DOCSLIB.ORG

Finale Inauguraldissertation Cla

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Finale Inauguraldissertation Cla Aus dem Interfakultären Institut für Zellbiologie der Universität Tübingen Abteilung Immunologie Kartierung des HLA-Ligandoms der akuten myeloischen Leukämie zur Entwicklung einer therapeutischen Multipeptidvakzine Inaugural–Disseration zur Erlangung des Doktorgrades der Medizin der Medizinischen Fakultät der Eberhard Karls Universität zu Tübingen vorgelegt von Berlin, Anne Claudia 2018 Dekan: Professor Dr. med. I. B. Autenrieth 1. Berichterstatter: Prof. Dr. S. Stevanovic 2. Berichterstatter: Privatdozent Dr. A. Yazdi 3. Berichterstatter: Professor Dr. P. Brossart Tag der Disputation: 25/04/2018 Meiner Familie Inhaltsverzeichnis Inhaltsverzeichnis Abbildungsverzeichnis: ............................................................................................................ III Tabellenverzeichnis: .................................................................................................................. V Abkürzungsverzeichnis: ......................................................................................................... VII 1 Einleitung ............................................................................................................................ 1 1.1 Zusammenspiel zwischen Tumorgenese und Immunsystem ......................................... 1 1.2 Immunologische Grundlagen ....................................................................................... 2 1.2.1 T-Lmphozyten ......................................................................................................... 4 1.2.2 Major Histokompatibilitätskomplex (MHC)/Humanes Leukozytenantigen (HLA) 6 1.3 Tumorantigene ........................................................................................................... 10 1.4 Krebsimmuntherapie .................................................................................................. 14 1.5 Akute myeloische Leukämie (AML) ........................................................................... 17 1.5.1 Ätiologie ................................................................................................................ 18 1.5.2 Pathogenese: .......................................................................................................... 19 1.5.3 Risikofaktoren: ...................................................................................................... 21 1.5.4 Klinik: .................................................................................................................... 22 1.5.5 Diagnostik ............................................................................................................. 23 1.5.6 Therapie ................................................................................................................. 24 1.5.7 Prognose: ............................................................................................................... 33 1.6 Ziele der vorliegenden Arbeit .................................................................................... 34 2 Material und Methoden ................................................................................................... 36 2.1 Material ..................................................................................................................... 36 2.1.1 Reagenzien, Verbrauchsmaterial, Geräte .............................................................. 36 2.1.2 Zusammensetzung von Puffern und Medien ......................................................... 39 2.2 Patienten- und Spendercharakteristiken .................................................................... 40 Methoden ................................................................................................................................ 47 2.2.1 Allgemeine, zellbiologische Methoden ................................................................. 47 2.2.2 Quantifizierung der HLA-Oberflächenmolekülexpression ................................... 48 2.2.3 Methoden zur qualitativen HLA-Ligandomanalyse .............................................. 49 2.2.4 Peptidsynthese ....................................................................................................... 52 2.2.5 Methoden der T-Zellkultivierung und funktionellen Charakterisierung ............... 53 2.2.6 Software und statistische Analyse ......................................................................... 55 2.2.7 Quantitative Bestimmung der WT-mRNA Expression ......................................... 56 3 Ergebnisse ......................................................................................................................... 57 3.1 Quantitative HLA-Ligandomanalyse ......................................................................... 57 3.2 Qualitative HLA-Ligandomanalyse ........................................................................... 63 3.2.1 LC-MS/MS basierte Identifikation natürlich präsentierter HLA-Klasse-I- & -II- Liganden maligner und benigner granulo- und monozytärer Zellen .................................. 63 3.2.2 Vergleichende Analysen des HLA-Klasse-I-Ligandoms ...................................... 67 3.2.3 Identifikation natürlich präsentierter HLA-Klasse-I-Liganden etablierter AML- assoziierter Antigene .......................................................................................................... 72 3.2.4 Subgruppen-spezifischer Vergleich des HLA-Ligandoms von FLT3-ITD Mutationsträgern und FLT3-wildtypischen Patienten ........................................................ 