DOCSLIB.ORG

Glycogen Synthase Kinase-3 Protein

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Glycogen Synthase Kinase-3 Protein The B Cell Antigen Receptor Regulates the Transcriptional Activator β-Catenin Via Protein Kinase C-Mediated Inhibition of Glycogen Synthase Kinase-3 This information is current as of October 1, 2021. Sherri L. Christian, Peter V. Sims and Michael R. Gold J Immunol 2002; 169:758-769; ; doi: 10.4049/jimmunol.169.2.758 http://www.jimmunol.org/content/169/2/758 Downloaded from References This article cites 77 articles, 43 of which you can access for free at: http://www.jimmunol.org/content/169/2/758.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on October 1, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2002 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology The B Cell Antigen Receptor Regulates the Transcriptional Activator ␤-Catenin Via Protein Kinase C-Mediated Inhibition of Glycogen Synthase Kinase-31 Sherri L. Christian, Peter V. Sims, and Michael R. Gold2 ␤-Catenin is a transcriptional activator that is regulated by glycogen synthase kinase-3 (GSK-3). GSK-3 is constitutively active in unstimulated cells where it phosphorylates ␤-catenin, targeting ␤-catenin for rapid degradation. Receptor-induced inhibition of GSK-3 allows ␤-catenin to accumulate in the cytoplasm and then translocate to the nucleus where it promotes the transcription of genes such as c-myc and cyclin D1. Wnt hormones, the best known regulators of ␤-catenin, inhibit GSK-3 via the Disheveled protein. However, GSK-3 is also inhibited when it is phosphorylated by Akt, a downstream target of phosphatidylinositol 3-kinase (PI3K). We have previously shown that B cell Ag receptor (BCR) signaling leads to activation of PI3K and Akt as well as inhibition of GSK-3. Therefore, we hypothesized that BCR engagement would induce the accumulation of ␤-catenin via a PI3K/Akt/GSK-3 Downloaded from pathway. We now show that BCR ligation causes an increase in the level of ␤-catenin in the nuclear fraction of B cells as well as an increase in ␤-catenin-dependent transcription. Direct inhibition of GSK-3 by LiCl also increased ␤-catenin levels in B cells. This suggests that GSK-3 keeps ␤-catenin levels low in unstimulated B cells and that BCR-induced inhibition of GSK-3 allows the accumulation of ␤-catenin. Surprisingly, we found that the BCR-induced phosphorylation of GSK-3 on its negative regulatory sites, as well as the subsequent up-regulation of ␤-catenin, was not mediated by Akt but by the phospholipase C-dependent activation of protein kinase C. Thus, the BCR regulates ␤-catenin levels via a phospholipase C/protein kinase C/GSK-3 http://www.jimmunol.org/ pathway. The Journal of Immunology, 2002, 169: 758–769. ignaling by the B cell Ag receptor (BCR)3 can promote B phorylating the membrane phospholipid phosphatidylinositol 4,5- cell survival, proliferation, differentiation, apoptosis, or bisphosphate (1, 2). Subsequent dephosphorylation of PIP3 yields anergy depending on the maturation state of the B cell and phosphatidylinositol 3,4-bisphosphate (PI(3,4)P ). Both PIP and S 2 3 the context provided by signals from other receptors. Although the PI(3,4)P2 act as anchors that recruit pleckstrin homology (PH) do- BCR activates multiple signaling pathways, the role of individual main-containing proteins to the plasma membrane (7). BCR en- signaling pathways in mediating responses to BCR engagement is gagement has been shown to increase the levels of both PIP and 3 by guest on October 1, 2021 not completely understood. PI(3,4)P2 (8). This allows PH domain-containing signaling en- Activation of the phosphatidylinositol 3-kinase (PI3K) pathway zymes such as Btk, phospholipase C (PLC)-␥2, and Akt/protein is a key element