrombospondin repeat in the UNC5H 1 extracellular domain (Figure 3.5B). Importantly, only UNC5HI"'TSPI was amplified from EI4 brain, while expression of both UNC5H l "'TSPI and the expected 907 bp product were detected in the adult spinal cord. An additional unc5hl alternatively spliced mRNA was amplified using primers spanning nucleotides 1861-2867 (Figure 3.5B). The primers were designed to amplify 837 bp encoding the UNC5H 1 intracellular domain, sequence that includes the death domain (DO; Hofmann & Tschopp, 1995), and 170 bp of 3' UTR. Two amplification products were obtained: an expected 1005 bp product and an unexpected 1594 bp product containing an additional 589 bp in the 3' UTR. The PCR primer pairs for unc5h2 and unc5h3 each produced a PCR amplification product that matched the predicted fragment length. Sequence analysis confirmed that these amplification products encoded the previously reported sequences (rat unc5h2: NCBI accession # NM_022207, Leonardo et al.(I997); rat unc5h3: NCBI accession # AB 118026, Karumoto et al., 2004).

86 v. DISCUSSION

Netrin-I is expressed by neurons and oligodendrocytes in the adult rat spinal cord (Manitt et al., 2001). Here we report that the netrin receptors DCC, neogenin, UNC5H l, UNC5H2, and UNC5H3 are constitutively expressed in the adult rat spinal cord by neurons and glia (Figure 3.5). Figure 3.6 presents a schematic summarizing the distribution of netrin-I and netrin receptor expression in the adult spinal cord. Relative to the embryonic spinal cord, reduced levels of DCC and neogenin are present in the adult spinal cord. Conversely, the amount of UNC-5 homologue protein increased during maturation, suggesting that UNC-5 homologue family members play an important role in mediating netrin signal transduction in the adult spinal cord.

Alternative splicing ofnetrin receptor mRNA Two alternative splice variants of dcc mRNA were detected in the adult spinal cord. Expression of a dcc mRNA containing a 6 bp deletion was previously found in a neuroblastoma cell line (Reale et al., 1994). This deletion is predicted to remove a potential casein kinase II phosphorylation site in the intracellular domain, but its functional significance has not been demonstrated. Importantly, our findings indicate that alternative splicing normally generates heterogeneity of DCC mRNA in the adult mammalian CNS. Many studies examining DCC function have used cDNAs lacking these 6 base pairs (Hong et al., 1999; Stein & Tessier-Lavigne, Stein et al., 2001; Shekarabi & Kennedy, 2002; Li et al., 2002a, 2002b). These include ail reports thus far that have addressed DCC mediated process extension and growth cone turning. In contrast, the full­ length DCC sequence has been used in studies investigating the role of DCC as a pro­ apoptotic dependence receptor (Mehlen et al., 1998; L1ambi et al., 2001; Forcet et al., 2001). Moreover, papers that disagree regarding the controversial role of the adenosine A2b receptor as a DCC co-receptor for netrin-I used cDNAs that in one case encode the intracellular 6 bp exon (Corset et al., 2000) and in the other case do not (Stein et al., 2001). Whether this difference has any functional significance for the putative interaction between DCC and the adenosine A2b receptor remains to be tested.

87 cDNAs encoding UNC5H 1 were first isolated from an E 18 rat brain cDNA library (Leonardo et al., 1997). Like C. elegans UNC-5 (Leung-Hagesteijn et al., 1992), the previously reported mammalian sequence encodes two extracellular immunoglobulin-like domains and two extracellular thrombospondin type-I repeats. Unlike this sequence, we report that the major mRNA transcript encoding UNC5H 1 in the E 14 rat brain lacks the first thrombospondin type-I domain, suggesting that expression of the full-Iength sequence begins later in development. Comparison of rat UNC5H l, D. melanogaster UNC-5, and C. elegans UNC-5 indicates that the first thrombospondin type-I repeats share 52% and 55% amino acid identity respectively, suggesting that they may also share a conserved function. Recent evidence suggests that the thrombospondin type-I repeats do not bind netrin directly (Geisbrecht et al., 2003). However, analysis of ectopically expressed mutant proteins in D. melanogaster provides evidence that the first thrombospondin type-I repeat is required for UNC-5 to repel axons from a source of netrin (Keleman and Dickson, 2001). Similar analysis in C. elegans suggests that loss of this sequence has greater consequences for cell migration than for axon guidance. Furtherrnore, the distribution of the mutant protein was shifted to cell bodies rather th an axons, which may contribute to the loss of function in these mutants (Killeen et al., 2002). While these findings suggest an important role for the UNC-5 TSPI domain, its contribution to UNC5HI function in mammals is not known. Since UNC5HI"'TSPI is the major isoforrn expressed in the early embryonic CNS, identification of the functional significance of this domain will be important for studies that address UNC5HI function during development.

Altered netrin receptor expression during maturation Our findings provide evidence that the repertoire of netrin receptors expressed by an individual neuron in the spinal cord may change as these neurons mature. Embryonic spinal commissural neurons express DCC and require netrin-I to extend axons to the ventral midline (Serafini et al., 1996). These neurons are thought to become spinothalamic, spinoreticular, and spinocerebellar neurons (Altman and Bayer, 1984; reviewed by Colamarino and Tessier-Lavigne, 1995b). Although DCC is the only netrin receptor known to be expressed by commissural neurons as they extend an axon to the

88 ventral midline, the results presented here suggest that many classes of spinal interneurons, express more th an one type of netrin receptor in the adult spinal cord. Furthermore, the patterns of expression observed suggest that sorne neurons may express DCC during early embryogenesis, but then switch to express an UNC-5 homologue(s) in the adult. Notably, the axons ofretinal ganglion cell neurons change their response to netrin- as they mature (Shewan et al., 2002). Using an embryonic Xenopus laevis preparation, Shewan et al (2002) reported that as the RGC axons extend along the optic pathway, their response to netrin changes. Soon after exiting the eye, the axons loose responsiveness to netrin-I, but as they approach the tectum they begin to be repelled by netrin-l. This was similarly the case for axons aged in vitro, suggesting that the change in responsiveness is triggered by a mechanism intrinsic to the neuron. This change in response correlated with reduced leve\s of cAMP in the neurons and decreased dcc expression.

Do netrins regulate short-range interactions between ulis? Although netrins are secreted proteins, evidence suggests that they may often act as short-range cues that are closely associated with netrin expressing cells, either bound to extracellular matrix or to the extracellular face of the plasma membrane (reviewed by Manitt & Kennedy, 2002). Interestingly, Ke\eman and Dickson (2001) demonstrated that in the absence of the Drosophila DCC homologue Frazzled, UNC-5 inhibits axon extension close to a source of netrin at the embryonic ventral midline. The authors suggest that it may be the case that when challenged with a high concentration of netrin, UNC-5 alone is sufficient to produce a repellent response. Importantly, in this case UNC-5 causes the axons to stop, rather th an directing them to turn away from the source of netrin. It may also be the case that without the contribution of DCC, UNC-5 signaling may result in complete growth cone collapse. In the adult spinal cord UNC-5 homologues are expressed at considerably higher leve\s than DCC family members. Analogous to the action ofUNC- 5 at the Drosophila ventral midline, netrin-l and UNC-5 homologue expression in the normal adult spinal cord may function to inhibit cell motility, process extension, and inappropriate collateral branching.

89 Is netrin-l a myelin associated inhibitor ofaxon regeneration? The expression ofnetrin-I by myelinating oligodendrocytes in the adult spinal cord led us to propose that netrin-I may be a myelin-associated inhibitor ofaxon regeneration following injury (Manitt et al., 2001). The presence of netrin-I in periaxonal myelin suggests that the normal function of netrin-I may be to inhibit axonal sprouting at the axon-oligodendroglial interface. A consequence of the dominance of UNC-5 homologue expression by neurons in the adult spinal cord may be that netrin-I would act to inhibit axonal regeneration following injury. If this is the case, neurons attempting to regenerate would be predicted to express members of the UNC-5 homologue family. Consistent with this, both dcc and unc5h2 expression persists in axotomized retinal ganglion cell neurons as they attempt to regenerate their axons in the optic nerve (Ellezam et al., 2001). Further support for the hypothesis that UNC-5 homologues inhibit axon regeneration is provided by a study in which a correlation was found between po or regenerative capacity and unc-5 expression by neurons in the spinal cord of lamprey, a primitive vertebrate with the capacity to recover significant function following spinal cord transection (Shifman and Selzer, 2000a). These findings suggest that receptors for netrin-I that direct axon extension during development, and perhaps restrict axon sprouting in the normal adult CNS, may act to inhibit axonal regeneration following in jury.

90 Figure 3.1. Northern blot analysis of netrin receptor expression. Northem blot analysis of E 14 rat brain and adult spinal cord mRNA for the netrin receptors dcc, neogenin, unc5hl, unc5h2, and unc5h3. Expression of a single major dcc transcript -10 kb in size, was detected in embryonic brain mRNA. The level of dcc mRNA expression in adult spinal cord mRNA was barely detectable. The neogenin probe hybridized to three major transcripts: -9.5, -7.5, and -5.5 kb. The unc5hl probe detected a major transcript at -4.5 kb. A single -6 kb transcript was detected encoding unc5h2. Two transcripts, -10 kb and -12 kb, were detected for unc5h3. RNA size standards correspond to 9.49, 7.46, 4.40, 2.37, 1.35, and 0.24 kb.

91 dcc nec unc5h1 unc5h2 unc5h3 E14 A E14 A E14 A E14 A E14 A -

GAPDH _ •• .. ••

92 Figure 3.2. Developmental shift in expression of DCC and UNC-5 homologue protein. Developmental time course of netrin receptor protein in homogenates of E 14, PI, P7, P 14, and adult rat spinal cord. Substantially higher levels of DCC protein (-180 kDa) were detected in the embryonic spinal cord compared to the adult. To visualize DCC protein in adult spinal cord homogenate, a separate blot was run comparing E 14 to adult spinal cord, in which double the amount of protein was loaded in the adult spinal cord lane. An immunoreactive band at the expected molecular weight of full-Iength neogenin (-190 kDa) was faintly detected in adult spinal cord homogenates. The lower molecular weight band (-120 kDa) may be non-speci fic immunoreactivity. Altematively, it may correspond to variant fOTm of neogenin generated by altematively mRNA splicing, differential glycosylation, or proteolysis. The specificity of an antiserum raised against UNC5H3 was tested for binding to recombinant intracellular domains (lCD) ofUNC5HI, UNC5H2, and UNC5H3 fused to GST. Approximately 10 ng of recombinant GST-ICD protein was loaded in each lane. The antiserum binds to aIl UNC-5 homologue ICDs, suggesting that it is a pan-UNC-5 homologue antibody. UNC-5 homologue protein (-130 kDa) was detected at higher levels in the adult spinal cord compared to E 14 CNS. In ail cases, 20 j.1g of protein was loaded per lane, with the exception of the 2x DCC lane (40 j.1g). Molecular weight markers are 200, 116,97,66,45 kDa (Broad Range, Bio-Rad).

93 DCC SPINALCORD E14 1 1 brain E14 P1 P7 P14 A

2X 1 l E14 Adult s.c. s.c. ... --

NEOGENIN SPINALCORD E14 1 1 brain E14 P1 P7 P14 A •.•..li.•• 8'.­ -

,....;.~ ,::~-~ ~-: .t

UNC5H SPINALCORD E14 1 1 brain E14 P1 P7 P14 A rUNC5H ICDs

1 U51., U52-- U53

- --- ~

94 Figure 3.3. Distribution of netrin receptor rnRNA expression. Expression of dcc, neogenin and the three unc-5 homologues was detected in similar distributions of cells in the adult spinal cord ventral gray matter using in situ hybridization. Differences in distribution and intensity of expression were detected in more superficial layers of the dorsal homo Faint dcc and neogenin hybridization was detected in the more superficial layers of the dorsal homo Sparse, low level hybridization was detected in the white matter for both receptors. Cells expressing unc5hl were predominantly restricted to the ventral hom of spinal cord gray matter, with a nearly complete absence of signal in the more superficial layers of the dorsal homo Multiple neuronal cell types expressing unc5h2 were detected throughout the gray matter. Unc5h2 hybridization was also c1early detected in glia in the white matter. Unc5h3 hybridization was detected in the ventral gray matter, in a similar distribution as dcc, neogenin and unc5hl. In addition, positive unc5h3 hybridization was detected in neurons in lamina 1 and outer lamina II. Hybridization of digoxygenin labeled probes was visualized using a POO conjugated DIG-antibody, tyramide amplification and DAB. The arrows point to attached dorsal roots. Dorsal is at the top and ventral at the bottom. Bright field optics. Scale bars: 500llm

95 dcc neogenin

'.

unc5h1 unc5h2

.. - . . " . -" ~ " :" .. : ; :... ..; ,,~ ",...... : .J ~,.... :: . .... •. . ", -!'F'" , ::

"'-

unc5h3 dcc neo SENSE STRAND CONTROLS

..: /. -".~ ....,: ".- " unc5h1 unc5h2 unc5h3 . ... . "' . ..,. "" ...... " " ... J. 0 " -

96 Figure 3.4. Differentiai expression of netrin receptors in the dorsal horn of the adult spinal cord. Faint expression of dcc and neogenin was detected in a sparse distribution of cells throughout the dorsal homo Unc5hl hybridization was almost completely absent. Unc5h2 was the only netrin receptor that strongly labeled cells in the dorsal homo Lamina II (substantia gelatinosa) and lamina III contained numerous intemeurons positively hybridizing for unc5h2, while cells labeled in lamina IV were more sparsely distributed. Unc5h3 hybridization was also faint throughout the dorsal hom, but the pattern of distribution was more localized to specific laminae in the dorsal homo Unc5h3 labeled intemeurons were predominantly located in lamina 1 and lamina IV. Bright field optics. Scale bars: 100 Ilm.

97 dcc neogenin unc5h1 unc5h2 unc5h3 1 J: .L 1 T

li-. III NI IN ln ln \ " " ;. . IV IV IV IV IV

.. ~. .,

~" ' .. - .,

98 Figure 3.5. Alternatively spliced netrin receptor rnRNA in adult rat spinal cord. A. RT-PCR revealed alternatively spliced mRNAs for dcc, neogenin, and unc5hl. Alternative splicing of unc5hl was deve\opmentally regulated. The larger transcript, detected in the adult but not in E 14 brain, corresponds to the sequence reported by Leonardo et al., (1997). The shorter product, present in both the E 14 brain and adult spinal cord encodes the nove\ alternatively splice variant UNC5H l "'TSPI. The primer sequences used are listed in the materials and methods section. B. Diagrams summarizing the DCC, neogenin, and UNC5H 1 splice variants detected. DCC; The dcc alternative\y spliced transcript was found to lack six nucleotides in its cytoplasmic domain that results in the deletion of two amino acids and the substitution of a third amino acid. Neogenin; A 159 bp alternatively spliced exon was detected in the sequence encoding the cytoplasmic domain of neogenin, close to the transmembrane region. Unc5h 1; An alternatively spliced 168 bp exon was detected in the sequence encoding the extracellular domain of UNC5H 1 that results in the loss of the first of two predicted thrombospondin domains. This transcript, UNC5H l "'TSP 1, is the predominant form in the embryonic CNS. An additional alternative\y spliced transcript containing a 589 bp exon in the 3' UTR of unc5h 1 was also detected.

99 A dcc neogenin unc5h1 unc5h2 unc5h3

B aa1297 R SOS V agaagtcagtctglg bp 4221 DCC agaa----clgtg R T V III 1 1 IfaJmUflj 1

D Ig-tju~ dom3ln _ FN-III-I"@ domaIn _ TMdoma!rt

o IGO

NEOGENIN

QPPQPVtSAHPIHSLDNPHatFHSSSlASPARSHlVHPSSPWPtGTSM5lSDRANSTESVRNT a31279 QPPQ------ESVRNT r1

o lIJ-lIke domatn _ FN-Ill-likedomam _ TMdomalf'l

LJ ICD

UNC5H1

aa 237 VT'I'YVNGGWSTSTEW$VCSASCGRGWOK.RSRSCTNPAPLNGGAFCEGQNVOKTACATLCPVOGSWS YlVYV------DGSWS rr-.-.~rï Il Il 1 1 1=1 m 1 HTR

ri Ig-l«@ doma·n § TSP-I-like domaIn - _ TMdomaln

DICO

100 netrin-1 dcc neogenin

...... ~.... ~.. . . '.' ... \. ". . ~.:...... '. . . ! •• ~.':\' .. ~ ..."'~'\ :-.";::">:.=':':'.::";\", "/~ .;::.:.;::.' .....:~' . /.:':.'::',:,,:,~, .... ' " ... :~., .' .... '...... ". "~'-~ '~.~ ~.~ '~J:~;/~~9~'~~":3. ' ...' . ' ... ' . .' ." .' . . . . ' .. unc5h1 unc5h2 unc5h3

...... :.~...... '.' ...... '. ~\ ..~ ~.\,~ ./ ....:: ... : .. ~ : :.' .: ~ :': ~: :':'::.~ :.:.:.\..... 1... .':~:•• :.: •• ;: :. :':.:':\ .' / J . ... ' . . . :. "., 1... .'. .:. :"\, . '~.~.~... ~.~~.!Y. :.-. '~'.~ ~.~' ' ' ' ' '. '...... '" . '~;03~&......

Figure 3.6. Schema tic summarizing the distribution of netrin-l and netrin receptor expression in the adult spinal cord.