78 3.3 Funktionelle T-Zell-Analysen zur orientierenden Charakterisierung des immunogenen Potentials exemplarisch ausgewählter HLA-Klasse-I-LiTAPs ........................ 82 3.4 Qualitative HLA-Analyse des HLA-Klasse-II-Ligandoms ......................................... 92 3.5 Funktionelle T-Zell-Analysen zur orientierenden Charakterisierung des immunogenen Potentials exemplarisch ausgewählter HLA-Klasse-II-LiTAPs .................... 101 I Inhaltsverzeichnis 4 Diskussion ........................................................................................................................ 104 4.1 Diskussion der HLA-Klasse-I-Ligandomanalyse ..................................................... 105 4.1.1 Diskussion der Ergebnisse der quantitativen HLA-Ligandomanalyse ................ 105 4.1.2 Diskussion der Ergebnisse qualitativen Ligandom-Analyse ............................... 107 4.1.3 Diskussion der Ergebnisse der Analysen zum immunogenen Potential ausgewählter Peptide ........................................................................................................ 115 4.2 Diskussion der HLA-Klasse II-Ligandomanalysen .................................................. 121 4.3 Auf dem Weg zur therapeutischen Anwendung und Ausblick .................................. 123 4.3.1 Interaktion einer Zytostatikabehandlung mit dem Immunpeptidom ................... 124 4.3.2 Kartierung des Immunopeptidom der Leukämie-Stammzellen ........................... 125 4.3.3 Neoantigene ......................................................................................................... 127 4.3.4 Tumormikromilieu: Immunsuppression & -evasion ........................................... 129 5 Zusammenfassung .......................................................................................................... 134 6 Anhang ................................................................................................................................. i 7 Literaturverzeichnis .......................................................................................................... iv 8 Erklärung zum Eigenanteil der Dissertationsschrift................................................ xxviii 9 Veröffentlichungen ........................................................................................................ xxix 10 Danksagung ..................................................................................................................... xxx 11 Lebenslauf ....................................................................... Fehler! Textmarke nicht definiert. II Abbildungsverzeichnis Abbildungsverzeichnis: Abbildung 1.1: Graphische, schematische Darstellung der Antigenbelandung von MHC- Klasse-I-Molekülen 9 Abbildung 1.2: Modellvorstellung der Entstehung und Regulation einer anti-Tumor- Antwort 14 Abbildung 3.1: Durchflusszytometrie-basierte Quantifizierungsergebnisse für Kalibrierungsbeads 58 Abbildung 3.2: FACS-basierte quantitative Analyse der HLA-Klasse-I &-II Molekülexpression/Zelle für maligne myeloische Vorläuferzellen sowie autologe benigne, ausgereifte granulo- und monozytäre Zellen für AML 18. 59 Abbildung 3.3: quantitative Analyse der HLA-Klasse-I-Oberflächenexpression für fünf AML-Patienten basierend auf der HLA-Klasse-I-Expression (W6/32 mAb) für AML-Blasten (CD34+) und autologe, benigne Zellen (CD15+) 60 Abbildung 3.4: quantitative Analyse der HLA-Klasse-II-Oberflächenexpression für fünf AML-Patienten basierend auf der HLA-Klasse-DR-Expression (L243 mAb) für AML-Blasten (CD34+) und autologe, benigne Zellen (CD15+) 61 Abbildung 3.5: Darstellung der mittleren HLA-Klasse-I-Expression (links) und HLA- Klasse-II-Expression (rechts) für CD34+AML-Blasten im Vergleich CD15+ autologen, benignen Zellen 61 Abbildung 3.6: Vergleich der mittleren HLA-Klasse-I-Expression (links; W6/32mAb) und HLA-Klasse-II-Expression (rechts; L243mAb) von CD34+ AML-Blasten und benignen, hämatopoetischen Vorläuferzellen (CD34+, CD38-) freiwilliger gesunder Spender 62 Abbildung
Load more

Recommended publications
  • Evidence for Differential Alternative Splicing in Blood of Young Boys With
    Stamova et al. Molecular Autism 2013, 4:30 http://www.molecularautism.com/content/4/1/30 RESEARCH Open Access Evidence for differential alternative splicing in blood of young boys with autism spectrum disorders Boryana S Stamova1,2,5*, Yingfang Tian1,2,4, Christine W Nordahl1,3, Mark D Shen1,3, Sally Rogers1,3, David G Amaral1,3 and Frank R Sharp1,2 Abstract Background: Since RNA expression differences have been reported in autism spectrum disorder (ASD) for blood and brain, and differential alternative splicing (DAS) has been reported in ASD brains, we determined if there was DAS in blood mRNA of ASD subjects compared to typically developing (TD) controls, as well as in ASD subgroups related to cerebral volume. Methods: RNA from blood was processed on whole genome exon arrays for 2-4–year-old ASD and TD boys. An ANCOVA with age and batch as covariates was used to predict DAS for ALL ASD (n=30), ASD with normal total cerebral volumes (NTCV), and ASD with large total cerebral volumes (LTCV) compared to TD controls (n=20). Results: A total of 53 genes were predicted to have DAS for ALL ASD versus TD, 169 genes for ASD_NTCV versus TD, 1 gene for ASD_LTCV versus TD, and 27 genes for ASD_LTCV versus ASD_NTCV. These differences were significant at P <0.05 after false discovery rate corrections for multiple comparisons (FDR <5% false positives). A number of the genes predicted to have DAS in ASD are known to regulate DAS (SFPQ, SRPK1, SRSF11, SRSF2IP, FUS, LSM14A). In addition, a number of genes with predicted DAS are involved in pathways implicated in previous ASD studies, such as ROS monocyte/macrophage, Natural Killer Cell, mTOR, and NGF signaling.