in BCR signaling (1, 2). Upon BCR engagement, kinase B to be recruited to the plasma membrane where they are PI3K is recruited to the plasma membrane via the binding of its Src activated (1, 2). homology 2 domains to phosphotyrosine-containing sequences on We and others have shown that BCR engagement activates Akt membrane-associated scaffolding proteins such as CD19, Gab1, (9–14). Akt is the primary mediator of the anti-apoptotic signals BCAP, and Cbl (3–6). Once at the plasma membrane, PI3K gen- generated by PI3K (15), and recent work has shown that Akt ki- erates phosphatidylinositol 3,4,5-trisphosphate (PIP3) by phos- nase activity is essential for the survival of the DT40 chicken B cell line (16). Akt phosphorylates a number of proteins that regu- Department of Microbiology and Immunology, University of British Columbia, Van- late cell survival (17–21). In addition, Akt can also phosphorylate couver, British Columbia, Canada the serine/threonine kinases glycogen synthase kinase-3 (GSK-3)␣ Received for publication January 22, 2002. Accepted for publication May 9, 2002. and GSK-3␤ (22). The costs of publication of this article were defrayed in part by the payment of page GSK-3␣ and GSK-3␤ are constitutively active in resting cells, charges. This article must therefore be hereby marked advertisement in accordance but receptor-stimulated phosphorylation of GSK-3␣ at Ser21 or with 18 U.S.C. Section 1734 solely to indicate this fact. GSK-3␤ at Ser9 inhibits their enzymatic activity (23). These neg- 1 This work was supported by a grant from the Canadian Institutes for Health Re- ative regulatory sites on GSK-3␣ and GSK-3␤ can be phosphor- search (to M.R.G). S.L.C. was supported by graduate fellowships from the Canadian Institues for Health Research, the Michael Smith Foundation for Health Research, the ylated not only by Akt, but also by several other kinases including Natural Science and Engineering Research Council of Canada, and the University of the p90Rsk kinase, integrin-linked kinase, and several protein ki- British Columbia. nase C (PKC) isoforms (22, 24–26). In B cells, we have shown 2 Address correspondence and reprint requests to Dr. Michael R. Gold, Department of that BCR engagement induces the phosphorylation of GSK-3␣ and Microbiology and Immunology, University of British Columbia, 6174 University Boulevard, Vancouver, British Columbia, Canada V6T 1Z3. E-mail address: GSK-3␤ on these negative regulatory sites and inhibits the activity [email protected] of GSK-3␣ (9). 3 Abbreviations used in this paper: BCR, B cell Ag receptor; PI3K, phosphatidylino- An important target of GSK-3 is ␤-catenin (27), a transcriptional sitol 3-kinase; PIP3, phosphatidylinositol 3,4,5-trisphosphate; PI(3,4)P2, phosphati- coactivator that has important roles in early development (28, 29). dylinositol 3,4-bisphosphate; PH, pleckstrin homology; PLC, phospholipase C; GSK-3, glycogen synthase kinase-3; PKC, protein kinase C; LEF-1, lymphoid en- In unstimulated cells, GSK-3 constitutively phosphorylates ␤-cate- hancer factor-1; TCF, T cell factor; FKHR, Forkhead-related transcription factor; nin on N-terminal serine residues, targeting ␤-catenin for rapid PKD, protein kinase D; mER-Akt, myristoylated estrogen receptor-Akt fusion pro- tein; ALLN, acetyl-leucine-leucine-norleucinol; PdBu, phorbol dibutyrate; 4-HT, ubiquitination and proteasome-mediated degradation (30, 31). In 4-hydroxytamoxifen; BIM I, bisindolylmaleimide I; DAG, diacylglycerol. immature progenitor cells of various lineages, including pro-B Copyright © 2002 by The American Association of Immunologists, Inc. 0022-1767/02/$02.00 The Journal of Immunology 759 cells (32), Wnt hormones regulate developmental processes by in- B cell stimulation and preparation of cell lysates hibiting GSK-3 (33). This Wnt-induced inhibition of GSK-3 is To reduce basal signaling caused by serum components, WEHI-231 cells mediated by the Disheveled protein (29). Inhibition of GSK-3- were grown in complete medium with the FCS reduced to 1% for 12–18 h dependent phosphorylation of ␤-catenin allows ␤-catenin to accu- before stimulation while A20 cells were grown in complete medium with mulate in the cytoplasm and then translocate into the nucleus (34). 