101 PREFACE TO CHAPTER 4

Although many CNS neurons have the capacity to regenerate a severed axon (David and Aguayo, 1981) the onset of myelination in the mammalian CNS coincides with a dramatic drop in the ability of injured axons to regenerate (Keirstead et al., 1992). Substantial evidence indicates that CNS white matter contains factors that inhibit axon outgrowth (reviewed by Schwab et al., 1993; McKerracher et al., 1994; Mukhopadhyay et al., 1994; Chen et al., 2000; GrandPre et al., 2000; Prinjha et al., 2000). Characterization of netrin expression in the adult rat spinal cord suggested that netrin-I may function as a short-range cue involved in cell-cell interactions. The distribution of netrin receptor expression was consistent with this conclusion; different netrin receptors were found to overlap with subsets of netrin expressing cells. Western analyses of the developmental timecourse of netrin receptor expression in the spinal cord indicated that netrin receptors undergo a shift in expression during maturation. While the DCC family members, DCC and Neogenin, were observed to be dramatically downregulated in adulthood, the UNC-S homologues were found to be upregulated. This indicated that the receptors that mediate a repulsive response to netrin predominate in the normal adult spinal cord. Together, these data, in addition to the finding that netrin-I is expressed by oligodendrocytes, led to the hypothesis that netrin-I may be a myelin­ associated-inhibitor ofaxon collateral sprouting in the normal spinal cord or may act as an inhibitor ofaxon regeneration following injury. To address this possibility 1 first examined if interfering with netrin function would improve neurite outgrowth in vitro in neurons cultured on myelin substrates. Netrin and DCC function blocking antibodies are currently available. The following series of experiments examined the effects of these function blocking antibodies on neurite length in a 24 hour myelin substrate culture assay. Western analysis of DCC and UNC-S homologue expression during this assay was also performed in order to assess if myelin influences the levels of the two netrin receptor families.

102 A high intraneuronal concentration of cAMP promotes attraction to netrin-l. Similarly, increasing cAMP in neurons grown on myelin substrates improves ne uri te extension. 1 also examined if myelin-associated netrin-l switches from an inhibitor to a promoter of neurite outgrowth when the concentration of cytosolic cAMP is increased.

103 I. SUMMARY

Netrin-I, a secreted protein that directs migrating cells and axons in the developing nervous system, is expressed by neurons and oligodendrocytes in the mature CNS. Here we provide evidence that netrin-I is a myelin-associated inhibitor of neurite extension. Cerebellar granule cell axons are repelled by netrin-I during development. Neurite extension by cerebellar granule cells on myelin substrates was significantly improved by blocking netrin-I or DCC function. The axons of spinal commissural intemeurons are attracted by netrin-I in the embryo. Surprisingly, blocking netrin-I or DCC function also significantly improved neurite extension by commissural neurons on myelin substrates, indicating that in the presence of myelin, these neurons respond to netrin-I as a repellent. Examination of netrin receptors levels in commissural neurons indicated that myelin reduces the amount of DCC and increases the expression of UNC-5 homologues, consistent with mye\in biasing netrin receptor expression toward transducing a repellent response. Axonal responses to netrin are also regulated by intra-neuronal cAMP concentrations. High leve\s of cAMP are associated with attraction, and low leve\s with repulsion. Furthermore, high intraneuronal cAMP promotes axon outgrowth on mye\in and axon regeneration in vivo. As expected, application of the cell permeable analog of cAMP, db-cAMP, enhanced axon outgrowth on myelin. Netrin-I or DCC function blocking antibodies inhibited the effect of db-cAMP on neurite extension, consistent with db-cAMP switching myelin associated netrin-I from a repellent to an attractant. These studies provide evidence that netrin-I IS a mye\in-associated inhibitor of neurite outgrowth, that myelin regulates netrin receptor expression in neurons, and that the response to mye\in-associated netrin-I is regulated by the concentration of intraneuronal cAMP.

lOS Il. INTRODUCTION

The vertebrate nervous system undergoes a developmental loss in its ability to regenerate injured axons (reviewed by Sandvig et al., 2004). An important event that is correlated with the loss of regenerative capacity is myelination (Keirstead et al., 1992). A number of myelin-associated inhibitors have been characterized for their ability to inhibit neurite extension in vitro, including myelin-associated glycoprotein (MAG), Nogo, and oligodendrocyte myelin glycoprotein (OMgp) (reviewed by David and Lacroix, 2003). While in vivo studies examining the specific contribution of MAG or Nogo on inhibiting regeneration in the injured CNS have yielded certain conflicting results (Schafer et al., 1996; Bartsch et al., 1995; Pot et al., 2002; Kim et al., 2003a; 2003b; Simonen et al., 2003; Zheng et al. 2003), the current consensus is that myelin-associated inhibitors acting together are a major impediment to regeneration (Huang et al., 1999; reviewed by Grados­ Munro and Fournier, 2003). The response of axons to MAG and Nogo is developmentally regulated. While older neurons are inhibited by MAG and Nogo, younger neurons are not (Mukhopadhyay et al., 1994; Bandtlow and Loschinger, 1997). MAG in fact, is bifunctional, in that it promotes outgrowth in younger neurons (Mukhopadhyay et al., 1994). A maturation associated decrease in the level of intraneuronal cAMP underlies this age-dependent difference in the response to MAG and Nogo (Cai et al., 1999, 2001; Bandtlow, 2003). Netrin-I is a bifunctional guidance molecule, acting as an attractant or a repellent for different groups of cells and axons in the developing nervous system (reviewed by Dickson & Keleman, 2002). At least two mechanisms contribute to netrin 's bidirectional function. The first in volves the repertoire of netrin receptors expressed by the responding cell (Hong et al., 1999). There are two families of netrin receptors, the DCC family, which includes DCC and neogenin in mammals (Fearon et al., 1990; Cooper et al., 1995; Keino­ Masu et al., 1996; Keeling et al., 1997; Meyerhardt et al., 1997), and the UNC-5 homologue family (Ackerman et al., 1997; Leonardo et al., 1997; Ackerman et al., 1998; Engelkamp, 2002; Komatsuzaki et al., 2002). DCC is associated with the attractant response to netrin-1 (Hedgecock et. al., 1990; Keino-Masu et al., 1996; Deiner & Stretavan, 1999; Yee et al., 1999; Anderson 2000; Braisted et al., 2000; Funato et al.,

106 2000; Barrallobre et al., 2000; Schwarting et al., 2001; Deiner et al., 1997; de la Torre et al., 1997) and a complex of DCC and an UNC-5 homologue is associated with repellent guidance responses (Hedgecock et. al., 1990; Keleman and Dickson, 200 l, F inger et al., 2002 Leung-Hagesteijn et al., 1992; Ackerman et al., 1997; Przyborski et al., 1998). The intracellular concentration of cAMP also regulates the direction of a response to netrin (Ming et al., 1997). Axons repelled by netrin-I can be switched to attraction by increasing the intracellular concentration of cAMP. Netrin-I is expressed by neurons and oligodendrocytes in the adult spinal cord, and subcellular fractionation has indicated that netrin likely functions as a short range-cue by becoming associated with extracellular matrix and the cell surface following its secretion (Manitt et al., 2001). Fractionation of mye\in has indicated that netrin-I is enriched in periaxonal membranes, both on periaxonal mye\in and axon membrane surfaces, but is not detectable in compact myelin. This distribution suggests that netrin-I present at the periaxonal space, derived from either the oligodendrocyte, the axon, or both, may influence axon-oligodendrocyte interactions. In addition, we have also reported that a developmental shift in netrin receptor expression occurs during spinal cord maturation resulting in a predominance of UNC-5 homologue expression in the adult (Manitt et al., 2004), suggesting that netrin at the periaxonal spa ce might exert an inhibitory function. Here we present evidence that netrin-I is a myelin-associated inhibitor of neurite extension. Neurite outgrowth from cerebellar granule cells and embryonic spinal commissural neurons on myelin substrates was improved when netrin or DCC function was blocked. During embryogenesis, the axons of cerebellar granule ce\ls are repelled by netrin-I (Alcantara et al., 2000). In contrast, embryonic spinal commissural axons are attracted by netrin-I (Serafini et al., 1994, 1996, Kennedy et al., 1994). Further examination of commissural neurons in this assay revealed that mye\in regulates the expression of DCC and UNC-5 homologues in a manner that favors a repellent response to netrin. We also provide evidence that the level of intra-neuronal cAMP regulates the direction of the response to mye\in-associated netrin-I. Netrin-I switched from acting as a mye\in-associated inhibitor, to a promoter of neurite extension, when the concentration of intraneuronal cAMP was increased.

107 III. MA TE RIALS AND METHODS

Animais Sprague-Dawley rats at embryonic day 15 (E 15) of gestation and Sprague-Dawley postnatal day 8 (P8) rat pups were obtained from Charles River Canada (PQ). Ali procedures with animaIs were performed in accordance with the "Canadian Council on Animal Care" guide\ines for the use of animaIs in research.

Myelin fractionation The mye\in used to make substrates for the in vitro outgrowth assay was obtained using a fractionation described by Detskey et al. (1988) and modified by Sapirstein et al. (1992). Spinal cords were dissected from 10 adult rats (350-400 gm), ail homogenization steps were performed using a Dounce homogenizer (Fisher Scientific). The initial homogenization consisted of six strokes with a loose pestle, followed by four strokes with a tight pestle, in 210 mIs of ice-cold buffer containing 0.9 M sucrose, 150 mM NaCI, and 10 mM HEP ES, and protease inhibitors (5 mM EDT A, 2 J.lg/ml leupeptin, 2 J.lg/ml aprotinin, 1 J.lg/ml pepstatin, and 2 mM PMSF, pH 7.5.). Homogenates were then centrifuged at 82,500 x g for 25 min at 4°C. The crude myelin fraction was isolated as a pellet floating at the top of the sucrose solution. Crude myelin pellets were then rehomogenized with six strokes of a loose pestle, followed by four strokes with a tight pestle in 210 ml of ice-cold 0.85 M sucrose containing protease inhibitors. The homogenate was th en spun at 82,500 x g for 25 min at 4°C. The resulting floating pellets were rehomogenized in osmotic shock buffer (10 mM HEP ES, pH 7.4, 5 mM EDT A, and protease inhibitors) to separate mye\in from cru de periaxolemma. Homogenates were gently rotated for 1.5 hr at 4°C, layered onto a discontinuous sucrose gradient composed of

15, 24, 28, 32, and 37% sucrose, and then centrifuged at 82,500 x g for 13 hr at 4°C. A mye\in fraction was collected from the 15-24% interface for further purification. To remove residual non-mye\in microsomal contaminants, the myelin fraction was osmotic shocked twice in ddH20 with protease inhibitors and sedimented at 12,000 x g. After the second sedimentation the pellet was resuspended in ddH20 with protease inhibitors, layered over a 0.75 M sucrose solution, and centrifuged at 75,000 x g for 1.5 hr at 4°C.

108 Purified compact myelin was collected from the ddH20-O.75 M interface. Prote in content was quantified using the BCA protein assay kit (Pierce, Rockford, IL).

Primary cultures Dorsal and ventral E 15 spinal cord cultures. E 15 embryonic rat spinal cords were dissected and the meninges removed. The dorsal half of the spinal cords were isolated by microdissection for the commissural neuron cultures, as described (Bouchard et al., 2004), and the remaining spinal cord tissue was used for the mixed ventral spinal cord culture. Cells suspensions were prepared by dissociating the tissue in 0.25% trypsin for 30 min at 37°C, followed by trituration using flame polished pasteur pipets. The medium used consisted of Neurobasal, 10 % IFBS, 2 mM glutamine, 1 % B-27, 1 U/ml penicillin, and 1 J.1g1ml streptomycin. P8 cerebellar granule cell cultures. The cerebellar granule cell cultures were prepared according to Huang et al. (1999). P8 rat pups were decapitated and their cerebellums dissected. Following removal of the meninges, cerebellums were diced using a razor blade. Tissue was trypsinized (0.125%) for 20 min at 37°C and triturated with flame polished pasteur pipets. Dissociated cells were spun at 450 x g for 10 min and resuspended in Hanks with 10 mM EDTA. Cell suspension was layered over a discontinuous Percoll gradient consisting of a 60 % and 35 % Percoll layer and centrifuged at 2000 x g for 10 min. Cerebellar granule cells were collected from the interface between the 35 % and 60 % layer.

Culture assays for neurite extension Reagents. The following antibodies or drugs were added to the medium: Polyclonal anti­ netrin function blocking antibody PN3 (10 J.1g/ml; Manitt et al., 2001), monoclonal DCC function blocking antibody (10 J.1g1ml; Calbiochem, La Jolla, CA), dibutyryl-cAMP (db­ cAMP; 1 mM), and KT-5720 (200 nM; Calbiochem, La Jolla, CA). Substrate preparation. The in vitro culture assays were performed according to Huang et al. (1999). Briefly, 96-well plates were coated with solubilized nitrocellulose, and then coated with poly-D-Iysine (5 J.1g1ml) overnight at 37°C. Wells were rinsed and dried. A 2 J.11 drop of purified rat spinal cord compact mye\in (0.2 Ilgl1l1) was placed at the center of

109 each weil and incubated for 4 hours at 37°C in a humidified chamber. Wells were rinsed and left to dry. Neurite outgrowth assay. Oissociated commissural interneurons, cerebellar granule cells or mixed ventral embryonic spinal cord cultures were plated at a density of 5 X 103 cells/well. At the end of the 24 hour assay period, cells were fixed in 4% paraformaldehydel7.5% sucrose and stained with Coomassie Blue. Neurite length for each condition was examined across 4 culture wells using Northern Eclipse software (Empix Imaging, Mississauga, Canada). Each experiment was done in duplicate.

Western analysis of netrin and netrin receptor expression lime course The following antibodies were used in for Western blot analyses. A polyclonal netrin antibody (PN3; Manitt et al., 2001) used at 0.7 mg/ml, monoclonal anti-OCC (G97- 449; BD Biosciences Pharmingen, San Jose, CA) used at 1: 1000, and a rabbit polyclonal pan-UNC-5 homologue antiserum (1 :6000; provided by Dr. Tony Pawson, University of Toronto: Tong et al., 2001). Protein homogenates were separated using 7.5% PAGE and transferred to nitrocellulose membrane (Amersham Biosciences). For DCC immunoreactivity, membranes were preincubated in 2% bovine serum albumin (BSA), 0.1 % Tween-20 in phosphate-buffered saline (PBS), and for netrin and pan-UNC-5 homologue immunoreactivity membranes were incubated in 5% milk powder, 0.1 % Tween 20 (Fisher Scientific, Fair Lawn, NJ), 3% heat-inactivated normal goat serum (Life Technologies), and 0.1 % sodium dodecyl sulfate (SOS; Fisher Scientific), for 1 hr at room temperature. Membraneswere incubated overnight at 4°C in primary antibodies diluted in their respective blocking solutions. Immunoreactivity was visualized with peroxidase­ conjugated donkey anti-rabbit, or donkey anti-mouse secondary antibodies (1 :5,000; Jackson Immunoresearch Laboratories, West Grove, PA) and the Chemiluminescence Reagent Plus protein detection kit (Perkin Elmer Biosignal, Norwalk, CT). ln situ hybridization Sense and antisense cRNA probe pairs corresponding to 933 bases of rat netrin-I, nucleotides 882-1815, were used. For probe synthesis, cONA templates were isolated from agarose gels, and cRNA transcription was performed using polymerases T7 (New England

110 Biolabs, Beverly, MA) or T3 (Promega) and digoxigenin (OIG) RNA labeling mix (Roche Products). Commissural intemeurons were grown on glass coverslips coated with POL (5 Ilg/ml) for 24 hours and then fixed in 4% PF A/15% picric acid, pH 8.5. Coverslips were th en rinsed in 2x SSC, equilibrated for 5 min in 10 mM triethanolamine (Fisher Scientific), and incubated in 0.25% acetic anhydride (Sigma) in 10 mM triethanolamine for 10 min at room temperature. In situ hybridization was perforrned as described previously (Braissant and Wahli, 1998) using OIG-labeled probes. Sections were transferred to prehybridization solution (50% forrnamide, 5x SSC, 5x Oenhardt's, 1% SOS, and 40 Ilg/ml single-stranded salmon sperrn ONA) for 20 min at room temperature. Hybridization was perforrned in 100 III of solution containing 200 ng of probe in 50% forrnamide, 5 x SSC, and 40 Ilg/ml single-stranded salmon sperrn ONA, ovemight at 57°C. Sections were then washed in 2x SSC at room temperature followed by a wash in 2x SSC for 1 hr at 65°C. Hybridization was detected using a peroxidase-coupled antibody against OIG (Roche Products), amplified using the TSA-Indirect (ISH) Tyramide Signal Amplification kit (NEN), and visualized with a streptavidin-FITC secondary antibody (Vector Laboratories). The coverslips were double-Iabeled with a monoclonal anti-TAG antibody at 1:500 (407; Oevelopmental Studies Hybridoma Bank University of Iowa, Iowa City, lA), and visualized with an anti-mouse secondary conjugated to CY3.

III IV. RESULTS

Myelin-associated netrin-l inhibits neurite extension in vitro During embryonic development, netrin-I attracts subsets of extending axons while repelling others (reviewed by Dickson and Keleman, 2002) Here we examined the response of two neuronal cell types to myelin-associated netrin-I : embryonic day 15 (E 15) commissural neurons and postnatal day 8 (P8) cerebellar granule cells. Embryonic rat spinal commissural intemeurons have been weil characterized and their axons are attracted by netrin-I early in embryogenesis (Serafini et al., 1994; 1996; Kennedy et al., 1994). In contrast, cerebellar granule cells are repelled by netrin-I (Alcantara et al., 2000). We report that blocking netrin-I function in either cell type improves neurite extension when grown on a myelin substrate. This suggests that netrin is a novel myelin-associated inhibitor of neurite extension. Further, this presents the surprising observation that axons that are attracted to netrin-I during embryogenesis, switch their response and are repelled by netrin-I when it is associated with myelin.

Myelin-associated netrin-l inhibits cerebellar granule cell neurite extension. Cerebellar granule cells are a well-characterized CNS neuronal cell type. Purification protocols allow essentially homogeneous cultures of these neurons to be generated (Schousboe et al., 1989). These cultures have been extensively used to characterize the response of neurons to myelin. Neurite extension by cerebellar granule cells is inhibited by myelin and by specific myelin-associated inhibitors, such as MAG and Nogo (reviewed by David and Lacroix, 2003). In vivo, cerebellar granule cell precursors express DCC and UNC-5 homologue receptors and their axons are repelled by netrin-I (Ackerman et al., 1997; Alcantara et al., 2000). Mutation of UNC5H3 leads to migration and axon guidance defects in these neurons (Ackerman et al., 1997; Przyborski et al., 1998; Finger et al., 2002). During postnatal development, granule cells express netrin-I, DCC and UNC-5 homologues (Alcantara et al, 2000). Using cerebellar granule cells, we tested the hypothesis that netrin-I contributes to the inhibitory effects of myelin on neurite outgrowth.