    [Show full text]
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • A Systematic Benchmark of Nanopore Long Read RNA Sequencing for Transcript Level Analysis in Human Cell Lines
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.21.440736; this version posted April 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. A systematic benchmark of Nanopore long read RNA sequencing for transcript level analysis in human cell lines Authors: Ying Chen1, Nadia M. Davidson2,3, Yuk Kei Wan1, Harshil Patel4, Fei Yao1, Hwee Meng Low1, Christopher Hendra1,5, Laura Watten1, Andre Sim1, Chelsea Sawyer4, Viktoriia Iakovleva1,6, Puay Leng Lee1, Lixia Xin1, Hui En Vanessa Ng7, Jia Min Loo1, Xuewen Ong8, Hui Qi Amanda Ng1, Jiaxu Wang1, Wei Qian Casslynn Koh1, Suk Yeah Polly Poon1, Dominik Stanojevic1,9, Hoang-Dai Tran1, Kok Hao Edwin Lim1, Shen Yon Toh10, Philip Andrew Ewels11, Huck-Hui Ng1, N.Gopalakrishna Iyer10,12, Alexandre Thiery13, Wee Joo Chng6,7,14, Leilei Chen7,15, Ramanuj DasGupta1, Mile Sikic1,9, Yun-Shen Chan1, Boon Ooi Patrick Tan1,7,8, Yue Wan1, Wai Leong Tam1,7,16,17, Qiang Yu1, Chiea Chuan Khor1,12,18, Torsten Wüstefeld1,10,14, Ploy N. Pratanwanich1,19,20, Michael I. Love21,22, Wee Siong Sho Goh1, 23, Sarah B. Ng1, Alicia Oshlack2,24, Jonathan Göke1,10*, SG-NEx consortium Affiliations: 1.Genome Institute of Singapore, Singapore, Singapore 2.Peter MacCallum Cancer Centre, Melbourne, VIC, Australia 3.School of BioSciences, The University of Melbourne, Parkville, Victoria, Australia 4.Bioinformatics and Biostatistics, The
    [Show full text]
  • Plasma Microrna Profile in Canine Appendicular Osteosarcoma Patients
    Plasma microRNA Profile in Canine Appendicular Osteosarcoma Patients by Michael Edson A Thesis presented to The University of Guelph In partial fulfilment of requirements for the degree of Master of Science in Pathobiology Guelph, Ontario, Canada © Michael Edson, September, 2019 ABSTRACT PLASMA MICRORNA PROFILE IN CANINE APPENDICULAR OSTEOSARCOMA PATIENTS Michael Edson Advisor: University of Guelph, 2019 Dr. Geoffrey Wood Osteosarcoma (OSA) is the most common primary bone tumor in dogs. The standard of care for canine appendicular OSA involves amputation followed by chemotherapy. Currently, there are no established biomarkers to determine which dogs benefit the most from chemotherapy. MicroRNAs (miRNAs) are small non-coding RNAs that are potential biomarkers of osteosarcoma. Plasma miRNA levels were profiled in healthy dogs and OSA patients, collected before and after amputation. Quantitative real-time PCR was conducted to determine the levels of 277 miRNAs on a miRNome PCR array. From these findings, a custom PCR array was designed and used to examine miRNA levels and correlations to clinical outcome in 20 control and 28 OSA cases. Additionally, miRNA levels in erythrocytes were analyzed. Overall, 37 plasma miRNAs and 1 erythrocyte miRNA had significant level changes. Furthermore, 24 plasma miRNAs were correlated to clinical outcome. These miRNAs could improve decision making in treatments for OSA patients. iii ACKNOWLEDGEMENTS I’d like to thank my advisor, Dr. Geoffrey Wood, as well as my committee members, Dr. Anthony Mutsaers, Dr. Alicia Viloria-Petit, and Dr. R. Darren Wood for their advice and guidance on this project. Many thanks to Mary Ellen Clark, Dr. Karlee Craig, Gabhan Chalmers and Leah Read for their technical assistance and advice in the laboratory.