0.5 mg/ml BSA instead of FCS. The cells were washed once with modified ϫ 7 Once in the nucleus, ␤-catenin promotes transcription by binding HEPES-buffered saline (9), resuspended in this buffer at 1 10 and warmed to 37°C for 10–30 min. Where indicated, the cells were incubated to members of the lymphoid enhancer factor-1 (LEF-1)/T factor with wortmannin (Biomol, Plymouth Meeting, PA), Ly294002 (Biomol), (TCF) family of DNA-binding proteins (35, 36). ␤-Catenin dis- acetyl-leucine-leucine-norleucinol (ALLN; Sigma-Aldrich, St. Louis, places Groucho/transducin-like enhancer of split transcriptional re- MO), safingol (Calbiochem), U73122 (Biomol), or U73343 (Biomol) for pressors from LEF-1/TCF and provides a transactivation domain 20–30 min before stimulation. The cells were then stimulated with either anti-Ig Abs, phorbol dibutyrate (PdBu), 4-hydroxytamoxifen (4-HT) (Sig- that can recruit CBP/p300 and promote transcription (37–39). In ma-Aldrich), LiCl, or bisindolylmaleimide I (BIM I; Calbiochem) for the mammalian cells, ␤-catenin up-regulates the transcription of both indicated times. The reactions were terminated by adding ice-cold PBS cyclin D1 and c-myc, genes whose products promote cell growth containing 1 mM Na3VO4 and then centrifuging the cells for 1 min at and proliferation (40–42).
Load more

Recommended publications
  • Retinamide Increases Dihydroceramide and Synergizes with Dimethylsphingosine to Enhance Cancer Cell Killing
    2967 N-(4-Hydroxyphenyl)retinamide increases dihydroceramide and synergizes with dimethylsphingosine to enhance cancer cell killing Hongtao Wang,1 Barry J. Maurer,1 Yong-Yu Liu,2 elevations in dihydroceramides (N-acylsphinganines), Elaine Wang,3 Jeremy C. Allegood,3 Samuel Kelly,3 but not desaturated ceramides, and large increases in Holly Symolon,3 Ying Liu,3 Alfred H. Merrill, Jr.,3 complex dihydrosphingolipids (dihydrosphingomyelins, Vale´rie Gouaze´-Andersson,4 Jing Yuan Yu,4 monohexosyldihydroceramides), sphinganine, and sphin- Armando E. Giuliano,4 and Myles C. Cabot4 ganine 1-phosphate. To test the hypothesis that elevation of sphinganine participates in the cytotoxicity of 4-HPR, 1Childrens Hospital Los Angeles, Keck School of Medicine, cells were treated with the sphingosine kinase inhibitor University of Southern California, Los Angeles, California; D-erythro-N,N-dimethylsphingosine (DMS), with and 2 College of Pharmacy, University of Louisiana at Monroe, without 4-HPR. After 24 h, the 4-HPR/DMS combination Monroe, Louisiana; 3School of Biology and Petit Institute of Bioengineering and Bioscience, Georgia Institute of Technology, caused a 9-fold increase in sphinganine that was sustained Atlanta, Georgia; and 4Gonda (Goldschmied) Research through +48 hours, decreased sphinganine 1-phosphate, Laboratories at the John Wayne Cancer Institute, and increased cytotoxicity. Increased dihydrosphingolipids Saint John’s Health Center, Santa Monica, California and sphinganine were also found in HL-60 leukemia cells and HT-29 colon cancer cells treated with 4-HPR. The Abstract 4-HPR/DMS combination elicited increased apoptosis in all three cell lines. We propose that a mechanism of N Fenretinide [ -(4-hydroxyphenyl)retinamide (4-HPR)] is 4-HPR–induced cytotoxicity involves increases in dihy- cytotoxic in many cancer cell types.