112 We first determined whether netrin influences neurite outgrowth of postnatal day 8 (P8) cerebellar granule cells grown on a substrate of poly-D-Iysine (POL). Cerebellar granule cells were grown in culture for 24 hrs in the presence or absence of netrin (10 Ilg/ml) or DCC (10 Ilg/ml) function blocking antibodies. Neither antibody influenced cerebellar granule cell neurite outgrowth on POL (data not shown). Cerebellar granule cell neurite outgrowth on myelin substrates reduced neurite extension by -40 % compared to control POL substrates (figure 4.2). In this case, addition of netrin or DCC function blocking antibodies significantly improved neurite outgrowth (figure 4.2). Quantification of neurite lengths indicated that in the presence of the function blocking antibodies, cerebellar granule cells extended neurites on myelin that were similar in length to those observed on control POL substrates. These findings support the conclusion that netrin associated with myelin contributes to inhibitory effects of myelin on cerebellar granule cell neurite outgrowth and that this effect requires DCC or a netrin receptor complex that inc1udes DCC.

Myelin-associated netrin-l inhibits embryonic commissural neurite extension. Rat embryonic spinal commissural interneurons are a well-characterized cell type that expresses DCC in vivo (Keino-Masu et al., 1996; Fazeli et al., 1997). The axons of these cells were the first shown to exhibit DCC dependent chemoattraction toward a source of netrin-l. Many neurons in the adult spinal cord express netrin-l (Manitt et al., 2001). In dissociated cell culture, we detect that rat embryonic spinal commissural interneurons also express netrin-l (Figure 4.1 E). Western blot analysis of homogenates of E 15 commissural interneurons grown in culture for 24 hours detected a positive -75 kDa band consistent with the molecular weight of netrin-l. Furthermore, in situ hybridization analysis of neuronal cultures with an antisense netrin-l riboprobe labeled cells immunopositive for tag-l, a marker for commissural neurons (Figure 4.1 E). Control sense probes did not produce a signal (data not shown). We then tested if myelin-associated netrin-l inhibits E 15 commissural neurite outgrowth. Commissural neurons were plated on substrates of either POL or compact myelin, in the presence or absence of netrin or DCC function blocking antibodies (Figure 4.1 A).

113 As was the case with cerebellar granule cells, E 15 commissural neuron outgrowth on POL was not atTected by interfering with netrin or DCC function (Figure 4.1 A). In contrast, application of either netrin or DCC function bloc king antibodies significantly improved E 15 commissural neurite outgrowth on myelin (Figure 4.1 A). Neurite extension on myelin al one was inhibited to about 12 % of control outgrowth values observed on POL substrates. Blockade of netrin or DCC function improved outgrowth up to 57 % and 49 % of control values, respectively. These data implicate netrin-I and DCC function in the inhibitory effects of myelin on embryonic commissural neurite extension. As a control, we also examined the etTects of myelin-associated netrin-I on mixed neuronal cultures derived from E 15 rat ventral spinal cord. Embryonic spinal cord motoneurons do not respond to netrin-I in expIant assays (Colamarino and Tessier­ Lavigne, 1995a). Blocking netrin or DCC function had no etTect on neurite outgrowth in neuronal cultures derived from dissociated E 15 rat ventral spinal cord plated on either POL or myelin substrates (Figure 4.10).

Myelin differentially regulates the levels of DCC and UNC-5 homologues in commissural interneurons. In vivo, embryonic rat spinal commissural neurons respond to netrin-I as a chemoattractant between EII and EI4 (Fazeli et al., 1997). The results described above are the first to indicate that netrin can also act as a repellent in embryonic rat spinal commissural intemeurons. To investigate how myelin might switch the response of these neurons to netrin from attraction to repulsion, we carried out a western blot analysis of netrin receptor expression in these neurons when cultured on substrates of either POL or myelin. Embryonic rat spinal commissural neurons grown on POL expressed high levels of DCC protein while UNC-5 homologues were not detected (Figure 4.1 C). In contrast, when these neurons were grown on a myelin substrate, a dramatic switch in netrin receptor expression was observed (Figure 4.1 C). The am ou nt of DCC detected decreased, while the level of UNC-5 homologues increased. These findings suggest that myelin regulates the expression of netrin receptors in a manner that biases the neuron to respond to netrin-I as a repellent by increasing the levels ofUNC-5 homologue receptors.

114 Level of cytosolic cAMP determines if cerebellar granule ce Ils respond to myelin associated netrin-l as an attractant or repellent Increasing the intracellular concentration of cAMP in cerebellar granule cells blocks the ability of myelin and myelin-associated inhibitors, such as MAG and Nogo, to inhibit neurite outgrowth, an effect which is achieved through cAMP-mediated activation ofPKA (Cai et al., 1999; 2001; Bandtlow, 2003). Interestingly, MAG exerts a bifunctional influence on neurite outgrowth; in sensory neurons younger than postnatal day 3 MAG promotes outgrowth, while in older neurons MAG inhibits neurite outgrowth (Mukhopadhyay et al., 1994). The nature of the response to MAG corresponds to a developmentally regulated change in cAMP levels that is intrinsic to these neurons. Similarly, the turning response to netrin can be switched from repulsion to attraction by increasing the intracellular concentration of cAMP (Ming et al., 1997). We examined whether netrin contributes to the cAMP induced improvement in outgrowth on myelin, by switching from a repellent to an attractant. Addition of db-cAMP (1 mM) to cultures grown on myelin substrates improved outgrowth from -60% to a level of outgrowth that was similar to the neurite lengths observed on control POL substrates (Figure 4.2). Addition of the PKA inhibitor KT-5720 blocked the effect of db-cAMP on neurite outgrowth, confirming that this effect is mediated by PKA, as previously reported (Cai et al., 1999). Application of netrin or DCC function blocking antibodies, significantly inhibited the growth promoting effect of db-cAMP (Figure 4.2). This is consistent with myelin-associated netrin-I switching from a repellent to an attractant when the concentration of cAMP was increased in these neurons. Blocking netrin-I or DCC function in the presence of db-cAMP decreased neurite lengths to the level observed in the myelin alone condition, namely -57 % and -55 % of the lengths found on POL, respectively. These findings support the conclusion that the intracellular concentration of cAMP plays a key role in determining whether cerebellar granule cells respond to myelin associated netrin-I as a cue that promotes or inhibits neurite growth.

115 v. DISCUSSION

We previously reported that netrin-I is expressed by neurons and oligodendrocytes in the adult spinal cord and that sub-fractionation of myelin indicates that netrin-I is enriched in periaxonal membranes (Manitt et al., 2001). Characterization of netrin receptors in the spinal cord revealed a developmental shift in receptor expression that results in the predominance of UNC-5 homologues in adulthood (Manitt et al., 2004). Together, these findings suggested that myelin-associated netrin-I regulates axon­ oligodendrocyte interactions and, due to the predominant expression of UNC-5 homologues, that netrin-I may act to inhibit process extension. Here we present evidence indicating that mye\in-associated netrin-l inhibits neurite outgrowth. We examined two neuronal cell types that respond to netrin during development. The cerebellar granule cell, which responds to netrin-l as a repellent (Ackerman et al., 1997; Alcantara et al., 2000), and the commissural neuron which responds to netrin-I as an attractant (Kennedy et al., 1994; Serafini et al., 1994; Serafini et al., 1996). Myelin substrates inhibited neurite outgrowth from both cell types, and interfering with either netrin or DCC function improved outgrowth in both cell types. While this might be expected ofaxon outgrowth by cerebellar granule cells, which are repelled by netrin-1 in vivo and in vitro (Ackerman et al., 1997: przyborski et al., 1998; Alcantara et al., 2000), the effect observed in commissural neurons was surprising. In vivo, embryonic commissural neurons express high levels of DCC but not UNC-5 homologues (Keino-Masu et al., 1996). Examination of netrin receptors in commissural neurons grown on myelin substrates revealed that myelin regulates netrin receptor levels in a manner that like\y favors a repellent response: DCC levels decreased, while UNC-5 homologues increased. Notably, a similar change in the relative leve\s of netrin receptor expression occurs in vivo during spinal cord deve\opment (Manitt et al., 2004). Our in vitro analysis raises the possibility that mye\ination of the spinal cord may contribute to the shift in netrin receptor levels observed in vivo in the spinal cord during maturation. Previous work indicated that axon outgrowth by neurons in the embryonic or early post-natal CNS is not inhibited by myelin-associated inhibitors (Mukhopadhyay et al., 1994; Shewan et al., 1995; Bandtlow and Loschinger, 1997), and that cytosolic levels of

116 cAMP mediate the neuronal response to MAG and Nogo (Cai et al., 1999, 2001; Bandtlow, 2003). Mature neurons have relatively lower levels of cAMP th an their younger counterparts and, as a result, are inhibited by MAG and Nogo. Furthermore, MAG can actually promote outgrowth in younger sensory neurons, and its action as an attractant or repellent depends on the concentration of intraneuronal cAMP (Mukhopadhyay et al., 1994; Cai et al., 2001). These experiments indicated that developmentally regulated changes that are intrinsic to neurons play a central role in regulating the shift in response to myelin inhibitors that occurs during maturation of the CNS. Interestingly, pre-treating neurons with neurotrophins can block the inhibitory effects of myelin (Cai et al., 1999). This was found to result from the ability of neurotrophins to activate PKA by inhibiting a phosphodiesterase and increasing the intracellular concentration of cAMP. In contrast, neurotrophin addition to neuronal cultures at the time of plating on myelin, did not e1evate cAMP or block the inhibitory effects of myelin. This observation suggested that myelin and neurotrophins might be antagonists, regulating cAMP concentration in opposite directions. This led to the finding that myelin can lower the levels of cAMP through the activation of a Gi protein, suggesting that changes in cAMP concentration that occur with maturation may also be regulated in part by myelination, rather than being completely intrinsic to the neuron. However, myelin does not inhibit younger neurons, either in culture (Shewan et al., 1995) or when transplanted in vivo (Li and Raisman, 1993), suggesting that myelin does not trigger the initial downregulation of cAMP observed with maturation. It may be the case that myelin in the mature nervous system contributes to maintaining suppressed levels of cAMP. The response to netrin-I is also regulated by the intracellular concentration of cAMP; low levels of cAMP are associated with repulsion and high levels with attraction (Ming et al., 1997). Our findings in commissural neurons suggest several mechanisms by which myelin-associated netrin-I might inhibit neurite extension. First, an intrinsic downregulation in commissural neuron cAMP levels might mediate the change in response to netrin. Early embryonic commissural neurons (E II-E 14) are attracted by netrin-I (Tessier-Lavigne et al., 1988). This developmental period corresponds to the time during which commissural neurons are extending toward the embryonic floor plate in a netrin-dependent manner (Altman and Bayer, 1984; Tessier-Lavigne et al., 1988). After

117 crossmg the midline however, commissural neurons become unresponslve to netrin (Shirasaki et al., 1998) through a silencing mechanism initiated by Slit, another guidance factor, and its receptor Roundabout (Stein and Tessier-Lavigne, 2001). It is possible that a developmentally regulated decrease in the concentration of cAMP also contributes to this change in responsiveness, however this has not been directly addressed in spinal commissural neurons. A developmentally regulated decrease in the concentration of cAMP has been documented in retinal ganglion cells (Shewan et al., 2002). Retinal ganglion cells are attracted by netrin wh en they exit the retina and then become unresponsive to netrin until they reach the optic tectum, where they are repelled by netrin. These changes correlated, not only with an intrinsic decrease in cAMP but also with downregulation of DCC (Shewan et al., 2002). Our tindings suggest that myelin can bias the neuron toward responding to netrin-I as a repellent by regulating netrin receptor levels. The results presented here are the tirst to report that netrin-I can function as a repellent cue in commissural neurons. It is possible that following their midline crossing, commissural neurons are unresponsive to netrin for a time until environmental factors, in this case myelination, cause them to become repelled by netrin through netrin receptor regulation. Evidence that myelin can suppress cAMP levels (Cai et al., 1999) suggests that the change in netrin receptor levels might also be mediated by the effects of myelin on cAMP. Bouchard et al (2004) recently reported that elevating cAMP promotes the translocation of DCC from an intracellular vesicular pool to the plasma membrane. In addition to this rapid response, increased levels of cAMP increased the phosphorylation of the transcription factor CREB, consistent with changes in gene expression being activated. It is possible that decreased concentrations of cAMP lead to opposite effects on DCC translocation and subsequent downregulation of DCC expression. However, the possibility that cAMP and CREB contribute to the changes observed in netrin receptor expression remains to be demonstrated.

Corn mon signaling pathways of the rnyelin inhibitors: Implications for myelin­ associated netrin signaling on neurite outgrowth inhibition The myelin-associated inhibitors have been shown to exert their effects through a co mm on signal transduction pathway. The nogo-66 receptor (NgR) binds MAG, Nogo and

118 OMgp (Fournier et al., 2001; Domeniconi et al., 2002; Liu et al., 2002; Wang et al., 2002a). NgR is associated with membranes through a GPI-linkage and does not have an intracellular domain with which to directly transduce a response to the myelin-associated inhibitors (Fournier et al., 2001). A receptor complex composed of P75NTR (P75 neurotrophin receptor), LINGO-I, and NgR has now been identified as being required to transduce a response to the myelin-associated inhibitors (Wang et al., 2002b; Wong et al., 2002; Mi et al., 2004). Activation of RhoA, a small guanosine triphosphatase (GTPase), mediates the effects of Nogo, MAG and OMgp on neurite inhibition (Niederost et al., 2002; Yamashita et al., 2002; Fournier et al., 2003; Borisoff et al., 2003). Myelin­ associated inhibitor activation of RhoA by P75NTR is produced by the enhanced interaction ofP75NTR with a Rho GDP dissociation inhibitor (Rho-GDI) (Yamashita and Tohyama, 2003). Interestingly, neurotrophins suppress P75NTR activation of RhoA during neurite outgrowth inhibition, and NGF binding abolishes P75NTRIRho GDI interactions. (Yamashita et al., 1999; Yamashita and Tohyama, 2003). Evidence indicates that the intraneuronal concentration of cAMP determines the response to myelin-associated inhibitors by regulating rho GTPases. The Rho GTPases are weil characterized regulators of the organization of the actin cytoskeleton. In particular, cdc42 and Rac direct filopodial and lamellipodial formation, and RhoA has been implicated in growth cone collapse (reviewed by Dickson, 2002). Netrin-I activates Cdc42 and Rac through DCC, and the formation of filopodia and lamellipodia induced by netrin- 1 and DCC requires activation of these GTPases (Shekarabi et al., 2002; Li et al., 2002a; 2002b). Elevation of cAMP activates PKA, and PKA activation inhibits RhoA (Qiao et al., 2003). Inhibition of RhoA stimulates netrin induced neurite outgrowth (Li et al., 2002b; Moore and Kennedy, unpublished data). The results obtained here are consistent with an intrinsic or myelin-induced decrease in the concentration of cAMP leading to the activation of RhoA and a repellent response to myelin-associated netrin-l.

Netrin-l: A secreted guidance molecule as an inhibitor of regeneration The results presented here are the first to implicate a secreted guidance molecule in the inhibitory effects of myelin. Netrin-I is a secreted protein that binds to ECM and membranes (Manitt et al., 2001). We have also demonstrated, using a myelin fractionation

119 protocol, that netrin-I is associated with periaxonal myelin and axonal membranes. In the adult CNS, netrin-I is expressed by neurons and oligodendrocytes (Manitt et al., 2001). As such, it is not c1ear whether the netrin-I protein associated with periaxonal myelin is derived from oligodendrocytes, axons, or both. To assay neurite outgrowth on a myelin substrate, purified compact myelin obtained from our myelin fractionation protocol was used (Manitt et al., 2001). Importantly, this fraction did not contain detectable levels of netrin. Our results indicate that blocking netrin function improves neurite outgrowth by neurons cultured on compact myelin. This supports a mechanism in which netrin produced by neurons becomes associated with myelin and is sufficient to inhibit neurite growth. Following in jury in the CNS, axons pull back and a significant proportion of damaged fibers initiate attempts to regenerate in an environment where myelin is intact. This suggests that an axon attempting to regenerate may encounter netrin-I produced by the regenerating neuron itself associated with intact myelin membranes, myelin debris, or netrin-I bound to the surface of neurons. Each of these sources of netrin-I protein may potentially influence the regenerative capacity of an axon attempting to regenerate following in jury.