    [Show full text]
  • Supplementary Table 1 Double Treatment Vs Single Treatment
    Supplementary table 1 Double treatment vs single treatment Probe ID Symbol Gene name P value Fold change TC0500007292.hg.1 NIM1K NIM1 serine/threonine protein kinase 1.05E-04 5.02 HTA2-neg-47424007_st NA NA 3.44E-03 4.11 HTA2-pos-3475282_st NA NA 3.30E-03 3.24 TC0X00007013.hg.1 MPC1L mitochondrial pyruvate carrier 1-like 5.22E-03 3.21 TC0200010447.hg.1 CASP8 caspase 8, apoptosis-related cysteine peptidase 3.54E-03 2.46 TC0400008390.hg.1 LRIT3 leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 1.86E-03 2.41 TC1700011905.hg.1 DNAH17 dynein, axonemal, heavy chain 17 1.81E-04 2.40 TC0600012064.hg.1 GCM1 glial cells missing homolog 1 (Drosophila) 2.81E-03 2.39 TC0100015789.hg.1 POGZ Transcript Identified by AceView, Entrez Gene ID(s) 23126 3.64E-04 2.38 TC1300010039.hg.1 NEK5 NIMA-related kinase 5 3.39E-03 2.36 TC0900008222.hg.1 STX17 syntaxin 17 1.08E-03 2.29 TC1700012355.hg.1 KRBA2 KRAB-A domain containing 2 5.98E-03 2.28 HTA2-neg-47424044_st NA NA 5.94E-03 2.24 HTA2-neg-47424360_st NA NA 2.12E-03 2.22 TC0800010802.hg.1 C8orf89 chromosome 8 open reading frame 89 6.51E-04 2.20 TC1500010745.hg.1 POLR2M polymerase (RNA) II (DNA directed) polypeptide M 5.19E-03 2.20 TC1500007409.hg.1 GCNT3 glucosaminyl (N-acetyl) transferase 3, mucin type 6.48E-03 2.17 TC2200007132.hg.1 RFPL3 ret finger protein-like 3 5.91E-05 2.17 HTA2-neg-47424024_st NA NA 2.45E-03 2.16 TC0200010474.hg.1 KIAA2012 KIAA2012 5.20E-03 2.16 TC1100007216.hg.1 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 7.43E-03 2.15 TC0400012977.hg.1 SH3D19
    [Show full text]
  • Full Genome Analysis of Microglial Activation; Ramifications of Trem2
    UNIVERSITY COLLEGE LONDON UCL INSTITUTE OF NEUROLOGY Department of Molecular Neuroscience FULL GENOME ANALYSIS OF MICROGLIAL ACTIVATION; RAMIFICATIONS OF TREM2 Thesis submitted for the degree of Doctor of Philosophy By, Claudio N Villegas Llerena 2017 Supervisors, Prof John Hardy Dr Jennifer Pocock DECLARATION I, Claudio Nicolas Villegas Llerena, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 ABSTRACT Neuroinflammation is a pathological hallmark of Alzheimer's disease (AD) and it is well established that microglia, the brain's resident phagocytes, are pivotal for the immune response observed in AD. In the healthy brain, microglia attack and remove pathogens and cell debris, but have been shown to become reactive in AD. An apparent link between microglia and AD is Amyloid β (Aβ), which accumulates in the plaques observed in the brains of AD patients and has been reported as a microglia activator. Genome Wide Association Studies (GWAS) have allowed the identification of more than 20 genetic risk associations to AD. Many of these associations highlight the importance of immune pathways (and others) in AD. More recently, the identification of mutations in TREM2 (Triggering Receptor Expressed on Myeloid Cells 2), a gene exclusively expressed by microglia in the brain, has brought microglial activation and dysfunction back to the attention of the AD community. The main focus of this study is to understand microglial activation elicited by different stimuli -including Aβ1-42 monomers, oligomers and fibrils- with regards to their inflammatory activation status (M1, M2 or other) and whole-genome expression profile.