    [Show full text]
  • AGC Kinases in Mtor Signaling, in Mike Hall and Fuyuhiko Tamanoi: the Enzymes, Vol
    Provided for non-commercial research and educational use only. Not for reproduction, distribution or commercial use. This chapter was originally published in the book, The Enzymes, Vol .27, published by Elsevier, and the attached copy is provided by Elsevier for the author's benefit and for the benefit of the author's institution, for non-commercial research and educational use including without limitation use in instruction at your institution, sending it to specific colleagues who know you, and providing a copy to your institution’s administrator. All other uses, reproduction and distribution, including without limitation commercial reprints, selling or licensing copies or access, or posting on open internet sites, your personal or institution’s website or repository, are prohibited. For exceptions, permission may be sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial From: ESTELA JACINTO, AGC Kinases in mTOR Signaling, In Mike Hall and Fuyuhiko Tamanoi: The Enzymes, Vol. 27, Burlington: Academic Press, 2010, pp.101-128. ISBN: 978-0-12-381539-2, © Copyright 2010 Elsevier Inc, Academic Press. Author's personal copy 7 AGC Kinases in mTOR Signaling ESTELA JACINTO Department of Physiology and Biophysics UMDNJ-Robert Wood Johnson Medical School, Piscataway New Jersey, USA I. Abstract The mammalian target of rapamycin (mTOR), a protein kinase with homology to lipid kinases, orchestrates cellular responses to growth and stress signals. Various extracellular and intracellular inputs to mTOR are known. mTOR processes these inputs as part of two mTOR protein com- plexes, mTORC1 or mTORC2. Surprisingly, despite the many cellular functions that are linked to mTOR, there are very few direct mTOR substrates identified to date.
    [Show full text]
  • Constitutive Activation of Akt/Protein Kinase B in Melanoma Leads to Up- Regulation of Nuclear Factor-␬B and Tumor Progression1
    [CANCER RESEARCH 62, 7335–7342, December 15, 2002] Constitutive Activation of Akt/Protein Kinase B in Melanoma Leads to Up- Regulation of Nuclear Factor-␬B and Tumor Progression1 Punita Dhawan, Amar B. Singh, Darrel L. Ellis, and Ann Richmond2 Departments of Veterans Affairs [A. R.], Cancer Biology [P. D., A. R.], Nephrology [A. B. S.], and Medicine, Division of Dermatology [D. L. E.], Vanderbilt University School of Medicine, Nashville, Tennessee 37232 ABSTRACT iting a cumulative melanoma risk of 1.9% compared with 0.04% of patients without dysplastic nevi (7). The current lifetime incidence The serine/threonine kinase Akt/protein kinase B and the pleiotropic of melanoma in the United States is estimated at 1:74 (8). The high transcription factor nuclear factor-␬B [NF-␬B (p50/p65)] play important incidence of dysplastic nevi and melanoma presents a large public roles in the control of cell proliferation, apoptosis, and oncogenesis. Pre- vious studies from our laboratory have shown the constitutive activation health problem. of NF-␬B in melanoma cells. However, the mechanism of this activation is Whereas histopathology is the current gold standard for the diag- not clearly understood. The purpose of this study was to explore the role nosis of atypical melanocytic lesions, interobserver correlation in the of Akt in the activation of NF-␬B during melanoma tumor progression. diagnosis of dysplastic nevi is variable (9, 10). The malignant poten- Based on our observation that two of the five melanoma cell lines exam- tial of dysplastic nevi and early melanomas is difficult to predict with ined exhibit constitutive Akt activation, we evaluated Akt activation by standard histological staining.