120 Figure 4.1. Commissural neuron outgrowth is inhibited by myelin-associated netrin- 1. A. Interfering with netrin function in commissural neurons had an effect on neurite outgrowth depending on the substrate. These raw data (neurite length (!lm» were analyzed with a two (substrate) by five (antibody) ANOVA (main effect of antibody, F(4.I051) =9.0, p

121 A EMBRYONIC COMMISSURAL NEURONS B MYELIN 120 POL PDL substrate

100

ec: 0 .,<> 80 :; myelin substrate '0 MYELIN + a-NETRIN MYELIN + a-DCC ~ l * 1- 60 (!) Z * w -' W 1- a: 40 , , ::J ... ~~ .. w z ~i::J~.~ 20

0

PDL MYELIN c diss r------,r------..., myelin cells '90 4h 14h 24h" 90 4h 14h 24h' alone DCC • .or't __ _ o EMBRYONIC VENTRAL SPINALCORD 120 POL substrate UNC5H ~ -_ .. ~--'. e 100 c:o .,<> :; El.~" 80 '0 E cuI~'241'1oout1;, NfTRIN-l NETR1N-11T.t.G-1 ~ l 1- (!) 50 Z w -' W netnn-1~ ..... 1-a: 40 ::J w Z 20

122 Figure 4.2. cAMP mediates the direction of outgrowth responses to myelin-associated netrin-l in cerebellar granule cells. Increasing the leve\s of cAMP in cerebellar granule cells changed the direction of their response to myelin-associated netrin. The raw data (neurite length (Ilm)) were analyzed with a five (antibody) by two (cAMP) ANOVA

(antibody by cAMP interaction, F(4, 2279) = 36.5, p

123 - db-cAMP

120 * + db-cAMP * _ 100 o...J cr:: t­ Z 8 80 +db-cAMP LL o +KT-5720 7 i= 60 <.9 * * Z UJ ...J UJ ~ 40 ::J UJ Z

20

o PDL myelin substrate substrate

124 CHAPTER 5: GENERAL DISCUSSION

While netrin function in the embryonic nervous system has been the subject of intense study, very little is known about its role in the adult CNS. The aim of the studies that were reported here was to characterize netrin and the netrin receptors in the adult spinal cord and, based on these findings, to identify potential roles of netrin in adult neural function. The characterization studies demonstrated that netrin is expressed in multiple neuronal subtypes, and in myelinating oligodendrocytes. Evidence was also provided that netrin in the adult spinal cord has a subcellular distribution that is consistent with it functioning as a contact-mediated eue, potentially involved in neuronal and axon­ oligodendrocyte interactions (Chapter 2). Examination of the netrin receptors indicated that the two families of netrin receptors are developmentally regulated, resulting in the UNC-5 homologues being the major receptors present in the adult spinal cord (Chapter 3). These results led to the hypothesis that in the adult spinal cord netrin may function as a myelin-associated inhibitor ofaxon extension. The experiments described in Chapter 4 led to three major findings: 1) myelin-associated netrin-l functions as an inhibitor of neurite extension in embryonic commissural neurons and postnatal cerebellar granule cells, 2) the level of intraneuronal cAMP deterrnines whether outgrowth will be promoted or inhibited by myelin-associated netrin-I, and 3) myelin regulates the levels of netrin receptors.

I. Netrin Expression in the Adult Spinal Cord The rationale for studying netrin in the adult nervous system came from the observation that netrin-I continues to be expressed in the adult spinal cord at a level that is similar to that which is observed during embryogenesis (Manitt et al., 2001: Chapter 2). This sustained leve\ of expression suggested that netrin may play a role in adult neural function. In the embryonic CNS the role of netrin is thought to involve its ability to forrn a long-range protein gradient following its secretion from netrin-I expressing targets, enabling it to guide axons across considerable distances (Kennedy et al., 1994; Serafini et al., 1994; Colamarino and Tessier-Lavigne, 1995a; Serafini et al., 1996; Ackerrnan et al., 1997). Therefore, 1 examined netrin-I mRNA and protein distribution in the adult spinal

125 cord to evaluate if this is also the case in the adult nervous system. Netrin-I mRNA and protein were observed to be distributed in cells throughout the grey matter of the adult spinal cord, indicating that netrin-I is expressed by multiple neuronal subtypes, and in mature oligodendrocytes in spinal white matter (Manitt et al., 2001; Chapter 2). The overlapping pattern of netrin-I mRNA and protein indicated that netrin in the adult spinal cord might not diffuse away following secretion, but rather may be presented as a short­ range or contact-mediated cue by rapidly becoming associated with the surface of cells or the ECM in its immediate environment. This was supported by findings from a subcellular fractionation which indicated that netrin is associated with ECM and cell membranes (Manitt et al., 2001; Chapter 2). Together, these findings suggested that netrin in the adult spinal cord functions as a contact-mediated cue involved in cell-cell interactions. Furthermore, subcellular fractionation of white matter indicated that netrin-I protein is enriched in periaxonal myelin (Manitt et al., 2001; Chapter 2), suggesting that netrin-I may function as a membrane-associated cue that mediates axon-oligodendrocyte interactions in the adult CNS.

II. Does Netrin in the Spinal Co rd Switch From A Long-Range to a Short-Range Cue With Maturation?

Netrin-I in the embryonic spinal cord, expressed o o by floor plate epithe\ial cells located at the ventral 1···· / 1 i midline, has been implicated in long-range guidance of ,

1 commissural axons (Kennedy et al. 1994; Serafini et al., 1 1 • l _FP· 1994, 1996). Commissural neurons of the embryonic .. ,.M-./ v v spinal cord are born in the dorsal extent of the netrin-1 mRNA netrin-1 protein

developing neural tube and extend their axons Figure 5.1. Netrin-l mRNA and protein distribution in the embryonic spinal cord circumferentially toward the floor plate at the ventral D, dorsal; V, ventral; FP. fIoor plate. midline (Figure 1.2). During this period, the location of netrin-I expression and distribution of netrin-I protein are largely non-overlapping. While netrin-I expression is restricted to the ventral floor plate. netrin-I immunoreactivity is observed throughout the ventral two thirds of the embryonic spinal cord (Figure 5.1; Kennedy et al., 1994). This

126 pattern of expression and protein distribution is consistent with netrin-l acting as a 10ng­ range guidance cue by forming a gradient after being secreted. Several lines of evidence support a mechanism of netrin-mediated long-range guidance in commissural axon pathfinding to the ventral midline. First, netrin-l protein can diffuse away from its source through a collagen matrix in vitro to attract or repe\ growing axons (Kennedy et al., 1994; Colamarino and Tessier-Lavigne, 1995a; Shirasaki et al., 1996; Deiner et al., 1997; Metin et al., 1997; Varela-Echavarria, 1997; Wang et al., 1999). Second, axons extending through explants of embryonic neuroepithelium reorient their growth and turn toward an ectopic source of netrin-l (Kennedy et al., 1994). Growth cones turn up to 250 Ilm away from a source of netrin-l, suggesting that netrin-l protein can diffuse through the neuroepithelium for at least this distance. Third, the growth cones of neurons dissociated from the embryonic Xenopus laevis CNS turn wh en challenged in vitro with a gradient ofnetrin-l puffed from a micropipette (de la Torre et al., 1997; Ming et al., 1997). Together, these results support the hypothesis that following secretion, netrin-l can diffuse several hundred microns and act as a long-range cue to direct axon extension. The pattern of netrin-I mRNA and protein observed in the embryonic spinal cord and the in vitro evidence that supports a mechanism of long-range diffusion, suggest that netrin-l should be present in soluble fractions following subcellular fractionation of embryonic CNS. However, wh en netrin-l was initially purified from embryonic day 10 (E 10) chick brains, the axon outgrowth promoting activity corresponding to netrin-l fractionated as a membrane-associated protein (Serafini et al., 1994), while only very limited activity was present in the fraction containing soluble proteins. If the majority of netrin-l is not free\y soluble following secretion, how might a gradient of netrin-I in the embryonic neural epithe\ium be produced? Figure 5.2 presents two mode\s illustrating extreme examples of how a graded distribution could be generated by a source of netrin-l. Panel A shows a gradient formed by protein freely diffusing away from the cells that secrete il. However, if netrin-l binds to cell surfaces and the ECM, this would dramatically limit diffusion. Panel B illustrates an alternative model that incorporates secretion, limited diffusion, cell surface binding, cell division and cell migration in the embryonic neuroepithelium. Here, netrin-l is secreted and diffuses a short