    [Show full text]
  • Autocrine IFN Signaling Inducing Profibrotic Fibroblast Responses By
    Downloaded from http://www.jimmunol.org/ by guest on September 23, 2021 Inducing is online at: average * The Journal of Immunology , 11 of which you can access for free at: 2013; 191:2956-2966; Prepublished online 16 from submission to initial decision 4 weeks from acceptance to publication August 2013; doi: 10.4049/jimmunol.1300376 http://www.jimmunol.org/content/191/6/2956 A Synthetic TLR3 Ligand Mitigates Profibrotic Fibroblast Responses by Autocrine IFN Signaling Feng Fang, Kohtaro Ooka, Xiaoyong Sun, Ruchi Shah, Swati Bhattacharyya, Jun Wei and John Varga J Immunol cites 49 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130037 6.DC1 This article http://www.jimmunol.org/content/191/6/2956.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 23, 2021. The Journal of Immunology A Synthetic TLR3 Ligand Mitigates Profibrotic Fibroblast Responses by Inducing Autocrine IFN Signaling Feng Fang,* Kohtaro Ooka,* Xiaoyong Sun,† Ruchi Shah,* Swati Bhattacharyya,* Jun Wei,* and John Varga* Activation of TLR3 by exogenous microbial ligands or endogenous injury-associated ligands leads to production of type I IFN.
    [Show full text]
  • Márcio Lorencini Avaliação Global De Transcritos Associados Ao Envelhecimento Da Epiderme Humana Utilizando Microarranjos De
    MÁRCIO LORENCINI AVALIAÇÃO GLOBAL DE TRANSCRITOS ASSOCIADOS AO ENVELHECIMENTO DA EPIDERME HUMANA UTILIZANDO MICROARRANJOS DE DNA GLOBAL EVALUATION OF TRANSCRIPTS ASSOCIATED TO HUMAN EPIDERMAL AGING WITH DNA MICROARRAYS CAMPINAS 2014 i ii UNIVERSIDADE ESTADUAL DE CAMPINAS Instituto de Biologia MÁRCIO LORENCINI AVALIAÇÃO GLOBAL DE TRANSCRITOS ASSOCIADOS AO ENVELHECIMENTO DA EPIDERME HUMANA UTILIZANDO MICROARRANJOS DE DNA GLOBAL EVALUATION OF TRANSCRIPTS ASSOCIATED TO HUMAN EPIDERMAL AGING WITH DNA MICROARRAYS Tese apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do título de Doutor em Genética e Biologia Molecular, na área de Genética Animal e Evolução. Thesis presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Doctor in Genetics and Molecular Biology, in the area of Animal Genetics and Evolution. Orientador/Supervisor: PROF. DR. NILSON IVO TONIN ZANCHIN ESTE EXEMPLAR CORRESPONDE À VERSÃO FINAL DA TESE DEFENDIDA PELO ALUNO MÁRCIO LORENCINI, E ORIENTADA PELO PROF. DR. NILSON IVO TONIN ZANCHIN. ________________________________________ Prof. Dr. Nilson Ivo Tonin Zanchin CAMPINAS 2014 iii iv COMISSÃO JULGADORA 31 de janeiro de 2014 Membros titulares: Prof. Dr. Nilson Ivo Tonin Zanchin (Orientador) __________________________ Assinatura Prof. Dr. José Andrés Yunes __________________________ Assinatura Profa. Dra. Maricilda Palandi de Mello __________________________ Assinatura Profa. Dra. Bettina
    [Show full text]
  • A Meta-Analysis of the Effects of High-LET Ionizing Radiations in Human Gene Expression
    Supplementary Materials A Meta-Analysis of the Effects of High-LET Ionizing Radiations in Human Gene Expression Table S1. Statistically significant DEGs (Adj. p-value < 0.01) derived from meta-analysis for samples irradiated with high doses of HZE particles, collected 6-24 h post-IR not common with any other meta- analysis group. This meta-analysis group consists of 3 DEG lists obtained from DGEA, using a total of 11 control and 11 irradiated samples [Data Series: E-MTAB-5761 and E-MTAB-5754]. Ensembl ID Gene Symbol Gene Description Up-Regulated Genes ↑ (2425) ENSG00000000938 FGR FGR proto-oncogene, Src family tyrosine kinase ENSG00000001036 FUCA2 alpha-L-fucosidase 2 ENSG00000001084 GCLC glutamate-cysteine ligase catalytic subunit ENSG00000001631 KRIT1 KRIT1 ankyrin repeat containing ENSG00000002079 MYH16 myosin heavy chain 16 pseudogene ENSG00000002587 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 ENSG00000003056 M6PR mannose-6-phosphate receptor, cation dependent ENSG00000004059 ARF5 ADP ribosylation factor 5 ENSG00000004777 ARHGAP33 Rho GTPase activating protein 33 ENSG00000004799 PDK4 pyruvate dehydrogenase kinase 4 ENSG00000004848 ARX aristaless related homeobox ENSG00000005022 SLC25A5 solute carrier family 25 member 5 ENSG00000005108 THSD7A thrombospondin type 1 domain containing 7A ENSG00000005194 CIAPIN1 cytokine induced apoptosis inhibitor 1 ENSG00000005381 MPO myeloperoxidase ENSG00000005486 RHBDD2 rhomboid domain containing 2 ENSG00000005884 ITGA3 integrin subunit alpha 3 ENSG00000006016 CRLF1 cytokine receptor like