    [Show full text]
  • Anticancer Effects of Vitamin E Forms and Their Long-Chain Metabolites Via Modulation of Sphingolipid Metabolism Yumi Jang Purdue University
    Purdue University Purdue e-Pubs Open Access Dissertations Theses and Dissertations January 2015 Anticancer Effects of Vitamin E Forms and Their Long-chain Metabolites via Modulation of Sphingolipid Metabolism Yumi Jang Purdue University Follow this and additional works at: https://docs.lib.purdue.edu/open_access_dissertations Recommended Citation Jang, Yumi, "Anticancer Effects of Vitamin E Forms and Their Long-chain Metabolites via Modulation of Sphingolipid Metabolism" (2015). Open Access Dissertations. 1119. https://docs.lib.purdue.edu/open_access_dissertations/1119 This document has been made available through Purdue e-Pubs, a service of the Purdue University Libraries. Please contact [email protected] for additional information. Graduate School Form 30 Updated 1/15/2015 PURDUE UNIVERSITY GRADUATE SCHOOL Thesis/Dissertation Acceptance This is to certify that the thesis/dissertation prepared By Yumi Jang Entitled Anticancer Effects of Vitamin E Forms and Their Long-chain Metabolites via Modulation of Sphingolipid Metabolism For the degree of Doctor of Philosophy Is approved by the final examining committee: Qing Jiang Chair Dorothy Teegarden John R. Burgess Yava Jones-Hall To the best of my knowledge and as understood by the student in the Thesis/Dissertation Agreement, Publication Delay, and Certification Disclaimer (Graduate School Form 32), this thesis/dissertation adheres to the provisions of Purdue University’s “Policy of Integrity in Research” and the use of copyright material. Approved by Major Professor(s): Qing Jiang Approved by: Connie M. Weaver 9/2/2015 Head of the Departmental Graduate Program Date i ANTICANCER EFFECTS OF VITAMIN E FORMS AND THEIR LONG-CHAIN METABOLITES VIA MODULATION OF SPHINGOLIPID METABOLISM A Dissertation Submitted to the Faculty of Purdue University by Yumi Jang In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy December 2015 Purdue University West Lafayette, Indiana ii ACKNOWLEDGEMENTS I owe a debt of gratitude to many people who have made this dissertation possible.
    [Show full text]
  • Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G 12
    The Journal of Neuroscience, August 15, 2002, 22(16):6863–6875 Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G␣ ␣ 12 and G 13 by Rho-Independent and Rho-Dependent Mechanisms C. Laura Sayas, Jesu´ s Avila, and Francisco Wandosell Centro de Biologı´a Molecular “Severo Ochoa”, Consejo Superior de Investigaciones Cientı´ficas, Universidad Auto´ noma de Madrid, Cantoblanco, Madrid 28049, Spain ␣ ␣ ␣ ␣ Glycogen synthase kinase-3 (GSK-3) was generally considered tively active G 12 (G 12QL) and G 13 (G 13QL) in Neuro2a cells a constitutively active enzyme, only regulated by inhibition. induces upregulation of GSK-3 activity. Furthermore, overex- Here we describe that GSK-3 is activated by lysophosphatidic pression of constitutively active RhoA (RhoAV14) also activates ␣ acid (LPA) during neurite retraction in rat cerebellar granule GSK-3 However, the activation of GSK-3 by G 13 is blocked by neurons. GSK-3 activation correlates with an increase in GSK-3 coexpression with C3 transferase, whereas C3 does not block ␣ tyrosine phosphorylation. In addition, LPA induces a GSK-3- GSK-3 activation by G 12. Thus, we demonstrate that GSK-3 is ␣ ␣ mediated hyperphosphorylation of the microtubule-associated activated by both G 12 and G 13 in neuronal cells. However, ␣ protein tau. Inhibition of GSK-3 by lithium partially blocks neu- GSK-3 activation by G 13 is Rho-mediated, whereas GSK-3 ␣ rite retraction, indicating that GSK-3 activation is important but activation by G 12 is Rho-independent. The results presented not essential for the neurite retraction progress. GSK-3 activa- here imply the existence of a previously unknown mechanism of ␣ tion by LPA in cerebellar granule neurons is neither downstream GSK-3 activation by G 12/13 subunits.