127 distance from its source, but is rapidly captured on cell surfaces. As these cells divide and migrate they dilute the concentration of netrin-I on their surface, generating a graded distribution of netrin-I protein that extends many cell diameters away from the source. Via this mechanism, a protein can function as a long-range cue in the absence of long distance diffusion in an environment like the developing CNS. The distribution ofnetrin protein in the embryonic CNS in vivo is likely to result from a combination of secretion, diffusion, and redistribution of membrane-associated netrin on the surface of di vi ding and migrating cells. This model incorporates the findings that netrin is predominantly a membrane­ associated protein that is presented differently in embryonic versus adult CNS. Due to very limited cell migration in the adult CNS, in this model netrin-I would function predominantly as a short-range cell and ECM-associated cue (Manitt et al., 2001; Chapter 2).

~~~ A B / ) rel ~71[iJ. 1-r:~ ',.~~·II ';:-c: / ~f;~ ~-::-:.. / ... ., l ' .-:1 I~· /-- r.~_.'-,~~~/-- I~J.~..!-, 10;011 '... °1 roo;!"!olI ~ r:;O\ / ~-~~ / !ù,~ /'~~! .;·.• 1<."1 _·~i~: _:~·IlY.I··_ ,1i.il~I· • l .. _!J .. !....!J. .l!i!J~ ~~y'.' ....~~\...~-'. ' ' '. .' .... ', .',.. '.' '. ',' ...... ,.;. .'.~ ...... 'j ...... :'" ......

Figure 5.2. Models illustraling the possible mechanisms by which a graded distribution of netrin-1 is formed in the embryonic spinal cord.

III. Netrin and Netrin Receptor Expression in Adult Neurons Netrin-I mRNA and protein are presented throughout ail laminae of adult spinal cord grey matter (Manitt et al., 2001: Chapter 2). These findings indicated that netrin-l is expressed by many neuronal subtypes in the adult spinal cord, including motoneurons and multiple classes of intemeurons. For netrin-I to function as a short-range cue, netrin receptors must be expressed by nearby cells. The netrin receptors dcc, neogenin, unc5hl, unc5h2, and unc5h3 were ail found to be constitutively expressed in the adult rat spinal

128 cord by neurons. (Manitt et al., 2004: Chapter 3), and together, the distributions of the five netrin receptors overlapped with ail areas of netrin expression.

IV. Changes in Netrin and Netrin Receptor Expression in Neurons During Maturation

In the embryonic CNS, netrin IS exc\usively expressed by populations of neuroepithelial cells. Commissural neurons in the developing spinal cord express DCC and extend their axons to the netrin-expressing floor plate (Serafini et al., 1996). Commissural interneurons are thought to become spinothalamic, spinoreticular, and spinocerebellar neurons (Altman and Bayer, 1984; reviewed by Colamarino and Tessier­ Lavigne, 1995b). The distribution of netrin-I in the adult spinal cord suggests that these neurons express netrin-I in adulthood (Manitt et al., 2001: Chapter 2). This can also be conc\uded for retinal ganglion cells (Diener et al., 1997; Ellezam et al., 2001), cerebellar granule cells (Ackerman et al., 1997; Alcantara et al., 2000; Manitt and Kennedy, unpublished findings) and hippocampal neurons (Barallobre et al., 2000; Tritsch and Kennedy, unpublished findings), indicating that neurons that express netrin receptors and respond to netrin with a guidance response during embryogenesis, often express netrin-l in adulthood. DCC, neogenin, UNC5H l, UNC5H2, and UNC5H3 were found to be expressed in the adult spinal cord (Manitt et al., 2004: Chapter 3). Examination of the timecourse of netrin receptor expression during spinal cord deve10pment indicated that the two netrin receptor families are regulated in opposite directions with maturation. The leve1s of the DCC family members, DCC and neogenin, were decreased relative to embryonic spinal cord, while the UNC-5 homologues were increased (Manitt et al., 2004: Chapter 3). This indicated that UNC-5 homologues increase with maturation and are the predominant receptors mediating netrin function in the adult spinal cord. In addition, the expression patterns observed for the netrin receptors in the adult spinal cord provide evidence that the repertoire of netrin receptors expressed by an individual neuron in the spinal cord may change as these neurons mature. In the case of commissural neurons, DCC is the only receptor expressed during axon extension to the floor plate, but in adulthood these neurons, and many other neural subtypes, express more th an one netrin receptor (Manitt et

129 al., 2004: Chapter 3). Furthermore, the patterns of expression observed suggest that most neurons express both a DCC and an UNC-5 homologue family member, or may switch from expressing DCC during early embryogenesis to expressing UNC-5 homologue(s) in the adult. Consistent with this, retinal ganglion cell axons respond to netrin with attraction wh en they are required to exit the retina but are repelled by netrin wh en they reach the optic tectum (Shewan et al., 2002). This change was shown to be intrinsic to the neuron, and is correlated with reduced levels of cAMP and DCC in these neurons.

V. Potential Role of Netrin and Netrin receptors in Neurons A limited number of studies have addressed the functional role of netrin protein produced by neurons. Netrin-I immunoreactivity is associated with neurites in the adult CNS (Manitt et al., 2001; Chapter 2; Tritsch and Kennedy, unpublished data), but it is not clear if netrin-I is secreted from neurons via dendrites, axons, or both, or if the protein is secreted by neighboring cells and then captured on the neuronal surface. Netrin-I produced by a neuron might signal neighboring cells or, alternatively, function as an autocrine cue. During neural deve\opment in C. elegans, certain pioneer axons that are attracted to a source ofnetrinlUNC-6 later express unc-6 themselves. This neuronal source of UNC-6 then influences the growth of other axons through contact-mediated guidance (Wadsworth et al., 1996). Analysis of the distribution of netrin protein in D. melanogaster revealed that the fly homolog of DCC, frazzled, can capture netrin protein and present it on axonal surfaces where it acts as a guidance cue for other axons (Hiramoto et al., 2000). These findings indicate that netrin presented on the surface of a neuron can influence a neighboring cell and that the distribution of netrin receptors may localize and present netrin protein to nearby cells. Characterization of the levels and distributions of netrin receptors in the adult spinal cord indicates that neurons in the ventral horn express UNC-5 homologues and low levels of DCC. In the dorsal horn however, the only receptors robustly expressed are UNC5H2 and UNC5H3 (Chapter 3). While previous reports indicate that DCC-UNC-5 receptor complexes are required to transduce a repellent response (Hong et al., 1999), it has been demonstrated in Drosophila that UNC-5 alone can inhibit axon extension close to a source of netrin at the embryonic midline (Ke\eman and Dickson, 2001). These authors

130 proposed that in the presence of high netrin concentrations UNC-5 is sufficient to produce a repellent response. In this case however, the axons were not observed to turn and grow away from the netrin-expressing midline, but rather were observed to stop. This suggests that UNC-5 alone causes growth cone collapse. It also supports the notion that DCC and UNC-5 working in concert are able to transduce a guidance response because the presence of both receptors may cause asymmetrical collapse in response to netrin (Zhou et al., 2002).

The profile of netrin and netrin receptor expressIOn In the adult spinal cord suggests that netrin may function to inhibit cell motility, process extension, and inappropriate forms of sprouting. In D. melanogaster, netrin has been shown to function as a target derived cue regulating synapse formation (Mitchell et al., 1996; Winberg et al., 1998). It may be the case that netrin and predominant UNC-5 homologue expression by neurons in the adult spinal cord contribute to the inhibition of synaptic plasticity. This has been described for ephrins in mammals in vivo and in vitro (reviewed by Murai et al., 2002) and for invertebrate semaphorins in vivo (Matthes et al., 1995; Godenschwege et al., 2002). In support ofthis our group has determined that netrin is present at the synapse, and very recently found evidence that netrin and DCC are involved in synaptogenesis and synaptic function in rat cortical neurons in vitro (Tritsch and Kennedy, in preparation). It is interesting that brain regions that are associated with high levels of plasticity correlate with the sites of highest DCC expression, su ch as the hippocampus, the cortex, and the dopaminergic system (Livesey and Hunt et al., 1997; Kennedy lab unpublished findings). Conversely, in areas where plasticity is more tightly regulated, such as in the spinal cord and particularly in the dorsal horn, which contains interneurons that receive sensory input from the peripheral nervous system and process pain information (reviewed by Ji et al., 2003), high levels ofUNC-5 homologues are expressed.

VI. Netrin-l is Expressed by Oligodendrocytes and Enriched in Periaxonal Myelin Mature myelinating oligodendrocytes were also found to express netrin-I in the adult spinal cord (Manitt et al., 2001: Chapter 2). During embryonic development, oligodendrocyte precursors are born in the ventral embryonic spinal cord just dorsal to the netrin-I expressing floor plate and then migrate away to disperse throughout the spinal

131 cord where they will eventually myelinate axons (reviewed by Jarjour and Kennedy, 2004). Oligodendrocyte precursors express dcc and unc5hl, and netrin-I is required for their migration away from the ventral midline (Tsai et al., 2003; Jarjour et al., 2003). Similar to that which is observed in embryonic neurons, oligodendrocyte precursors express netrin receptors during their migration (Tsai et al., 2003; Jarjour et al., 2003), and also express netrin-I wh en they become more mature (Manitt et al., 2001: Chapter 2; Manitt et al., 2004: Chapter 3). Initiation of myelination requires surface recognition events and adhesive interactions (reviewed by Pedraza et al., 2001). The profile of netrin-I and netrin receptor expression in oligodendrocytes, and the finding that netrin-I becomes associated to membranes following its secretion, suggest that netrin-I may be important in these processes. A myelin fractionation protocol that yields enriched fractions of compact myelin. periaxonal myelin, and axolemma indicated that netrin-I is absent from compact myelin, but is present on membranes at the periaxonal space (Figure 5.3; Manitt et al., 2001: Chapter 2). This suggested that netrin-I may function in mediating axon-oligodendrocyte interactions. Other molecules that have a similar subcellular distribution, such as MAG. Nogo and cnp. have been shown Figure 5.3. Netrin-1 (in red) is localized to play a role in the maintenance of myelin ultrastructure te membranes al the periaxonal space. 00. oligodendrocyte. and/or axon-oligodendrocyte interactions (Martini and Schachner, 1986; Trapp, 1990; Trapp and Quarles, 1984; Yin et al., 1997; Schachner and Bartsch, 2000). In particular, MAG and Nogo have been shown to inhibit aberrant axon collateral sprouting in uninjured fiber tracts (Weiss et al., 2004; Sicotte et al.., 2003; Simonen et al., 2003).

VII. Netrin-l is a Myelin-Associated Inhibitor of Neurite Extension While the myelin associated inhibitors MAG and Nogo have been reported to be important in axon/myelin interactions by preventing sprouting in the normal spinal cord, they have been most intensely studied for their role in inhibiting regeneration. Although many CNS neurons have the capacity to regenerate a severed axon (David and Aguayo,

132 1981) the onset of myelination in the mammalian CNS coincides with a dramatic drop in the ability of injured axons to regenerate (Keirstead et al., 1992). It is widely believed that the presence of myelin-associated inhibitors contribute to the effects of the injured CNS environment on inhibiting regeneration (reviewed by Sandvig et al., 2004). A particularly convincing study demonstrated that mice immunized against total myelin prote in undergo extensive regeneration and recovery of function following cortico-spinal tract lesions (Huang et al., 1999). However, when mice were specifically immunized against MAG and Nogo-66 (the inhibitory domain of Nogo: Fournier et al., 2001), the extent of the regenerative response was more modest (Sicotte et al., 2003), suggesting that additional myelin-associated inhibitors have yet to be identified. The finding that UNC-5 homologues are the predominant netrin receptors in the adult spinal cord (Manitt et al., 2004: Chapter 3) led us to the hypothesize that netrin-I may function as a novel myelin­ associated inhibitor of regeneration. The aim of the study in Chapter 4 was to examine the contribution of myelin-associated netrin-I to the inhibitory effects of myelin on neurite outgrowth in vitro. We demonstrated in these experiments that myelin-associated netrin-I functions as an inhibitor of neurite extension in postnatal cerebellar granule cells and embryonic commissural neurons, and that DCC is involved in mediating this repellent response. This study also led to two other major findings: 1) that the levels of intraneuronal cAMP determine whether neurite outgrowth will be promoted or inhibited by myelin-associated netrin-I and 2) that myelin regulates the levels of netrin receptors expressed by neurons.

VIII. Intraneuronal cAMP Levels Determine the Response to Myelin-Associated Netrin-l During late embryonic and early post-natal development, the intracellular concentration of cAMP is downregulated in neurons (Cai et al., 2001). This correlates with the loss of the capacity of these neurons to extend neurites in the presence of myelin, MAG and Nogo (Cai et al., 2001, Bandtlow, 2003). Furthermore, lowering the concentration of cAMP in neurons in the early post-natal rat spinal cord blocked their ability to regenerate in vivo (Cai et al., 2001). Lesioning the peripheral processes of sensory neurons in dorsal root ganglia (DRG), which regenerate successfully, initiates

133 molecular events in sensory neurons that "'prime" them to subsequently regenerate their central axons more successfully (Neumann and Woolf, 1999). In these experiments, a "preconditioning" lesion to peripheral axons one or two weeks prior to injuring the central processes resulted in improved regeneration, but not wh en both lesions were performed at the same time. Qiu et al. (2002) have shown that this priming effect involves the ability of a peripheral lesion to induce increases in the levels of cytosolic cAMP concentration in sensory neurons. Similarly, pre-treatment of neurons with neurotrophins prior to plating them on myelin blocked their inhibitory response to myelin in vitro (Cai et al., 1999). This was found to result from neurotrophin activation of PKA, caused by increasing the intracellular concentration of cAMP. However, when the neurons were not pre-treated with neurotrophins but were exposed to neurotrophins and myelin simultaneously, neurotrophins did not improve neurite outgrowth. This suggested that myelin and neurotrophins compete antagonistically to regulate the concentration of cAMP, and implicated myelin in a signal transduction cascade that downregulates the level of cytosolic cAMP. However, the fact that myelin does not exert an inhibitory effect on younger neurons, either in culture (Shewan et al., 1995) or when transplanted in vivo (Li and Raisman, 1993), suggests that myelin does not trigger the initial downregulation of cAMP observed with maturation, but rather may present a mechanism by which myelin in the mature nervous system might contribute to maintaining suppressed levels of cAMP. The studies described above indicate that regulation of cAMP levels is a pivotaI factor in mediating the effects of myelin-associated inhibitors. Importantly, the intracellular level of cAMP has also been shown to modulate the response to netrin-l ; high leve\s of cAMP promote attraction and low levels promote repulsion (Ming et al., 1997). In Chapter 4 we tested wh ether the leve\ of intraneuronal cAMP also mediates the response to myelin-associated netrin. Addition of netrin or DCC function blocking antibodies was found to inhibit the ability of cAMP to improve neurite outgrowth on myelin. These results confirmed that cAMP determines the neural response to myelin­ associated netrin and that the improvement in outgrowth that is observed from increasing the levels of cAMP may be due in part to a cAMP mediated change in netrin function from repulsion to attraction.

134 IX. Myelin Regulates Netrin Receptor Levels The finding that both cerebellar granule cells and commissural neurons were inhibited by myelin-associated netrin-I was surprising because the two neuronal subtypes respond to netrin differently during development. In addition to being mediated by the levels of intraneuronal cAMP, the bidirectional properties of netrin-I function are dependent on the repertoire of netrin receptors expressed by the responding cell (Hong et al., 1999). Cerebellar granule cells express an UNC-5 homologue and respond to netrin with repulsion. Netrin-I is required for appropriate neuronal migration of cerebellar granule cell precursors and later for inhibiting granule cells process extension in vivo (Ackerman et al., 1997; przyborski et al., 1998). Interestingly, one ectopic location of granule cells in these mutants is in cerebellar white matter (Goldowitz et al., 2000). Embryonic commissural neurons however, express DCC but not UNC-5 and are attracted by netrin-I, in vivo and in vitro (Kennedy et al., 1994; Serafini et al., 1994; Serafini et al., 1996). In an in vitro study, neurons that are normally attracted by netrin became repelled when they were transfected with unc5h2 (Hong et al., 1999). It was shown that this repellent response requires the presence of both the cytoplasmic domain of DCC and UNC5H2 indicating that a repellent directional response requires a netrin receptor complex that includes a member from both receptor families. Consistent with this, we found that while commissural neurons grown on POL expressed DCC, commissural neurons challenged with myelin underwent a change in netrin receptor levels that resulted in decreased levels of DCC and dramatic upregulation of UNC-5 homologues. This shift in netrin receptor expression c10sely resembles changes that are observed during spinal cord maturation (Manitt et al., 2004: Chapter 3). This indicates that myelination may contribute to the shift in netrin receptor levels that is observed in the spinal cord in vivo.

X. Mechanisms that Regulate the Response to Myelin-Associated Netrin-l The results presented in Chapter 4 suggested that the response to myelin­ associated netrin-I may be regulated in several ways. First, an intrinsic decrease in cAMP concentration that occurs with maturation may cause neurons that respond to netrin either