    [Show full text]
  • Submicroscopic Deletion Involving the Fibroblast Growth Factor Receptor 1 Gene in a Patient with Combined Pituitary Hormone Deficiency
    Endocrine Journal 2013, 60 (8), 1013-1020 NOTE Submicroscopic deletion involving the fibroblast growth factor receptor 1 gene in a patient with combined pituitary hormone deficiency Maki Fukami1)*, Manami Iso1)*, Naoko Sato1), Maki Igarashi1), Misuzu Seo2), Itsuro Kazukawa3), Eiichi Kinoshita4), Sumito Dateki1), 4) and Tsutomu Ogata1), 5) 1) Department of Molecular Endocrinology, National Research Institute for Child Health and Development, Tokyo 157-8535, Japan 2) Department of Molecular Bioscience, Faculty of Life Sciences, Kyoto Sangyo University, Kyoto 603-8555, Japan 3) Department of Endocrinology, Chiba Children’s Hospital, Chiba 266-0007, Japan 4) Department of Pediatrics, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki 852-8501, Japan 5) Department of Pediatrics, Hamamatsu University School of Medicine, Hamamatsu 431-3192, Japan Abstract. Combined pituitary hormone deficiency (CPHD), isolated hypogonadotropic hypogonadism (IHH), Kallmann syndrome (KS), and septo-optic dysplasia (SOD) are genetically related conditions caused by abnormal development of the anterior midline in the forebrain. Although mutations in the fibroblast growth factor receptor 1 (FGFR1) gene have been implicated in the development of IHH, KS, and SOD, the relevance of FGFR1 abnormalities to CPHD remains to be elucidated. Here, we report a Japanese female patient with CPHD and FGFR1 haploinsufficiency. The patient was identified through copy-number analyses and direct sequencing of FGFR1 performed for 69 patients with CPHD. The patient presented with a combined deficiency of GH, LH and FSH, and multiple neurological abnormalities. In addition, normal TSH values along with a low free T4 level indicated the presence of central hypothyroidism. Molecular analyses identified a heterozygous ~8.5 Mb deletion involving 56 genes and pseudogenes.
    [Show full text]
  • An Investigation Into the Utility of Guilt by Association Machine Learning Algorithms for the Prioritization of Autism Spectrum Disorder Candidate Risk Genes
    An investigation into the utility of guilt by association machine learning algorithms for the prioritization of autism spectrum disorder candidate risk genes by Margot Patricia Rainbow Gunning B.Sc.H, Queen’s University, 2017 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The Faculty of Graduate and Postdoctoral Studies (Bioinformatics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) December 2019 © Margot Patricia Rainbow Gunning, 2019 The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, a thesis/dissertation entitled: An investigation into the utility of guilt by association machine learning algorithms for the prioritization of autism spectrum disorder risk genes submitted Margot Patricia Rainbow in partial fulfillment of the requirements by Gunning for the degree of Master of Science in Bioinformatics Examining Committee: Paul Pavlidis, Michael Smith Laboratories/Psychiatry Supervisor Kurt Haas, Cellular and Physiological Sciences Supervisory Committee Member Elodie Portales-Casamar, Clinical Research Informatics Lead, BCCHR Supervisory Committee Member Joerg Gsponer, Biochemistry/Molecular Biology Additional Examiner ii Abstract Autism spectrum disorder (ASD) is a neurodevelopmental disorder characterized by impairments in social interaction and communication, and restrictive repetitive behaviours or interests, with extreme phenotypic and genetic heterogeneity. Currently, genetic association studies
    [Show full text]