    [Show full text]
  • PRKCQ Promotes Oncogenic Growth and Anoikis Resistance of a Subset
    Byerly et al. Breast Cancer Research (2016) 18:95 DOI 10.1186/s13058-016-0749-6 RESEARCH ARTICLE Open Access PRKCQ promotes oncogenic growth and anoikis resistance of a subset of triple- negative breast cancer cells Jessica Byerly1†, Gwyneth Halstead-Nussloch1†, Koichi Ito1, Igor Katsyv3 and Hanna Y. Irie1,2* Abstract Background: The protein kinase C (PKC) family comprises distinct classes of proteins, many of which are implicated in diverse cellular functions. Protein tyrosine kinase C theta isoform (PRKCQ)/PKCθ, a member of the novel PKC family, may have a distinct isoform-specific role in breast cancer. PKCθ is preferentially expressed in triple-negative breast cancer (TNBC) compared to other breast tumor subtypes. We hypothesized that PRKCQ/PKCθ critically regulates growth and survival of a subset of TNBC cells. Methods: To elucidate the role of PRKCQ/PKCθ in regulating growth and anoikis resistance, we used both gain and loss of function to modulate expression of PRKCQ. We enhanced expression of PKCθ (kinase-active or inactive) in non-transformed breast epithelial cells (MCF-10A) and assessed effects on epidermal growth factor (EGF)- independent growth, anoikis, and migration. We downregulated expression of PKCθ in TNBC cells, and determined effects on in vitro and in vivo growth and survival. TNBC cells were also treated with a small molecule inhibitor to assess requirement for PKCθ kinase activity in the growth of TNBC cells. Results: PRKCQ/PKCθ can promote oncogenic phenotypes when expressed in non-transformed MCF-10A mammary epithelial cells; PRKCQ/PKCθ enhances anchorage-independent survival, growth-factor-independent proliferation, and migration. PKCθ expression promotes retinoblastoma (Rb) phosphorylation and cell-cycle progression under growth factor-deprived conditions that typically induce cell-cycle arrest of MCF-10A breast epithelial cells.
    [Show full text]
  • A Phase I Clinical Trial of Safingol in Combination with Cisplatin in Advanced Solid Tumors
    Published OnlineFirst January 21, 2011; DOI: 10.1158/1078-0432.CCR-10-2323 Clinical Cancer Cancer Therapy: Clinical Research A Phase I Clinical Trial of Safingol in Combination with Cisplatin in Advanced Solid Tumors Mark A. Dickson1, Richard D. Carvajal1, Alfred H. Merrill, Jr.3, Mithat Gonen2, Lauren M. Cane1, and Gary K. Schwartz1 Abstract Purpose: Sphingosine 1-phosphate (S1P) is an important mediator of cancer cell growth and pro- liferation. Production of S1P is catalyzed by sphingosine kinase 1 (SphK). Safingol, (L-threo-dihydro- sphingosine) is a putative inhibitor of SphK. We conducted a phase I trial of safingol (S) alone and in combination with cisplatin (C). Experimental Design: A3þ 3 dose escalation was used. For safety, S was given alone 1 week before the combination. S þ C were then administered every 3 weeks. S was given over 60 to 120 minutes, depending on dose. Sixty minutes later, C was given over 60 minutes. The C dose of 75 mg/m2 was reduced in cohort 4 to 60 mg/m2 due to excessive fatigue. Results: Forty-three patients were treated, 41 were evaluable for toxicity, and 37 for response. The maximum tolerated dose (MTD) was S 840 mg/m2 over 120 minutes C 60 mg/m2, every 3 weeks. Dose- limiting toxicity (DLT) attributed to cisplatin included fatigue and hyponatremia. DLT from S was hepatic enzyme elevation. S pharmacokinetic parameters were linear throughout the dose range with no significant interaction with C. Patients treated at or near the MTD achieved S levels of more than 20 mmol/L and maintained levels greater than and equal to 5 mmol/L for 4 hours.