135 as an attractant or a repellent early in development, to later become inhibited by myelin­ associated netrin. In the neuronal subtypes that have been examined to date, cAMP is reported to be downregulated during maturation and this is correlated with the ability of myelin and myelin-associated inhibitors, such as MAG and Nogo, to produce an inhibitory effect (Cai et al., 1999, 2001; Bandtlow, 2003). This downregulation is observed to happen at different ages depending on the neuron. In the case ofDRG sensory neurons this occurs around postnatal day 3 (deBellard et al., 1996; Cai et al., 2001). In retinal ganglion cells and in mixed spinal cord cultures the switch is reported to occur embryonically (Johnson et al., 1989; deBellard et al., 1996; Turnley and Bartlett, 1998; Cai et al., 2001). Therefore, it is possible that a developmentally regulated decrease in cAMP concentrations in commissural neurons may account for the ability of myelin-associated netrin to produce inhibition. In support of this, embryonic commissural neurons are no longer attracted by netrin after crossing the midline (Shirasaki et al., 1998), and the period during which commissural neurons extend to the tloor plate is between E II and E 14 (Altman and Bayer, 1984; Tessier-Lavigne et al., 1988). The commissural neurons used in our study were obtained from E 15 embryos. Further, we found that elevating the concentration of cAMP using the membrane-permeable analogue, db-cAMP, in cerebellar granule cells switched their response to myelin-associated netrin-I from repulsion to attraction. Thus, cAMP levels also modulate the response to myelin-associated netrin. Second, while evidence suggests that myelin is not involved in the developmentally regulated decrease in cAMP concentration that has been implicated in age-related changes in the response to myelin inhibitors (Shewan et al., 1995; Li and Raisman, 1993), our findings indicate that myelin may be involved in the regulation of receptors that respond to myelin-associated inhibitors. Analysis of commissural netrin receptor expression over the course of the in vitro assay revealed a shift in expression wh en the cells were grown on myelin that would bias these neurons to respond to netrin as a repellent (Chapter 4). In support of this, young retinal and DRG neurons that have elevated cAMP concentrations and are unresponsive to myelin or myelin inhibitors, were demonstrated to become inhibited by Nogo-66 when these neurons were transfected with the Nogo-66 receptor (NgR) (Fournier et al., 2001). Third, it is alternatively possible that the ability of myelin to regulate netrin receptors is mediated through regulation of cAMP levels. Elevating the

136 levels of cAMP has been shown to promote translocation of DCC from an intracellular vesicular pool to the plasma membrane (Bouchard et al., 2004). This increase in cAMP concentration is associated with increased phosphorylation of the transcription factor CREB, which suggests that changes in gene expression are also induced. In support of this, increasing the concentration of cAMP in DRG neurons that have undergone a lesion to their central axons show improvements in regeneration that are dependent on PKA activation only immediately following injury, but that following this period, improved regeneration is PKA independent (Qiu et al., 2002). This suggests that changes in gene expression have occurred. Thus, it is possible that a decrease in the concentrations of cAMP might have opposite effects on DCC translocation to the membrane and its subsequent levels of expression. Together, these studies indicate that the neural response to myelin-associated inhibitors may be regulated by a combination of intrinsic and extrinsic factors. An intrinsically regulated decrease in the levels of cAMP, in conjunction with the effects of myelin on the levels of cAMP and the receptors for the mye\in-associated inhibitors, may all work in concert to regulate the response to netrin and other mye\in-associated inhibitors.

XI. Common Signaling Pathways The mechanism by which myelin-associated netrin-l produces an inhibitory effect on neurite outgrowth is like\y to share common signal transduction pathways with the other known myelin-associated inhibitors. The Rho GTPases are well characterized for their roles in organizing the actin cytoske\eton. In particular, Cdc42 and Rac direct filopodial and lamellipodial formation, and RhoA has been implicated in growth cone collapse (reviewed by Dickson, 2002). Evidence indicates that the leve\s of cAMP determine the response to myelin-associated inhibitors by regulating rho GTPases. (reviewed by Sandvig et al., 2004). MAG and Nogo have been shown to activate RhoA (Yamashita et al., 2002; Niederost et al., 2002; Fournier et al., 2003; Borisoff et al., 2003), and inhibiting RhoA activation improves regeneration (Lehmann et al., 1999; Dergham et al., 2002). Subsequent experiments demonstrated that elevating the leve\s of cAMP inhibits RhoA activation by the myelin inhibitors and consequently facilitate Rac 1

137 activation (Bandtlow, 2003). Netrin-I activates Cdc42 and Rac through DCC (Shekarabi et aL, 2002; Li et aL, 2002b), and netrin-I mediated formation of filopodia and lamellipodia has been shown to require activation of these GTPases (Shekarabi et aL, 2002). Furthermore, inhibition of RhoA stimulates netrin-I induced neurite outgrowth (Li et aL, 2002b; SW Moore and TE Kennedy, unpublished data). These results are consistent with myelin-associated netrin-I functioning as an inhibitor of neurite extension in the mature CNS. The Nogo-66 receptor binds to ail the identified myelin-associated inhibitors, namely MAG, Nogo, and OMgp (Fournier et aL, 2001; Domeniconi et aL, 2002; Liu et aL, 2002; Wang et al., 2002a). The ability of NgR to transduce a repellent response to the myelin-associated inhibitors results from its interaction with P75, which in turn activates RhoA (Yamashita et al., 2002). It is intriguing that ail of the myelin-associated inhibitors identified thus far have been shown to act through the same receptor complex. Determining whether the netrin receptors interact with this P75 receptor complex or ifthey signal separately may prove to have very important implications for our understanding of how myelin-associated inhibitors exert their effects on plasticity in the normal CNS as weil as following injury.

XII. Role of Myelin-Associated Netrin Following (njury. ln order for netrin-I to function as a myelin-associated inhibitor of regeneration, neurons attempting to regenerate following in jury would have to express members of the unc-5 homologue family of netrin receptors. Ellezam et al. (2001) reported that both dcc and unc5h2 expression persists, albeit downregulated, in axotomized retinal ganglion cell neurons as they attempt to regenerate into the optic nerve or into a peripheral nerve graft, both of which contain netrin-I expressing cells (Madison et al. 2000; Petrausch et aL, 2000; Ellezam et a., 2001). Interestingly, a study carried out in lamprey, a primitive vertebrate with the capacity to recover significant function following transfection of its spinal cord (Cohen et al., 1988), reports a correlation between the expression of unc-5 by neurons and poor axonal regeneration following injury (Shifman and Selzer, 2000a). In the intact aduIt spinal cord, the expression of DCC family members decreased with maturation, while the UNC-5 homologues dramatically increased (Manitt et al., 2004:

138 Chapter 2). Recently, we have found that both families of netrin receptors decrease slightly (-20%) after spinal cord lesion indicating that the repertoire of netrin receptors expressed continue to favor a repulsive response to netrin following injury (Manitt, Kennedy & Howland, unpublished findings).

139 CONCLUSIONS & FUTURE DIRECTIONS The findings presented in this thesis have set the stage for future studies examining the role of netrin in adult neural function. The characterization studies have implicated a role for netrin in the adult nervous system in mediating neural and axon-oligodendrocyte interactions. It has also provided evidence that netrin exerts inhibitory functions in the adult spinal cord. Consistent with these findings, we confirmed that myelin-associated netrin-I inhibits neurite extension in vitro. This suggests that netrin may contribute to the inhibitory properties of the injured CNS on regeneration. Future work will determine if blocking netrin function in vivo following in jury will improve regeneration. The implication that netrin is involved in oligodendrocyte function and the finding that netrin is required early on for oligodendrocyte precursor migration also suggests that netrin function may be important in myelination and related disorders such as multiple sclerosis. While 1 focused on the role of netrin as a myelin-associated inhibitor of neurite extension and emphasized its implications for regeneration, this work also suggests that netrin in the adult nervous system may be involved in regulating sprouting on a wider scale as weil as in mediating synaptic events. Findings in vitro support this hypothesis by demonstrating a role for netrin in synaptic plasticity in embryonic cortical neurons (Tritsch and Kennedy, unpublished findings). Many neurological and psychiatrie diseases have been linked to abnormal synapse function. Determining the role of netrin in these processes may prove to be important in our understandings of these diseases.

140 REFERENCES

Ackerman S.L., Kozak L.P., Przyborski S.A., Rund L.A., Boyer 8.B., Knowles B.B. (\ 997). The mouse rostral cerebellar malformation gene encodes an UNC-5-like protein. Nature. 386 (6627):838-842.

Ackerman S.L., Knowles B.B. (1998). Cloning and mapping of the UNC5C gene to human chromosome 4q21-q23. Genomics. 52(2):205-208.

A\cantara S., Ruiz M., De C.F., Soriano E., Sotelo C. (2000). Netrin 1 acts as an attractive or as a repulsive cue for distinct migrating neurons during the deve10pment of the cerebellar system. Development. 127(7): 1359-1372.

Altman J., Bayer S.A. (1984). The deve10pment of the rat spinal cord. Adv Anat Embryo/ Cell Biol. 85: 1-164.

Anderson R.B., Cooper H.M., Jackson S.c., Seaman c., Key B. (2000). DCC plays a role in navigation of forebrain axons across the ventral midbrain commissure in embryonic xenopus. Dev Biol. 217(2):244-253.

Anderson R.B., Holt C.E. (2002). Expression of UNC-5 in the deve10ping Xenopus visual system. Mech Dev. 118(\-2):157-160.

Ausubel F.M., Brent R., Kingston R.E., Moore 0.0., Seidman J.G., Smith J.A., Struhl K. (1990). Current protoco/s in mo/ecu/ar bi%gy. Wiley. New York.

Bachnou N., Schwartz Z., Farhdi H., Peterson A. (1997). Developmenta/ programming of a myelin gene revea/ed at high reso/ution in NBP "knock-in" mice. Mystic Connecticut: ISN satellite and U Conn-Kroc, Symposium abstracts pp 79.

Bandtlow C.E., Loschinger J. (\ 997). Developmental changes in neuronal responsiveness to the CNS myelin-associated neurite growth inhibitor NI-35/250. Eur J Neurosei. 9( 12):2743-2752.

Bandtlow C.E. (2003). Regeneration in the central nervous system. Exp Gerontol. 38(\- 2):79-86.

Banyai L., Patthy L. (1999). The NTR module: domains of netrins, secreted frizzled related proteins, and type 1 procollagen C-proteinase enhancer protein are homologous with tissue inhibitors of metalloproteases. Protein Sei. 8(8): 1636-1642.

141 Barallobre M.J., Del Rio J.A., Alcantara S., Borrell V., Aguado F., Ruiz M., Carmona M.A., Martin M., Fabre M., Yuste R., Tessier-Lavigne M., Soriano E. (2000). Aberrant development of hippocampal circuits and altered neural activity in netrin I-deficient mice. Development. 127(22):4797-4810.

Bartsch U., Kirchoff F., Schachner M. (1989). Immunohistological localization of the adhesion molecules LI, N-CAM, and MAG in the developing and adult optic nerve of mice. J Comp Neurol. 284(3):451-462.

Bartsch U., Bandtlow C.E., Schnell L., Bartsch S., Spillmann A.A., Rubin B.P., Hillenbrand R., Montag O., Schwab M.E., Schachner M. (1995). Lack of evidence that myelin-associated glycoprotein is a major inhibitor ofaxonal regeneration in the CNS. Neuron. 15(6):1375-1381.

Bennett V., Chen L. (2001). Ankyrins and cellular targeting of diverse membrane proteins to physiological sites. Curr Opin Cell Biol. 13(1 ):61-67.

Bentley O., O'Connor T.P. (1994). Cytoskeletal events in growth cone steering. Curr Opin Neurobiol. 4( 1):43-48.

Bloch-Gallego E., Ezan F., Tessier-Lavigne M., Sotelo C. (1999). Floor plate and netrin-l are involved in the migration and survival of inferior olivary neurons. J Neurosci. 19(11):4407-4420.

Bonaldo M.F., Lennon G., Soares M.B. (1996). Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res. 6(9):791-806.

Borisoff J.F., Chan c.c., Hiebert G.W., Oschipok L., Robertson G.S., Zamboni R., Steeves J.O., Tetzlaff W. (2003). Suppression of Rho-kinase activity promotes axonal growth on inhibitory CNS substrates. Mol Cell Neurosci. 22(3 ):405-416.

Bouchard J.F., Moore S.W., Tritsch N.X., Roux P.P., Shekarabi M., Barker P.A., Kennedy T.E. (2004). Protein kinase A activation promotes plasma membrane insertion of DCC from an intracellular pool: A nove! mechanism regulating commissural axon extension. J Neurosci. 24( 12):3040-3050.

Braissant O., Wahli W. (1998). A simplified in situ hybridization protocol using non­ radioactive!y labeled probes to detect abundant and rare mRNAs on tissue sections. Biochemica. 1: 10-16.

Braisted J.E., Catalano S.M., Stimac R., Kennedy T.E., Tessier-Lavigne M., Shatz C.l., 0'Leary 0.0. (2000). Netrin-l promotes thalamic axon growth and is required for proper development of the thalamocortical projection. J Neurosci. 20(15):5792-5801.

142 Brose K., Bland K.S., Wang K.H., Amott O., Henzel W., Goodman C.S., Tessier-Lavigne M., Kidd T. (1999). Slit proteins bind Robo receptors and have an evolutionarily conserved role in repulsive axon guidance. Cell. 96(6):795-806.

Cai O., Shen Y., De B.M., Tang S., Filbin M.T. (1999). Prior exposure to neurotrophins blocks inhibition ofaxonal regeneration by MAG and myelin via a cAMP-dependent mechanism. Neuron. 22( 1):89-1 0 1.

Cai O., Qiu J., Cao Z., McAtee M., Bregman B.S., Filbin M.T. (2001). Neuronal cyclic AMP controls the developmental loss in ability of axons to regenerate. J Neurosci. 21( 13):4731-4739.

Campbell O.S., Holt C.E. (2001). Chemotropic responses of retinal growth cones mediated by rapid local protein synthesis and degradation. Neuron. 32(6): 1013-1026.

Chan S.S., Zheng H., Su M.W., Wilk R., Killeen M.T., Hedgecock E.M., Culotti J.G. (1996). UNC-40, a C. elegans homolog of DCC (Oeleted in Colorectal Cancer), is required in motile cells responding to UNC-6 netrin cues. Cell. 87(2): 187-195.

Chang c., Yu T.W., Bargmann c.I., Tessier-Lavigne M. (2004). Inhibition of netrin­ mediated axon attraction by a receptor protein tyrosine phosphatase. Science. 305(5680): 103-1 06.

Chen M.S., Huber A.B., van der Haar M.E., Frank M., Schnell L., Spillmann A.A., Christ F., Schwab M.E. (2000). Nogo-A is a myelin-associated neurite outgrowth inhibitor and an antigen for monoclonal antibody IN-l. Nature. 403(6768):434-439.

Chen Y.Q., Hsieh J.T., Yao F., Fang B., Pong R.C., Cipriano S.c., Krepulat F. (1999). Induction of apoptosis and G2/M cell cycle arrest by DCC. Oncogene. 18( 17):2747- 2754.

Chien C.B., Rosenthal O.E., Harris W.A., Holt C.E. (1993). Navigational errors made by growth con es without filopodia in the embryonic Xenopus brain. Neuron. 11(2):237- 251.

Cho K.R., Fearon E.R. (1995). DCC: linking tumor suppressor genes and altered cell surface interactions in cancer? Curr Opin Genet Dev. 5( 1):72-78.

Chuong C.M., Jiang T.X., Yin E., Widelitz R.B. (1994). cOCC (chicken homologue to a gene deleted in colorectal carcinoma) is an epithelial adhesion molecule expressed in the basal cells and involved in epithelial-mesenchymal interaction. Dev Biol. 164(2):383-397.

143 Clancy 8., Cauller LJ. (1998). Reduction of background auto fluorescence in brain sections following immersion in sodium borohydride. J Neurosci Methods. 83(2):97- 102.

Cohen A.H., Mackler S.A., Selzer M.E. (1988). Behavioral recovery following spinal transection: functional regeneration in the lamprey CNS. Trends Neurosci. 11(5):227- 231.

Colamarino S.A., Tessier-Lavigne M. (1995a). The axonal chemoattractant netrin-I is also a chemorepellent for trochlear motor axons. Cel!. 81(4):621-629.

Colamarino S.A., Tessier-Lavigne M. (1 995b). The role of the floor plate In axon guidance. Annu Rev Neurosci. 18:497-529.

Colavita A., Culotti J.G. (1998). Suppressors of ectopic UNC-5 growth cone steering identify eight genes involved in axon guidance in Caenorhabditis elegans. Dev Bio/. 194(1):72-85.

Colavita A., Krishna S., Zheng H., Padgett R.W., Culotti J.G. (1998). Pioneer axon guidance by UNC-129, a C. elegans TGF-beta. Science. 281(5377):706-709.

Cooper H.M., Armes P., Britto J., Gad J., Wilks A.F. (1995). Cloning of the mouse homologue of the deleted in colorectal cancer gene (mDCC) and its expression in the deve\oping mouse embryo. Oncogene. 11( II ):2243-2254.

Corset V., Nguyen-Ba-Charvet K.T., Forcet c., Moyse E., Chedotal A., Mehlen P. (2000). Netrin-I-mediated axon outgrowth and cAMP production requires interaction with adenosine A2b receptor. Nature. 407(6805):747-750.

Croul S., Mezitis S.G., Stieber A., Chen YJ., Gonatas J.O., Goud 8., Gonatas N.K. (1990). Immunocytochemical visualization of the Golgi apparatus in several species, including human, and tissues with an antiserum against MG-160, a sialoglycoprotein of rat Golgi apparatus. J Histochem Cytochem. 38(7):957-963.

David S., Aguayo AJ. (1981). Axonal elongation into peripheral nervous system "bridges" after central nervous system in jury in adult rats. Science. 214(4523):931-933.

David S., Lacroix S. (2003). Molecular approaches to spinal cord repair. Annu Rev Neurosci. 26:411-440. de la Torre Jr., Hopker V.H., Ming G.L., Poo M.M., Tessier-Lavigne M., Hemmati­ Brivanlou A., Holt C.E. (1997). Tuming of retinal growth cones in a netrin-I gradient mediated by the netrin receptor DCC. Neuron. 19(6): 1211-1224.

144 de Wit J., Verhaagen J. (2003). Role of semaphorins in the adult nervous system. Prog Neurobiol. 71(2-3):249-267.

DeBellard M.E., Tang S., Mukhopadhyay G., Shen Y.1., Filbin M.T. (1996). Myelin­ associated glycoprotein inhibits axonal regeneration from a variety of neurons vIa interaction with a sialoglycoprotein. Mol Cell Neurosci. 7(2):89-101.

Deiner M.S., Kennedy T.E., Fazeli A., Serafini T., Tessier-Lavigne M., Sretavan D.W. (1997). Netrin-I and DCC mediate axon guidance locally at the optic disc: loss of function leads to optic nerve hypoplasia. Neuron. 19(3):575-589.

Deiner M.S., Sretavan D.W. (1999). Altered midline axon pathways and ectopie neurons in the developing hypothalamus of netrin-I- and DCC-deficient mice. J Neurosci. 19(22):9900-9912.

Dergham P., Ellezam B., Essagian e., Avedissian H., Lubell W.D., McKerracher L. (2002). Rho signaling pathway targeted to promote spinal cord repair. J Neurosci. 22( 15):6570-6577.

Detskey P.Z., Bigbee J.W., DeVries G.H. (1988). Isolation and characterization of axolemma-enriched fractions from discrete areas of bovine CNS. Neurochem Res. 13(5):449-454.

Dickson B.1. (2001). Rho GTPases ln growth cone guidance. Curr Opin Neurobiol. 11(1): 103-110.

Dickson B.1., Keleman K. (2002). Netrins. Curr Biol. 12(5):RI54-RI55.

Domeniconi M., Cao Z., Spencer T., Sivasankaran R., Wang K., Nikulina E., Kimura N., Cai H., Deng K., Gao Y., He Z., Filbin M. (2002). Myelin-associated glycoprotein interacts with the Nog066 receptor to inhibit neurite outgrowth. Neuron. 35(2):283- 290.

Ekstrand B.e., Mansfield T.A., Bigner S.H., Fearon E.R. (1995). DCC expression IS altered by multiple mechanisms in brain tumours. Oncogene. 11( Il ):2393-2402.

Ellezam B., Selles-Navarro 1., Manitt e., Kennedy T.E., McKerracher L. (200 1). Expression of netrin-l and its receptors DCC and UNC-5H2 after axotomy and during regeneration ofadult rat retinal ganglion cells. Exp Neurol. 168(1):105-115.

Engelkamp D. (2002). Cloning ofthree mouse Unc5 genes and their expression patterns at mid-gestation. Mech Dev. 118(1-2):191-197.

145 Faze\i A., Dickinson S.L., Hermiston M.L., Tighe R.V., Steen R.G., Small c.G., Stoeckli E.T., Keino-Masu K., Masu M., Rayburn H., Simons l, Bronson R.T., Gordon J.I., Tessier-Lavigne M., Weinberg R.A. (1997). Phenotype of mice lacking functional Deleted in colorectal cancer (Dcc) gene. Nature. 386(6627):796-804.

Fearon E.R., Cho K.R., Nigro lM., Kern S.E., Simons lW., Ruppert lM., Hamilton S.R., Preisinger A.c., Thomas G., Kinzler K.W., . (1990). Identification of a chromosome 18q gene that is altered in colorectal cancers. Science. 247(4938):49-56.

Finger J.H., Bronson R.T., Harris B., Johnson K., przyborski S.A., Ackerman S.L. (2002). The netrin 1 receptors Unc5h3 and Dcc are necessary at multiple choice points for the guidance of corticospinal tract axons. J Neurosci. 22(23): 10346-10356.

Forcet c., Ye X., Granger L., Corset V., Shin H., Bredesen D.E., Mehlen P. (2001). The dependence receptor DCC (de\eted in colorectal cancer) defines an alternative mechanism for caspase activation. Proe Nat/ Aead Sci USA. 98(6):3416-3421.

Forcet c., Stein E., Pays L., Corset V., Llambi F., Tessier-Lavigne M., Mehlen P. (2002). Netrin-l-mediated axon outgrowth requires deleted in colorectal cancer-dependent MAPK activation. Nature. 417(6887):443-447.

Forrester W.c., Garriga G. (1997). Genes necessary for C. elegans cell and growth cone migrations. Deve/opment. 124(9): 1831-1843.

Fournier A.E., GrandPre T., Strittmatter S.M. (2001). Identification of a receptor mediating Nogo-66 inhibition ofaxonal regeneration. Nature. 409(6818):341-346.

Fournier A.E., Takizawa B.T., Strittmatter S.M. (2003). Rho kinase inhibition enhances axonal regeneration in the injured CNS. J Neurosei. 23(4): 1416-1423.

Funato H., Saito-Nakazato Y., Takahashi H. (2000). Axonal growth from the habenular nucleus along the neuromere boundary region of the diencephalon is regulated by semaphorin 3F and netrin-I. Mo/ Cell Neurosci. 16(3):206-220.

Galko M.J., Tessier-Lavigne M. (2000). Function of an axonal chemoattractant modulated by metalloprotease activity. Science. 289(5483):1365-1367.

Gan W.B., Wong V.Y., Phillips A., Ma c., Gershon T.R., Macagno E.R. (1999). Cellular expression of a leech netrin suggests roles in the formation of longitudinal nerve tracts and in regional innervation ofperipheral targets.J Neurobiol. 40(1):103-115.

146 Geisbrecht B.V., Dowd K.A., Barfield R.W., Longo P.A., Leahy DJ. (2003). Netrin binds discrete subdomains of DCC and UNC5 and mediates interactions between DCC and heparin. J Biol Chem. 278(35):32561-32568.

Gitai Z., Yu T.W., Lundquist E.A., Tessier-Lavigne M., Bargmann e.1. (2003). The netrin receptor UNC-40IDCC stimulates axon attraction and outgrowth through enabled and, in parallel, Rac and UNC-115/AbLIM. Neuron. 37(1):53-65.

Godenschwege T.A., Hu H., Shan-Crofh X., Goodman e.S., Murphey R.K. (2002). Bi­ directional signaling by Semaphorin 1a during central synapse fonnation in Drosophila. Nat Neurosci. 5(12):1294-1301.

Goldowitz D., Hamre K.M., Przyborski S.A., Ackennan S.L. (2000). Granule cells and cerebellar boundaries: analysis of Unc5h3 mutant chimeras. J Neurosci. 20(11 ):4129- 4137.

Gonatas 1.0., Mezitis S.G., Stieber A., Fleischer B., Gonatas N.K. (1989). MG-160. A novel sialoglycoprotein of the medial cisternae of the Golgi apparatus [published eeratum appears in 1 Biol Chem 1989 Mar 5;264(7):4264]. J Biol Chem. 264(1 ):646- 653.

Grados-Munro E.M., Fournier A.E. (2003). Myelin-associated inhibitors ofaxon regeneration. J Neurosci Res. 74(4):479-485.

GrandPre T., Nakamura F., Vartanian T., Strittmatter S.M. (2000). Identification of the Nogo inhibitor ofaxon regeneration as a Reticulon protein. Nature. 403(6768):439- 444.

Hall A. (1998). Rho GTPases and the actin cytoskeleton. Science. 279(5350):509-514.

Hamasaki T., Goto S., Nishikawa S., Ushio Y. (2001). A role ofnetrin-l in the fonnation of the subcortical structure striatum: repulsive action on the migration of late-born striatal neurons. J Neurosci. 21(12):4272-4280.

Hamelin M., Zhou Y., Su M.W., Scott I.M., Culotti J.G. (1993). Expression of the UNC-5 guidance receptor in the touch neurons ofe. elegans steers their axons dorsally. Nature. 364(6435):327-330.

Harris R., Sabatelli L.M., Seeger M.A. (1996). Guidance cues at the Drosophila CNS midline: identification and characterization of two Drosophila NetrinlUNC-6 homologs. Neuron. 17(2):217-228.

147 Hedgeeoek E.M., Culotti J.G., Hall D.H., Stem B.D. (1987). Geneties of cell and axon migrations in Caenorhabditis elegans. Development. 100(3):365-382.

Hedgeeoek E.M., Culotti J.G., Hall D.H. (1990). The une-5, une-6, and une-40 genes guide eireumferential migrations of pioneer axons and mesodermal eells on the epidermis in C. elegans. Neuron. 4(1):61-85.

Hedrick L., Cho K.R., Fearon E.R., Wu T.c., Kinzler K.W., Vogelstein B. (1994). The DCC gene product in cellular ditTerentiation and colorectal tumorigenesis. Genes Dev. 8(10):1174-1183.

Hendershot L.M., Wei J.Y., Gaut J.R., Lawson B., Freiden P.J., Murti K.G. (1995). In vivo expression of mammalian BiP A TPase mutants causes disruption of the endoplasmic reticulum. Mol Biol Cell. 6(3):283-296.

Hilgers W., Song 1.J., Haye M., Hruban R.R., Kem S.E., Fearon E.R. (2000). Homozygous deletions inactivate DCC, but not MADH4/DPC4/SMAD4, in a subset of pancreatic and biliary cancers. Genes Chromosomes Cancer. 27(4):353-357.

Hiramoto M., Hiromi Y., Giniger E., Hotta Y. (2000). The Drosophila Netrin receptor Frazzled guides axons by controlling Netrin distribution. Nature. 406(6798):886-889.

Hjorth J. T., Gad J., Cooper H., Key B. (2001). A zebratish homologue of deleted in colorectal cancer (zdec) is expressed in the tirst neuronal c1usters of the developing brain. Mech Dev. 109(1): 105-1 09.

Hofmann K., Tschopp 1. (1995). The death domain motif found in Fas (Apo-I) and TNF receptor is present in proteins involved in apoptosis and axonal guidance. FEBS Lett. 371(3):321-323.

Holt M.R., Koffer A. (2001). Cell motility: proline-rich proteins promote protrusions. Trends Cell Biol. 11( 1):38-46.

Hong K., Hinck L., Nishiyama M., Poo M.M., Tessier-Lavigne M., Stein E. (1999). A ligand-gated association between cytoplasmic domains of UNC5 and DCC family receptors con verts netrin-induced growth cone attraction to repulsion. Cell. 97(7):927- 941.

Hong K., Nishiyama M., Henley J., Tessier-Lavigne M., Poo M. (2000). Calcium signalling in the guidance ofnerve growth by netrin-1. Nature. 403(6765):93-98.

Hopker V.H., Shewan D., Tessier-Lavigne M., Poo M., Holt C. (1999). Growth-cone attraction to netrin-I is converted to repulsion by laminin-I. Nature. 401(6748):69-73.

148 Huang D.W., McKerracher L., Braun P.E., David S. (1999). A therapeutic vaccine approach to stimulate axon regeneration in the aduIt mammalian spinal cord. Neuron. 24(3):639-647.

Huber A.B., Kolodkin A.L., Ginty 0.0., Cloutier J.F. (2003). Signaling at the growth cone: ligand-receptor complexes and the control ofaxon growth and guidance. Annu Rev Neurosci. 26:509-563.

Ishii N., Wadsworth W.G., Stern B.D., Culotti J.G., Hedgecock E.M. (1992). UNC-6, a laminin-related protein, guides cell and pioneer axon migrations in C. elegans. Neuron. 9(5):873-881.

Jarjour A.A., Manitt c., Moore S.W., Thompson K.M., Yuh S.J., Kennedy T.E. (2003). Netrin-I is a chemorepellent for oligodendrocyte precursor cells in the embryonic spinal cord. J Neurosci. 23(9):3735-3744.

Jarjour A.A., Kennedy T.E. (2004). Oligodendrocyte precursors on the move: mechanisms directing migration. Neuroscientist. 10(2):99-105.

Ji R.R., Kohno T., Moore K.A., WoolfC.J. (2003). Central sensitization and LTP: do pain and memory share similar mechanisms? Trends Neurosci. 26(12):696-705.

Johnson K.G., McKinnell LW., Stoker A.W., HoIt C.E. (2001). Receptor protein tyrosine phosphatases regulate retinal ganglion cell axon outgrowth in the developing Xenopus visual system. J Neurobiol. 49(2):99-117.

Johnson P.W., bramow-Newerly W., Seilheimer B., Sadoul R., Tropak M.B., Arquint M., Dunn R.J., Schachner M., Roder 1.c. (1989). Recombinant myelin-associated glycoprotein con fers neural adhesion and neurite outgrowth function. Neuron. 3(3):377-385.

Kappler J., Franken S., Junghans U., Hoffmann R., Linke T., Muller H.W., Koch K.W. (2000). G1ycosaminoglycan-binding properties and secondary structure of the C­ terminus ofnetrin-l. Biochem Biophys Res Commun. 271(2):287-291.

Keeling S.L., Gad J.M., Cooper H.M. (1997). Mouse Neogenin, a DCC-like molecule, has four splice variants and is expressed widely in the aduIt mouse and during embryogenesis. Oncogene. 15(6):691-700.

Keino-Masu K., Masu M., Hinck L., Leonardo E.D., Chan S.S., Culotti 1.G., Tessier­ Lavigne M. (1996). Deleted in Colorectal Cancer (DCC) encodes a netrin receptor. Cell. 87(2): 175-185.

149 Keirstead H.S., Hasan SJ., Muir G.D., Steeves J.D. (1992). Suppression of the onset of myelination extends the permissive period for the functional repair of embryonic spinal cord. Proc Natl Acad Sei USA .. 89(24): 11664-11668.

Keleman K., Dickson BJ. (2001). Short- and long-range repulsion by the Drosophila Unc5 netrin receptor. Neuron. 32(4):605-617.

Kennedy T.E., Serafini T., de I.T., Jr., Tessier-Lavigne M. (1994). Netrins are diffusible chemotropic factors for commissural axons in the embryonic spinal cord. Ce Il. 78(3):425-435.

Kennedy T.E. (2000). Cellular mechanisms of netrin function: long-range and short-range actions. Biochem Cell Biol. 78(5):569-575.

Killeen M., Tong 1., Krizus A., Steven R., Scott 1., Pawson T., Culotti 1. (2002). UNC-5 function requires phosphorylation of cytoplasmic tyrosine 482, but its UNC-40- independent functions also require a region between the ZU-5 and death domains. Dev Biol. 251(2):348-366.

Kim 1.E., Bonilla I.E., Qiu D., Strittmatter S.M. (2003a). Nogo-C is sufficient to de!ay nerve regeneration. Mol Cell Neurosei. 23(3):451-459.

Kim J.E., Li S., GrandPre T., Qiu D., Strittmatter S.M. (2003b). Axon regeneration in young adult mice lacking Nogo-AIB. Neuron. 38(2): 187-199.

Kim S., Ren X.c., Fox E., Wadsworth W.G. (1999). SDQR migrations in Caenorhabditis elegans are controlled by multiple guidance cues and changing responses to netrin UNC-6. Development. 126( 17):3881-3890.

Klein R. (2001). Excitatory Eph receptors and adhesive ephrin ligands. Curr Opin Cell Biol. 13(2): 196-203.

Klein R., Nanduri V., Jing S.A., Lamballe F., Tapley P., Bryant S., Cordon-Cardo c., Jones K.R., Reichardt L.F., Barbacid M. (1991). The trkB tyrosine protein kinase is a receptor for brain-derived neurotrophic factor and neurotrophin-3. Cell. 66(2):395-403.

Klingelhutz AJ., Hedrick L., Cho K.R., McDougall 1.K. (1995). The DCC gene suppresses the malignant phenotype of transformed human epithelial cells. Oncogene. 10(8): 1581-1586.

Koch M., Murrell J.R., Hunter D.D., Oison P.F., Jin W., Keene D.R., Brunken WJ., Burgeson R.E. (2000). A nove! member of the netrin family, beta-netrin, shares

150 homology with the beta chain of laminin: identification, expression, and functional characterization. J Cell Biol. 151 (2):221-234.

Koeberle P.O., Bahr M. (2004). Growth and guidance cues for regenerating axons: where have they gone? J Neurobiol. 59( 1): 162-180.

Kolodziej P.A., Timpe L.e., Mitchell K.J., Fried S.R., Goodman e.S., Jan L.Y., Jan Y.N. (1996). frazzled encodes a Orosophila member of the DCC immunoglobulin subfamily and is required for CNS and motor axon guidance. Cell. 87(2): 197-204.

Komatsuzaki K., Oalvin S., Kinane T.B. (2002). Modulation of G(ialpha(2» signaling by the axonal guidance molecule UNC5H2. Biochem Biophys Res Commun. 297(4):898- 905.

Kuramoto T., Kuwamura M., Seri kawa T. (2004). Rat neurological mutations cerebellar vermis defect and hobble are caused by mutations in the netrin-l receptor gene Unc5h3. Brain Res Mol Brain Res. 122(2): 103-108.

Lang P., Gesbert F., espine-Carmagnat M., Stan cou R., Pouchelet M., Bertoglio 1. (1996). Protein kinase A phosphorylation of RhoA mediates the morphological and functional effects of cyclic AMP in cytotoxic lymphocytes. EMBO 1. 15(3):510-519.

Lanier L.M., Gates M.A., Witke W., Menzies A.S., Wehman A.M., Macklis J.O., Kwiatkowski O., Soriano P., Gertler F.B. (1999). Mena is required for neurulation and commissure formation. Neuron. 22(2):313-325.

Lauderdale J.O., Davis N.M., Kuwada J.Y. (1997). Axon tracts correlate with netrin-Ia expression in the zebrafish embryo. Mol Cell Neurosci. 9(4):293-313.

Lebrand e., Dent E.W., Strasser G.A., Lanier L.M., Krause M., Svitkina T.M., Borisy G.G., Gertler F.B. (2004). Critical raIe ofEna/VASP prateins for filopodia formation in neurons and in function downstream of netrin-l. Neuron. 42(1 ):37-49.

Lee M.K., Cleveland O.W. (1996). Neuronal intermediate filaments. Annu Rev Neurosci. 19:187-217.

Lehmann M., Fournier A., Selles-Navarro 1., Oergham P., Sebok A., Leclerc N., Tigyi G., McKerracher L. (1999). Inactivation of Rho signaling pathway promotes CNS axon regeneration. J Neurosci. 19(17):7537-7547.

Leonardo E.O., Hinck L., Masu M., Keino-Masu K., Ackerman S.L., Tessier-Lavigne M. (1997). Vertebrate homologues of e. e1egans UNC-5 are candidate netrin receptors. Nature. 386(6627):833-838.

151 Leung-Hagesteijn c., Spence A.M., Stem B.D., Zhou Y., Su M.W., Hedgecock E.M., Culotti J.G. (1992). UNC-5, a transmembrane protein with immunoglobulin and thrombospondin type 1 domains, guides cell and pioneer axon migrations in C. elegans. Cell. 71(2):289-299.

Li X., Meriane M., Triki 1., Shekarabi M., Kennedy T.E., Larose L., Lamarche-Vane N. (2002a). The adaptor protein Nck-I couples the netrin-I receptor DCC (deleted in colorectal cancer) to the activation of the small GTPase Rac 1 through an atypical mechanism. J Biol Chem. 277(40):37788-37797.

Li X., Saint-Cyr-Proulx E., Aktories K., Lamarche-Vane N. (2002b). Rac1 and Cdc42 but not RhoA or Rho kinase activities are required for neurite outgrowth induced by the Netrin-I receptor DCC (deleted in colorectal cancer) in NI E-115 neuroblastoma cells. J Biol Chem. 277( 17): 15207 -15214.

Li Y., Raisman G. (\ 993). Long axon growth from embryonic neurons transplanted into myelinated tracts of the adult rat spinal cord. Brain Res. 629( 1): 115-127.

Liu B.P., Fournier A, GrandPre T., Strittmatter S.M. (2002). Myelin-associated glycoprotein as a functionalligand for the Nogo-66 receptor. Science. 297(5584): 1190- 1193.

Livesey FJ., Hunt S.P. (\ 997). Netrin and netrin receptor expression in the embryonic mammalian nervous system suggests roles in retinal, striatal, nigral, and cerebellar development. Mol Cell Neurosci. 8(6):417-429.

L1ambi F., Causeret F., Bloch-Gallego E., Mehlen P. (2001). Netrin-I acts as a survival factor via its receptors UNC5H and DCC. EMBO J. 20(\ 1):2715-2722.

Macdonald R., Scholes J., Strahle U., Brennan c., Holder N., Brand M., Wilson S.W. (1997). The Pax protein Noi is required for commissural axon pathway formation in the rostral forebrain. Development. 124(\ 2):2397-2408.

Madison R.D., Zomorodi A, Robinson G.A. (2000). Netrin-I and peripheral nerve regeneration in the adult rat. Exp Neurol. 161(2):563-570.

Manitt c., Colicos M.A., Thompson K.M., Rousselle E., Peterson AC., Kennedy T.E. (2001). Widespread expression of netrin-I by neurons and oligodendrocytes in the adult mammalian spinal cord. J Neurosci. 21(11):3911-3922.

Manitt c., Kennedy T.E. (2002). Where the rubber meets the road: netrin expression and fun ct ion in developing and adult nervous systems. Prog Brain Res. 137:425-442.

152 Manitt c., Thompson K.M., Kennedy T.E. (2004). Oevelopmental shift in expression of netrin receptors in the rat spinal cord: Predominance of UNC-5 homologues in adulthood. J Neurosci Res. 77(5):690-700.

Martini R., Schachner M. (1986). Immunoelectron microscopic localization of neural cell adhesion molecules (LI, N-CAM, and MAG) and their shared carbohydrate epitope and myelin basic protein in developing sciatic nerve. J Cell Biol. 103(6 Pt 1):2439- 2448.

Matsunaga E., Tauszig-Oelamasure S., Monnier P.P., Mueller B.K., Strittmatter S.M., Mehlen P., Chedotal A. (2004). RGM and its receptor neogenin regulate neuronal survival. Nat Cell Biol. 6(8):749-755.

Matthes 0.1., Sink H., Kolodkin A.L., Goodman C.S. (1995). Semaphorin II can function as a selective inhibitor of specific synaptic arborizations. Cell. 81(4):631-639.

McIntire S.L., Garriga G., White J., Jacobson O., Horvitz H.R. (1992). Genes necessary for directed axonal elongation or fasciculation in C. elegans. Neuron. 8(2):307-322.

McKerracher L., David S., Jackson O.L., Kottis V., Ounn R.1., Braun P.E. (1994). Identification of myelin-associated glycoprotein as a major myelin-derived inhibitor of neurite growth. Neuron. 13(4):805-811.

Mehlen P., Rabizadeh S., Snipas S.1., Assa-Munt N., Salvesen G.S., Bredesen O.E. (1998). The DCC gene product induces apoptosis by a mechanism requiring receptor proteolysis. Nature. 395(6704):801-804.

Merz O.c., Zheng H., Killeen M.T., Krizus A., Culotti J.G. (2001). Multiple signaling mechanisms of the UNC-6/netrin receptors UNC-5 and UNC-40IDCC in vivo. Genetics. 158(3):1071-1080.

Metin c., Oeleglise O., Serafini T., Kennedy T.E., Tessier-Lavigne M. (1997). A role for netrin-l in the guidance of cortical efTerents. Development. 124(24):5063-5074.

Meyerhardt J.A., Look A.T., Bigner S.H., Fearon E.R. (1997). Identification and characterization of neogenin, a OCC-related gene. Oncogene. 14( 10): 1129-1136.

Meyerhardt J.A., Caca K., Eckstrand B.C., Hu G., Lengauer c., Banavali S., Look A.T., Fearon E.R. (1999). Netrin-I: interaction with deleted in colorectal cancer (DCC) and alterations in brain tumors and neuroblastomas. Cell Growth Differ. 10(1 ):35-42.

Mi S., Lee X., Shao Z., Thill G., Ji B., Rehon J., Levesque M., Allaire N., Perrin S., Sands B., Crowell T., Cate R.L., McCoy J.M., Pepinsky R.B. (2004). LINGO-l is a

153 component of the Nogo-66 receptor/p75 signaling complex. Nat Neurosci. 7(3):221- 228.

Ming G., Song H., Berninger B., Inagaki N., Tessier-Lavigne M., Poo M. (1999). Phospholipase C-gamma and phosphoinositide 3-kinase mediate cytoplasmic signaling in nerve growth cone guidance. Neuron. 23( 1): 139-148.

Ming G., Henley l, Tessier-Lavigne M., Song H., Poo M. (2001). Electrical activity modulates growth cone guidance by diffusible factors. Neuron. 29(2):441-452.

Ming G.L., Song H.J., Berninger B., Holt C.E., Tessier-Lavigne M., Poo M.M. (1997). cAMP-dependent growth cone guidance by netrin-I. Neuron. 19(6): 1225-1235.

Mitchell K.J., Doyle lL., Serafini T., Kennedy T.E., Tessier-Lavigne M., Goodman C.S., Dickson B.J. (1996). Genetic analysis of Netrin genes in Drosophila: Netrins guide CNS commissural axons and peripheral motor axons. Neuron. 17(2):203-215.

Mitchison T.l, Cramer L.P. (1996). Actin-based cell motility and cell locomotion. Cel!. 84(3):371-379.

Mueller B.K. (1999). Growth cone guidance: first steps towards a deeper understanding. Annu Rev Neurosci. 22:351-388.

Mukhopadhyay G., Doherty P., Walsh F.S., Crocker P.R., Filbin M.T. (1994). A novel role for myelin-associated glycoprotein as an inhibitor ofaxonal regeneration. Neuron. 13(3):757-767.

Munro S., Pelham H.R. (1986). An Hsp70-like protein in the ER: identity with the 78 kd glucose-regulated protein and immunoglobulin heavy chain binding protein. Cell. 46(2):291-300.