    [Show full text]
  • Protein Kinase C ␣/␤ Inhibitor Go6976 Promotes Formation of Cell Junctions and Inhibits Invasion of Urinary Bladder Carcinoma Cells
    [CANCER RESEARCH 64, 5693–5701, August 15, 2004] Protein Kinase C ␣/␤ Inhibitor Go6976 Promotes Formation of Cell Junctions and Inhibits Invasion of Urinary Bladder Carcinoma Cells Jussi Koivunen,1 Vesa Aaltonen,1 Sanna Koskela,1,3 Petri Lehenkari,1,3 Matti Laato,4,5 and Juha Peltonen1,2,5 Departments of 1Anatomy and Cell Biology and 2Dermatology, University of Oulu, Oulu, Finland; 3Department of Surgery, Clinical Research Center, University of Oulu, Oulu, Finland; 4Department of Surgery, Turku University Central Hospital, Turku, Finland; and 5Department of Medical Biochemistry, University of Turku, Turku, Finland ABSTRACT drugs in cell cultures and animal models (14–19). Furthermore, isoen- zyme-specific PKC inhibitors seem to be more effective anticancer Changes in activation balance of different protein kinase C (PKC) drugs than broad-spectrum inhibitors, suggesting the role of PKC isoenzymes have been linked to cancer development. The current study activation balance in cancer (20). investigated the effect of different PKC inhibitors on cellular contacts in cultured high-grade urinary bladder carcinoma cells (5637 and T24). Epithelial cells have abundant cell-cell junctions, which have a Exposure of the cells to isoenzyme-specific PKC inhibitors yielded vari- critical role in cell behavior and tissue morphogenesis. The most able results: Go6976, an inhibitor of PKC␣ and PKC␤ isoenzymes, in- important anchoring structures between epithelial cells are adherens duced rapid clustering of cultured carcinoma cells and formation of an junctions and desmosomes. Adherens junctions are composed of increased number of desmosomes and adherens junctions. Safingol, a transmembrane cadherin proteins; ␤-catenin, which attaches to cyto- PKC␣ inhibitor, had similar but less pronounced effects.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Protein Kinases Phosphorylation/Dephosphorylation Protein Phosphorylation Is One of the Most Important Mechanisms of Cellular Re
    Protein Kinases Phosphorylation/dephosphorylation Protein phosphorylation is one of the most important mechanisms of cellular responses to growth, stress metabolic and hormonal environmental changes. Most mammalian protein kinases have highly a homologous 30 to 32 kDa catalytic domain. • Most common method of reversible modification - activation and localization • Up to 1/3 of cellular proteins can be phosphorylated • Leads to a very fast response to cellular stress, hormonal changes, learning processes, transcription regulation .... • Different than allosteric or Michealis Menten regulation Protein Kinome To date – 518 human kinases known • 50 kinase families between yeast, invertebrate and mammaliane kinomes • 518 human PKs, most (478) belong to single super family whose catalytic domain are homologous. • Kinase dendrogram displays relative similarities based on catalytic domains. • AGC (PKA, PKG, PKC) • CAMK (Casein kinase 1) • CMGC (CDC, MAPK, GSK3, CLK) • STE (Sterile 7, 11 & 20 kinases) • TK (Tryosine kinases memb and cyto) • TKL (Tyrosine kinase-like) • Phosphorylation stabilized thermodynamically - only half available energy used in adding phosphoryl to protein - change in free energy forces phosphorylation reaction in one direction • Phosphatases reverse direction • The rate of reaction of most phosphatases are 1000 times faster • Phosphorylation occurs on Ser/The or Tyr • What differences occur due to the addition of a phosphoryl group? • Regulation of protein phosphorylation varies depending on protein - some turned on or off
    [Show full text]
  • Supplementary Table 1. in Vitro Side Effect Profiling Study for LDN/OSU-0212320. Neurotransmitter Related Steroids
    Supplementary Table 1. In vitro side effect profiling study for LDN/OSU-0212320. Percent Inhibition Receptor 10 µM Neurotransmitter Related Adenosine, Non-selective 7.29% Adrenergic, Alpha 1, Non-selective 24.98% Adrenergic, Alpha 2, Non-selective 27.18% Adrenergic, Beta, Non-selective -20.94% Dopamine Transporter 8.69% Dopamine, D1 (h) 8.48% Dopamine, D2s (h) 4.06% GABA A, Agonist Site -16.15% GABA A, BDZ, alpha 1 site 12.73% GABA-B 13.60% Glutamate, AMPA Site (Ionotropic) 12.06% Glutamate, Kainate Site (Ionotropic) -1.03% Glutamate, NMDA Agonist Site (Ionotropic) 0.12% Glutamate, NMDA, Glycine (Stry-insens Site) 9.84% (Ionotropic) Glycine, Strychnine-sensitive 0.99% Histamine, H1 -5.54% Histamine, H2 16.54% Histamine, H3 4.80% Melatonin, Non-selective -5.54% Muscarinic, M1 (hr) -1.88% Muscarinic, M2 (h) 0.82% Muscarinic, Non-selective, Central 29.04% Muscarinic, Non-selective, Peripheral 0.29% Nicotinic, Neuronal (-BnTx insensitive) 7.85% Norepinephrine Transporter 2.87% Opioid, Non-selective -0.09% Opioid, Orphanin, ORL1 (h) 11.55% Serotonin Transporter -3.02% Serotonin, Non-selective 26.33% Sigma, Non-Selective 10.19% Steroids Estrogen 11.16% 1 Percent Inhibition Receptor 10 µM Testosterone (cytosolic) (h) 12.50% Ion Channels Calcium Channel, Type L (Dihydropyridine Site) 43.18% Calcium Channel, Type N 4.15% Potassium Channel, ATP-Sensitive -4.05% Potassium Channel, Ca2+ Act., VI 17.80% Potassium Channel, I(Kr) (hERG) (h) -6.44% Sodium, Site 2 -0.39% Second Messengers Nitric Oxide, NOS (Neuronal-Binding) -17.09% Prostaglandins Leukotriene,
    [Show full text]
  • Distinct Regulation of Cardiac Fibroblast Proliferation and Transdifferentiation by Classical and Novel Protein Kinase C Isoform
    Molecular Pharmacology Fast Forward. Published on November 25, 2020 as DOI: 10.1124/molpharm.120.000094 This article has not been copyedited and formatted. The final version may differ from this version. Distinct regulation of cardiac fibroblast proliferation and transdifferentiation by classical and novel protein kinase C isoforms: possible implications for new antifibrotic therapies S. Tuuli Karhu, Heikki Ruskoaho, Virpi Talman* Affiliations Downloaded from STK, HR, and VT: Drug Research Program and Division of Pharmacology and Pharmacotherapy, Faculty of Pharmacy, University of Helsinki, Finland molpharm.aspetjournals.org *Corresponding author at ASPET Journals on September 30, 2021 1 Molecular Pharmacology Fast Forward. Published on November 25, 2020 as DOI: 10.1124/molpharm.120.000094 This article has not been copyedited and formatted. The final version may differ from this version. Running title: PKC agonists inhibit cardiac fibroblast activation Corresponding author: Virpi Talman Division of Pharmacology and Pharmacotherapy Faculty of Pharmacy University of Helsinki P.O. Box 56 (Viikinkaari 5E) FI-00014 Helsinki, FINLAND Downloaded from Tel: +358504480768 Email: [email protected] molpharm.aspetjournals.org Number of text pages: 35 Number of tables: 0 Number of figures: 4 at ASPET Journals on September 30, 2021 Number of references: 55 Number of words in the Abstract: 249 Number of words in the Introduction: 728 Number of words in the Discussion: 1459 Abbreviations: α-SMA, α-smooth muscle actin; aPKC, atypical protein kinase C isoform; BrdU, 5-bromo-2’-deoxyuridine; CF, cardiac fibroblast; cPKC, classical protein kinase C isoform; DDR2, discoidin domain receptor 2; ECM, extracellular matrix; ERK, extracellular signal-regulated kinase; HCA, high-content analysis; LDH, lactate dehydrogenase; MTT, 3- (4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; nPKC, novel protein kinase C isoform; PKC, protein kinase C 2 Molecular Pharmacology Fast Forward.
    [Show full text]