Murai K.K., Pasquale E.B. (2002). Can Eph receptors stimulate the mind? Neuron. 33(2): 159-162.

Nairn A.c., Hemmings H.C., lr., Greengard P. (1985). Protein kinases in the brain. Annu Rev Biochem. 54:931-976.

Nakashiba T., Ikeda T., Nishimura S., Tashiro K., Honjo T., Culotti l.G., Itohara S. (2000). Netrin-G 1: a novel glycosyl phosphatidylinositol-linked mammalian netrin that is functionally divergent from c1assical netrins. J Neurosci. 20( 17):6540-6550.

Nakashiba T., Nishimura S., Ikeda T., Itohara S. (2002). Complementary expression and neurite outgrowth activity of netrin-G subfamily members. Mech Dev. 111 (1-2):47 -60.

154 Neumann S., WoolfCJ. (1999). Regeneration of dorsal column fibers into and beyond the lesion site following adult spinal cord in jury. Neuron. 23( 1):83-91.

Niederost B., OertIe T., Fritsche 1., McKinney R.A., Bandtlow C.E. (2002). Nogo-A and myelin-associated glycoprotein mediate neurite growth inhibition by antagonistic regulation of RhoA and Rac 1. J Neurosci. 22(23): 10368-1 0376.

Norton W.T., Poduslo S.E. (1973). Myelination in rat brain: method of myelin isolation. J Neurochem. 21(4):749-757.

O'Connor T.P., Duerr J.S., Bentley D. (1990). Pioneer growth cone steering decisions mediated by single filopodial contacts in situ. J Neurosci. 10(12):3935-3946.

Otsuka AJ., Franco R., Yang B., Shim K.H., Tang L.Z., Zhang Y.Y., Boontrakulpoontawee P., Jeyaprakash A., Hedgecock E., Wheaton V.I., . (1995). An ankyrin-related gene (unc-44) is necessary for proper axonal guidance in Caenorhabditis elegans. J Cefl Biol. 129(4): 1081-1 092.

Paxinos G. (1995). The rat nervous system. Academic Press. San Diego.

Pedraza L., Huang 1.K., Colman D.R. (2001). Organizing principles of the axoglial apparatus. Neuron. 30(2):335-344.

Petrausch B., Jung M., Leppert C.A., Stuermer c.A. (2000). Lesion-induced regulation of netrin receptors and modification of netrin-I expression in the retina of fish and grafted rats. Mol Cefl Neurosci. 16(4):350-364.

Pierceall W.E., Reale M.A., Candia A.F., Wright C.V., Cho K.R., Fearon E.R. (1994). Expression of a homologue of the deleted in colorectal cancer (DCC) gene in the nervous system of developing Xenopus embryos. Dev Biol. 166(2):654-665.

Placzek M., Tessier-Lavigne M., Jessell T., Dodd 1. (1990). Orientation of commissural axons in vitro in response to a floor plate-derived chemoattractant. Development. 110(1): 19-30.

Pot c., Simonen M., Weinmann O., Schnell L., Christ F., Stoeckle S., Berger P., Rulicke T., Suter U., Schwab M.E. (2002). Nogo-A expressed in Schwann cells impairs axonal regeneration after peripheral nerve injury. J Cell Biol. 159( 1):29-35.

Prinjha R., Moore S.E., Vinson M., Blake S., Morrow R., Christie G., Michalovich D., Simmons D.L., Walsh F.S. (2000). Inhibitor of neurite outgrowth in humans. Nature. 403(6768):383-384.

155 Przyborski S.A., Knowles B.B., Ackerman S.L. (1998). Embryonic phenotype of Unc5h3 mutant mice suggests chemorepulsion during the formation of the rostral cerebellar boundary. Development. 125(1 ):41-50.

Qiao l, Huang F., Lum H. (2003). PKA inhibits RhoA activation: a protection mechanism against endothelial barrier dysfunction. Am J Physiol Lung Cel! Mol Physiol. 284(6):L972-L980.

Qiu J., Cai D., Dai H., McAtee M., Hoffman P.N., Bregman B.S., Filbin M.T. (2002). Spinal axon regeneration induced by elevation of cyclic AMP. Neuron. 34(6):895-903.

Rajagopalan S., Deitinghoff L., Davis D., Conrad S., Skutella T., Chedotal A., Mueller B.K., Strittmatter S.M. (2004). Neogenin mediates the action of repulsive guidance molecule. Nat Cel! Biol. 6(8):756-762.

Ramon y Cahal S. (1909). Histologie du système nerveux de l'homme & des vertébrés. Consejo Superior de Investigaciones Cientificas. Madrid.

Reale M.A., Hu G., Zafar A.I., Getzenberg R.H., Levine S.M., Fearon E.R. (1994). Expression and alternative splicing of the deleted in colorectal cancer (DCC) gene in normal and malignant tissues. Cancer Res. 54(16):4493-4501.

Reale M.A., Reyes-Mugica M., Pierceall W.E., Rubinstein M.e., Hedrick L., Cohn S.L., Nakagawara A., Brodeur G.M., Fearon E.R. (1996). Loss of DCC expression in neuroblastoma is associated with disease dissemination. Clin Cancer Res. 2(7): 1097- 1102.

Reyes-Mugica M., Rieger-Christ K., Ohgaki H., Ekstrand B.e., Helie M., Kleinman G., Yahanda A., Fearon E.R., Kleihues P., Reale M.A. (1997). Loss of DCC expression and glioma progression. Cancer Res. 57(3):382-386.

Reyes-Mugica M., Lin P., Yokota l, Reale M.A. (1998). Status of deleted in colorectal cancer gene expressIOn correlates with neuroblastoma metastasis. Lab Invest. 78(6):669-675.

Roach A., Takahashi N., Pravtcheva D., Ruddle F., Hood L. (1985). Chromosomal mapping of mouse myelin basic protein gene and structure and transcription of the partially deleted gene in shiverer mutant mice. Cel!. 42( 1): 149-155.

Salbaum lM. (1998). Punc, a novel mouse gene of the immunoglobulin superfamily, is expressed predominantly in the developing nervous system. Mech Dev. 71(1-2):201- 204.

156 Salbaum J.M., Kappen C. (2000). Cloning and expression of nope, a new mouse gene of the immunoglobulin superfamily related to guidance receptors. Genomics. 64(1): 15- 23.

Sandoval A., Ai R., Ostresh J.M., Ogata R.T. (2000). Distal recognition site for c1assical pathway convertase located in the C345C/netrin module of complement component C5. J /mmunol. 165(2):1066-1073.

Sandvig A., Berry M., Barrett L.B., Butt A., Logan A. (2004). Mye\in-, reactive glia-, and scar-derived CNS axon growth inhibitors: expression, receptor signaling, and correlation with axon regeneration. Glia. 46(3):225-251.

Sapirstein V.S., Durrie R., Cherksey B., Beard M.E., Flynn c.J., Fischer 1. (1992). Isolation and characterization of periaxolemmal and axolemmal enriched membrane fractions from the rat central nervous system. J Neurosci Res. 32(4):593-604.

Schachner M., Bartsch U. (2000). Multiple functions of the myelin-associated glycoprotein MAG (siglec-4a) in formation and maintenance of myelin. Glia. 29(2): 154-165.

Schafer M., Fruttiger M., Montag D., Schachner M., Martini R. (1996). Disruption of the gene for the myelin-associated glycoprotein improves axonal regrowth along myelin in C57BL/Wlds mice. Neuron. 16(6):1107-1113.

Scheck A.c., Coons S.W. (1993). Expression of the tumor suppressor gene DCC in human gliomas. Cancer Res. 53(23):5605-5609.

Schwab M.E., Kapthammer J.P., Bandtlow C.E. (1993). Inhibitors ofneurite growth. Annu Rev Neurosci. 16:565-595.

Schwarting G.A., Kostek c., Bless E.P., Ahmad N., Tobet S.A. (2001). De\eted in colorectal cancer (DCC) regulates the migration of luteinizing hormone-releasing hormone neurons to the basal forebrain. J Neurosci. 21(3):911-919.

Serafini T., Kennedy T.E., Galko M.J., Mirzayan c., Jessell T.M., Tessier-Lavigne M. (1994). The netrins define a family ofaxon outgrowth-promoting proteins homologous to C. elegans UNC-6. Cell. 78(3):409-424.

Serafini T., Colamarino S.A., Leonardo E.D., Wang H., Beddington R., Skarnes W.c., Tessier-Lavigne M. (1996). Netrin-I is required for commissural axon guidance in the developing vertebrate nervous system. Cell. 87(6):\001-1014.

157 Shekarabi M., Kennedy T.E. (2002). The netrin-I receptor DCC promotes filopodia formation and cell spreading by activating Cdc42 and Rac 1. Mol Cel! Neurosci. 19(1): 1-17.

Shen H., Illges H., Reuter A., Stuermer C.A. (2002). Cloning, expression, and alternative splicing of neogenin 1 in zebrafish. Mech Dev. 118(1-2):219-223.

Shewan D., Berry M., Cohen 1. (1995). Extensive regeneration in vitro by early embryonic neurons on immature and adult CNS tissue. J Neurosci. 15(3 Pt 1):2057-2062.

Shewan D., Dwivedy A., Anderson R., Holt C.E. (2002). Age-related changes underlie switch in netrin-I responsiveness as growth cones advance along visual pathway. Nat Neurosci. 5( 10):955-962.

Shifman M.I., Selzer M.E. (2000a). Expression of the netrin receptor UNC-5 in lamprey brain: modulation by spinal cord transection. Neurorehabil Neural Repair. 14(1):49- 58.

Shifman M.I., Selzer M.E. (2000b). In situ hybridization in wholemounted lamprey spinal cord: localization of netrin mRNA expression. J Neurosci Methods. 104( 1): 19-25.

Shimeld S. (2000). An amphioxus netrin gene is expressed in midline structures during embryonic and larval development. Dev Genes Evo!' 210(7):337-344.

Shirasaki R., Tamada A., Katsumata R., Murakami F. (1995). Guidance of cerebellofugal axons in the rat embryo: directed growth toward the floor plate and subsequent elongation along the longitudinal axis. Neuron. 14(5):961-972.

Shirasaki R., Mirzayan c., Tessier-Lavigne M., Murakami F. (1996). Guidance of circumferentially growing axons by netrin-dependent and -independent floor plate chemotropism in the vertebrate brain. Neuron. 17(6): 1079-1 088.

Shirasaki R., Katsumata R., Murakami F. (1998). Change in chemoattractant responsiveness ofdeveloping axons at an intermediate target. Science. 279(5347):105- 107.

Sicotte M., Tsatas O., Jeong S.Y., Cai C.Q., He Z., David S. (2003). Immunization with myelin or recombinant Nogo-66/MAG in alum promotes axon regeneration and sprouting after corticospinal tract lesions in the spinal cord. Mol Cel! Neurosci. 23(2):251-263.

158 Siddiqui S.S., Culotti J.G. (1991). Examination of neurons in wild type and mutants of Caenorhabditis elegans using antibodies to horseradish peroxidase. J Neurogenet. 7(4):193-211.

Simonen M., Pedersen V., Weinmann O., Schnell L., Buss A., Ledermann B., Christ F., Sansig G., van der P.H., Schwab M.E. (2003). Systemic deletion of the myelin­ associated outgrowth inhibitor Nogo-A improves regenerative and plastic responses after spinal cord injury. Neuron. 38(2):201-211.

Song H.J., Poo M.M. (1999). Signal transduction underlying growth cone guidance by diffusible factors. Curr Opin Neurobiol. 9(3):355-363.

Srinivasan K., Strickland P., Val des A., Shin G.c., Hinck L. (2003). Netrin-I/neogenin interaction stabilizes multipotent progenitor cap cells during mammary gland morphogenesis. Dev Cell. 4(3):371-382.

Stein E., Zou Y., Poo M., Tessier-Lavigne M. (2001). Binding of DCC by netrin-I to mediate axon guidance independent of adenosine A2B receptor activation. Science. 291(5510): 1976-1982.

Stein E., Tessier-Lavigne M. (2001). Hierarchical organization of guidance receptors: silencing of netrin attraction by slit through a RobolDCC receptor complex. Science. 291(5510): 1928-1938.

Strahle U., Fischer N., Blader P. (1997). Expression and regulation of a netrin homologue in the zebrafish embryo. Mech Dev. 62(2): 147-160.

Su M., Merz D.C., Killeen M.T., Zhou Y., Zheng H., Kramer J.M., Hedgecock E.M., Culotti J.G. (2000). Regulation of the UNC-5 netrin receptor initiates the first reorientation of migrating distal tip cells in Caenorhabditis elegans. Development. 127(3):585-594.

Sugimoto Y., Taniguchi M., Vagi T., Akagi Y., Nojyo Y., Tamamaki N. (2001). Guidance of glial precursor cell migration by secreted cues in the developing optic nerve. Development. 128( 17):3321-3330.

Suter D.M., Forscher P. (1998). An emerging link between cytoskeletal dynamics and cell adhesion molecules in growth cone guidance. Curr Opin Neurobiol. 8( 1): 106-116.

Tanaka E., Sabry J. (1995). Making the connection: cytoskeletal rearrangements during growth cone guidance. Cell. 83(2): 171-176.

159 Tanaka K., Oshimura M., Kikuchi R., Seki M., Hayashi T., Miyaki M. (1991). Suppression of tumorigenicity in human colon carcinoma cells by introduction of normal chromosome 5 or 18. Nature. 349(6307):340-342.

Tessier-Lavigne M., Placzek M., Lumsden A.G., Dodd 1., Jessell T.M. (1988). Chemotropic guidance of developing axons in the mammalian central nervous system. Nature. 336(6201):775-778.

Tessier-Lavigne M., Goodman e.S. (1996). The molecular biology ofaxon guidance. Science. 274(5290): 1123-1133.

Thiagalingam S., Lengauer e., Leach F.S., Schutte M., Hahn S.A., Overhauser 1., Willson 1.K., Markowitz S., Hamilton S.R., Kern S.E., Kinzler K.W., Vogelstein B. (1996). Evaluation of candidate tumour suppressor genes on chromosome 18 in colorectal cancers. Nat Genet. 13(3):343-346.

Thompson K.M., Uetani N., Manitt e., Elchebly M., Tremblay M.L., Kennedy T.E. (2003). Receptor protein tyrosine phosphatase sigma inhibits axonal regeneration and the rate ofaxon extension. Mol Cell Neurosei. 23(4):681-692.

Timpl R., Brown 1.e. (1994). The laminins. Matrix Biol. 14(4):275-281.

Tong 1., Killeen M., Steven R., Binns K.L., Culotti 1., Pawson T. (2001). Netrin stimulates tyrosine phosphorylation of the UNC-5 family of netrin receptors and induces Shp2 binding to the RCM cytodomain. J Biol Chem. 276(44):40917-40925.

Trapp B.D., Quarles R.H. (1984). Immunocytochemical localization of the myelin­ associated glycoprotein. Fact or artifact? J Neuroimmunol. 6(4):231-249.

Trapp B.D., Bernier L., Andrews S.B., Colman D.R. (1988). Cellular and subcellular distribution of 2',3'-cyclic nucleotide 3'-phosphodiesterase and its mRNA in the rat central nervous system. J Neuroehem. 51(3):859-868.

Trapp B.D. (1990). Myelin-associated glycoprotein. Location and potential functions. Ann N y Aead Sei. 605:29-43.

Tsai H.H., Tessier-Lavigne M., Miller R.H. (2003). Netrin 1 mediates spinal cord oligodendrocyte precursor dispersal. Development. 130( 10):2095-21 05.

Turnley A.M., Bartlett P.F. (1998). MAG and MOG enhance neurite outgrowth of embryonic mouse spinal co rd neurons. Neuroreport. 9(9): 1987 -1990.

160 Van Raay T.1., Foskett S.M., Connors T.D., Klinger K.W., Landes G.M., Bum T.c. (1997). The NTN2L gene encoding a novel human netrin maps to the autosomal dominant polycystic kidney disease region on chromosome 16pI3.3. Genomics. 41(2):279-282.

Varela-Echavarria A., Tucker A., Puschel A.W., Guthrie S. (1997). Motor axon subpopulations respond differentially to the chemorepellents netrin-I and semaphorin o. Neuron. 18(2): 193-207.

Vie1metter l, Kayyem lF., Roman lM., Dreyer W.1. (1994). Neogenin, an avian cell surface prote in expressed during terminal neuronal differentiation, is c10sely related to the human tumor suppressor molecule deleted in colorectal cancer. J Cell Biol. 127(6 Pt 2):2009-2020.

Vielmetter l, Chen X.N., Miskevich F., Lane R.P., Yamakawa K., Korenberg lR., Dreyer W.1. (1997). Molecular characterization of human neogenin, a OCC-related protein, and the mapping of its gene (NEO 1) to chromosomal position 15q22.3-q23. Genomics. 41(3):414-421.

Vogel U.S., Thompson R.1. (1988). Molecular structure, localization, and possible functions of the myelin-associated enzyme 2',3'-cyclic nucleotide 3'-phosphodiesterase. J Neurochem. 50(6):1667-1677.

Volenec A., Bhogal R.K., Moorman J.M., Leslie R.A., Flanigan T.P. (1997). DifferentiaI expression of DCC mRNA in adult rat forebrain. Neuroreport. 8(13):2913-2917.

Volenec A., Zetterstrom T.S., Flanigan T.P. (1998). 6-0HOA denervation substantially decreases DCC mRNA levels in rat substantia nigra compacta. Neuroreport. 9( 16):3553-3556.

Wada 1., Rindress O., Cameron P.H., Ou W.1., Ooherty 1.1., Louvard O., Bell A.W., Oignard O., Thomas O.Y., Bergeron 1.1. (1991). SSR alpha and associated calnexin are major calcium binding proteins of the endoplasmic reticulum membrane. J Biol Chem. 266(29): 19599-1961 O.

Wadsworth W.G., Bhatt H., Hedgecock E.M. (1996). Neuroglia and pioneer neurons express UNC-6 to provide global and local netrin cues for guiding migrations in C. elegans. Neuron. 16(1 ):35-46.

Wang H., Copeland N.G., Gilbert 0.1., Jenkins N.A., Tessier-Lavigne M. (1999). Netrin- 3, a mouse homolog of human NTN2L, is highly expressed in sensory ganglia and shows differential binding to netrin receptors. J Neurosci. 19(12):4938-4947.

161 Wang K.C., Koprivica V., Kim J.A., Sivasankaran R., Guo Y., Neve R.L., He Z. (2002a). Oligodendrocyte-myelin glycoprotein is a Nogo receptor ligand that inhibits neurite outgrowth. Nature. 417(6892):941-944.

Wang K.C., Kim J.A., Sivasankaran R., Segal R., He Z. (2002b). P75 interacts with the Nogo receptor as a co-receptor for Nogo, MAG and OMgp. Nature. 420(6911 ):74-78.

Weber A. (1938). Croissance des fibres nerveuses commissurales lors de les ions de la moelle epiniere chez de jeunes embyons de poulet.

Weiss 1., Takizawa B., McGee A., Stewart W.B., Zhang H., Ment L., Schwartz M., Strittmatter S. (2004). Neonatal hypoxia suppresses oligodendrocyte Nogo-A and increases axonal sprouting in a rodent mode! for human prematurity. Exp Neurol. 189(1):141-149.

Williams M.E., Wu S.c., McKenna W.L., Hinck L. (2003). Surface expression of the netrin receptor UNC5H 1 is regulated through a protein kinase C-interacting protein/protein kinase-dependent mechanism. J Neurosci. 23(36): 11279-11288.

Wills Z., Bateman J., Korey C.A., Corner A., Van V.O. (1999). The tyrosine kinase Abl and its substrate enabled collaborate with the receptor phosphatase Olar to control motor axon guidance. Neuron. 22(2):301-312.

Winberg M.L., Mitchell K.J., Goodman C.S. (1998). Genetic analysis of the mechanisms controlling target selection: complementary and combinatorial functions of netrins, semaphorins, and IgCAMs. Cell. 93(4):581-591.

Wong S.T., Henley 1.R., Kanning K.C., Huang K.H., Bothwell M., Poo M.M. (2002). A p75(NTR) and Nogo receptor complex mediates repulsive signaling by mye!in­ associated glycoprotein. Nat Neurosci. 5( 12): 1302-1308.

Yamashita H., Avraham S., Jiang S., Oikic 1., Avraham H. (1999). The Csk homologous kinase associates with TrkA receptors and is involved in neurite outgrowth of PC 12 cells. J Biol Chem. 274(21): 15059-15065.

Yamashita T., Tucker K.L., Barde Y.A. (1999). Neurotrophin binding to the p75 receptor modulates Rho activity and axonal outgrowth. Neuron. 24(3):585-593.

Yamashita T., Higuchi H., Tohyama M. (2002). The p75 receptor transduces the signal from myelin-associated glycoprotein to Rho. J Cell Biol. 157(4):565-570.

Yamashita T., Tohyama M. (2003). The p75 receptor acts as a displacement factor that releases Rho from Rho-GOI. Nat Neurosci. 6(5):461-467.

162 Yebra M., Montgomery A.M., Diaferia G.R., Kaido T., Silletti S., Perez B., Just M.L., Hildbrand S., Hurford R., Florkiewicz E., Tessier-Lavigne M., Cirulli V. (2003). Recognition of the neural chemoattractant Netrin-I by integrins alpha6beta4 and alpha3betal regulates epithelial cell adhesion and migration. Dev Cel!. 5(5):695-707.

Yee K.T., Simon H.H., Tessier-Lavigne M., O'Leary D.M. (1999). Extension of long leading processes and neuronal migration in the mammalian brain directed by the chemoattractant netrin-I. Neuron. 24(3):607-622.

Yin X., Peterson J., Gravel M., Braun P.E., Trapp B.D. (1997). CNP overexpression induces aberrant oligodendrocyte membranes and inhibits MBP accumulation and myelin compaction. J Neurosci Res. 50(2):238-247.

Yin Y., Sanes J.R., Miner J.H. (2000). Identification and expression of mouse netrin-4. Mech Dev. 96(1): 115-119.

Yu T. W., Bargmann C. 1. (2001). Dynamic regulation ofaxon guidance. Nat Neurosci. 4 Suppl: 1169-1176.

Zheng B., Ho c., Li S., Keirstead H., Steward O., Tessier-Lavigne M. (2003). Lack of enhanced spinal regeneration in Nogo-deficient mice. Neuron. 38(2):213-224.

Zhou F.Q., Waterman-Storer C.M., Cohan C.S. (2002). Focal loss of actin bundles causes microtubule redistribution and growth cone tuming. J Cel! Biol. 157(5):839-849.

Zou Y., Stoeckli E., Chen H., Tessier-Lavigne M. (2000). Squeezing axons out of the gray matter: a role for slit and semaphorin proteins from midline and ventral spinal cord. Cell. 102(3):363-375.

163